framycetin profile

Framycetin is an aminoglycoside antibiotic derived from the bacterium *Streptomyces fradiae*. It is effective against a wide range of gram-negative bacteria, including *Pseudomonas aeruginosa*, *Escherichia coli*, and *Klebsiella pneumoniae*. It works by binding to the 30S ribosomal subunit of bacteria, inhibiting protein synthesis and ultimately leading to bacterial cell death. Framycetin is commonly used topically for the treatment of skin and eye infections, but is also available in oral and injectable forms for systemic infections. However, its use is limited by its potential for nephrotoxicity and ototoxicity, especially when used intravenously. Framycetin is studied extensively for its potential as an antibacterial agent, particularly against multidrug-resistant bacteria. Research is also ongoing to explore its potential in treating cancer and other diseases.'

Framycetin: A component of NEOMYCIN that is produced by Streptomyces fradiae. On hydrolysis it yields neamine and neobiosamine B. (From Merck Index, 11th ed) [Medical Subject Headings (MeSH), National Library of Medicine, extracted Dec-2023]

framycetin : A tetracyclic antibacterial agent derived from neomycin, being a glycoside ester of neamine and neobiosamine B. [Chemical Entities of Biological Interest (ChEBI), Hastings J, Owen G, Dekker A, Ennis M, Kale N, Muthukrishnan V, Turner S, Swainston N, Mendes P, Steinbeck C. (2016). ChEBI in 2016: Improved services and an expanding collection of metabolites. Nucleic Acids Res]

ID Source	ID
PubMed CID	8378
CHEMBL ID	184618
CHEBI ID	7508
SCHEMBL ID	3279
MeSH ID	M0008812

Synonym
AB00443887-03
gtpl709
(1r,2r,3s,4r,6s)-4,6-diamino-2-{[3-o-(2,6-diamino-2,6-dideoxy-beta-l-idopyranosyl)-beta-d-ribofuranosyl]oxy}-3-hydroxycyclohexyl 2,6-diamino-2,6-dideoxy-alpha-d-glucopyranoside
D05140
framycetin (inn)
d-streptamine, o-2,6-diamino-2,6-dideoxy-alpha-d-glucopyranosyl-(1-4)-o-(o-2,6-diamino-2,6-dideoxy-beta-l-idopyranosyl-(1-3)-beta-d-ribofuranosyl-(1-5))-2-deoxy-
mycerin
brn 0101621
soframycine
neolate
neomcin
antibiotic 10676
actiline
vonamycin powder v
antibiotique
framycetine [inn-french]
antibiotic 956
framygen
neomycine [inn-french]
myacyne
actilin
neomin
framicetina [inn-spanish]
antibiotic produced by streptomyces decaris. neomycin b
einecs 215-766-3
neomycinum [inn-latin]
einecs 204-292-2
epa pesticide chemical code 006303
enterfram
framycetin [inn:ban:dcf]
framycetinum [inn-latin]
neomicina [dcit]
BSPBIO_000296
NCGC00179612-01
usaf cb-19
d-streptamine, o-2,6-diamino-2,6-dideoxy-.beta.-l-idopyranosyl-(1.->3)-o-.beta.-d-ribofuranosyl-(1->5)]-o-[2,6-diamino-2,6-dideoxy-.alpha.-d-glucopyranosyl-(1->4)]-2-deoxy
hsdb 3242
mycifradin
fradiomycinum
neomas
caswell no. 595
soframycin
(2r,3s,4r,5r,6r)-5-amino-2-(aminomethyl)-6-[(1r,2r,3s,4r,6s)-4,6-diamino-2-[(2s,3r,4s,5r)-4-[(2r,3r,4r,5s,6s)-3-amino-6-(aminomethyl)-4,5-dihydroxy-tetrahydropyran-2-yl]oxy-3-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]oxy-3-hydroxy-cyclohexoxy]tetrahyd
ccris 5462
fradiomycin
PRESTWICK3_000158
AB00443887
fradiomycin b
C01737
neomycin b
framycetin
119-04-0
neomycin ,
pimavecort
nmy ,
DB00452
BPBIO1_000326
HMS2089P15
(2r,3s,4r,5r,6r)-5-amino-2-(aminomethyl)-6-[(1r,2r,3s,4r,6s)-4,6-diamino-2-[(2s,3r,4s,5r)-4-[(2r,3r,4r,5s,6s)-3-amino-6-(aminomethyl)-4,5-dihydroxyoxan-2-yl]oxy-3-hydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-3-hydroxycyclohexyl]oxyoxane-3,4-diol
framicetina
CHEBI:7508 ,
framycetinum
framycetine
unii-4boc774388
4-18-00-07476 (beilstein handbook reference)
4boc774388 ,
i16qd7x297 ,
neomicina
unii-i16qd7x297
neomycin [inn:ban]
neomycinum
bycomycin
jernadex
antibiotique ef 185
framycin
francetin
framidal
dekamycin iii
CHEMBL184618
neomycine
11004-65-2
BRD-K71013094-065-01-2
SCHEMBL3279
framycetin [inn]
antibiotic produced by streptomyces decaris
neomycin b [usp-rs]
neomycin b [mi]
d-streptamine, o-2,6-diamino-2,6-dideoxy-.beta.-l-idopyranosyl-(1->3)-o-.beta.-d-ribofuranosyl-(1->5)-o-(2,6-diamino-2,6-dideoxy-.alpha.-d-glucopyranosyl-(1->4))-2-deoxy-
framycetin [who-dd]
d-streptamine, o-2,6-diamino-2,6-dideoxy-.alpha.-d-glucopyranosyl-(1->4)-o-(o-2,6-diamino-2,6-dideoxy-.beta.-l-idopyranosyl-(1->3)-.beta.-d-ribofuranosyl-(1->5))-2-deoxy-
AKOS024284361
DTXSID2023359
(2r,3s,4r,5r,6r)-5-amino-2-(aminomethyl)-6-{[(1r,2r,3s,4r,6s)-4,6-diamino-2-{[(2s,3r,4s,5r)-4-{[(2r,3r,4r,5s,6s)-3-amino-6-(aminomethyl)-4,5-dihydroxyoxan-2-yl]oxy}-3-hydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy}-3-hydroxycyclohexyl]oxy}oxane-3,4-diol
J-004060
6-(2-{(4s,2r,3r,5r)-4-[(5s,6s,2r,3r,4r)-3-amino-6-(aminomethyl)-4,5-dihydroxy( 2h-3,4,5,6-tetrahydropyran-2-yloxy)]-3-hydroxy-5-(hydroxymethyl)oxolan-2-yloxy }(3s,6s,1r,2r,4r)-4,6-diamino-3-hydroxycyclohexyloxy)(3s,2r,4r,5r,6r)-5-amino- 2-(aminomethyl)-2h
HY-17624
CS-6390
mycifradin; neomas; pimavecort; vonamycin
Q4492348
neomycinb
neomycin b; fradiomycin b
EN300-7480789

Excerpt	Reference	Relevance
" Severe pathologic conditions, over-dosage, or concomitant exposure to other potent drugs may predispose a patient to these acute adverse effects."	( Acute adverse effects of antibiotics. Adams, HR, 1975)	0.25
" The authors suggest that irrigation of large open wounds with neomycin is dangerous since toxic blood concentrations may ensue."	( Nephrotoxicity and ototoxicity following irrigation of wounds with neomycin. Kurtz, I; Manuel, MA; Nedzelski, JM; Saiphoo, CS, 1979)	0.26
" As a result there was no significant difference in hearing loss between the controls and the animals treated with 75 and 150 mg V; toxic doses of 300 mg V led to a certain threshold elevation after click stimuli, but not after trapezoid stimuli of 1, 4 and 8 kHz."	( Ototoxicity of vancomycin: an experimental study in guinea pigs. Federspil, P; Hoth, S; Lenarz, T; Lutz, H; Weidauer, H, 1991)	0.28
" The adverse effects of many of the principal drugs in this category are discussed."	( A comparative review of the adverse effects of treatments for hyperlipidaemia. Steiner, A; Vetter, W; Weisser, B, )	0.13
" Adverse side effects ranging from mere annoyances to uncommon serious consequences may be associated with dietary modification, recreational physical exercise, and drug intervention."	( Adverse effects of the treatment for hyperlipidemia. Malinow, MR, 1986)	0.27
"Prevention of cephalosporin nephrotoxicity in animal models by probenecid or p-aminohippurate requires treatment regimen that produce sustained inhibition of cortical accumulation of the toxic antibiotic."	( Prevention of cephalosporin nephrotoxicity by other cephalosporins and by penicillins without significant inhibition of renal cortical uptake. Browning, MC; Fravert, D; Hsu, CY; Tune, BM, 1982)	0.26
" The present report describes the effects of transient ureteral obstruction, which increases intracellular concentrations of secreted organic anions, on the cortical uptake and the proximal tubular toxicity of several cephalosporins given in mildly toxic doses."	( Effects of ureteral obstruction on the toxicity of cephalosporins in the rabbit kidney. Hsu, CY; Prime, DJ; Tune, BM; Wang, PL, 1982)	0.26
" The well known ototoxicity of neomycin was observed and RU 25434 appeared to be relatively less toxic than amikacin."	( Comparative ototoxic effects of RU 25434, amikacin and neomycin in guinea-pigs. Boissier, JR; Dumont, C; N'guyen, P, 1980)	0.26
"Our experience leads us to believe that topical ear drops containing ototoxic antibiotics are clinically safe to use for a short period of time."	( Safety of topical ear drops containing ototoxic antibiotics. Keywan, K; Rakover, Y; Rosen, G, 1997)	0.3
"Determination of potential drug toxicity and side effect in early stages of drug development is important in reducing the cost and time of drug discovery."	( Prediction of potential toxicity and side effect protein targets of a small molecule by a ligand-protein inverse docking approach. Chen, YZ; Ung, CY, 2001)	0.31
"As measured by time to cell death and change in morphology of OHCs, acetic acid with or without hydrocortisone was most toxic to OHCs."	( Determination of ototoxicity of common otic drops using isolated cochlear outer hair cells. Church, CA; Jinn, TH; John, EO; Jung, TT; Kim, PD; Russell, PT, 2001)	0.31
" Seven toxic or allergic reactions were reported."	( The efficacy and safety of topical polymyxin B, neomycin and gramicidin for treatment of presumed bacterial corneal ulceration. Bosscha, MI; Jager, MJ; Kuijper, EJ; Swart, W; van Dissel, JT, 2004)	0.32
"This study shows that the combination of polymyxin B, neomycin, and gramicidin is an effective and safe treatment of suspected corneal ulceration."	( The efficacy and safety of topical polymyxin B, neomycin and gramicidin for treatment of presumed bacterial corneal ulceration. Bosscha, MI; Jager, MJ; Kuijper, EJ; Swart, W; van Dissel, JT, 2004)	0.32
"Signs and symptoms of AOE, including ear inflammation, tenderness, edema and discharge (assessed on Days 3, 8 [End-of-Therapy] and 18 [Test-of-Cure]); microbiologic eradication (presumed or documented); and frequency of adverse events."	( Efficacy and safety of topical ciprofloxacin/dexamethasone versus neomycin/polymyxin B/hydrocortisone for otitis externa. Conroy, PJ; Dupre, SJ; Garadi, R; Henry, DC; Hogg, LG; Pien, FD; Potts, SL; Roland, PS; Schultz, CC; Stroman, DW; Wall, GM, 2004)	0.32
"In the treatment of OE in children, once-daily ofloxacin otic solution was as effective and safe as neomycin sulfate/polymyxin B sulfate/hydrocortisone otic suspension given four times daily."	( Once-daily ofloxacin otic solution versus neomycin sulfate/polymyxin B sulfate/hydrocortisone otic suspension four times a day: a multicenter, randomized, evaluator-blinded trial to compare the efficacy, safety, and pain relief in pediatric patients with Schwartz, RH, 2006)	0.33
"The aim of this study was to examine in vitro the interaction between aminoglycoside antibiotics displaying adverse ototoxic effects and melanin which is a constituent of the inner ear."	( Interaction of neomycin, tobramycin and amikacin with melanin in vitro in relation to aminoglycosides-induced ototoxicity. Buszman, E; Trzcionka, J; Wrześniok, D, 2007)	0.34
" Most adverse events were mild and unrelated to study medication in both treatment groups."	( Comparison of efficacy and safety of ciprofloxacin otic solution 0.2% versus polymyxin B-neomycin-hydrocortisone in the treatment of acute diffuse otitis externa*. Drehobl, M; Goldstein, G; Guerrero, JL; Lacarte, PR; Luber, S; Mata, FS, 2008)	0.35
" The mechanisms by which aminoglycosides cause auditory dysfunction are still being unraveled, but likely include the following: 1) penetration into the endolymphatic fluid of the scala media, 2) permeation of nonselective cation channels on the apical surface of hair cells, and 3) generation of toxic reactive oxygen species and interference with other cellular pathways."	( Synergistic ototoxicity due to noise exposure and aminoglycoside antibiotics. Li, H; Steyger, PS, )	0.13
"Hearing and balance receptors in the inner ear are highly susceptible to damage caused by a wide variety of toxic substances, including aminoglycosides."	( Comparison of different aminoglycoside antibiotic treatments to refine ototoxicity studies in adult mice. Cediel, R; Contreras, J; Murillo-Cuesta, S; Varela-Nieto, I, 2010)	0.36
" These findings are consistent with decades of clinical experience indicating that neomycin/polymyxin B/hydrocortisone otic suspension is safe when used responsibly."	( Is there an ototoxicity risk from Cortisporin and comparable otic suspensions? Distortion-product otoacoustic emission findings. Berenholz, LP; Burkey, JM; Lippy, WH; Rossi, DL, 2012)	0.38
"The commonly used otic solution containing polymyxin B, neomycin, and hydrocortisone demonstrates no ototoxicity in tympanoplasty surgery and is safe to use in this setting."	( Ototoxicity of polymyxin B, neomycin, and hydrocortisone suspension in tympanoplasty surgery. House, JR; House, LK, 2014)	0.4
"To compare interventions in terms of patients' adverse events and major clinical outcomes."	( Systematic review with network meta-analysis: the comparative effectiveness and safety of interventions in patients with overt hepatic encephalopathy. Braddock, M; Chen, YP; Huang, GQ; Huang, S; Lin, YQ; Shi, KQ; Wang, LR; Zheng, MH; Zhu, GQ, 2015)	0.42
" Neomycin appeared to be associated with more adverse events in comparison with non-absorbable disaccharides (OR 10."	( Systematic review with network meta-analysis: the comparative effectiveness and safety of interventions in patients with overt hepatic encephalopathy. Braddock, M; Chen, YP; Huang, GQ; Huang, S; Lin, YQ; Shi, KQ; Wang, LR; Zheng, MH; Zhu, GQ, 2015)	0.42
" Rifaximin shows the greatest reduction in blood ammonia concentration, and treatment with neomycin demonstrates a higher probability in causing adverse effects among the five compared interventions."	( Systematic review with network meta-analysis: the comparative effectiveness and safety of interventions in patients with overt hepatic encephalopathy. Braddock, M; Chen, YP; Huang, GQ; Huang, S; Lin, YQ; Shi, KQ; Wang, LR; Zheng, MH; Zhu, GQ, 2015)	0.42
" The full repertoire of cellular targets and processes leading to the toxicity of aminoglycosides is not fully resolved, making it challenging to devise rational directions to circumvent their adverse effects."	( The relationship between the structure and toxicity of aminoglycoside antibiotics. Fridman, M; Jospe-Kaufman, M; Siomin, L, 2020)	0.56

Excerpt	Reference	Relevance
" Various pharmacokinetic parameters of neomycin were also determined from its profile of plasma concentration versus time."	( Determination of neomycin in plasma and urine by high-performance liquid chromatography. Application to a preliminary pharmacokinetic study. Guyer, G; Jackson, J; Ravis, WR; Shaikh, B, 1991)	0.28
" The pharmacokinetic parameters show an enhanced plasma elimination of both drugs at interrupted enterohepatic circulation compared to the control group."	( The pharmacokinetics of exaprolol and propranolol in rats with interrupted enterohepatic circulation. Bezek, S; Durisová, M; Faberová, V; Misánikova, K; Motheová, O; Trnovec, T; Zemánek, M, )	0.13
" Although the elimination half-life of gentamicin appeared to decrease with age, the changes were not significant and were due to an increased elimination rate in only one calf."	( Comparative pharmacokinetics of gentamicin, neomycin and oxytetracycline in newborn calves. Barto, PB; Burrows, GE; Martin, B, 1987)	0.27
" Chloramphenicol is mainly excreted after biotransformation and large differences in pharmacokinetic parameters are to be found, not only between birds and mammals, but also between avian species."	( Pharmacokinetic aspects of penicillins, aminoglycosides and chloramphenicol in birds compared to mammals. A review. Dorrestein, GM; Rinzema, JD; van Gogh, H, 1984)	0.27
" Serum drug levels were determined and the intravenous pharmacokinetic parameters derived using the Gauss-Newton nonlinear fitting algorithm and the two compartment open model."	( Pharmacokinetic study of neomycin in calves following intravenous and intramuscular administration. Black, WD; Gentry, RD; Holt, JD, 1983)	0.27
" The pharmacokinetic behaviour of the three aminoglycosides was similar, in that a rapid distribution phase was followed by a relatively short half-life."	( The pharmacokinetics of some aminoglycoside antibiotics in the horse. Baggot, JD; Love, DN; Raus, J; Rose, RJ, 1981)	0.26
" A non-compartment model estimated the pharmacokinetic parameters of APAP and its metabolites, and the ratios of the area under curve (AUC; AUC(metabolite) /AUC(APAP) ) were also observed to evaluate the change of APAP metabolism."	( Evaluation of pharmacokinetic differences of acetaminophen in pseudo germ-free rats. An, JH; Jung, BH; Lee, HJ; Lee, SH, 2012)	0.38
") administration of 15, 30, and 60 mg kg(-1) neamine, the pharmacokinetic parameters were as follows: AUC(0-t), 9,398."	( Pharmacokinetics of neamine in rats and anti-cervical cancer activity in vitro and in vivo. An, S; Hu, G; Liu, Y; Wu, Y; Zhang, X, 2015)	0.42
" However, no information is available on the pharmacokinetic characteristics and absolute availability of neomycin sulfate after intravenous (i."	( Pharmacokinetics of neomycin sulfate after intravenous and oral administrations in swine. Cao, X; Cao, Y; Guo, Y; Kong, J; Liu, Y; Qiu, J; Yang, Y; Zhang, L; Zhang, M; Zhang, S, 2021)	0.62

Excerpt	Reference	Relevance
"5 g/d) and large (up to 6 g/d) doses alone and in combination with cholestyramine."	( Effects of neomycin alone and in combination with cholestyramine on serum cholesterol and fecal steroids in hypercholesterolemic subjects. Miettinen, TA, 1979)	0.26
" One was mainly Chinese traditional dialectic therapy combined with western medicine."	( [Comparison of Chinese traditional therapy combined with Western medicine and Western medicine alone in the treatment of uveitis]. Gao, R; Hu, Z; Wen, S, 1991)	0.28
"The effect of 1-day mechanical bowel preparation with 10% mannitol combined with oral neomycin and short-term perioperative intravenous Flagyl (group I) was studied in a prospective, randomized, double-blind study and was compared with oral neomycin and an intravenous placebo (Group II)."	( A prospective, randomized, double-blind study of 10% mannitol mechanical bowel preparation combined with oral neomycin and short-term, perioperative, intravenous Flagyl as prophylaxis in elective colorectal resections. Fazio, VW; Jagelman, DG; Lavery, IC; Weakley, FL, 1985)	0.27
"The in vitro activity of mastoparan-AF, an amphipathic antimicrobial peptide isolated from the hornet venom of Vespa affinis, alone and in combination with various clinically used antibiotics, was investigated against 21 Escherichia coli isolates/strains."	( In vitro activity of mastoparan-AF alone and in combination with clinically used antibiotics against multiple-antibiotic-resistant Escherichia coli isolates from animals. Hou, RF; Lin, CF; Lin, CH; Shia, WY; Shyu, CL; Tu, WC, 2012)	0.38
" Checkerboard test was used to evaluate the interaction of EOs in combination with amoxicillin and neomycin."	( Antibacterial activity of Cladanthus arabicus and Bubonium imbricatum essential oils alone and in combination with conventional antibiotics against Enterobacteriaceae isolates. Aghraz, A; Ait Dra, L; Ben-Mahdi, MH; Benameur, Q; Cicero, N; Gervasi, T; Larhsini, M; Markouk, M, 2018)	0.48

Excerpt	Reference	Relevance
" The decrease in ocular steroid bioavailability could not be directly equated with differences in antinflammatory effectiveness, so that the therapeutic relevance of the demonstrated drug interaction is not known."	( Drug interaction in the eye. Concurrent corticosteroid-antibiotic therapy for inflammatory keratitis. Kupferman, A; Leibowitz, HM, 1977)	0.26
"The effect of oral neomycin sulfate on the bioavailability of oral spironolactone in humans was studied."	( Effect of neomycin on the bioavailability of spironolactone: a single-dose study. Bartle, WR; Coates, PE; Fisher, MM; Louman, FJ, 1979)	0.26
" Ions present in the GI fluid might increase the bioavailability of neomycin from such neomycin-clay adsorbates."	( Influence of monovalent and divalent electrolytes on sorption of neomycin sulfate to attapulgite and montmorillonite clays. Hill, JA; McGinity, JW, 1975)	0.25
"The pharmacokinetics and bioavailability of neomycin in sheep were investigated following intravenous, intramuscular, subcutaneous and intratracheal administration of 10 mg/kg."	( Pharmacokinetics of neomycin in sheep after intravenous, intramuscular, subcutaneous and intratracheal administration. Errecalde, JO; Landoni, MF; Lanusse, CE, 1990)	0.28
" Oral administration of poorly absorbed antibiotics was for a long time a common practice in preparing patients for elective clo-rectal operations."	( [Preoperative topical antibiotics in patients subjected to short term prophylaxis for colorectal surgery]. Castoldi, R; Di Carlo, V; Di Palo, S; Ferrari, G, 1989)	0.28
" In order to determine whether this abnormal metabolism also involved other sterols, a patient with sitosterolemia was fed a diet high in shellfish that contain significant quantities of noncholesterol sterols, some of which are less well absorbed than cholesterol in humans."	( Abnormal metabolism of shellfish sterols in a patient with sitosterolemia and xanthomatosis. Brewer, HB; Connor, WE; Gregg, RE; Lin, DS, 1986)	0.27
"The disposition kinetics and bioavailability of streptomycin, kanamycin and neomycin were determined following their administration as parenteral preparations to horses."	( The pharmacokinetics of some aminoglycoside antibiotics in the horse. Baggot, JD; Love, DN; Raus, J; Rose, RJ, 1981)	0.26
"The objective of the present paper was to study the interaction of Neomycin and aluminium hydroxide with vitamin A in terms of the effect of these drugs on the bioavailability of vitamin A in the rat."	( Bioavailability of vitamin A in the rat following ingestion of neomycin sulfate or aluminium hydroxide. Favaro, RM; Silva, HC; Vannucchi, H, 1994)	0.29
"This study in the rat established the effects that a broad-spectrum and poorly absorbed antibiotic, neomycin sulfate, had on the in vitro and in vivo hydrolysis of vicine and convicine by the intestinal microflora, and on vicine- and convicine-induced depletion of blood glutathione and the resulting toxicity."	( Effect of neomycin on the hydrolysis and toxicity of vicine and convicine in rats. Arbid, MS; Frohlich, AA; Madhyastha, MS; Marquardt, RR, 1993)	0.29
" Increases of diltiazem bioavailability (in the range of 5-29%) promoted by additions of the surfactants were observed."	( Enhancement of diltiazem bioavailability by traces of surfactants in rats after neomycin-induced malabsorption syndrome. Wojdak, H, 1998)	0.3
"The bioavailability of cellobiose (CEB) was investigated with respect to small intestinal digestibility and cecal fermentation in rats."	( Cellobiose is extensively digested in the small intestine by beta-galactosidase in rats. Ito, H; Kimio, S; Kiriyama, S; Morita, T; Ozawa, M, )	0.13
" The bioavailability of neamine administered through intramuscular, subcutaneous, intraperitoneal and intragastric route was 14."	( Pharmacokinetics of neamine in rats and anti-cervical cancer activity in vitro and in vivo. An, S; Hu, G; Liu, Y; Wu, Y; Zhang, X, 2015)	0.42
"The bioavailability of neamine administered through extravascular routes was low."	( Pharmacokinetics of neamine in rats and anti-cervical cancer activity in vitro and in vivo. An, S; Hu, G; Liu, Y; Wu, Y; Zhang, X, 2015)	0.42
"The main aim of the present work was to formulate and evaluate hydrogel-based drug delivery containing combination of neomycin sulphate and betamethasone sodium phosphate in order to provide prolonged release and also better bioavailability of drugs for the treatment of eye infections."	( Novel hydrogel-based ocular drug delivery system for the treatment of conjunctivitis. Deepthi, S; Jose, J, 2019)	0.51

Excerpt	Relevance	Reference
" But this effect is small and does not justify a change in the usual dosage of rifampicin."	( [The use of mycobacteria in the estimation of the concentration of antibiotics, antimycotics and antituberculotics (author's transl)]. Iwainsky, H; Reutgen, H; Sesser, I, 1978)	0.26
" In the case of neomycin, it was shown that the effect worsens as the duration of the dosage administration is extended."	( Detection of ototoxicity from drugs applied topically to the middle ear space. Brummett, RE; Harris, RF; Lindgren, JA, 1976)	0.26
" Values of onset, potency, dose-response relations, duration and reversibility of block, the train-of-four and tetanic responses during block, the frequency-block relationships, and the posttetanic twitch behavior were well approximated by averaging the corresponding values previously reported for each antibiotic."	( Interaction of neuromuscular blocking effects of neomycin and polymyxin B. de Silva, AJ; Lee, C, 1979)	0.26
" The influence of dosage and renal function on serum levels and their relevance to ototoxicity are discussed."	( Suggestions for monitoring patients during treatment with aminoglycoside antibiotics. Lerner, SA; Matz, GJ, )	0.13
"To better define a minimal but optimal dose of oral neomycin to suppress ammonia production by bowel flora, several dosage regimens were examined in normal healthy volunteers."	( Oral neomycin dosage schedules for suppression of ammonia production by bowel flora. Kunin, CM; Stephens, JL; Suh, B, 1979)	0.26
" Animals receiving labeled steroids or labeled bile intraductally also had the duodenum fitted with a cannula connected with a dosing syringe."	( Effects of neomycin on the biliary excretion and enterohepatic circulation of mestranol and 17beta-oestradiol. Brewster, D; Jones, RS; Symons, AM, 1977)	0.26
" Topical application in high dosage can cause ototoxicity as proved by one patient from this clinic."	( [Deafness due to topical neomycin (author's transl)]. Quante, M, 1976)	0.26
"Prophylactic (preventive) antibiotic therapy initiated preoperatively, with antibiotics administered in moderately high dosage for short periods, is recommended on the basis of experimental and prospective, randomized clinical trials for patients who require surgery that is likely to expose tissue planes to contamination."	( Prophylactic antibiotic therapy in surgery. MacLean, LD, 1975)	0.25
" In a second series of 27 orthotopic liver transplantations in tissue-typed littermate dogs and littermate pigs the standard surgical technique and aftercare were changed with regard to four factors: an end-to-end common bile duct anastomosis was made instead of a gallbladder to duodenum anastomosis; the continuous postoperative bacteriostatic antibiotic therapy was changed to a single 2-day course of bactericidal antibiotics; preoperative selective bowel decontamination combined with postoperative protective isolation was introduced; the dosage of azathioprine used for immunosuppression was reduced."	( Orthotopic liver transplantation: an experimental study on the prevention of infections with Gram-negative organisms. Hendriks, WD; Jerusalem, C; Krom, RA; Popescu, DT; Schalm, SW; Terpstra, JL; Van Der Waay, D, 1975)	0.25
" Oral dosage (100 mg/kg) of the aldehyde resulted in urinary excretion of most metabolites within 24 h, mainly as glucuronide and/or sulphate conjugates although the acids formed were also excreted free and as their glycine conjugates."	( The metabolism of vanillin and isovanillin in the rat. Scheline, RR; Strand, LP, 1975)	0.25
" Based on the bioavailability and disposition kinetics of neomycin, a twice daily IM dosage regimen should both be practical and adequate to maintain plasma neomycin concentrations within the pharmacologically active but nontoxic range."	( Pharmacokinetics of neomycin in sheep after intravenous, intramuscular, subcutaneous and intratracheal administration. Errecalde, JO; Landoni, MF; Lanusse, CE, 1990)	0.28
" Close analysis of the dose-response curves revealed a biphasic pattern, indicative of the presence of two substrates of the Ca-release channel, displaying high- and low-affinity binding sites for the inhibitors."	( Rapid kinetic analysis of the calcium-release channels of skeletal muscle sarcoplasmic reticulum: the effect of inhibitors. Calviello, G; Chiesi, M, 1989)	0.28
" The pharmacokinetic behaviour of neomycin with multiple dosing was characterised and a range of blood chemical and urinary parameters examined for evidence of nephrotoxicity."	( The nephrotoxic potential of neomycin in the horse. Baggott, JD; Edwards, DJ; Love, DN; Raus, J, 1989)	0.28
" These include mistakes in DNA synthesis by an error-prone DNA polymerase, the nucleotide pool distartion and the overreplication of replication origins, abnormal DNA repair, high rate recombination, by expression of fragile sites and possibly by expression of retrotransposons, frequent nondisjunction of chromosomes as a consequence of gene dosage inbalance, and abnormal DNA methylation."	( [Clonal evolution in tumor cell population]. Enoki, Y; Niwa, O; Yokoro, K, 1989)	0.28
" Most of these drugs have side effects which, in the elderly, may necessitate lower dosing than usual."	( Treating hyperlipidemia, Part III: Drug therapy. Brown, WV; Karmally, W; Smith, DA, 1987)	0.27
" A comparison of the Ca2+ dose-response curves for release of the various granule constituents indicated that elastase was being secreted along with other contents of the azurophil granules."	( The kinetics of secretion from permeabilized human neutrophils: release of elastase and correlations with other granule constituents and right angle light scatter. Sklar, LA; Smolen, JE; Stoehr, SJ; Traynor, AE, 1987)	0.27
" It is concluded that the intravenous chemoprophylaxis should be preferred because of the lowest dosage and therefore the fewest side-effects."	( [Antimicrobial chemoprevention in colorectal interventions: a single parenteral dose at the start of surgery is adequate]. Berker-von-Schlichting, C; Hancke, E; Jensen, JC; Marklein, G; Stute, H; Voigt, U, 1986)	0.27
" Based on pharmacokinetic changes, an adjustment of dosage is indicated for oxytetracycline in the newborn calf as compared to the older calf or adult."	( Comparative pharmacokinetics of gentamicin, neomycin and oxytetracycline in newborn calves. Barto, PB; Burrows, GE; Martin, B, 1987)	0.27
" This work holds considerable promise for the study of dosage adjustments in patients with renal disease."	( Quantitative investigation of renal handling of drugs in dogs with renal insufficiency. Hori, R; Kamiya, A; Okumura, K, 1984)	0.27
" Even minute admixtures of neomycin A in the preparations of neomycin significantly changes the dose-response curves and affected the results of the biological activity determination."	( [Standardization of the index of biological activity of the multi-component antibiotic neomycin]. Ermolova, OB; Grigor'eva, VM; Klimova, NE; Snezhnova, LP, 1983)	0.27
"A spectrophotometric assay method for the quantitative determination of amikacin, kanamycin, neomycin, and tobramycin in pharmaceutical dosage forms has been developed."	( Quantitation of amikacin, kanamycin, neomycin, and tobramycin in pharmaceutical dosage forms using the Hantzsch reaction. Gunter, JM; Gupta, VD; Stewart, KR, 1983)	0.27
" Therefore in various degrees of renal function impairment, systemic drug accumulation with dose-related toxicity may take place unless a readjustment is made in standard drug dosing principles."	( Therapeutic considerations in the use of antibiotics in renal insufficiency. Whelton, A, 1980)	0.26
" In order to appropriately administer prophylactic antibiotics in the various clinical settings on the surgical service, in which this practice has been of proved value, one must be aware of the following nuances including (1) choice of the antibiotic agent based on the type of organisms usually causing infection, (2) route of its administration, (3) the dosage necessary to attain efficacious tissue or serum levels, and (4) the timing of administration which offers the maximum benefits without risking the adverse effects."	( Use of prophylactic antibiotics in surgical practice. Nichols, RL, 1981)	0.26
" Neuromuscular block produced by neomycin was cumulative despite rapid and apparent full recovery of twitch tension and an interval of 3 h between dose-response studies."	( Cumulation of neomycin and its residual potentiation of tubocurarine in the cat. Durant, NN; Katz, RL; Lee, C, 1981)	0.26
" A dosage interval of 8 h would be appropriate for kanamycin compared with a 12-h interval for streptomycin."	( The pharmacokinetics of some aminoglycoside antibiotics in the horse. Baggot, JD; Love, DN; Raus, J; Rose, RJ, 1981)	0.26
"Neomycin sulfate was administered intravenously to eight mixed-breed dogs at a dosage of 30 mg/kg/day for as long as 50 days."	( Effects of neomycin on the waveform of auditory-evoked brain stem potentials in dogs. Coulter, DB; Goetsch, DD; Marshall, AE; Morgan, JL, 1980)	0.26
" A simultaneous intravenous/oral dosing regimen was used, with half of each group receiving treatment with neomycin and cholestyramine (neo/chol) to block the EHC of the drug."	( Disposition of lorazepam in Gilbert's syndrome: effects of fasting, feeding, and enterohepatic circulation. Chaudhary, A; Herman, RJ; Szakacs, CB, 1994)	0.29
"58% of the dose) dosed similarly."	( Neomycin metabolism in calves. Aschbacher, PW; Feil, VJ, 1994)	0.29
" The method was used to determine neomycin B in kidney tissue obtained from a calf killed 14 days after intramuscular dosing with neomycin (5 mg/lb)."	( Improved liquid chromatographic determination of neomycin B in bovine kidney. Jackson, J; Shaikh, B, )	0.13
" Dose-response curves to the hormone were determined in the absence and in the presence of several drugs that affect sequential steps of the Ca(2+)-dependent signalling pathway."	( Cellular signalling of PCH-induced pigment aggregation in the crustacean Macrobrachium potiuna erythrophores. Castrucci, AM; da Silva, MA; Josefsson, L; Nery, LE, 1997)	0.3
" Parallel GPMT and Buehler tests were conducted according to OECD guideline #406 using a multiple-dose design and test results were analysed using a standard logistic dose-response model."	( Comparison of the sensitivities of the Buehler test and the guinea pig maximization test for predictive testing of contact allergy. Andersen, KE; Frankild, S; Vølund, A; Wahlberg, JE, )	0.13
" FMRFamide and FLRFamide had similar dose-response curve patterns with thresholds at 10(-9) mol l(-1) but FLRFamide was more potent than FMRFamide."	( Excitation evoked by FMRFamide and FLRFamide in the heart of Buccinum undatum and evidence for inositol 1,4,5-trisphosphate as an RF-tetrapeptide second messenger. Ellis, AM; Huddart, H, 2000)	0.31
" The validated procedure was used to determine gentamicin concentrations in porcine tissue after dosing with gentamicin at a level of 5 mg/kg body mass."	( Sample preparation for residue determination of gentamicin and neomycin by liquid chromatography. Niedzielska, J; Posyniak, A; Zmudzki, J, 2001)	0.31
" The dose-response curves for each test did not deviate significantly from parallelism."	( Antinociceptive potency of aminoglycoside antibiotics and magnesium chloride: a comparative study on models of phasic and incisional pain in rats. Machado Filho, EB; Prado, WA, 2002)	0.31
"1 mM neomycin neither shifted the dose-response curve of the peak I(ACh) to the right (dissociation constant (K(d)) = 16."	( Decrease in acetylcholine-induced current by neomycin in PC12 cells. Cheng, XH; Liu, LA; Shi, LJ; Wang, CA, 2002)	0.31
" The proposed method was applied successfully to the determination of NMS in pure and dosage forms, with a good precision and accuracy compared to the official one."	( Ion-association method for the colorimetric determination of neomycin sulphate in pure and dosage forms. Amin, AS; Issa, YM, 2003)	0.32
" However, the results were not uniform across the dose-response function; CEP-11004 did not inhibit hair cell death in utricles exposed to high-dose neomycin."	( JNK signaling in neomycin-induced vestibular hair cell death. Cunningham, LL; Rubel, EW; Sugahara, K, 2006)	0.33
" The dose-response curves could be modeled by a competition model that reduces the pool of free PIP(2)."	( Electrostatic interaction of internal Mg2+ with membrane PIP2 Seen with KCNQ K+ channels. Hille, B; Suh, BC, 2007)	0.34
" Due to the different dosing regimens, patients were not blinded, but they also were not directly informed of their treatment assignments."	( Pooled analysis of two clinical trials comparing the clinical outcomes of topical ciprofloxacin/dexamethasone otic suspension and polymyxin B/neomycin/hydrocortisone otic suspension for the treatment of acute otitis externa in adults and children. Rahman, A; Rizwan, S; Wall, GM; Waycaster, C, 2007)	0.34
" The requested frequency and dosage of meperidine, the first spontaneous voiding time, the frequency of single urinary catheterization, and a patient satisfaction score were also obtained."	( Use of a topical anesthetic cream (EMLA) to reduce pain after hemorrhoidectomy. Chen, HS; Hung, KC; Lin, SE; Shiau, JM; Su, HP; Tseng, CC, )	0.13
"The VAS score and frequency and dosage of meperidine injections were significantly lower in the EMLA group than in the control group (P < ."	( Use of a topical anesthetic cream (EMLA) to reduce pain after hemorrhoidectomy. Chen, HS; Hung, KC; Lin, SE; Shiau, JM; Su, HP; Tseng, CC, )	0.13
" However, low systemic exposure, absence of ototoxicity, and less frequent dosing clearly favor Cipro HC."	( A single topical agent is clinically equivalent to the combination of topical and oral antibiotic treatment for otitis externa. Belcher, BP; Bettis, R; Conroy, PJ; Dupre, S; Hogg, G; Makabale, RL; Potts, S; Roland, PS; Wall, GM; Weber, K, )	0.13
" Animals received methylcellulose, neomycin (179 mg/kg/d) or variably dosed rifaximin (150-2000 mg/kg/d) one hour after irradiation and daily throughout the study period."	( Rifaximin diminishes neutropenia following potentially lethal whole-body radiation. Brawner, WR; Faircloth, J; Jahraus, CD; Powell, C; Ramos, M; Rynders, P; Schemera, B, 2010)	0.36
" We proposed a systematic classification scheme using FDA-approved drug labeling to assess the DILI potential of drugs, which yielded a benchmark dataset with 287 drugs representing a wide range of therapeutic categories and daily dosage amounts."	( FDA-approved drug labeling for the study of drug-induced liver injury. Chen, M; Fang, H; Liu, Z; Shi, Q; Tong, W; Vijay, V, 2011)	0.37
" The methods were tested for QC of veterinary dosage forms (commercial powders and injections containing these antibiotics)."	( Determination of neomycin and oxytetracycline in the presence of their impurities in veterinary dosage forms by high-performance liquid chromatography/tandem mass spectrometry. Cservenák, R; Radulović, N; Vucićević-Prcetić, K, )	0.13
" Limitations of evidence for probiotics include small populations analyzed and lack of clarity in optimal dosing regimen; antimicrobial evidence would benefit from better understanding of the effects of repeated treatment in patients with IBS."	( Emerging role of probiotics and antimicrobials in the management of irritable bowel syndrome. Cash, BD, 2014)	0.4
" Despite their limitations, microbiological assays are widely employed to determine antibiotic potency of pharmaceutical dosage forms, since they provide a measure of biological activity."	( Development, optimization and validation of a rapid colorimetric microplate bioassay for neomycin sulfate in pharmaceutical drug products. Francisco, FL; Lourenço, FR; Pinto, Tde J; Saviano, AM, 2014)	0.4
"New, sensitive, and selective spectrofluorimetric method was developed for determination of three aminoglycoside drugs in different dosage forms, namely; neomycin sulfate (NEO), tobramycin (TOB) and kanamycin sulfate (KAN)."	( Validated spectrofluorimetric method for determination of selected aminoglycosides. Ahmed, HM; Derayea, SM; Hammad, MA; Omar, MA, 2015)	0.42
" The proposed method was successfully applied for the analysis of cited drugs in dosage forms with high accuracy (98."	( Development of spectrofluorimetric method for determination of certain aminoglycoside drugs in dosage forms and human plasma through condensation with ninhydrin and phenyl acetaldehyde. Aly, AA; Hammad, MA; Nagy, DM; Omar, MA, 2015)	0.42
" This suggests that a higher dosing frequency in order to maintain a therapeutic effect."	( Pharmacokinetics of neamine in rats and anti-cervical cancer activity in vitro and in vivo. An, S; Hu, G; Liu, Y; Wu, Y; Zhang, X, 2015)	0.42
" Dose-response curves were generated to evaluate the protective effect on hair cells."	( Quercetin protects against hair cell loss in the zebrafish lateral line and guinea pig cochlea. Hashimoto, M; Hirose, Y; Kanagawa, E; Sugahara, K; Takemoto, Y; Yamashita, H, 2016)	0.43
" aeruginosa can survive in the presence of neomycin with a concentration typically used in topical dosage forms, and that the acquired adaptive resistance is persistent and is accompanied by cross-resistance to other aminoglycosides."	( Adaptive Cross-Resistance to Aminoglycoside Antibiotics in Pseudomonas aeruginosa Induced by Topical Dosage of Neomycin. Hirayama, S; Inoue, H; Kitagawa, M; Kyan, R; Miyamoto, A; Mizuno, H; Narimatsu, E; Sawamoto, K; Shiraishi, T; Uemura, S; Yokota, SI, 2017)	0.46
" Various antioxidant is marketed, and different dosage form is developed with the same drug."	( Protective effect of an astaxanthin nanoemulsion against neomycin-induced hair-cell damage in zebrafish. Hara, H; Hashimoto, M; Hirose, Y; Sugahara, K; Takemoto, Y; Yamashita, H, 2018)	0.48
"Conventional dosage form like eye drops showed poor therapeutic response and also require frequent dosing."	( Novel hydrogel-based ocular drug delivery system for the treatment of conjunctivitis. Deepthi, S; Jose, J, 2019)	0.51
" Neomycin in ST and LT was dosed in MR at a rate of 20 mg/kg of BW and was adjusted weekly according to BW."	( The effect of neomycin inclusion in milk replacer on the health, growth, and performance of male Holstein calves during preweaning. Buss, LN; Cangiano, LR; Guan, LL; Keunen, AJ; Renaud, DL; Steele, MA; Yohe, TT, 2021)	0.62

Role	Description
antibacterial drug	A drug used to treat or prevent bacterial infections.
allergen	A chemical compound, or part thereof, which causes the onset of an allergic reaction by interacting with any of the molecular pathways involved in an allergy.
Escherichia coli metabolite	Any bacterial metabolite produced during a metabolic reaction in Escherichia coli.
[role information is derived from Chemical Entities of Biological Interest (ChEBI), Hastings J, Owen G, Dekker A, Ennis M, Kale N, Muthukrishnan V, Turner S, Swainston N, Mendes P, Steinbeck C. (2016). ChEBI in 2016: Improved services and an expanding collection of metabolites. Nucleic Acids Res]

Class	Description
aminoglycoside
[compound class information is derived from Chemical Entities of Biological Interest (ChEBI), Hastings J, Owen G, Dekker A, Ennis M, Kale N, Muthukrishnan V, Turner S, Swainston N, Mendes P, Steinbeck C. (2016). ChEBI in 2016: Improved services and an expanding collection of metabolites. Nucleic Acids Res]

Pathway	Proteins	Compounds
Neomycin Action Pathway	1	4

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Bile salt export pump	Homo sapiens (human)	IC50 (µMol)	135.0000	0.1100	7.1903	10.0000	AID1443980
30S ribosomal protein S6	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S7	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L15	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L10	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L11	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L7/L12	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L19	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L1	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L20	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L27	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L28	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L29	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L31	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L31 type B	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L32	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L33	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L34	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L35	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L36	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S10	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S11	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S12	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S13	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S16	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S18	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S19	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S20	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S2	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S3	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S4	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S5	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S8	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S9	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L13	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L14	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L16	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L23	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S15	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L17	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L21	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L30	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L6	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S14	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S17	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S1	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L18	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
Lethal factor	Bacillus anthracis	Ki	0.2535	0.0070	1.9581	4.9000	AID1895854; AID270308
50S ribosomal protein L2	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L3	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L24	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L4	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L22	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L5	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
30S ribosomal protein S21	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L25	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
50S ribosomal protein L36 2	Escherichia coli K-12	IC50 (µMol)	0.0320	0.0089	1.2035	5.0000	AID548954
Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)	IC50 (µMol)	8,000.0000	0.0120	3.3213	8.4300	AID673458
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Menin	Homo sapiens (human)	Kd	15.6000	0.1580	0.1580	0.1580	AID1139968
Protein Rev	HIV-1 M:B_HXB2R	Kd	0.1800	0.1800	2.1450	4.1100	AID82302
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Aminoglycoside 3'-phosphotransferase	Pseudomonas aeruginosa PAO1	Km	17.5000	10.0000	10.0000	10.0000	AID278807
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Process	via Protein(s)	Taxonomy
osteoblast development	Menin	Homo sapiens (human)
negative regulation of osteoblast differentiation	Menin	Homo sapiens (human)
negative regulation of transcription by RNA polymerase II	Menin	Homo sapiens (human)
MAPK cascade	Menin	Homo sapiens (human)
negative regulation of protein phosphorylation	Menin	Homo sapiens (human)
DNA repair	Menin	Homo sapiens (human)
DNA damage response	Menin	Homo sapiens (human)
negative regulation of cell population proliferation	Menin	Homo sapiens (human)
response to UV	Menin	Homo sapiens (human)
response to gamma radiation	Menin	Homo sapiens (human)
positive regulation of transforming growth factor beta receptor signaling pathway	Menin	Homo sapiens (human)
negative regulation of DNA-binding transcription factor activity	Menin	Homo sapiens (human)
T-helper 2 cell differentiation	Menin	Homo sapiens (human)
negative regulation of cyclin-dependent protein serine/threonine kinase activity	Menin	Homo sapiens (human)
negative regulation of cell cycle	Menin	Homo sapiens (human)
transcription initiation-coupled chromatin remodeling	Menin	Homo sapiens (human)
negative regulation of DNA-templated transcription	Menin	Homo sapiens (human)
positive regulation of transcription by RNA polymerase II	Menin	Homo sapiens (human)
negative regulation of JNK cascade	Menin	Homo sapiens (human)
negative regulation of telomerase activity	Menin	Homo sapiens (human)
regulation of transcription by RNA polymerase II	Menin	Homo sapiens (human)
retinoid metabolic process	Lecithin retinol acyltransferase	Homo sapiens (human)
vitamin A metabolic process	Lecithin retinol acyltransferase	Homo sapiens (human)
visual perception	Lecithin retinol acyltransferase	Homo sapiens (human)
response to bacterium	Lecithin retinol acyltransferase	Homo sapiens (human)
positive regulation of lipid transport	Lecithin retinol acyltransferase	Homo sapiens (human)
response to retinoic acid	Lecithin retinol acyltransferase	Homo sapiens (human)
response to vitamin A	Lecithin retinol acyltransferase	Homo sapiens (human)
retinol metabolic process	Lecithin retinol acyltransferase	Homo sapiens (human)
cellular response to leukemia inhibitory factor	Lecithin retinol acyltransferase	Homo sapiens (human)
fatty acid metabolic process	Bile salt export pump	Homo sapiens (human)
bile acid biosynthetic process	Bile salt export pump	Homo sapiens (human)
xenobiotic metabolic process	Bile salt export pump	Homo sapiens (human)
xenobiotic transmembrane transport	Bile salt export pump	Homo sapiens (human)
response to oxidative stress	Bile salt export pump	Homo sapiens (human)
bile acid metabolic process	Bile salt export pump	Homo sapiens (human)
response to organic cyclic compound	Bile salt export pump	Homo sapiens (human)
bile acid and bile salt transport	Bile salt export pump	Homo sapiens (human)
canalicular bile acid transport	Bile salt export pump	Homo sapiens (human)
protein ubiquitination	Bile salt export pump	Homo sapiens (human)
regulation of fatty acid beta-oxidation	Bile salt export pump	Homo sapiens (human)
carbohydrate transmembrane transport	Bile salt export pump	Homo sapiens (human)
bile acid signaling pathway	Bile salt export pump	Homo sapiens (human)
cholesterol homeostasis	Bile salt export pump	Homo sapiens (human)
response to estrogen	Bile salt export pump	Homo sapiens (human)
response to ethanol	Bile salt export pump	Homo sapiens (human)
xenobiotic export from cell	Bile salt export pump	Homo sapiens (human)
lipid homeostasis	Bile salt export pump	Homo sapiens (human)
phospholipid homeostasis	Bile salt export pump	Homo sapiens (human)
positive regulation of bile acid secretion	Bile salt export pump	Homo sapiens (human)
regulation of bile acid metabolic process	Bile salt export pump	Homo sapiens (human)
transmembrane transport	Bile salt export pump	Homo sapiens (human)
cytoplasmic translation	30S ribosomal protein S6	Escherichia coli K-12
translation	30S ribosomal protein S6	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S7	Escherichia coli K-12
negative regulation of translation	30S ribosomal protein S7	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S7	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S7	Escherichia coli K-12
translation	30S ribosomal protein S7	Escherichia coli K-12
negative regulation of translation	30S ribosomal protein S7	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L15	Escherichia coli K-12
translation	50S ribosomal protein L15	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L10	Escherichia coli K-12
translation	50S ribosomal protein L10	Escherichia coli K-12
regulation of translation	50S ribosomal protein L10	Escherichia coli K-12
negative regulation of translation	50S ribosomal protein L10	Escherichia coli K-12
translation	50S ribosomal protein L11	Escherichia coli K-12
translational termination	50S ribosomal protein L11	Escherichia coli K-12
stringent response	50S ribosomal protein L11	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L11	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L11	Escherichia coli K-12
translation	50S ribosomal protein L11	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L7/L12	Escherichia coli K-12
translation	50S ribosomal protein L7/L12	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L19	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L19	Escherichia coli K-12
translation	50S ribosomal protein L19	Escherichia coli K-12
negative regulation of translational initiation	50S ribosomal protein L1	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L1	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L1	Escherichia coli K-12
translation	50S ribosomal protein L1	Escherichia coli K-12
regulation of translation	50S ribosomal protein L1	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L20	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L20	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L20	Escherichia coli K-12
translation	50S ribosomal protein L20	Escherichia coli K-12
negative regulation of translation	50S ribosomal protein L20	Escherichia coli K-12
cytosolic ribosome assembly	50S ribosomal protein L27	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L27	Escherichia coli K-12
regulation of cell growth	50S ribosomal protein L27	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L27	Escherichia coli K-12
translation	50S ribosomal protein L27	Escherichia coli K-12
positive regulation of ribosome biogenesis	50S ribosomal protein L27	Escherichia coli K-12
assembly of large subunit precursor of preribosome	50S ribosomal protein L27	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L28	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L28	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L28	Escherichia coli K-12
translation	50S ribosomal protein L28	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L29	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L29	Escherichia coli K-12
translation	50S ribosomal protein L29	Escherichia coli K-12
translation	50S ribosomal protein L31	Escherichia coli K-12
translational initiation	50S ribosomal protein L31	Escherichia coli K-12
negative regulation of cytoplasmic translational initiation	50S ribosomal protein L31	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L31	Escherichia coli K-12
translation	50S ribosomal protein L31	Escherichia coli K-12
cellular response to zinc ion starvation	50S ribosomal protein L31 type B	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L31 type B	Escherichia coli K-12
translation	50S ribosomal protein L31 type B	Escherichia coli K-12
response to reactive oxygen species	50S ribosomal protein L32	Escherichia coli K-12
response to radiation	50S ribosomal protein L32	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L32	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L32	Escherichia coli K-12
translation	50S ribosomal protein L32	Escherichia coli K-12
response to antibiotic	50S ribosomal protein L33	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L33	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L33	Escherichia coli K-12
translation	50S ribosomal protein L33	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L34	Escherichia coli K-12
translation	50S ribosomal protein L34	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L35	Escherichia coli K-12
translation	50S ribosomal protein L35	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L36	Escherichia coli K-12
translation	50S ribosomal protein L36	Escherichia coli K-12
transcription antitermination	30S ribosomal protein S10	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S10	Escherichia coli K-12
translation	30S ribosomal protein S10	Escherichia coli K-12
transcription antitermination	30S ribosomal protein S10	Escherichia coli K-12
regulation of DNA-templated transcription elongation	30S ribosomal protein S10	Escherichia coli K-12
ribosome biogenesis	30S ribosomal protein S10	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S11	Escherichia coli K-12
translation	30S ribosomal protein S11	Escherichia coli K-12
Group I intron splicing	30S ribosomal protein S12	Escherichia coli K-12
positive regulation of RNA splicing	30S ribosomal protein S12	Escherichia coli K-12
RNA folding	30S ribosomal protein S12	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S12	Escherichia coli K-12
translation	30S ribosomal protein S12	Escherichia coli K-12
response to antibiotic	30S ribosomal protein S12	Escherichia coli K-12
maintenance of translational fidelity	30S ribosomal protein S12	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S13	Escherichia coli K-12
translation	30S ribosomal protein S13	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S16	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S16	Escherichia coli K-12
DNA metabolic process	30S ribosomal protein S16	Escherichia coli K-12
translation	30S ribosomal protein S16	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S18	Escherichia coli K-12
translation	30S ribosomal protein S18	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S19	Escherichia coli K-12
translation	30S ribosomal protein S19	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S19	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S20	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S20	Escherichia coli K-12
translation	30S ribosomal protein S20	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S2	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S2	Escherichia coli K-12
translation	30S ribosomal protein S2	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S3	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S3	Escherichia coli K-12
translation	30S ribosomal protein S3	Escherichia coli K-12
transcription antitermination	30S ribosomal protein S4	Escherichia coli K-12
negative regulation of translational initiation	30S ribosomal protein S4	Escherichia coli K-12
maintenance of translational fidelity	30S ribosomal protein S4	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S4	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S4	Escherichia coli K-12
DNA-templated transcription termination	30S ribosomal protein S4	Escherichia coli K-12
translation	30S ribosomal protein S4	Escherichia coli K-12
regulation of translation	30S ribosomal protein S4	Escherichia coli K-12
transcription antitermination	30S ribosomal protein S4	Escherichia coli K-12
ribosome biogenesis	30S ribosomal protein S4	Escherichia coli K-12
response to antibiotic	30S ribosomal protein S4	Escherichia coli K-12
ribosomal small subunit biogenesis	30S ribosomal protein S4	Escherichia coli K-12
maintenance of translational fidelity	30S ribosomal protein S5	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S5	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S5	Escherichia coli K-12
translation	30S ribosomal protein S5	Escherichia coli K-12
response to antibiotic	30S ribosomal protein S5	Escherichia coli K-12
regulation of mRNA stability	30S ribosomal protein S8	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S8	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S8	Escherichia coli K-12
translation	30S ribosomal protein S8	Escherichia coli K-12
regulation of translation	30S ribosomal protein S8	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S9	Escherichia coli K-12
translation	30S ribosomal protein S9	Escherichia coli K-12
negative regulation of translation	50S ribosomal protein L13	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L13	Escherichia coli K-12
translation	50S ribosomal protein L13	Escherichia coli K-12
negative regulation of translation	50S ribosomal protein L13	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L14	Escherichia coli K-12
translation	50S ribosomal protein L14	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L16	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L16	Escherichia coli K-12
translation	50S ribosomal protein L16	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L23	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L23	Escherichia coli K-12
translation	50S ribosomal protein L23	Escherichia coli K-12
translation	30S ribosomal protein S15	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S15	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S15	Escherichia coli K-12
translation	30S ribosomal protein S15	Escherichia coli K-12
regulation of translation	30S ribosomal protein S15	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L17	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L17	Escherichia coli K-12
translation	50S ribosomal protein L17	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L21	Escherichia coli K-12
translation	50S ribosomal protein L21	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L30	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L30	Escherichia coli K-12
translation	50S ribosomal protein L30	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L6	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L6	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L6	Escherichia coli K-12
translation	50S ribosomal protein L6	Escherichia coli K-12
response to antibiotic	50S ribosomal protein L6	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S14	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S14	Escherichia coli K-12
translation	30S ribosomal protein S14	Escherichia coli K-12
response to antibiotic	30S ribosomal protein S17	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S17	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S17	Escherichia coli K-12
translation	30S ribosomal protein S17	Escherichia coli K-12
response to antibiotic	30S ribosomal protein S17	Escherichia coli K-12
translation	30S ribosomal protein S1	Escherichia coli K-12
RNA secondary structure unwinding	30S ribosomal protein S1	Escherichia coli K-12
negative regulation of cytoplasmic translation	30S ribosomal protein S1	Escherichia coli K-12
positive regulation of cytoplasmic translation	30S ribosomal protein S1	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S1	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S1	Escherichia coli K-12
translation	30S ribosomal protein S1	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L18	Escherichia coli K-12
translation	50S ribosomal protein L18	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L2	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L2	Escherichia coli K-12
translation	50S ribosomal protein L2	Escherichia coli K-12
negative regulation of DNA-templated DNA replication initiation	50S ribosomal protein L2	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L3	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L3	Escherichia coli K-12
translation	50S ribosomal protein L3	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L24	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L24	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L24	Escherichia coli K-12
translation	50S ribosomal protein L24	Escherichia coli K-12
transcriptional attenuation	50S ribosomal protein L4	Escherichia coli K-12
negative regulation of cytoplasmic translation	50S ribosomal protein L4	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L4	Escherichia coli K-12
DNA-templated transcription termination	50S ribosomal protein L4	Escherichia coli K-12
translation	50S ribosomal protein L4	Escherichia coli K-12
regulation of translation	50S ribosomal protein L4	Escherichia coli K-12
negative regulation of translation	50S ribosomal protein L4	Escherichia coli K-12
ribosome assembly	50S ribosomal protein L4	Escherichia coli K-12
negative regulation of DNA-templated transcription	50S ribosomal protein L4	Escherichia coli K-12
response to antibiotic	50S ribosomal protein L4	Escherichia coli K-12
translation	50S ribosomal protein L22	Escherichia coli K-12
cytosolic ribosome assembly	50S ribosomal protein L22	Escherichia coli K-12
assembly of large subunit precursor of preribosome	50S ribosomal protein L22	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L22	Escherichia coli K-12
translation	50S ribosomal protein L22	Escherichia coli K-12
ribosome assembly	50S ribosomal protein L22	Escherichia coli K-12
response to antibiotic	50S ribosomal protein L22	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L5	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L5	Escherichia coli K-12
translation	50S ribosomal protein L5	Escherichia coli K-12
ribosomal small subunit assembly	30S ribosomal protein S21	Escherichia coli K-12
cytoplasmic translation	30S ribosomal protein S21	Escherichia coli K-12
translation	30S ribosomal protein S21	Escherichia coli K-12
translation	50S ribosomal protein L25	Escherichia coli K-12
response to radiation	50S ribosomal protein L25	Escherichia coli K-12
negative regulation of translation	50S ribosomal protein L25	Escherichia coli K-12
ribosomal large subunit assembly	50S ribosomal protein L25	Escherichia coli K-12
cytoplasmic translation	50S ribosomal protein L25	Escherichia coli K-12
translation	50S ribosomal protein L25	Escherichia coli K-12
translation	50S ribosomal protein L36 2	Escherichia coli K-12
single strand break repair	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
DNA repair	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
double-strand break repair	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Process	via Protein(s)	Taxonomy
four-way junction DNA binding	Menin	Homo sapiens (human)
Y-form DNA binding	Menin	Homo sapiens (human)
transcription cis-regulatory region binding	Menin	Homo sapiens (human)
double-stranded DNA binding	Menin	Homo sapiens (human)
protein binding	Menin	Homo sapiens (human)
protein-macromolecule adaptor activity	Menin	Homo sapiens (human)
phosphoprotein binding	Menin	Homo sapiens (human)
R-SMAD binding	Menin	Homo sapiens (human)
chromatin binding	Menin	Homo sapiens (human)
retinoic acid binding	Lecithin retinol acyltransferase	Homo sapiens (human)
protein binding	Lecithin retinol acyltransferase	Homo sapiens (human)
O-palmitoyltransferase activity	Lecithin retinol acyltransferase	Homo sapiens (human)
acyltransferase activity	Lecithin retinol acyltransferase	Homo sapiens (human)
retinol binding	Lecithin retinol acyltransferase	Homo sapiens (human)
phosphatidylcholine-retinol O-acyltransferase activity	Lecithin retinol acyltransferase	Homo sapiens (human)
lecithin:11-cis retinol acyltransferase activity	Lecithin retinol acyltransferase	Homo sapiens (human)
protein binding	Bile salt export pump	Homo sapiens (human)
ATP binding	Bile salt export pump	Homo sapiens (human)
ABC-type xenobiotic transporter activity	Bile salt export pump	Homo sapiens (human)
bile acid transmembrane transporter activity	Bile salt export pump	Homo sapiens (human)
canalicular bile acid transmembrane transporter activity	Bile salt export pump	Homo sapiens (human)
carbohydrate transmembrane transporter activity	Bile salt export pump	Homo sapiens (human)
ABC-type bile acid transporter activity	Bile salt export pump	Homo sapiens (human)
ATP hydrolysis activity	Bile salt export pump	Homo sapiens (human)
structural constituent of ribosome	30S ribosomal protein S6	Escherichia coli K-12
protein binding	30S ribosomal protein S6	Escherichia coli K-12
rRNA binding	30S ribosomal protein S6	Escherichia coli K-12
mRNA 5'-UTR binding	30S ribosomal protein S6	Escherichia coli K-12
small ribosomal subunit rRNA binding	30S ribosomal protein S6	Escherichia coli K-12
tRNA binding	30S ribosomal protein S7	Escherichia coli K-12
RNA binding	30S ribosomal protein S7	Escherichia coli K-12
mRNA binding	30S ribosomal protein S7	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S7	Escherichia coli K-12
protein binding	30S ribosomal protein S7	Escherichia coli K-12
rRNA binding	30S ribosomal protein S7	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L15	Escherichia coli K-12
protein binding	50S ribosomal protein L15	Escherichia coli K-12
rRNA binding	50S ribosomal protein L15	Escherichia coli K-12
GTPase activity	50S ribosomal protein L10	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L10	Escherichia coli K-12
protein binding	50S ribosomal protein L10	Escherichia coli K-12
rRNA binding	50S ribosomal protein L10	Escherichia coli K-12
ribosome binding	50S ribosomal protein L10	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L10	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L11	Escherichia coli K-12
protein binding	50S ribosomal protein L11	Escherichia coli K-12
rRNA binding	50S ribosomal protein L11	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L11	Escherichia coli K-12
GTPase activity	50S ribosomal protein L7/L12	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L7/L12	Escherichia coli K-12
protein binding	50S ribosomal protein L7/L12	Escherichia coli K-12
protein homodimerization activity	50S ribosomal protein L7/L12	Escherichia coli K-12
ribosome binding	50S ribosomal protein L7/L12	Escherichia coli K-12
mRNA binding	50S ribosomal protein L7/L12	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L19	Escherichia coli K-12
rRNA binding	50S ribosomal protein L19	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L19	Escherichia coli K-12
tRNA binding	50S ribosomal protein L1	Escherichia coli K-12
RNA binding	50S ribosomal protein L1	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L1	Escherichia coli K-12
protein binding	50S ribosomal protein L1	Escherichia coli K-12
rRNA binding	50S ribosomal protein L1	Escherichia coli K-12
mRNA regulatory element binding translation repressor activity	50S ribosomal protein L20	Escherichia coli K-12
mRNA binding	50S ribosomal protein L20	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L20	Escherichia coli K-12
rRNA binding	50S ribosomal protein L20	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L20	Escherichia coli K-12
tRNA binding	50S ribosomal protein L27	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L27	Escherichia coli K-12
protein binding	50S ribosomal protein L27	Escherichia coli K-12
rRNA binding	50S ribosomal protein L27	Escherichia coli K-12
ribosome binding	50S ribosomal protein L27	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L28	Escherichia coli K-12
protein binding	50S ribosomal protein L28	Escherichia coli K-12
rRNA binding	50S ribosomal protein L28	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L29	Escherichia coli K-12
rRNA binding	50S ribosomal protein L29	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L31	Escherichia coli K-12
zinc ion binding	50S ribosomal protein L31	Escherichia coli K-12
rRNA binding	50S ribosomal protein L31	Escherichia coli K-12
metal ion binding	50S ribosomal protein L31	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L31 type B	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L32	Escherichia coli K-12
protein binding	50S ribosomal protein L32	Escherichia coli K-12
tRNA binding	50S ribosomal protein L33	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L33	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L34	Escherichia coli K-12
protein binding	50S ribosomal protein L34	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L35	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L36	Escherichia coli K-12
tRNA binding	30S ribosomal protein S10	Escherichia coli K-12
transcription antitermination factor activity, RNA binding	30S ribosomal protein S10	Escherichia coli K-12
RNA binding	30S ribosomal protein S10	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S10	Escherichia coli K-12
protein binding	30S ribosomal protein S10	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S11	Escherichia coli K-12
protein binding	30S ribosomal protein S11	Escherichia coli K-12
rRNA binding	30S ribosomal protein S11	Escherichia coli K-12
small ribosomal subunit rRNA binding	30S ribosomal protein S11	Escherichia coli K-12
tRNA binding	30S ribosomal protein S12	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S12	Escherichia coli K-12
protein binding	30S ribosomal protein S12	Escherichia coli K-12
rRNA binding	30S ribosomal protein S12	Escherichia coli K-12
misfolded RNA binding	30S ribosomal protein S12	Escherichia coli K-12
tRNA binding	30S ribosomal protein S13	Escherichia coli K-12
RNA binding	30S ribosomal protein S13	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S13	Escherichia coli K-12
protein binding	30S ribosomal protein S13	Escherichia coli K-12
rRNA binding	30S ribosomal protein S13	Escherichia coli K-12
four-way junction DNA binding	30S ribosomal protein S16	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S16	Escherichia coli K-12
endonuclease activity	30S ribosomal protein S16	Escherichia coli K-12
DNA endonuclease activity	30S ribosomal protein S16	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S18	Escherichia coli K-12
protein binding	30S ribosomal protein S18	Escherichia coli K-12
rRNA binding	30S ribosomal protein S18	Escherichia coli K-12
mRNA 5'-UTR binding	30S ribosomal protein S18	Escherichia coli K-12
small ribosomal subunit rRNA binding	30S ribosomal protein S18	Escherichia coli K-12
tRNA binding	30S ribosomal protein S19	Escherichia coli K-12
RNA binding	30S ribosomal protein S19	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S19	Escherichia coli K-12
rRNA binding	30S ribosomal protein S19	Escherichia coli K-12
RNA binding	30S ribosomal protein S20	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S20	Escherichia coli K-12
ornithine decarboxylase inhibitor activity	30S ribosomal protein S20	Escherichia coli K-12
rRNA binding	30S ribosomal protein S20	Escherichia coli K-12
small ribosomal subunit rRNA binding	30S ribosomal protein S20	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S2	Escherichia coli K-12
protein binding	30S ribosomal protein S2	Escherichia coli K-12
zinc ion binding	30S ribosomal protein S2	Escherichia coli K-12
RNA binding	30S ribosomal protein S3	Escherichia coli K-12
mRNA binding	30S ribosomal protein S3	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S3	Escherichia coli K-12
rRNA binding	30S ribosomal protein S3	Escherichia coli K-12
mRNA regulatory element binding translation repressor activity	30S ribosomal protein S4	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S4	Escherichia coli K-12
protein binding	30S ribosomal protein S4	Escherichia coli K-12
rRNA binding	30S ribosomal protein S4	Escherichia coli K-12
mRNA 5'-UTR binding	30S ribosomal protein S4	Escherichia coli K-12
RNA binding	30S ribosomal protein S5	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S5	Escherichia coli K-12
protein binding	30S ribosomal protein S5	Escherichia coli K-12
rRNA binding	30S ribosomal protein S5	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S8	Escherichia coli K-12
rRNA binding	30S ribosomal protein S8	Escherichia coli K-12
tRNA binding	30S ribosomal protein S9	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S9	Escherichia coli K-12
RNA binding	30S ribosomal protein S9	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L13	Escherichia coli K-12
zinc ion binding	50S ribosomal protein L13	Escherichia coli K-12
mRNA 5'-UTR binding	50S ribosomal protein L13	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L13	Escherichia coli K-12
mRNA binding	50S ribosomal protein L13	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L14	Escherichia coli K-12
protein binding	50S ribosomal protein L14	Escherichia coli K-12
rRNA binding	50S ribosomal protein L14	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L14	Escherichia coli K-12
tRNA binding	50S ribosomal protein L16	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L16	Escherichia coli K-12
rRNA binding	50S ribosomal protein L16	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L23	Escherichia coli K-12
protein binding	50S ribosomal protein L23	Escherichia coli K-12
rRNA binding	50S ribosomal protein L23	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S15	Escherichia coli K-12
rRNA binding	30S ribosomal protein S15	Escherichia coli K-12
small ribosomal subunit rRNA binding	30S ribosomal protein S15	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L17	Escherichia coli K-12
protein binding	50S ribosomal protein L17	Escherichia coli K-12
RNA binding	50S ribosomal protein L21	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L21	Escherichia coli K-12
rRNA binding	50S ribosomal protein L21	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L30	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L6	Escherichia coli K-12
rRNA binding	50S ribosomal protein L6	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L6	Escherichia coli K-12
tRNA binding	30S ribosomal protein S14	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S14	Escherichia coli K-12
rRNA binding	30S ribosomal protein S14	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S17	Escherichia coli K-12
zinc ion binding	30S ribosomal protein S17	Escherichia coli K-12
rRNA binding	30S ribosomal protein S17	Escherichia coli K-12
molecular adaptor activity	30S ribosomal protein S17	Escherichia coli K-12
small ribosomal subunit rRNA binding	30S ribosomal protein S17	Escherichia coli K-12
RNA binding	30S ribosomal protein S1	Escherichia coli K-12
single-stranded RNA binding	30S ribosomal protein S1	Escherichia coli K-12
mRNA binding	30S ribosomal protein S1	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S1	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L18	Escherichia coli K-12
5S rRNA binding	50S ribosomal protein L18	Escherichia coli K-12
rRNA binding	50S ribosomal protein L18	Escherichia coli K-12
RNA binding	50S ribosomal protein L2	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L2	Escherichia coli K-12
protein binding	50S ribosomal protein L2	Escherichia coli K-12
zinc ion binding	50S ribosomal protein L2	Escherichia coli K-12
transferase activity	50S ribosomal protein L2	Escherichia coli K-12
rRNA binding	50S ribosomal protein L2	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L3	Escherichia coli K-12
protein binding	50S ribosomal protein L3	Escherichia coli K-12
rRNA binding	50S ribosomal protein L3	Escherichia coli K-12
RNA binding	50S ribosomal protein L24	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L24	Escherichia coli K-12
protein binding	50S ribosomal protein L24	Escherichia coli K-12
rRNA binding	50S ribosomal protein L24	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L24	Escherichia coli K-12
RNA-binding transcription regulator activity	50S ribosomal protein L4	Escherichia coli K-12
DNA binding	50S ribosomal protein L4	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L4	Escherichia coli K-12
protein binding	50S ribosomal protein L4	Escherichia coli K-12
rRNA binding	50S ribosomal protein L4	Escherichia coli K-12
translation repressor activity	50S ribosomal protein L4	Escherichia coli K-12
mRNA 5'-UTR binding	50S ribosomal protein L4	Escherichia coli K-12
endoribonuclease inhibitor activity	50S ribosomal protein L4	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L22	Escherichia coli K-12
protein binding	50S ribosomal protein L22	Escherichia coli K-12
rRNA binding	50S ribosomal protein L22	Escherichia coli K-12
large ribosomal subunit rRNA binding	50S ribosomal protein L22	Escherichia coli K-12
tRNA binding	50S ribosomal protein L5	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L5	Escherichia coli K-12
5S rRNA binding	50S ribosomal protein L5	Escherichia coli K-12
rRNA binding	50S ribosomal protein L5	Escherichia coli K-12
RNA binding	50S ribosomal protein L5	Escherichia coli K-12
structural constituent of ribosome	30S ribosomal protein S21	Escherichia coli K-12
rRNA binding	30S ribosomal protein S21	Escherichia coli K-12
RNA binding	50S ribosomal protein L25	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L25	Escherichia coli K-12
5S rRNA binding	50S ribosomal protein L25	Escherichia coli K-12
rRNA binding	50S ribosomal protein L25	Escherichia coli K-12
structural constituent of ribosome	50S ribosomal protein L36 2	Escherichia coli K-12
double-stranded DNA binding	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
single-stranded DNA binding	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
exonuclease activity	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
protein binding	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
3'-tyrosyl-DNA phosphodiesterase activity	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Process	via Protein(s)	Taxonomy
chromosome, telomeric region	Menin	Homo sapiens (human)
nucleus	Menin	Homo sapiens (human)
nucleoplasm	Menin	Homo sapiens (human)
cytoplasm	Menin	Homo sapiens (human)
endoplasmic reticulum lumen	Menin	Homo sapiens (human)
cytosol	Menin	Homo sapiens (human)
nuclear matrix	Menin	Homo sapiens (human)
transcription repressor complex	Menin	Homo sapiens (human)
cleavage furrow	Menin	Homo sapiens (human)
MLL1/2 complex	Menin	Homo sapiens (human)
MLL1 complex	Menin	Homo sapiens (human)
chromatin	Menin	Homo sapiens (human)
protein-containing complex	Menin	Homo sapiens (human)
histone methyltransferase complex	Menin	Homo sapiens (human)
multivesicular body	Lecithin retinol acyltransferase	Homo sapiens (human)
endoplasmic reticulum	Lecithin retinol acyltransferase	Homo sapiens (human)
endoplasmic reticulum membrane	Lecithin retinol acyltransferase	Homo sapiens (human)
rough endoplasmic reticulum	Lecithin retinol acyltransferase	Homo sapiens (human)
perinuclear region of cytoplasm	Lecithin retinol acyltransferase	Homo sapiens (human)
rough endoplasmic reticulum	Lecithin retinol acyltransferase	Homo sapiens (human)
basolateral plasma membrane	Bile salt export pump	Homo sapiens (human)
Golgi membrane	Bile salt export pump	Homo sapiens (human)
endosome	Bile salt export pump	Homo sapiens (human)
plasma membrane	Bile salt export pump	Homo sapiens (human)
cell surface	Bile salt export pump	Homo sapiens (human)
apical plasma membrane	Bile salt export pump	Homo sapiens (human)
intercellular canaliculus	Bile salt export pump	Homo sapiens (human)
intracellular canaliculus	Bile salt export pump	Homo sapiens (human)
recycling endosome	Bile salt export pump	Homo sapiens (human)
recycling endosome membrane	Bile salt export pump	Homo sapiens (human)
extracellular exosome	Bile salt export pump	Homo sapiens (human)
membrane	Bile salt export pump	Homo sapiens (human)
cytoplasm	30S ribosomal protein S6	Escherichia coli K-12
cytosol	30S ribosomal protein S6	Escherichia coli K-12
ribosome	30S ribosomal protein S6	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S6	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S6	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S6	Escherichia coli K-12
cytosol	30S ribosomal protein S7	Escherichia coli K-12
ribosome	30S ribosomal protein S7	Escherichia coli K-12
membrane	30S ribosomal protein S7	Escherichia coli K-12
cytoplasm	30S ribosomal protein S7	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S7	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S7	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S7	Escherichia coli K-12
ribosome	30S ribosomal protein S7	Escherichia coli K-12
ribosome	50S ribosomal protein L15	Escherichia coli K-12
cytoplasm	50S ribosomal protein L15	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L15	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L15	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L15	Escherichia coli K-12
cytosol	50S ribosomal protein L10	Escherichia coli K-12
ribosome	50S ribosomal protein L10	Escherichia coli K-12
cytoplasm	50S ribosomal protein L10	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L10	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L10	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L10	Escherichia coli K-12
cytosol	50S ribosomal protein L11	Escherichia coli K-12
ribosome	50S ribosomal protein L11	Escherichia coli K-12
cytoplasm	50S ribosomal protein L11	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L11	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L11	Escherichia coli K-12
cytoplasm	50S ribosomal protein L7/L12	Escherichia coli K-12
cytosol	50S ribosomal protein L7/L12	Escherichia coli K-12
ribosome	50S ribosomal protein L7/L12	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L7/L12	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L7/L12	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L7/L12	Escherichia coli K-12
cytosol	50S ribosomal protein L19	Escherichia coli K-12
ribosome	50S ribosomal protein L19	Escherichia coli K-12
cytoplasm	50S ribosomal protein L19	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L19	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L19	Escherichia coli K-12
cytosol	50S ribosomal protein L1	Escherichia coli K-12
ribosome	50S ribosomal protein L1	Escherichia coli K-12
cytoplasm	50S ribosomal protein L1	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L1	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L1	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L1	Escherichia coli K-12
cytosol	50S ribosomal protein L20	Escherichia coli K-12
ribosome	50S ribosomal protein L20	Escherichia coli K-12
cytoplasm	50S ribosomal protein L20	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L20	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L20	Escherichia coli K-12
ribosome	50S ribosomal protein L27	Escherichia coli K-12
cytoplasm	50S ribosomal protein L27	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L27	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L27	Escherichia coli K-12
cytosol	50S ribosomal protein L28	Escherichia coli K-12
ribosome	50S ribosomal protein L28	Escherichia coli K-12
cytoplasm	50S ribosomal protein L28	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L28	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L28	Escherichia coli K-12
ribosome	50S ribosomal protein L29	Escherichia coli K-12
cytoplasm	50S ribosomal protein L29	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L29	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L29	Escherichia coli K-12
cytosol	50S ribosomal protein L31	Escherichia coli K-12
ribosome	50S ribosomal protein L31	Escherichia coli K-12
cytoplasm	50S ribosomal protein L31	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L31	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L31	Escherichia coli K-12
ribosome	50S ribosomal protein L31 type B	Escherichia coli K-12
cytoplasm	50S ribosomal protein L31 type B	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L31 type B	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L31 type B	Escherichia coli K-12
cytosol	50S ribosomal protein L32	Escherichia coli K-12
ribosome	50S ribosomal protein L32	Escherichia coli K-12
cytoplasm	50S ribosomal protein L32	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L32	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L32	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L32	Escherichia coli K-12
cytoplasm	50S ribosomal protein L33	Escherichia coli K-12
cytosol	50S ribosomal protein L33	Escherichia coli K-12
ribosome	50S ribosomal protein L33	Escherichia coli K-12
intracellular organelle	50S ribosomal protein L33	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L33	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L33	Escherichia coli K-12
ribosome	50S ribosomal protein L34	Escherichia coli K-12
cytoplasm	50S ribosomal protein L34	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L34	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L34	Escherichia coli K-12
ribosome	50S ribosomal protein L35	Escherichia coli K-12
cytoplasm	50S ribosomal protein L35	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L35	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L35	Escherichia coli K-12
cytoplasm	50S ribosomal protein L36	Escherichia coli K-12
ribosome	50S ribosomal protein L36	Escherichia coli K-12
intracellular organelle	50S ribosomal protein L36	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L36	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L36	Escherichia coli K-12
cytosol	30S ribosomal protein S10	Escherichia coli K-12
ribosome	30S ribosomal protein S10	Escherichia coli K-12
cytoplasm	30S ribosomal protein S10	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S10	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S10	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S10	Escherichia coli K-12
cytosol	30S ribosomal protein S11	Escherichia coli K-12
ribosome	30S ribosomal protein S11	Escherichia coli K-12
cytoplasm	30S ribosomal protein S11	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S11	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S11	Escherichia coli K-12
cytosol	30S ribosomal protein S12	Escherichia coli K-12
ribosome	30S ribosomal protein S12	Escherichia coli K-12
cytoplasm	30S ribosomal protein S12	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S12	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S12	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S12	Escherichia coli K-12
ribosome	30S ribosomal protein S12	Escherichia coli K-12
cytosol	30S ribosomal protein S13	Escherichia coli K-12
ribosome	30S ribosomal protein S13	Escherichia coli K-12
cytoplasm	30S ribosomal protein S13	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S13	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S13	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S13	Escherichia coli K-12
cytosol	30S ribosomal protein S13	Escherichia coli K-12
cytoplasm	30S ribosomal protein S16	Escherichia coli K-12
ribosome	30S ribosomal protein S16	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S16	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S16	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S16	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S16	Escherichia coli K-12
cytosol	30S ribosomal protein S18	Escherichia coli K-12
ribosome	30S ribosomal protein S18	Escherichia coli K-12
cytoplasm	30S ribosomal protein S18	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S18	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S18	Escherichia coli K-12
cytoplasm	30S ribosomal protein S19	Escherichia coli K-12
cytosol	30S ribosomal protein S19	Escherichia coli K-12
ribosome	30S ribosomal protein S19	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S19	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S19	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S19	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S19	Escherichia coli K-12
cytosol	30S ribosomal protein S20	Escherichia coli K-12
ribosome	30S ribosomal protein S20	Escherichia coli K-12
cytoplasm	30S ribosomal protein S20	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S20	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S20	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S20	Escherichia coli K-12
cytosol	30S ribosomal protein S20	Escherichia coli K-12
ribosome	30S ribosomal protein S2	Escherichia coli K-12
cytoplasm	30S ribosomal protein S2	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S2	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S2	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S2	Escherichia coli K-12
cytosol	30S ribosomal protein S3	Escherichia coli K-12
ribosome	30S ribosomal protein S3	Escherichia coli K-12
cytoplasm	30S ribosomal protein S3	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S3	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S3	Escherichia coli K-12
cytosol	30S ribosomal protein S4	Escherichia coli K-12
ribosome	30S ribosomal protein S4	Escherichia coli K-12
cytoplasm	30S ribosomal protein S4	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S4	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S4	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S4	Escherichia coli K-12
cytoplasm	30S ribosomal protein S5	Escherichia coli K-12
cytosol	30S ribosomal protein S5	Escherichia coli K-12
ribosome	30S ribosomal protein S5	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S5	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S5	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S5	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S5	Escherichia coli K-12
cytoplasm	30S ribosomal protein S8	Escherichia coli K-12
cytosol	30S ribosomal protein S8	Escherichia coli K-12
ribosome	30S ribosomal protein S8	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S8	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S8	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S8	Escherichia coli K-12
cytosol	30S ribosomal protein S9	Escherichia coli K-12
ribosome	30S ribosomal protein S9	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S9	Escherichia coli K-12
cytoplasm	30S ribosomal protein S9	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S9	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S9	Escherichia coli K-12
cytoplasm	50S ribosomal protein L13	Escherichia coli K-12
cytosol	50S ribosomal protein L13	Escherichia coli K-12
ribosome	50S ribosomal protein L13	Escherichia coli K-12
intracellular organelle	50S ribosomal protein L13	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L13	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L13	Escherichia coli K-12
ribosome	50S ribosomal protein L13	Escherichia coli K-12
cytosol	50S ribosomal protein L14	Escherichia coli K-12
ribosome	50S ribosomal protein L14	Escherichia coli K-12
cytoplasm	50S ribosomal protein L14	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L14	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L14	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L14	Escherichia coli K-12
ribosome	50S ribosomal protein L16	Escherichia coli K-12
cytoplasm	50S ribosomal protein L16	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L16	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L16	Escherichia coli K-12
ribosome	50S ribosomal protein L23	Escherichia coli K-12
cytoplasm	50S ribosomal protein L23	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L23	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L23	Escherichia coli K-12
cytoplasm	30S ribosomal protein S15	Escherichia coli K-12
cytosol	30S ribosomal protein S15	Escherichia coli K-12
ribosome	30S ribosomal protein S15	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S15	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S15	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S15	Escherichia coli K-12
cytosol	50S ribosomal protein L17	Escherichia coli K-12
ribosome	50S ribosomal protein L17	Escherichia coli K-12
cytoplasm	50S ribosomal protein L17	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L17	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L17	Escherichia coli K-12
cytoplasm	50S ribosomal protein L21	Escherichia coli K-12
cytosol	50S ribosomal protein L21	Escherichia coli K-12
ribosome	50S ribosomal protein L21	Escherichia coli K-12
intracellular organelle	50S ribosomal protein L21	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L21	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L21	Escherichia coli K-12
ribosome	50S ribosomal protein L30	Escherichia coli K-12
cytoplasm	50S ribosomal protein L30	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L30	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L30	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L30	Escherichia coli K-12
cytosol	50S ribosomal protein L6	Escherichia coli K-12
ribosome	50S ribosomal protein L6	Escherichia coli K-12
cytoplasm	50S ribosomal protein L6	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L6	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L6	Escherichia coli K-12
cytoplasm	30S ribosomal protein S14	Escherichia coli K-12
ribosome	30S ribosomal protein S14	Escherichia coli K-12
intracellular organelle	30S ribosomal protein S14	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S14	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S14	Escherichia coli K-12
small ribosomal subunit	30S ribosomal protein S14	Escherichia coli K-12
ribosome	30S ribosomal protein S17	Escherichia coli K-12
cytoplasm	30S ribosomal protein S17	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S17	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S17	Escherichia coli K-12
cytoplasm	30S ribosomal protein S1	Escherichia coli K-12
ribosome	30S ribosomal protein S1	Escherichia coli K-12
membrane	30S ribosomal protein S1	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S1	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S1	Escherichia coli K-12
cytoplasm	50S ribosomal protein L18	Escherichia coli K-12
cytosol	50S ribosomal protein L18	Escherichia coli K-12
ribosome	50S ribosomal protein L18	Escherichia coli K-12
intracellular organelle	50S ribosomal protein L18	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L18	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L18	Escherichia coli K-12
cytosol	50S ribosomal protein L2	Escherichia coli K-12
ribosome	50S ribosomal protein L2	Escherichia coli K-12
cytoplasm	50S ribosomal protein L2	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L2	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L2	Escherichia coli K-12
DnaA-L2 complex	50S ribosomal protein L2	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L2	Escherichia coli K-12
cytosol	50S ribosomal protein L3	Escherichia coli K-12
ribosome	50S ribosomal protein L3	Escherichia coli K-12
cytoplasm	50S ribosomal protein L3	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L3	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L3	Escherichia coli K-12
cytosol	50S ribosomal protein L24	Escherichia coli K-12
ribosome	50S ribosomal protein L24	Escherichia coli K-12
cytoplasm	50S ribosomal protein L24	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L24	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L24	Escherichia coli K-12
cytosol	50S ribosomal protein L4	Escherichia coli K-12
ribosome	50S ribosomal protein L4	Escherichia coli K-12
cytoplasm	50S ribosomal protein L4	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L4	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L4	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L4	Escherichia coli K-12
cytosol	50S ribosomal protein L22	Escherichia coli K-12
ribosome	50S ribosomal protein L22	Escherichia coli K-12
cytoplasm	50S ribosomal protein L22	Escherichia coli K-12
large ribosomal subunit	50S ribosomal protein L22	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L22	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L22	Escherichia coli K-12
cytosol	50S ribosomal protein L5	Escherichia coli K-12
ribosome	50S ribosomal protein L5	Escherichia coli K-12
cytoplasm	50S ribosomal protein L5	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L5	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L5	Escherichia coli K-12
cytosol	30S ribosomal protein S21	Escherichia coli K-12
ribosome	30S ribosomal protein S21	Escherichia coli K-12
cytoplasm	30S ribosomal protein S21	Escherichia coli K-12
cytosolic small ribosomal subunit	30S ribosomal protein S21	Escherichia coli K-12
ribonucleoprotein complex	30S ribosomal protein S21	Escherichia coli K-12
cytosol	50S ribosomal protein L25	Escherichia coli K-12
ribosome	50S ribosomal protein L25	Escherichia coli K-12
cytoplasm	50S ribosomal protein L25	Escherichia coli K-12
cytosolic large ribosomal subunit	50S ribosomal protein L25	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L25	Escherichia coli K-12
ribosome	50S ribosomal protein L36 2	Escherichia coli K-12
cytosolic ribosome	50S ribosomal protein L36 2	Escherichia coli K-12
ribonucleoprotein complex	50S ribosomal protein L36 2	Escherichia coli K-12
nucleoplasm	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
cytoplasm	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
plasma membrane	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
intracellular membrane-bounded organelle	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
nucleus	Tyrosyl-DNA phosphodiesterase 1	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Assay ID	Title	Year	Journal	Article
AID481451	Antibacterial activity against Streptococcus pneumoniae ATCC 49619 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID584123	Antimicrobial activity against Staphylococcus aureus RN4220 carrying pAFS11-apmA, erm(B), tet(L), dfrK, aadD resistance genes by CLSI M31-A3 method	2011	Antimicrobial agents and chemotherapy, Jan, Volume: 55, Issue:1	Novel apramycin resistance gene apmA in bovine and porcine methicillin-resistant Staphylococcus aureus ST398 isolates.
AID414693	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 43300 by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID644960	Displacement of ethidium bromide from human pre-hsa-mir-155 miRNA after 30 mins	2012	Bioorganic & medicinal chemistry letters, Feb-15, Volume: 22, Issue:4	Pre-microRNA binding aminoglycosides and antitumor drugs as inhibitors of Dicer catalyzed microRNA processing.
AID390919	Antibacterial activity against Candida albicans	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID126453	Dissociation constant for binding to mitochondrial 12S rRNA construct M2 was determined	2002	Bioorganic & medicinal chemistry letters, Aug-19, Volume: 12, Issue:16	Decoding region bubble size and aminoglycoside antibiotic binding.
AID535432	Antimicrobial activity against Eubacterium cylindroides by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1139966	Binding affinity to menin (unknown origin) assessed as thermal stability at 200 uM by differential scanning fluorimetry (Rvb = 40.46 degC)	2014	Bioorganic & medicinal chemistry letters, May-01, Volume: 24, Issue:9	Discovery of two aminoglycoside antibiotics as inhibitors targeting the menin-mixed lineage leukaemia interface.
AID1322258	Antibacterial activity against ANT2''-IA expressing Escherichia coli L8058.1 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID564686	Antimicrobial activity against beta lactamase KPC-producing Klebsiella pneumoniae isolates by microdilution method	2009	Antimicrobial agents and chemotherapy, Oct, Volume: 53, Issue:10	ACHN-490, a neoglycoside with potent in vitro activity against multidrug-resistant Klebsiella pneumoniae isolates.
AID499955	Dissociation constant Kd of the compound	2010	Journal of medicinal chemistry, Aug-26, Volume: 53, Issue:16	Strategies for recognition of stem-loop RNA structures by synthetic ligands: application to the HIV-1 frameshift stimulatory sequence.
AID534726	Antimicrobial activity against Bacteroides caccae by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535462	Antimicrobial activity against Propionibacterium propionicum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID446126	Antibacterial activity against AAC6'-2a expressing Pseudomonas aeruginosa F03 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID534992	Antimicrobial activity against Clostridium bolteae by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1322251	Antibacterial activity against AAC6'-2A expressing Pseudomonas aeruginosa F03 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID278538	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium breve R0070 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID566353	Inhibition of rat phospholipase C	2010	Bioorganic & medicinal chemistry, Nov-01, Volume: 18, Issue:21	Discovery of {1-[4-(2-{hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl}-1H-benzimidazol-1-yl)piperidin-1-yl]cyclooctyl}methanol, systemically potent novel non-peptide agonist of nociceptin/orphanin FQ receptor as analgesic for the treatment of neuropathic pain: de
AID535478	Antimicrobial activity against Ruminococcus flavefaciens by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278522	Antimicrobial activity against Bifidobacterium bifidum R0071	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1241211	Binding affinity to 5'-FAM-pre-miR-373 (unknown origin) after 4 hrs by fluorescence assay	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID534946	Antimicrobial activity against Fusobacterium varium by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535426	Antimicrobial activity against Eubacterium alactolyticum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534718	Antimicrobial activity against Parabacteroides merdae by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID548954	Binding affinity to Escherichia coli ribosome assessed as inhibition of transcription-translational activity by luciferase assay	2010	Bioorganic & medicinal chemistry letters, Dec-15, Volume: 20, Issue:24	Second generation analogs of rigid 6,7-spiro scaffolds targeting the bacterial ribosome.
AID535442	Antimicrobial activity against Lactobacillus acidophilus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID588213	Literature-mined compound from Fourches et al multi-species drug-induced liver injury (DILI) dataset, effect in non-rodents	2010	Chemical research in toxicology, Jan, Volume: 23, Issue:1	Cheminformatics analysis of assertions mined from literature that describe drug-induced liver injury in different species.
AID1241212	Binding affinity to 5'-FAM-pre-miR-372 (unknown origin) after 4 hrs by fluorescence assay in presence of 100-fold excess of Escherichia coli tRNA	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID1662707	Ototoxicity against C57BL/6 mouse cochlea hair cells assessed as reduction in cell viability at 0.1 mM incubated for 23 hrs by FITC-phalloidin staining-based assay	2020	Bioorganic & medicinal chemistry letters, 07-01, Volume: 30, Issue:13	The relationship between the structure and toxicity of aminoglycoside antibiotics.
AID644954	Binding affinity to human pre-hsa-mir-155 miRNA assessed as increase in melting temperature	2012	Bioorganic & medicinal chemistry letters, Feb-15, Volume: 22, Issue:4	Pre-microRNA binding aminoglycosides and antitumor drugs as inhibitors of Dicer catalyzed microRNA processing.
AID535446	Antimicrobial activity against Lactobacillus fermentum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID390912	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 33592 after 24 hrs by macrobroth dilution method	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID1165219	Antibacterial activity against Staphylococcus aureus MLS16 MTCC 2940 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID534715	Antimicrobial activity against Bacteroides fragilis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534986	Antimicrobial activity against Clostridium bartlettii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534972	Antimicrobial activity against Clostridium difficile by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1232185	Induction of thermal stability changes in HIV1 TAR RNA U3 bulge mutant assessed as change in melting temperature using 1 molar equivalents of compound pre-incubated for 4 hrs at pH 6.8 at 4 degC before test by UV thermal denaturation assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID535434	Antimicrobial activity against Eubacterium limosum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID244810	Minimum inhibitory concentration required against Escherichia coli	2004	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 14, Issue:17	Synthesis of an unusual branched-chain sugar, 5-C-methyl-L-idopyranose for SAR studies of pyranmycins: implication for the future design of aminoglycoside antibiotics.
AID278551	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium infantis ATCC 15697 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1322254	Antibacterial activity against Acinetobacter lwoffii ATCC 17925 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID535226	Antimicrobial activity against Atopobium minutum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414699	Antibacterial activity against Escherichia coli BL21 by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID1322252	Antibacterial activity against MexXY expressing Pseudomonas aeruginosa PA22 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID535468	Antimicrobial activity against Finegoldia magna by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID540929	Antimicrobial activity against paromomycin-resistant Streptomyces coelicolor KO-347 harboring rpsl P91S mutant gene after 48 hrs	2009	Antimicrobial agents and chemotherapy, Mar, Volume: 53, Issue:3	A novel insertion mutation in Streptomyces coelicolor ribosomal S12 protein results in paromomycin resistance and antibiotic overproduction.
AID1232124	Antimicrobial activity against Escherichia coli ATCC 25922 assessed as inhibition of bacterial growth incubated at 35 degC for 12 to 18 hrs	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Antifungal Amphiphilic Aminoglycosides.
AID446136	Antibacterial activity against MexXY expressing Pseudomonas aeruginosa PA22 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID513839	Binding affinity to Escherichia coli 23S rRNA H69 assessed as tRNA translocation rate at 20 uM (Rvb= 1.57+/-0.05 /sec)	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID414688	Antibacterial activity against Escherichia coli R477-100 by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID446130	Antibacterial activity against AAC6'-2b expressing Escherichia coli PAZ505H8101 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID535240	Antimicrobial activity against Bifidobacterium pseudocatenulatum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID564685	Antimicrobial activity against multidrug-resistant Klebsiella pneumoniae isolates by microdilution method	2009	Antimicrobial agents and chemotherapy, Oct, Volume: 53, Issue:10	ACHN-490, a neoglycoside with potent in vitro activity against multidrug-resistant Klebsiella pneumoniae isolates.
AID534943	Antimicrobial activity against Fusobacterium mortiferum by Wadsworth agar dilution method in presence of beta-lactamase inhibitor Sulbactam	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414706	Inhibition of protein synthesis in Escherichia coli S30 extracts assessed as luciferase activity after 1 hr by coupled transcription/translation assay	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID534936	Antimicrobial activity against Desulfovibrio vulgaris by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535210	Antimicrobial activity against Clostridium spiroforme by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534954	Antimicrobial activity against Porphyromonas somerae by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID270923	Binding affinity to tRNA	2006	Bioorganic & medicinal chemistry letters, Sep-15, Volume: 16, Issue:18	A strategy for the design of selective RNA binding agents. Preparation and RRE RNA binding affinities of a neomycin-peptide nucleic acid heteroconjugate library.
AID534988	Antimicrobial activity against Clostridium beijerinckii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1322253	Antibacterial activity against triABC deficient Pseudomonas aeruginosa PA406 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID535190	Antimicrobial activity against Clostridium lactatifermentans by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID469604	Binding affinity to duplex DNA dA22.dT22 assessed as change in melting temperature at 3 uM by UV analysis at 260 nm	2009	Bioorganic & medicinal chemistry letters, Sep-01, Volume: 19, Issue:17	Triple recognition of B-DNA.
AID1570829	Selectivity ratio of IC50 for anti-ribosomal activity against human-bacterial hybrid ribosome containing human mitochondrial ribosome A site harboring A1555G mutant 12s rRNA to IC50 for anti-ribosomal activity against bacterial 70S hybrid ribosomes	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID288156	Ototoxicity assessed as cochlear inner cells damage in Albino guinea pig with transtympanic application in right ear relative to left ear control	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID534930	Antimicrobial activity against Desulfovibrio desulfuricans by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID255064	Effect against transactivation responsive RNA-binding protein at pH 7.4 (50 mM Tris-HCl and 20 M KCl) in fluorimetric competition assay	2005	Bioorganic & medicinal chemistry letters, Nov-01, Volume: 15, Issue:21	Neamine dimers targeting the HIV-1 TAR RNA.
AID534934	Antimicrobial activity against Desulfovibrio piger by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID446143	Inhibition of protein synthesis in Pseudomonas aeruginosa ATCC 27853 assessed as decrease in incorporation of L-[4,5-3H]leucine at 10 times MIC by liquid scintillation counter relative to control	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID535440	Antimicrobial activity against Holdemania filiformis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID92475	Inhibitory activity of the aminoglycoside on Staphylococcus aureus IF-2 binding to fMet-tRNA(fMet)	2003	Bioorganic & medicinal chemistry letters, Mar-24, Volume: 13, Issue:6	Inhibition of bacterial IF2 binding to fMet-tRNA((fMet)) by aminoglycosides.
AID534970	Antimicrobial activity against Clostridium clostridioforme by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID774224	Antibacterial activity against Staphylococcus aureus expressing aminoglycoside-4'-O-phosphoryltransferase after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID534722	Antimicrobial activity against Bacteroides ovatus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278805	Antimicrobial activity against Stenotrophomonas maltophilia K279a mutant	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Aph(3')-IIc, an aminoglycoside resistance determinant from Stenotrophomonas maltophilia.
AID278530	Antimicrobial activity against Bifidobacterium longum P/N 601377	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID278566	Antimicrobial activity against 90 mins hydrogen peroxide-stressed Bifidobacterium longum P/N 601377 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID428870	Antibacterial activity against Escherichia coli CSH-2 carrying Escherichia coli ARS3 pARS3 by agar dilution method	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID534720	Antimicrobial activity against Parabacteroides goldsteinii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535438	Antimicrobial activity against Eubacterium saburreum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414695	Antibacterial activity against aminoglycosides-resistant Escherichia coli XL1-blue harboring pSF815 expressing AAC(6')-APH(2'') enzyme by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID278536	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium bifidum BB12 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1322257	Antibacterial activity against AAC6'-IB expressing Escherichia coli PAZ505H8101 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID1704234	Antibacterial activity against Methicillin-resistant Staphylococcus aureus USA300 by CLSI-based microdilution method	2020	European journal of medicinal chemistry, Nov-15, Volume: 206	1,2,3-Triazole-containing hybrids with potential antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA).
AID534960	Antimicrobial activity against Prevotella corporis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID481453	Antibacterial activity against Escherichia coli ATCC 25922 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID1241214	Binding affinity to 5'-FAM-pre-miR-372 (unknown origin) after 4 hrs by fluorescence assay in presence of 100-fold excess of 15-mer DNA	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID535206	Antimicrobial activity against Clostridium sordellii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1879369	Stabilization of [poly(dA).2poly(dT) triplex DNA (unknown origin) assessed as increase in melting temperature at 1 uM by Thermal denaturation assay	2022	Bioorganic & medicinal chemistry letters, 04-01, Volume: 61	5-Substituted 3, 3', 4', 7-tetramethoxyflavonoids - A novel class of potent DNA triplex specific binding ligands.
AID534998	Antimicrobial activity against Clostridium cocleatum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID625292	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) combined score	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID535212	Antimicrobial activity against Clostridium sporogenes by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535484	Antimicrobial activity against Ruminococcus luti by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535218	Antimicrobial activity against Clostridium tertium by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1241222	Inhibition of pre-miR-372 (unknown origin) cleavage at A24 at 1 to 100 uM after 2 hrs by denaturing gel electrophoresis in presence of recombinant Dicer	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID534952	Antimicrobial activity against Porphyromonas asaccharolyticus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278557	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium thermophilum ATCC 25866 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1232198	Binding affinity to HIV1 TAR RNA bulgeless mutant assessed as association constant at pH 6.8 by ethidium bromide displacement assay based Scatchard analysis method	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID534976	Antimicrobial activity against Clostridium innocuum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID625286	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for hepatitis	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID535250	Antimicrobial activity against Eggerthella lenta by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535486	Antimicrobial activity against Ruminococcus obeum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID283221	Antimicrobial activity against Escherichia coli XL1-Blue pPA95S29	2007	Antimicrobial agents and chemotherapy, Mar, Volume: 51, Issue:3	Coproduction of novel 16S rRNA methylase RmtD and metallo-beta-lactamase SPM-1 in a panresistant Pseudomonas aeruginosa isolate from Brazil.
AID278535	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium bifidum R0071 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID774221	Antibacterial activity against Acinetobacter lwoffii ATCC 17925 after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID1534875	Toxicity in Caenorhabditis elegans infected with methicillin-resistant Staphylococcus aureus assessed as effect on nematode larvae viability by measuring decrease in formazan production at 3.13 to 1.56 uM after 24 hrs by MTT assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID774213	Antibacterial activity against Escherichia coli L58058.1 expressing ANT2''-1A after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID198297	Compound was evaluated for the apparent first-order binding constant (K) at a concentration of 90 uM to 5 mM	1999	Bioorganic & medicinal chemistry letters, Jan-18, Volume: 9, Issue:2	RNA-aminoglycoside antibiotic interactions: fluorescence detection of binding and conformational change.
AID1710137	Binding affinity to 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) assessed as dissociation constant incubated for overnight in presence of Saccharomyces cerevisiae tRNA by fluo	2021	ACS medicinal chemistry letters, Jun-10, Volume: 12, Issue:6	Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
AID560599	Antimicrobial activity against Escherichia coli JM109 transformant harboring pSTV28 plasmid expressing aac(6')-Iaf wild type gene by microdilution method	2009	Antimicrobial agents and chemotherapy, Jun, Volume: 53, Issue:6	AAC(6')-Iaf, a novel aminoglycoside 6'-N-acetyltransferase from multidrug-resistant Pseudomonas aeruginosa clinical isolates.
AID446138	Antibacterial activity against MexAB, MexCD, MexEF, MexXY, TriABC deleted Pseudomonas aeruginosa PA406 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID535488	Antimicrobial activity against Ruminococcus productus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1232193	Binding affinity to HIV1 TAR RNA bulgeless mutant at pH 6.8 by ethidium bromide displacement assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID535248	Antimicrobial activity against Coprobacillus cateniformis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID428873	Antibacterial activity against Escherichia coli JM109 carrying pMCL210 by agar dilution method	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID1534862	Inhibition of AAC(6')-1e (unknown origin)	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID278541	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium longum R0175 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1848762	Antimicrobial activity against Vancomycin-resistant Enterococcus faecium ATCC 51559 assessed as growth inhibition after 14 to 16 hrs by CLSI based broth dilution method	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Targeting Vancomycin-Resistant
AID1330467	Binding affinity to poly(rA).(rU) RNA duplex (unknown origin) assessed as thermal stability by measuring change in melting temperature at 5 uM in presence of Hoechst 33258 by UV-Vis spectrophotometry	2016	Bioorganic & medicinal chemistry letters, 12-15, Volume: 26, Issue:24	Linker dependent intercalation of bisbenzimidazole-aminosugars in an RNA duplex; selectivity in RNA vs. DNA binding.
AID535458	Antimicrobial activity against Propionibacterium acnes by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1408010	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 43300 measured after 12 to 18 hrs	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Tuning the biological activity of cationic anthraquinone analogues specifically toward Staphylococcus aureus.
AID664696	Antimicrobial activity against Staphylococcus aureus ATCC 29213	2011	ACS medicinal chemistry letters, Dec-08, Volume: 2, Issue:12	Toward Overcoming Staphylococcus aureus Aminoglycoside Resistance Mechanisms with a Functionally Designed Neomycin Analogue.
AID390914	Antibacterial activity against methicillin-resistant Staphylococcus epidermidis ATCC 14990 after 24 hrs by macrobroth dilution method	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID588212	Literature-mined compound from Fourches et al multi-species drug-induced liver injury (DILI) dataset, effect in rodents	2010	Chemical research in toxicology, Jan, Volume: 23, Issue:1	Cheminformatics analysis of assertions mined from literature that describe drug-induced liver injury in different species.
AID534968	Antimicrobial activity against Prevotella melaninogenica by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535480	Antimicrobial activity against Ruminococcus gnavus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1704233	Antibacterial activity against Methicillin-resistant Staphylococcus aureus USA200 by CLSI-based microdilution method	2020	European journal of medicinal chemistry, Nov-15, Volume: 206	1,2,3-Triazole-containing hybrids with potential antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA).
AID1534866	Inhibition of APH(3')-1a (unknown origin)	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID731210	Binding affinity to 2-AP labeled 16s rRNA (unknown origin) having pairing of G1405-C1496 by fluorescence assay	2013	Bioorganic & medicinal chemistry letters, Mar-15, Volume: 23, Issue:6	Investigation of antibacterial mode of action for traditional and amphiphilic aminoglycosides.
AID535234	Antimicrobial activity against Bifidobacterium dentium by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535224	Antimicrobial activity against Actinomyces viscosus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278564	Antimicrobial activity against 90 mins hydrogen peroxide-stressed Bifidobacterium longum ATCC 15708 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1322250	Antibacterial activity against Pseudomonas aeruginosa ATCC 27853 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID609431	Binding affinity to 2-AP labeled mutant RNA5 by fluorescence binding assay	2011	Bioorganic & medicinal chemistry letters, Aug-15, Volume: 21, Issue:16	Conjugate of neamine and 2-deoxystreptamine mimic connected by an amide bond.
AID428877	Binding affinity to 16S rRNA G1494(N7) position in wild type Escherichia coli JM109 30S sunit at 1000 uM by footprint assay	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID535232	Antimicrobial activity against Bifidobacterium breve by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID625287	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for hepatomegaly	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID535184	Antimicrobial activity against Clostridium fallax by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535456	Antimicrobial activity against Lactobacillus sp. by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID288160	Antimicrobial activity against Staphylococcus aureus ATCC 6538 at 15 mg/ml after 24 hrs by micro dilution method	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID551744	Antibacterial activity against Mycobacterium smegmatis ATCC 14468 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID348086	Antibacterial activity against aminoglycoside-susceptible Escherichia coli TG1 after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID534714	Antimicrobial activity against Parabacteroides distasonis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1570833	Binding affinity to 5'-fluorescein-tagged bacterial ribosomal A site 27-nucleotide hairpin RNA construct by fluorescence analysis	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID288157	Ototoxicity assessed as cochlear outer cells damage in Albino guinea pig with transtympanic application in right ear relative to left ear control	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID644953	Binding affinity to human pre-hsa-mir-155 miRNA assessed as inhibition of dicer-catalysed (33P)-labelled pre-miRNA processing at 1 mM after 1 hr by PAGE analysis	2012	Bioorganic & medicinal chemistry letters, Feb-15, Volume: 22, Issue:4	Pre-microRNA binding aminoglycosides and antitumor drugs as inhibitors of Dicer catalyzed microRNA processing.
AID1633749	Binding affinity to HIV-1 FSS RNA assessed as dissociation constant by SPR assay	2019	Bioorganic & medicinal chemistry, 07-01, Volume: 27, Issue:13	Enhancing the ligand efficiency of anti-HIV compounds targeting frameshift-stimulating RNA.
AID278547	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium bifidum ATCC 15696 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1232188	Induction of thermal stability changes in HIV1 TAR RNA bulgeless tetraloop mutant assessed as change in melting temperature using 1 molar equivalents of compound pre-incubated for 4 hrs at pH 6.8 at 4 degC before test by UV thermal denaturation assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID1566495	Inhibition of biotinylated pre-let-7d (unknown origin) maturation at 1 mM preincubated for 15 mins followed by Pre-let-7d addition and measured after 5 hrs by cat-ELCCA	2019	ACS medicinal chemistry letters, May-09, Volume: 10, Issue:5	Tetracyclines as Inhibitors of Pre-microRNA Maturation: A Disconnection between RNA Binding and Inhibition.
AID1534822	Antibacterial activity against NEO-sensitive Staphylococcus aureus 25923 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID535470	Antimicrobial activity against Peptoniphilus asaccharolyticus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414702	Activity at aminoglycoside 3'-phosphotransferase 3a	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID1232192	Binding affinity to wild type HIV1 TAR RNA at pH 6.8 by ethidium bromide displacement assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID544012	Antimicrobial activity against Arthrobacter arilaitensis isolate C361 harboring sul1 to sul3 genes assessed as antibiotic resistance breakpoint by agar dilution method	2009	Antimicrobial agents and chemotherapy, Feb, Volume: 53, Issue:2	Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.
AID244820	Minimum inhibitory concentration required against Staphylococcus aureus	2004	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 14, Issue:17	Synthesis of an unusual branched-chain sugar, 5-C-methyl-L-idopyranose for SAR studies of pyranmycins: implication for the future design of aminoglycoside antibiotics.
AID535222	Antimicrobial activity against Actinomyces odontolyticus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1241219	Inhibition of pre-miR-372 (unknown origin) cleavage at 10 to 100 uM after 15 mins by RNase footprinting assay in presence of RNase-S1	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID535204	Antimicrobial activity against Clostridium septicum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1241203	Inhibition of pre-miR-17 (unknown origin) cleavage assessed as reduction of oncogenic microRNAs biogenesis at 200 uM by measuring fluorescence every minute for 5 hrs using 5'-FAM,3'-dabcyl-pre-miRNA beacons by FRET assay in presence of recombinant Dicer	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID534728	Antimicrobial activity against Bacteroides nordii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278526	Antimicrobial activity against Bifidobacterium infantis ATCC 15697	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID664697	Antimicrobial activity against Staphylococcus aureus harboring APH(3'/5'''')-3 enzyme	2011	ACS medicinal chemistry letters, Dec-08, Volume: 2, Issue:12	Toward Overcoming Staphylococcus aureus Aminoglycoside Resistance Mechanisms with a Functionally Designed Neomycin Analogue.
AID535236	Antimicrobial activity against Bifidobacterium infantis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID428879	Binding affinity to 16S rRNA G1494(N7) position in A1408-methylated Escherichia coli JM109 30S sunit at 1000 uM by footprint assay	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID348089	Activity of Enterococcus APH(3')-3a	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID625281	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for cholelithiasis	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID535202	Antimicrobial activity against Clostridium scindens by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414703	Ratio of kcat/km for aminoglycoside 3'-phosphotransferase 3a	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID535474	Antimicrobial activity against Peptostreptococcus anaerobius by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1232196	Binding affinity to HIV1 TAR RNA U3 bulge mutant at pH 6.8 by ethidium bromide displacement assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID534978	Antimicrobial activity against Clostridium orbiscindens by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID540930	Antimicrobial activity against paromomycin-resistant Streptomyces coelicolor 92G harboring rpsL gene with inserted glycine at position 92 after 48 hrs	2009	Antimicrobial agents and chemotherapy, Mar, Volume: 53, Issue:3	A novel insertion mutation in Streptomyces coelicolor ribosomal S12 protein results in paromomycin resistance and antibiotic overproduction.
AID534724	Antimicrobial activity against Bacteroides thetaiotaomicron by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535242	Antimicrobial activity against Bifidobacterium pseudolongum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID560591	Antimicrobial activity against Pseudomonas aeruginosa isolate IMCJ799 by microdilution method	2009	Antimicrobial agents and chemotherapy, Jun, Volume: 53, Issue:6	AAC(6')-Iaf, a novel aminoglycoside 6'-N-acetyltransferase from multidrug-resistant Pseudomonas aeruginosa clinical isolates.
AID544019	Antimicrobial activity against Acinetobacter lwoffii isolate C15 harboring sul1 to sul3 genes assessed as antibiotic resistance breakpoint by agar dilution method	2009	Antimicrobial agents and chemotherapy, Feb, Volume: 53, Issue:2	Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.
AID1614689	Antimicrobial activity against compound-pre-treated Escherichia coli by broth dilution assay based drug resistance development assay	2019	Journal of medicinal chemistry, 02-28, Volume: 62, Issue:4	Deciphering the Role of Intramolecular Networking in Cholic Acid-Peptide Conjugates on the Lipopolysaccharide Surface in Combating Gram-Negative Bacterial Infections.
AID1232200	Binding affinity to HIV1 TAR RNA bulgeless tetraloop mutant assessed as association constant at pH 6.8 by ethidium bromide displacement assay based Scatchard analysis method	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID551751	Antibacterial activity against vancomycin-resistant Enterococcus faecalis ATCC 51299 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID1241209	Binding affinity to 5'-FAM-pre-miR-372 (unknown origin) after 4 hrs by fluorescence assay	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID382890	Induction of tRNA-UCCA binding to T box antiterminator RNA AM1A at 200 uM by FRET method	2008	Bioorganic & medicinal chemistry, Apr-15, Volume: 16, Issue:8	Identification of neomycin B-binding site in T box antiterminator model RNA.
AID535476	Antimicrobial activity against Peptostreptococcus micros by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278806	Antimicrobial activity against Stenotrophomonas maltophilia K279a (aph FS) mutant	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Aph(3')-IIc, an aminoglycoside resistance determinant from Stenotrophomonas maltophilia.
AID446124	Antibacterial activity against APH30-VIa expressing Acinetobacter lwoffii AI.88-483 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID535192	Antimicrobial activity against Clostridium leptum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535466	Antimicrobial activity against Anaerococcus tetradius by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1241217	Inhibition of pre-miR-372 (unknown origin) cleavage at U15-G16-G17-A18 at 10 to 100 uM after 15 mins by RNase footprinting assay in presence of RNase-V1	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID535450	Antimicrobial activity against Lactobacillus plantarum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID288163	Antimicrobial activity against Pseudomonas aeruginosa ATCC 27853 at 15 mg/ml after 24 hrs by micro dilution method	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID535244	Antimicrobial activity against Catenibacterium mitsuokai by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1534825	Displacement of F-NEO from Escherichia coli rRNA-A site after 10 to 20 mins by fluorescence assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID535482	Antimicrobial activity against Ruminococcus lactaris by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID301914	Antibacterial activity against aminoglycoside-resistant Escherichia coli TG1 pSF815 after 12 to 18 hrs	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Synthesis and antibacterial activity of pyranmycin derivatives with N-1 and O-6 modifications.
AID1848760	Antimicrobial activity against Enterococcus faecium assessed as growth inhibition after 14 to 16 hrs by CLSI based broth dilution method	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Targeting Vancomycin-Resistant
AID1232123	Antimicrobial activity against methicillin-resistant Staphylococcus aureus ATCC 33591 assessed as inhibition of bacterial growth incubated at 35 degC for 12 to 18 hrs	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Antifungal Amphiphilic Aminoglycosides.
AID278556	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium pseudolongum ATCC 25562 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID535460	Antimicrobial activity against Propionibacterium avidum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID301883	Binding affinity to Escherichia coli K12 stem-loop region L2-11 RNA aptamers using luminescence spectrometer by anisotropy technique	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Elucidation of the RNA target of linezolid by using a linezolid-neomycin B heteroconjugate and genomic SELEX.
AID1534868	Antibacterial activity against NEO-sensitive Staphylococcus aureus C2 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID1241215	Ratio of Kd for 5'-FAM-pre-miR-372 (unknown origin) in presence of 100-fold excess of 15-mer DNA to Kd for 5'-FAM-pre-miR-372 (unknown origin)	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID481456	Antibacterial activity against Pseudomonas aeruginosa CAN-ICU 62308 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID534944	Antimicrobial activity against Fusobacterium necrophorum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID664698	Antimicrobial activity against Staphylococcus aureus harboring ANT(4')-1 enzyme	2011	ACS medicinal chemistry letters, Dec-08, Volume: 2, Issue:12	Toward Overcoming Staphylococcus aureus Aminoglycoside Resistance Mechanisms with a Functionally Designed Neomycin Analogue.
AID535428	Antimicrobial activity against Eubacterium biforme by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID348088	Antibacterial activity against Escherichia coli TG1 pTZ19U-3 plasmid encoded for APH(3')-1 after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID588220	Literature-mined public compounds from Kruhlak et al phospholipidosis modelling dataset	2008	Toxicology mechanisms and methods, , Volume: 18, Issue:2-3	Development of a phospholipidosis database and predictive quantitative structure-activity relationship (QSAR) models.
AID1848759	Antimicrobial activity against Staphylococcus aureus ATCC 25923 assessed as growth inhibition after 14 to 16 hrs by CLSI based broth dilution method	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Targeting Vancomycin-Resistant
AID535182	Antimicrobial activity against Clostridium disporicum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535238	Antimicrobial activity against Bifidobacterium longum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID446127	Antibacterial activity against MexXY expressing Pseudomonas aeruginosa PT629 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID625282	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for cirrhosis	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID183797	Effect on colon small bowel tumorigenesis in rats fed with safflower oil diet(Group 1 diet)	1999	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 9, Issue:17	Fecal excretion pattern of bile acids in rats fed high fat diets and neomycin in induced colon tumorigenesis.
AID340325	Inhibition of phospholipase C	2008	Journal of medicinal chemistry, Jul-24, Volume: 51, Issue:14	Identification of a potent, selective, and orally active leukotriene a4 hydrolase inhibitor with anti-inflammatory activity.
AID278548	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium bifidum BB12 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1241213	Ratio of Kd for 5'-FAM-pre-miR-372 (unknown origin) in presence of 100-fold excess of Escherichia coli tRNA to Kd for 5'-FAM-pre-miR-372 (unknown origin)	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID270922	Binding affinity to Rev response element RNA	2006	Bioorganic & medicinal chemistry letters, Sep-15, Volume: 16, Issue:18	A strategy for the design of selective RNA binding agents. Preparation and RRE RNA binding affinities of a neomycin-peptide nucleic acid heteroconjugate library.
AID540932	Antimicrobial activity against paromomycin-resistant Streptomyces coelicolor SP2 harboring rpsL K88E mutant gene and inserted glycine at position 92 of the gene after 48 hrs	2009	Antimicrobial agents and chemotherapy, Mar, Volume: 53, Issue:3	A novel insertion mutation in Streptomyces coelicolor ribosomal S12 protein results in paromomycin resistance and antibiotic overproduction.
AID278546	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium bifidum R0071 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID625290	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for liver fatty	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID166715	Tested for binding affinity against RNA construct C	2002	Bioorganic & medicinal chemistry letters, Feb-11, Volume: 12, Issue:3	Binding of aminoglycoside antibiotics with modified A-site 16S rRNA construct containing non-nucleotide linkers.
AID278567	Antimicrobial activity against 90 mins hydrogen peroxide-stressed Bifidobacterium thermophilum ATCC 25866 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID535452	Antimicrobial activity against Lactobacillus reuteri by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534996	Antimicrobial activity against Clostridium cadaveris by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID774227	Antibacterial activity against 14- and 15-membered macrolide-resistant Staphylococcus aureus expressing MsrA efflux pump after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID166717	Tested for binding affinity against RNA construct D	2002	Bioorganic & medicinal chemistry letters, Feb-11, Volume: 12, Issue:3	Binding of aminoglycoside antibiotics with modified A-site 16S rRNA construct containing non-nucleotide linkers.
AID534730	Antimicrobial activity against Bacteroides stercoris by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414696	Resistance index, MIC for aminoglycosides-resistant Escherichia coli XL1-blue harboring pSF815 expressing AAC(6')-APH(2'') enzyme to MIC for Escherichia coli XL1-blue	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID278549	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium breve ATCC 15700 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID534982	Antimicrobial activity against Clostridium acetobutylicum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID126454	Dissociation constant for binding to mitochondrial 12S rRNA construct M3 was determined	2002	Bioorganic & medicinal chemistry letters, Aug-19, Volume: 12, Issue:16	Decoding region bubble size and aminoglycoside antibiotic binding.
AID1241204	Inhibition of pre-miR-21 (unknown origin) cleavage assessed as reduction of oncogenic microRNAs biogenesis at 200 uM by measuring fluorescence every minute for 5 hrs using 5'-FAM,3'-dabcyl-pre-miRNA beacons by FRET assay in presence of recombinant Dicer	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID625279	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for bilirubinemia	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID584121	Antimicrobial activity against methicillin-resistant Staphylococcus aureus ST398 isolate 11 containing apmA, erm(B), tet(L), tet(M), tet(K), dfrK, aadD, mecA, blaZ resistance genes by CLSI M31-A3 method	2011	Antimicrobial agents and chemotherapy, Jan, Volume: 55, Issue:1	Novel apramycin resistance gene apmA in bovine and porcine methicillin-resistant Staphylococcus aureus ST398 isolates.
AID609437	Binding affinity to 2-AP labeled mutant RNA7 by fluorescence binding assay	2011	Bioorganic & medicinal chemistry letters, Aug-15, Volume: 21, Issue:16	Conjugate of neamine and 2-deoxystreptamine mimic connected by an amide bond.
AID1422369	Antibacterial activity against Pseudomonas aeruginosa PA22 harboring surexp MexXY by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID278528	Antimicrobial activity against Bifidobacterium longum ATCC 15708	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID523397	Antimicrobial activity against amikacin-susceptible Nocardia farcinica IFM 10152 harboring 16s rRNA A1408G mutant after 3 days by broth microdilution method	2010	Antimicrobial agents and chemotherapy, Jun, Volume: 54, Issue:6	Homozygous triplicate mutations in three 16S rRNA genes responsible for high-level aminoglycoside resistance in Nocardia farcinica clinical isolates from a Canada-wide bovine mastitis epizootic.
AID551746	Antibacterial activity against Staphylococcus aureus ATCC 25923 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID1232199	Binding affinity to HIV1 TAR RNA tetraloop mutant assessed as association constant at pH 6.8 by ethidium bromide displacement assay based Scatchard analysis method	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID65065	Percent killing of the total Escherichia coli K12 (ATCC 25868) cells at the C50 concentration was determined.	1987	Journal of medicinal chemistry, Feb, Volume: 30, Issue:2	Comparison of aminoglycoside antibiotics with respect to uptake and lethal activity in Escherichia coli.
AID774215	Antibacterial activity against Escherichia coli ATCC 25922 after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID1241216	Inhibition of pre-miR-372 (unknown origin) cleavage at C27 at 10 to 100 uM after 15 mins by RNase footprinting assay in presence of RNase-V1	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID534962	Antimicrobial activity against Prevotella disiens by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1246294	Resistance index, ratio of MIC for methicillin-resistant Staphylococcus aureus HEMSA to MIC for Staphylococcus aureus ATCC 25923	2015	European journal of medicinal chemistry, Aug-28, Volume: 101	Imidazolidine-4-one derivatives in the search for novel chemosensitizers of Staphylococcus aureus MRSA: synthesis, biological evaluation and molecular modeling studies.
AID301885	Binding affinity to Escherichia coli K12 stem-loop region L2-12 RNA aptamers using BIAcore 3000 instrument	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Elucidation of the RNA target of linezolid by using a linezolid-neomycin B heteroconjugate and genomic SELEX.
AID1330459	Binding affinity to poly(rA).(rU) RNA duplex (unknown origin) assessed as change in CD band intensity at 266 nanometer measured after 5 mins by circular dichroism titration method	2016	Bioorganic & medicinal chemistry letters, 12-15, Volume: 26, Issue:24	Linker dependent intercalation of bisbenzimidazole-aminosugars in an RNA duplex; selectivity in RNA vs. DNA binding.
AID582309	Inhibition of HIV1 Rev-radiolabeled Rev response element interaction after 10 mins by electrophoretic mobility shift assay	2008	Antimicrobial agents and chemotherapy, Sep, Volume: 52, Issue:9	Heterocyclic compounds that inhibit Rev-RRE function and human immunodeficiency virus type 1 replication.
AID275056	Antibacterial activity against Escherichia coli pTMV19 in presence of mevalonate	2006	Journal of medicinal chemistry, Dec-14, Volume: 49, Issue:25	Isoprenoid biosynthesis as a drug target: bisphosphonate inhibition of Escherichia coli K12 growth and synergistic effects of fosmidomycin.
AID283220	Antimicrobial activity against Pseudomonas aeruginosa PA0905	2007	Antimicrobial agents and chemotherapy, Mar, Volume: 51, Issue:3	Coproduction of novel 16S rRNA methylase RmtD and metallo-beta-lactamase SPM-1 in a panresistant Pseudomonas aeruginosa isolate from Brazil.
AID348085	Antibacterial activity against aminoglycoside-susceptible Staphylococcus aureus ATCC 25923 after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID1534838	Antibacterial activity against NEO-sensitive Escherichia coli ATCC 25922 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID534964	Antimicrobial activity against Prevotella intermedia by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID544058	Antimicrobial activity against Shigella flexneri isolate C506 harboring sul1 to sul3 genes assessed as antibiotic resistance breakpoint by agar dilution method	2009	Antimicrobial agents and chemotherapy, Feb, Volume: 53, Issue:2	Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.
AID551750	Antibacterial activity against Enterococcus faecalis ATCC 29212 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID535220	Antimicrobial activity against Actinomyces meyeri by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1422364	Antibacterial activity against Staphylococcus aureus ATCC 25923 by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID534932	Antimicrobial activity against Desulfovibrio fairfieldensis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID445939	Antibacterial activity against NorA pump expressing Staphylococcus aureus after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID644958	Binding affinity to human pre-hsa-mir-155 miRNA assessed as melting temperature at 2 uM (Rvb = 48 degC)	2012	Bioorganic & medicinal chemistry letters, Feb-15, Volume: 22, Issue:4	Pre-microRNA binding aminoglycosides and antitumor drugs as inhibitors of Dicer catalyzed microRNA processing.
AID301915	Antibacterial activity against aminoglycoside-resistant Escherichia coli TG1 pTZ19U-3 after 12 to 18 hrs	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Synthesis and antibacterial activity of pyranmycin derivatives with N-1 and O-6 modifications.
AID535216	Antimicrobial activity against Clostridium symbiosum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535198	Antimicrobial activity against Clostridium ramosum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID446117	Antibacterial activity against MsrA pump expressing Staphylococcus aureus after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID382892	Binding affinity to T box antiterminator RNA AM1A by FRET	2008	Bioorganic & medicinal chemistry, Apr-15, Volume: 16, Issue:8	Identification of neomycin B-binding site in T box antiterminator model RNA.
AID535490	Antimicrobial activity against Ruminococcus torques by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1905202	Antibacterial activity against MDR-methicillin-resistant Staphylococcus aureus ATCC BAA-44 assessed as reduction in bacterial growth measured after 18 hrs by broth microdilution method	2022	Journal of medicinal chemistry, 04-14, Volume: 65, Issue:7	Spermine-Conjugated Short Proline-Rich Lipopeptides as Broad-Spectrum Intracellular Targeting Antibacterial Agents.
AID1246257	Antimicrobial activity against methicillin-resistant Staphylococcus aureus HEMSA incubated for 20 hrs by serial dilution broth microplate method	2015	European journal of medicinal chemistry, Aug-28, Volume: 101	Imidazolidine-4-one derivatives in the search for novel chemosensitizers of Staphylococcus aureus MRSA: synthesis, biological evaluation and molecular modeling studies.
AID534956	Antimicrobial activity against Porphyromonas uenonis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535230	Antimicrobial activity against Bifidobacterium bifidum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534966	Antimicrobial activity against Prevotella loescheii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID65062	Lethal dose required to kill 90% of the Escherichia coli K12 (ATCC 25868) cell population	1987	Journal of medicinal chemistry, Feb, Volume: 30, Issue:2	Comparison of aminoglycoside antibiotics with respect to uptake and lethal activity in Escherichia coli.
AID446134	Antibacterial activity against MexEF expressing Pseudomonas aeruginosa PA03 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID348091	Antibacterial activity against Escherichia coli TG1 pET28a plasmid encoded for APH(3')-3a after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID414698	Resistance index, MIC for aminoglycosides-resistant Escherichia coli XL1-blue harboring pET9d expressing APH(3')-1a enzyme to MIC for Escherichia coli XL1-blue	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID534990	Antimicrobial activity against Clostridium bifermentans by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1064522	Antibacterial activity against Staphylococcus epidermidis H 6966/08 after 24 hrs by microdilution broth method	2014	Bioorganic & medicinal chemistry letters, Jan-15, Volume: 24, Issue:2	Alkylamino derivatives of pyrazinamide: synthesis and antimycobacterial evaluation.
AID1139965	Binding affinity to menin (unknown origin) assessed as thermal stability at 50 uM by differential scanning fluorimetry (Rvb = 40.46 degC)	2014	Bioorganic & medicinal chemistry letters, May-01, Volume: 24, Issue:9	Discovery of two aminoglycoside antibiotics as inhibitors targeting the menin-mixed lineage leukaemia interface.
AID1534870	Antibacterial activity against NEO-sensitive Staphylococcus aureus NRS77 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID523017	Activity at APH(3')-3a by PK/LDH-coupled assay in presence of ATP	2010	Antimicrobial agents and chemotherapy, May, Volume: 54, Issue:5	Nucleotide selectivity of antibiotic kinases.
AID1879368	Stabilization of [poly(dA).2poly(dT) triplex DNA (unknown origin) assessed as melting temperature at 20 uM by Thermal denaturation assay	2022	Bioorganic & medicinal chemistry letters, 04-01, Volume: 61	5-Substituted 3, 3', 4', 7-tetramethoxyflavonoids - A novel class of potent DNA triplex specific binding ligands.
AID514836	Binding affinity to Escherichia coli 16S rRNA helix 44 assessed as decrease in classical-state occupancy by tRNA at 20 uM by smFRET	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID288161	Antimicrobial activity against Staphylococcus epidermidis ATCC 12228 at 15 mg/ml after 24 hrs by micro dilution method	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID534994	Antimicrobial activity against Clostridium butyricum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535472	Antimicrobial activity against Peptoniphilus harei by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID446131	Antibacterial activity against ANT2'-2a expressing Escherichia coli L58058.1 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID513823	Binding affinity to Escherichia coli 16S rRNA helix 44 assessed as reduction in rate of tRNA exit from classical state at 100 nM	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID288162	Antimicrobial activity against Escherichia coli ATCC 25922 at 15 mg/ml after 24 hrs by micro dilution method	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID774220	Antibacterial activity against Acinetobacter lwoffii AI.88-483 expressing APH3'-6A after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID390916	Antibacterial activity against Escherichia coli ATCC 25922 after 24 hrs by macrobroth dilution method	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID560598	Antimicrobial activity against Escherichia coli JM109 transformant harboring pSTV28 plasmid by microdilution method	2009	Antimicrobial agents and chemotherapy, Jun, Volume: 53, Issue:6	AAC(6')-Iaf, a novel aminoglycoside 6'-N-acetyltransferase from multidrug-resistant Pseudomonas aeruginosa clinical isolates.
AID1422370	Antibacterial activity against Pseudomonas aeruginosa PA406 harboring triABC deletion mutant by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID481457	Antibacterial activity against Stenotrophomonas maltophilia CAN-ICU 62585 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID278529	Antimicrobial activity against Bifidobacterium longum R0175	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID390917	Antibacterial activity against gentamicin-resistant Escherichia coli ATCC 6174 after 24 hrs by macrobroth dilution method	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID2937	Dissociation constant with dimeric 16S rRNA RNA construct B	2001	Bioorganic & medicinal chemistry letters, Nov-19, Volume: 11, Issue:22	Novel synthesis and RNA-binding properties of aminoglycoside dimers conjugated via a naphthalene diimide-based intercalator.
AID535194	Antimicrobial activity against Clostridium nexile by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1232184	Induction of thermal stability changes in wild type HIV1 TAR RNA assessed as change in melting temperature using 1 molar equivalents of compound pre-incubated for 4 hrs at pH 6.8 at 4 degC before test by UV thermal denaturation assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID348092	Ratio of MIC for Escherichia coli TG1 to MIC for Escherichia coli TG1 pET28a plasmid encoded for APH(3')-3a	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID1704232	Antibacterial activity against Methicillin-resistant Staphylococcus aureus USA100 by CLSI-based microdilution method	2020	European journal of medicinal chemistry, Nov-15, Volume: 206	1,2,3-Triazole-containing hybrids with potential antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA).
AID534984	Antimicrobial activity against Clostridium aminobutyricum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID476929	Human intestinal absorption in po dosed human	2010	European journal of medicinal chemistry, Mar, Volume: 45, Issue:3	Neural computational prediction of oral drug absorption based on CODES 2D descriptors.
AID278803	Antimicrobial activity against recombinant Escherichia coli DHalpha expressing pBAD [aph(3')-2]	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Aph(3')-IIc, an aminoglycoside resistance determinant from Stenotrophomonas maltophilia.
AID551748	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 33591 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID535430	Antimicrobial activity against Eubacterium callanderi by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535208	Antimicrobial activity against Clostridium sp. by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278542	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium longum P/N 601377 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID188927	Average number of tumors per rat in colon large bowel tumorigenesis in rats fed with safflower oil diet(Group 1 diet)	1999	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 9, Issue:17	Fecal excretion pattern of bile acids in rats fed high fat diets and neomycin in induced colon tumorigenesis.
AID1710138	Selectivity index, ratio of Kd for 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) in presence of tRNA to Kd for 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAU	2021	ACS medicinal chemistry letters, Jun-10, Volume: 12, Issue:6	Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
AID1165218	Antibacterial activity against Bacillus subtilis MTCC 121 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID481454	Antibacterial activity against Escherichia coli CAN-ICU 63074 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID198299	Compound was evaluated for the apparent second-order binding constant (K) at a concentration of 90 uM to 5 mM	1999	Bioorganic & medicinal chemistry letters, Jan-18, Volume: 9, Issue:2	RNA-aminoglycoside antibiotic interactions: fluorescence detection of binding and conformational change.
AID535196	Antimicrobial activity against Clostridium paraputrificum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID625283	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for elevated liver function tests	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID535214	Antimicrobial activity against Clostridium subterminale by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID278532	Antimicrobial activity against Bifidobacterium thermophilum ATCC 25866	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID774214	Antibacterial activity against Escherichia coli PAZ505H8101 expressing AAC6'-1B after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID530052	Antimicrobial activity against Staphylococcus aureus RN4220 expressing gyrB D437N mutant gene by broth microdilution method	2008	Antimicrobial agents and chemotherapy, Aug, Volume: 52, Issue:8	Discovery and characterization of QPT-1, the progenitor of a new class of bacterial topoisomerase inhibitors.
AID514835	Binding affinity to Escherichia coli 16S rRNA helix 44 assessed as increase in classical-state occupancy by tRNA at 100 nM by smFRET	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID534980	Antimicrobial activity against Clostridium perfringens by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID348098	Antibacterial activity against vancomycin-resistant Enterococcus faecalis ATCC 51299 expressing vanB, ant(6)-1, aac(6')-aph(2') resistant gene after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID278553	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium longum ATCC 15708 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1848763	Cytotoxicity against mouse LLC cells assessed as reduction in cell viability	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Targeting Vancomycin-Resistant
AID1534834	Antibacterial activity against methicillin-resistant Staphylococcus aureus M0602 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID278544	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium thermophilum ATCC 25866 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID2939	Dissociation constant towards 16S rRNA construct B	2000	Bioorganic & medicinal chemistry letters, Jul-17, Volume: 10, Issue:14	Enhanced binding of aminoglycoside dimers to a "dimerized" A-site 16S rRNA construct.
AID544028	Antimicrobial activity against Acinetobacter lwoffii isolate C141 harboring sul1 to sul3 genes assessed as antibiotic resistance breakpoint by agar dilution method	2009	Antimicrobial agents and chemotherapy, Feb, Volume: 53, Issue:2	Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.
AID534958	Antimicrobial activity against Prevotella bivia by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID540931	Antimicrobial activity against paromomycin-resistant Streptomyces coelicolor SP1 harboring rpsL A262G and C271T mutant gene after 48 hrs	2009	Antimicrobial agents and chemotherapy, Mar, Volume: 53, Issue:3	A novel insertion mutation in Streptomyces coelicolor ribosomal S12 protein results in paromomycin resistance and antibiotic overproduction.
AID301918	Antibacterial activity against Klebsiella pneumoniae ATCC 13883 after 12 to 18 hrs	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Synthesis and antibacterial activity of pyranmycin derivatives with N-1 and O-6 modifications.
AID278808	Antibacterial activity against Pseudomonas aeruginosa ATCC 27853	2007	Antimicrobial agents and chemotherapy, Feb, Volume: 51, Issue:2	Overexpression and initial characterization of the chromosomal aminoglycoside 3'-O-phosphotransferase APH(3')-IIb from Pseudomonas aeruginosa.
AID551747	Antibacterial activity against Klebsiella pneumoniae ATCC 13883 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID414697	Antibacterial activity against aminoglycosides-resistant Escherichia coli XL1-blue harboring pET9d expressing APH(3')-1a enzyme by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID1534871	Antibacterial activity against NEO-sensitive Staphylococcus aureus 6538 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID1165220	Antibacterial activity against Micrococcus luteus MTC 2470 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID1241208	Inhibition of pre-miR-21 (unknown origin) cleavage assessed as reduction of oncogenic microRNAs biogenesis by measuring fluorescence every minute for 5 hrs using 5'-FAM,3'-dabcyl-pre-miRNA beacons by FRET assay in presence of recombinant Dicer	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID1232122	Antimicrobial activity against Staphylococcus aureus ATCC 25923 assessed as inhibition of bacterial growth incubated at 35 degC for 12 to 18 hrs	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Antifungal Amphiphilic Aminoglycosides.
AID1710136	Binding affinity to 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) assessed as dissociation constant incubated for overnight by fluorescence based assay	2021	ACS medicinal chemistry letters, Jun-10, Volume: 12, Issue:6	Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
AID1408007	Antibacterial activity against Escherichia coli ATCC 25922 measured after 12 to 18 hrs	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Tuning the biological activity of cationic anthraquinone analogues specifically toward Staphylococcus aureus.
AID428878	Binding affinity to 16S rRNA G1494(N7) position in A1408-methylated Escherichia coli JM109 30S sunit at 100 uM by footprint assay	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID278539	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium infantis ATCC 15697 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID534948	Antimicrobial activity against Fusobacterium sp. by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID348090	Ratio of kcat to Km of Enterococcus APH(3')-3a	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID199517	Compound was tested for the inhibition of Rev-RBE RNA complex formation	1998	Journal of medicinal chemistry, Jan-15, Volume: 41, Issue:2	Modeling RNA-ligand interactions: the Rev-binding element RNA-aminoglycoside complex.
AID278561	Antimicrobial activity against 90 mins hydrogen peroxide-stressed Bifidobacterium breve ATCC 15700 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID535200	Antimicrobial activity against Clostridium rectum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534938	Antimicrobial activity against Desulfovibrio sp. by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID390911	Antibacterial activity against Staphylococcus aureus ATCC 29213 after 24 hrs by macrobroth dilution method	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID523398	Antimicrobial activity against amikacin-susceptible Nocardia farcinica IFM 10152 harboring 16s rRNA A1408G mutant after 5 days by broth microdilution method	2010	Antimicrobial agents and chemotherapy, Jun, Volume: 54, Issue:6	Homozygous triplicate mutations in three 16S rRNA genes responsible for high-level aminoglycoside resistance in Nocardia farcinica clinical isolates from a Canada-wide bovine mastitis epizootic.
AID534950	Antimicrobial activity against Porphyromonas sp. by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535464	Antimicrobial activity against Anaerococcus prevotii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535454	Antimicrobial activity against Lactobacillus rhamnosus by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID166719	Tested for binding affinity against RNA construct E	2002	Bioorganic & medicinal chemistry letters, Feb-11, Volume: 12, Issue:3	Binding of aminoglycoside antibiotics with modified A-site 16S rRNA construct containing non-nucleotide linkers.
AID445938	Antibacterial activity against Staphylococcus aureus ATCC 25923 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID540927	Antimicrobial activity against Streptomyces coelicolor 1147 after 48 hrs	2009	Antimicrobial agents and chemotherapy, Mar, Volume: 53, Issue:3	A novel insertion mutation in Streptomyces coelicolor ribosomal S12 protein results in paromomycin resistance and antibiotic overproduction.
AID82136	Binding to 176-mer RNA from the packaging region of HIV-1 (LAI) and value of binding constant K is determined	2002	Bioorganic & medicinal chemistry letters, Feb-25, Volume: 12, Issue:4	Absorption studies on aminoglycoside binding to the packaging region of human immunodeficiency virus type-1.
AID535444	Antimicrobial activity against Lactobacillus catenaformis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1165221	Antibacterial activity against Klebsiella planticola MTCC 530 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID535186	Antimicrobial activity against Clostridium glycolicum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1139968	Binding affinity to menin (unknown origin) by isothermal titration calorimetry analysis	2014	Bioorganic & medicinal chemistry letters, May-01, Volume: 24, Issue:9	Discovery of two aminoglycoside antibiotics as inhibitors targeting the menin-mixed lineage leukaemia interface.
AID539120	Antibacterial activity against Staphylococcus aureus ATCC 13709	2010	Bioorganic & medicinal chemistry letters, Dec-01, Volume: 20, Issue:23	Structure-based design, synthesis and A-site rRNA co-crystal complexes of novel amphiphilic aminoglycoside antibiotics with new binding modes: a synergistic hydrophobic effect against resistant bacteria.
AID446142	Inhibition of protein synthesis in Pseudomonas aeruginosa ATCC 27853 assessed as decrease in incorporation of L-[4,5-3H]leucine at MIC by liquid scintillation counter relative to control	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID428872	Antibacterial activity against Escherichia coli JM109 carrying pMCL-BE by agar dilution method	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID82302	Tested for the ability to bind the HIV-1 RRE-RNA construct by fluorescence anisotropy	2001	Bioorganic & medicinal chemistry letters, May-07, Volume: 11, Issue:9	Binding of dimeric aminoglycosides to the HIV-1 rev responsive element (RRE) RNA construct.
AID609435	Binding affinity to 2-AP labeled RNA1 by fluorescence binding assay	2011	Bioorganic & medicinal chemistry letters, Aug-15, Volume: 21, Issue:16	Conjugate of neamine and 2-deoxystreptamine mimic connected by an amide bond.
AID1322255	Antibacterial activity against APH3'-VIA expressing Acinetobacter lwoffii AI.88-483 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID535188	Antimicrobial activity against Clostridium hastiforme by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID535228	Antimicrobial activity against Bifidobacterium adolescentis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1422376	Antibacterial activity against Klebsiella pneumoniae 700603 by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID1570828	Selectivity ratio of Kd for 5'-fluorescein-tagged human mitochondrial ribosomal A site wt-duplex RNA to Kd for 5'-fluorescein-tagged Escherichia coli ribosomal A site wt-bac duplex RNA	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID1165222	Antibacterial activity against Escherichia coli MTCC 739 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID278563	Antimicrobial activity against 90 mins hydrogen peroxide-stressed Bifidobacterium longum ATCC 15707 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID481449	Antibacterial activity against Staphylococcus epidermidis ATCC 1490 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID183796	Effect on colon small bowel tumorigenesis in rats fed with cholesterol and cholic acid diet(Group 2 diet)	1999	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 9, Issue:17	Fecal excretion pattern of bile acids in rats fed high fat diets and neomycin in induced colon tumorigenesis.
AID644957	Binding affinity to human pre-hsa-mir-155 miRNA assessed as melting temperature at 10 uM (Rvb = 48 degC)	2012	Bioorganic & medicinal chemistry letters, Feb-15, Volume: 22, Issue:4	Pre-microRNA binding aminoglycosides and antitumor drugs as inhibitors of Dicer catalyzed microRNA processing.
AID1422366	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 33592 by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID414694	Antibacterial activity against Escherichia coli XL1-blue by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID1241225	Binding affinity to 5'-FAM-pre-miR-372 (unknown origin) assessed as change in total free energy by thermodynamic assay	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID625288	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for jaundice	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID348093	Antibacterial activity against ampicillin-resistant and aminoglycosides-susceptible Klebsiella pneumoniae ATCC 13883 after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID534974	Antimicrobial activity against Clostridium hathewayi by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID544004	Antimicrobial activity against Aerococcus viridans isolate PGS22 harboring sul1 to sul3 genes assessed as antibiotic resistance breakpoint by agar dilution method	2009	Antimicrobial agents and chemotherapy, Feb, Volume: 53, Issue:2	Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.
AID301886	Binding affinity to Escherichia coli K12 stem-loop region L2-11 RNA aptamers using BIAcore 3000 instrument	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Elucidation of the RNA target of linezolid by using a linezolid-neomycin B heteroconjugate and genomic SELEX.
AID1241210	Binding affinity to 5'-FAM-pre-miR-17 (unknown origin) after 4 hrs by fluorescence assay	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID275055	Antibacterial activity against Escherichia coli pTMV19	2006	Journal of medicinal chemistry, Dec-14, Volume: 49, Issue:25	Isoprenoid biosynthesis as a drug target: bisphosphonate inhibition of Escherichia coli K12 growth and synergistic effects of fosmidomycin.
AID1848764	Hemolytic activity in human RBC at 50 ug/ml	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Targeting Vancomycin-Resistant
AID288159	Antimicrobial activity against Micrococcus luteus ATCC 9341 at 15 mg/ml after 24 hrs by micro dilution method	2007	Bioorganic & medicinal chemistry, Jun-01, Volume: 15, Issue:11	Aminoglycoside antibiotic derivatives: preparation and evaluation of toxicity on cochlea and vestibular tissues and antimicrobial activity.
AID774216	Antibacterial activity against Klebsiella pneumoniae ATCC 700603 after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID534734	Antimicrobial activity against Bilophila wadsworthia by Wadsworth agar dilution method in presence of 1% pyruvic acid	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1570821	Binding affinity to 5'-fluorescein-tagged human mitochondrial ribosomal A site wt-duplex RNA incubated for 2 mins by fluorescence spectrophotometric analysis	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID673458	Inhibition of Tdp1	2012	Journal of medicinal chemistry, 05-10, Volume: 55, Issue:9	Synthesis and biological evaluation of the first dual tyrosyl-DNA phosphodiesterase I (Tdp1)-topoisomerase I (Top1) inhibitors.
AID1422372	Antibacterial activity against Acinetobacter lwoffii AI.88-483 harboring APH3'-6A by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID613696	Binding affinity to HIV1 TAR RNA assessed as change in melting temperature at HIV1 TAR RNA to compound ratio of 1 at pH 6.8 by UV thermal denaturation assay	2011	Bioorganic & medicinal chemistry letters, Aug-15, Volume: 21, Issue:16	Recognition of HIV TAR RNA by triazole linked neomycin dimers.
AID1570831	Binding affinity to 5'-fluorescein-tagged Escherichia coli ribosomal A site wt-bac duplex RNA assessed as conformational change in RNA by measuring decrease in fluorescence intensity incubated for 2 mins by fluorescence spectrophotometric analysis	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID535448	Antimicrobial activity against Lactobacillus jensenii by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID534732	Antimicrobial activity against Bacteroides uniformis by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID513838	Binding affinity to Escherichia coli 16S rRNA helix 44 assessed as tRNA translocation rate at 100 nM (Rvb= 1.57+/-0.05 /sec)	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID99721	Compound tested in vitro for inhibition of translation using highly active Escherichia coli S30 and a plasmid containing a gene expressing truncated lecithin retinol acyltransferase	2003	Bioorganic & medicinal chemistry letters, Mar-10, Volume: 13, Issue:5	Synthesis of (+),(-)-neamine and their positional isomers as potential antibiotics.
AID534940	Antimicrobial activity against Fusobacterium nucleatum by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID414690	Antibacterial activity against kanamycin-resistant Escherichia coli AG100B expressing aminoglycosides resistant APH(3')-1 enzyme by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID535436	Antimicrobial activity against Eubacterium rectale by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID514832	Binding affinity to Escherichia coli 23S rRNA assessed as decrease in classical-state occupancy by tRNA at 20 uM by smFRET	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID1139967	Binding affinity to menin (unknown origin) assessed as thermal stability at 400 uM by differential scanning fluorimetry (Rvb = 40.46 degC)	2014	Bioorganic & medicinal chemistry letters, May-01, Volume: 24, Issue:9	Discovery of two aminoglycoside antibiotics as inhibitors targeting the menin-mixed lineage leukaemia interface.
AID1769490	Binding affinity to salmon DNA groove measured after 30 mins by UV based spectroscopic method
AID1443980	Inhibition of human BSEP expressed in fall armyworm sf9 cell plasma membrane vesicles assessed as reduction in vesicle-associated [3H]-taurocholate transport preincubated for 10 mins prior to ATP addition measured after 15 mins in presence of [3H]-tauroch	2010	Toxicological sciences : an official journal of the Society of Toxicology, Dec, Volume: 118, Issue:2	Interference with bile salt export pump function is a susceptibility factor for human liver injury in drug development.
AID529885	Antibacterial activity against Staphylococcus aureus RN4220 by broth microdilution method	2008	Antimicrobial agents and chemotherapy, Aug, Volume: 52, Issue:8	Discovery and characterization of QPT-1, the progenitor of a new class of bacterial topoisomerase inhibitors.
AID535246	Antimicrobial activity against Colinsella aerofaciens by Wadsworth agar dilution method	2009	Antimicrobial agents and chemotherapy, Jan, Volume: 53, Issue:1	Study of the in vitro activities of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora.
AID1422377	Cytotoxicity against mouse J774 cells assessed as cell viability at 10 uM after 24 hrs by MTT assay relative to control	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID560249	Antibacterial activity against Staphylococcus aureus RN4220 harboring tet(L), dfrK gene by CLSI method	2009	Antimicrobial agents and chemotherapy, Aug, Volume: 53, Issue:8	Novel ABC transporter gene, vga(C), located on a multiresistance plasmid from a porcine methicillin-resistant Staphylococcus aureus ST398 strain.
AID1534869	Antibacterial activity against NEO-sensitive Staphylococcus aureus C1 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID446128	Antibacterial activity against Klebsiella pneumoniae ATCC 700603 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID774223	Antibacterial activity against healthcare-acquired methicillin-resistant Staphylococcus aureus ATCC 33592 after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID625284	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for hepatic failure	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID278525	Antimicrobial activity against Bifidobacterium breve ATCC 15700	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID440547	Antibacterial activity against Klebsiella pneumoniae ATCC 700603	2009	Journal of medicinal chemistry, Dec-10, Volume: 52, Issue:23	Discovery of Trp-His and His-Arg analogues as new structural classes of short antimicrobial peptides.
AID166713	Tested for binding affinity against RNA construct B	2002	Bioorganic & medicinal chemistry letters, Feb-11, Volume: 12, Issue:3	Binding of aminoglycoside antibiotics with modified A-site 16S rRNA construct containing non-nucleotide linkers.
AID65071	Estimated rate of [3H]DHS uptake in Escherichia coli K12 (ATCC 25868)	1987	Journal of medicinal chemistry, Feb, Volume: 30, Issue:2	Comparison of aminoglycoside antibiotics with respect to uptake and lethal activity in Escherichia coli.
AID446132	Antibacterial activity against Pseudomonas aeruginosa PAO1 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID625280	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for cholecystitis	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID544027	Antimicrobial activity against Acinetobacter rhizosphaerae isolate C44 harboring sul1 to sul3 genes assessed as antibiotic resistance breakpoint by agar dilution method	2009	Antimicrobial agents and chemotherapy, Feb, Volume: 53, Issue:2	Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.
AID588211	Literature-mined compound from Fourches et al multi-species drug-induced liver injury (DILI) dataset, effect in humans	2010	Chemical research in toxicology, Jan, Volume: 23, Issue:1	Cheminformatics analysis of assertions mined from literature that describe drug-induced liver injury in different species.
AID339764	Binding affinity to synthetic poly(dA):poly(rU) DNA:RNA hybrid assessed as association constant at 20 degC	2008	Bioorganic & medicinal chemistry letters, Jul-15, Volume: 18, Issue:14	Molecular recognition of a DNA:RNA hybrid: sub-nanomolar binding by a neomycin-methidium conjugate.
AID774229	Antibacterial activity against fluoroquinolone-resistant Staphylococcus aureus 1199B expressing NorA efflux pump after 24 hrs by geometric microdilution method	2013	Journal of medicinal chemistry, Oct-10, Volume: 56, Issue:19	Tuning the antibacterial activity of amphiphilic neamine derivatives and comparison to paromamine homologues.
AID1322256	Antibacterial activity against Escherichia coli ATCC 25922 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.
AID278533	Antimicrobial activity against Bifidobacterium breve R0070	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID513835	Binding affinity to Escherichia coli 23S rRNA H69 assessed as classical-state occupancy by tRNA at 20 uM (Rvb= 62.4+/-1.1%)	2010	Nature chemical biology, Jan, Volume: 6, Issue:1	Aminoglycoside activity observed on single pre-translocation ribosome complexes.
AID1165217	Antibacterial activity against Staphylococcus aureus MTCC 96 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID339753	Binding affinity to synthetic poly(rA):poly(rU) RNA:RNA duplex assessed as melting temperature at 2.2 uM	2008	Bioorganic & medicinal chemistry letters, Jul-15, Volume: 18, Issue:14	Molecular recognition of a DNA:RNA hybrid: sub-nanomolar binding by a neomycin-methidium conjugate.
AID1704235	Antibacterial activity against Methicillin-resistant Staphylococcus aureus USA600 by CLSI-based microdilution method	2020	European journal of medicinal chemistry, Nov-15, Volume: 206	1,2,3-Triazole-containing hybrids with potential antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA).
AID1408009	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 33591 measured after 12 to 18 hrs	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Tuning the biological activity of cationic anthraquinone analogues specifically toward Staphylococcus aureus.
AID183794	Effect on colon large bowel tumorigenesis in rats fed with cholesterol and cholic acid diet(Group 2 diet)	1999	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 9, Issue:17	Fecal excretion pattern of bile acids in rats fed high fat diets and neomycin in induced colon tumorigenesis.
AID773388	Thermal stabilization of HIV TAR RNA assessed as change in melting temperature at 1:1 ligand to RNA ratio by UV-vis spectrophotometric analysis	2013	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 23, Issue:20	Recognition of HIV-TAR RNA using neomycin-benzimidazole conjugates.
AID1232201	Binding affinity to HIV1 TAR RNA U3 bulge mutant at assessed as association constant at pH 6.8 by ethidium bromide displacement assay based Scatchard analysis method	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID1422371	Antibacterial activity against Acinetobacter lwoffii ATCC 17925 by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID278560	Antimicrobial activity against 90 mins hydrogen peroxide-stressed Bifidobacterium bifidum BB12 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID278534	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium animalis ATCC 27536 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID446118	Antibacterial activity against aminoglycoside-6'-N-acetyltransferase/2''-O-phosphoryltransferase expressing Staphylococcus aureus after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID339766	Binding affinity to synthetic poly(dA-dT):poly(dA-dT) DNA:DNA duplex assessed as association constant at 20 degC	2008	Bioorganic & medicinal chemistry letters, Jul-15, Volume: 18, Issue:14	Molecular recognition of a DNA:RNA hybrid: sub-nanomolar binding by a neomycin-methidium conjugate.
AID1165223	Antibacterial activity against Pseudomonas aeruginosa MTCC 2453 after 24 hrs by well diffusion method	2014	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 24, Issue:20	Synthesis of novel benzimidazole functionalized chiral thioureas and evaluation of their antibacterial and anticancer activities.
AID1704236	Antibacterial activity against wild type Methicillin-resistant Staphylococcus aureus by CLSI-based microdilution method	2020	European journal of medicinal chemistry, Nov-15, Volume: 206	1,2,3-Triazole-containing hybrids with potential antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA).
AID1064507	Antibacterial activity against Staphylococcus epidermidis H 6966/08 after 48 hrs by microdilution broth method	2014	Bioorganic & medicinal chemistry letters, Jan-15, Volume: 24, Issue:2	Alkylamino derivatives of pyrazinamide: synthesis and antimycobacterial evaluation.
AID446119	Antibacterial activity against aminoglycoside-3'-O-phosphoryltransferase expressing Staphylococcus aureus after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID275054	Antibacterial activity against Escherichia coli W3110	2006	Journal of medicinal chemistry, Dec-14, Volume: 49, Issue:25	Isoprenoid biosynthesis as a drug target: bisphosphonate inhibition of Escherichia coli K12 growth and synergistic effects of fosmidomycin.
AID1232197	Binding affinity to wild type HIV1 TAR RNA assessed as association constant at pH 6.8 by ethidium bromide displacement assay based Scatchard analysis method	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID278537	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium breve ATCC 15700 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID530051	Antimicrobial activity against Staphylococcus aureus 286607-R1 harboring wild type gyrB by broth microdilution method	2008	Antimicrobial agents and chemotherapy, Aug, Volume: 52, Issue:8	Discovery and characterization of QPT-1, the progenitor of a new class of bacterial topoisomerase inhibitors.
AID357302	Antibacterial activity against Staphylococcus aureus at 30 ug after overnight incubation by agar diffusion method	2001	Journal of natural products, Aug, Volume: 64, Issue:8	Dicerandrols, new antibiotic and cytotoxic dimers produced by the fungus Phomopsis longicolla isolated from an endangered mint.
AID1232187	Induction of thermal stability changes in HIV1 TAR RNA bulgeless mutant assessed as change in melting temperature using 1 molar equivalents of compound pre-incubated for 4 hrs at pH 6.8 at 4 degC before test by UV thermal denaturation assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID731207	Antibacterial activity against Staphylococcus aureus ATCC 25923 assessed as membrane disruption at 4 X MIC after 2 hrs by SYTOX staining-based fluorescence microscopic analysis	2013	Bioorganic & medicinal chemistry letters, Mar-15, Volume: 23, Issue:6	Investigation of antibacterial mode of action for traditional and amphiphilic aminoglycosides.
AID278527	Antimicrobial activity against Bifidobacterium longum ATCC 15707	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID390913	Antibacterial activity against Staphylococcus epidermidis ATCC 1490 after 24 hrs by macrobroth dilution method	2008	Journal of medicinal chemistry, Oct-09, Volume: 51, Issue:19	Design, synthesis, and antibacterial activities of neomycin-lipid conjugates: polycationic lipids with potent gram-positive activity.
AID731211	Antibacterial activity against Staphylococcus aureus ATCC 25923 assessed as growth inhibition	2013	Bioorganic & medicinal chemistry letters, Mar-15, Volume: 23, Issue:6	Investigation of antibacterial mode of action for traditional and amphiphilic aminoglycosides.
AID348087	Antibacterial activity against Escherichia coli TG1 pSF815 plasmid encoded for AAC(6')/APH(2') after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID301912	Antibacterial activity against Escherichia coli ATCC 25922 after 12 to 18 hrs	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Synthesis and antibacterial activity of pyranmycin derivatives with N-1 and O-6 modifications.
AID339765	Binding affinity to synthetic poly(rA):poly(rU) DNA:RNA hybrid assessed as association constant at 20 degC	2008	Bioorganic & medicinal chemistry letters, Jul-15, Volume: 18, Issue:14	Molecular recognition of a DNA:RNA hybrid: sub-nanomolar binding by a neomycin-methidium conjugate.
AID560247	Antibacterial activity against Staphylococcus aureus RN4220 by CLSI method	2009	Antimicrobial agents and chemotherapy, Aug, Volume: 53, Issue:8	Novel ABC transporter gene, vga(C), located on a multiresistance plasmid from a porcine methicillin-resistant Staphylococcus aureus ST398 strain.
AID238131	Binding dissociation constant towards 3'-Fl-AM1A-Rhd in Bacillus subtilis tyrS	2005	Bioorganic & medicinal chemistry letters, Apr-15, Volume: 15, Issue:8	Fluorescence resonance energy transfer studies of aminoglycoside binding to a T box antiterminator RNA.
AID1422368	Antibacterial activity against Pseudomonas aeruginosa FO3 harboring AAC6'-2A by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID460286	Antibacterial activity against aminoglycoside-susceptible Staphylococcus aureus ATCC 25923 after 12 to 18 hrs	2010	Bioorganic & medicinal chemistry, Feb-15, Volume: 18, Issue:4	Synthesis of novel aminoglycosides via allylic azide rearrangement for investigating the significance of 2'-amino group.
AID1566486	Binding affinity to biotinylated pre-miRNA-21 (unknown origin) by SPR analysis	2019	ACS medicinal chemistry letters, May-09, Volume: 10, Issue:5	Tetracyclines as Inhibitors of Pre-microRNA Maturation: A Disconnection between RNA Binding and Inhibition.
AID446145	Binding affinity to bacterial rRNA A site at 200 uM by isothermal titration calorimetry	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID278545	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium animalis ATCC 27536 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1534837	Antibacterial activity against NEO-sensitive Mycobacterium smegmatis after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID278540	Antimicrobial activity against 60 min 1 M HCl-stressed Bifidobacterium longum ATCC 15707 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1570822	Binding affinity to 5'-fluorescein-tagged human mitochondrial ribosome A site mutant duplex RNA incubated for 2 mins by fluorescence spectrophotometry analysis	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID1241205	Inhibition of pre-miR-372 (unknown origin) cleavage assessed as reduction of oncogenic microRNAs biogenesis by measuring fluorescence every minute for 5 hrs using 5'-FAM,3'-dabcyl-pre-miRNA beacons by FRET assay in presence of recombinant Dicer	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID446135	Antibacterial activity against MexAB expressing Pseudomonas aeruginosa PA21 after 24 hrs by geometric microdilution method	2010	Journal of medicinal chemistry, Jan-14, Volume: 53, Issue:1	Synthesis and antimicrobial evaluation of amphiphilic neamine derivatives.
AID301917	Antibacterial activity against Klebsiella pneumoniae ATCC 700603 after 12 to 18 hrs	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Synthesis and antibacterial activity of pyranmycin derivatives with N-1 and O-6 modifications.
AID502926	Binding affinity to phosphatidylinositol 4,5-bisphosphate liposome assessed as dynamin2-stimulated GTP hydrolysis at 250 uM by scintillation counting	2006	Nature chemical biology, Jan, Volume: 2, Issue:1	Secramine inhibits Cdc42-dependent functions in cells and Cdc42 activation in vitro.
AID625285	Drug Induced Liver Injury Prediction System (DILIps) training set; hepatic side effect (HepSE) score for hepatic necrosis	2011	PLoS computational biology, Dec, Volume: 7, Issue:12	Translating clinical findings into knowledge in drug safety evaluation--drug induced liver injury prediction system (DILIps).
AID183795	Effect on colon large bowel tumorigenesis in rats fed with safflower oil diet(Group 1 diet)	1999	Bioorganic & medicinal chemistry letters, Sep-06, Volume: 9, Issue:17	Fecal excretion pattern of bile acids in rats fed high fat diets and neomycin in induced colon tumorigenesis.
AID523396	Antimicrobial activity against amikacin-resistant Nocardia farcinica IFM 10580 after 3 days by broth microdilution method	2010	Antimicrobial agents and chemotherapy, Jun, Volume: 54, Issue:6	Homozygous triplicate mutations in three 16S rRNA genes responsible for high-level aminoglycoside resistance in Nocardia farcinica clinical isolates from a Canada-wide bovine mastitis epizootic.
AID1232127	Antimicrobial activity against Fusarium graminearum B4-5A using RPMI medium by microbroth dilution assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Antifungal Amphiphilic Aminoglycosides.
AID1534836	Antibacterial activity against NEO-sensitive Bacillus anthracis BA852 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID301916	Antibacterial activity against methicillin-resistant Staphylococcus aureus ATCC 33591 after 12 to 18 hrs	2007	Bioorganic & medicinal chemistry, Dec-15, Volume: 15, Issue:24	Synthesis and antibacterial activity of pyranmycin derivatives with N-1 and O-6 modifications.
AID1232126	Antimicrobial activity against Pseudomonas aeruginosa ATCC 27853 assessed as inhibition of bacterial growth incubated at 35 degC for 12 to 18 hrs	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Antifungal Amphiphilic Aminoglycosides.
AID278804	Antimicrobial activity against recombinant Escherichia coli DH5-alpha expressing pBAD [aph(3')-2] in the presence of arabinose	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Aph(3')-IIc, an aminoglycoside resistance determinant from Stenotrophomonas maltophilia.
AID339754	Binding affinity to synthetic poly(dA):poly(rU) DNA:RNA hybrid assessed as melting temperature at 2.2 uM	2008	Bioorganic & medicinal chemistry letters, Jul-15, Volume: 18, Issue:14	Molecular recognition of a DNA:RNA hybrid: sub-nanomolar binding by a neomycin-methidium conjugate.
AID560250	Antibacterial activity against Staphylococcus aureus RN4220 harboring aadD and tet(L) gene by CLSI method	2009	Antimicrobial agents and chemotherapy, Aug, Volume: 53, Issue:8	Novel ABC transporter gene, vga(C), located on a multiresistance plasmid from a porcine methicillin-resistant Staphylococcus aureus ST398 strain.
AID278554	Antimicrobial activity against 90 mins oxgall-stressed Bifidobacterium longum R0175 after 18 hrs	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Antibiotic susceptibility profile of bifidobacteria as affected by oxgall, acid, and hydrogen peroxide stress.
AID1534832	Antibacterial activity against methicillin-resistant Staphylococcus aureus A960649 after 15 to 20 hrs by CLSI protocol based microdilution assay	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID1422375	Antibacterial activity against Escherichia coli L8058.1 harboring ANT2'-1A by microdilution assay	2018	European journal of medicinal chemistry, Sep-05, Volume: 157	Broad-spectrum antibacterial amphiphilic aminoglycosides: A new focus on the structure of the lipophilic groups extends the series of active dialkyl neamines.
AID481450	Antibacterial activity against methicillin-resistant Staphylococcus epidermidis ATCC 14990 after 24 hrs by macrobroth dilution method	2010	Journal of medicinal chemistry, May-13, Volume: 53, Issue:9	Antibacterial activities of aminoglycoside antibiotics-derived cationic amphiphiles. Polyol-modified neomycin B-, kanamycin A-, amikacin-, and neamine-based amphiphiles with potent broad spectrum antibacterial activity.
AID1710140	Selectivity index, ratio of Kd for 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) in presence of double stranded 15-mer 5'-CGTTTTTATTTTTGC-3' DNA to Kd for 5'-FAM/3'-DAB-labeled	2021	ACS medicinal chemistry letters, Jun-10, Volume: 12, Issue:6	Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
AID92477	Maximal inhibition of the aminoglycoside on Staphylococcus aureus IF-2 binding to fMet-tRNA(fMet)	2003	Bioorganic & medicinal chemistry letters, Mar-24, Volume: 13, Issue:6	Inhibition of bacterial IF2 binding to fMet-tRNA((fMet)) by aminoglycosides.
AID1534863	Inhibition of AAC(3)-4 (unknown origin)	2019	European journal of medicinal chemistry, Feb-01, Volume: 163	Synthesis, antimicrobial activity, attenuation of aminoglycoside resistance in MRSA, and ribosomal A-site binding of pyrene-neomycin conjugates.
AID1241224	Inhibition of pre-miR-372 (unknown origin) cleavage at U28 at 1 to 100 uM after 2 hrs by denaturing gel electrophoresis in presence of recombinant Dicer	2015	Bioorganic & medicinal chemistry, Sep-01, Volume: 23, Issue:17	Ribosome-targeting antibiotics as inhibitors of oncogenic microRNAs biogenesis: Old scaffolds for new perspectives in RNA targeting.
AID414701	Resistance index, MIC for aminoglycosides-resistant Escherichia coli BL21 harboring pETSACG1 expressing APH(3')-3a enzyme to MIC for Escherichia coli BL21	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID551749	Antibacterial activity against Pseudomonas aeruginosa ATCC 27853 after 12 to 18 hrs by twofold dilution method	2011	Bioorganic & medicinal chemistry, Jan-01, Volume: 19, Issue:1	Synthesis and antibacterial activity study of a novel class of cationic anthraquinone analogs.
AID1232190	Induction of thermal stability changes in HIV1 TAR RNA U3 bulge mutant assessed as change in melting temperature using 2 molar equivalents of compound pre-incubated for 4 hrs at pH 6.8 at 4 degC before test by UV thermal denaturation assay	2014	MedChemComm, Aug-01, Volume: 5, Issue:8	Multivalent Amino Sugars to Recognize Different TAR RNA Conformations.
AID348097	Antibacterial activity against vancomycin-susceptible and aminoglycosides-resistant Enterococcus faecalis ATCC 29212 after 12 to 18 hrs	2008	Journal of medicinal chemistry, Dec-11, Volume: 51, Issue:23	Surprising alteration of antibacterial activity of 5"-modified neomycin against resistant bacteria.
AID414700	Antibacterial activity against aminoglycosides-resistant Escherichia coli BL21 harboring pETSACG1 expressing APH(3')-3a enzyme by double-microdilution method	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID644956	Binding affinity to human pre-hsa-mir-155 miRNA assessed as melting temperature at 12 uM (Rvb = 48 degC)	2012	Bioorganic & medicinal chemistry letters, Feb-15, Volume: 22, Issue:4	Pre-microRNA binding aminoglycosides and antitumor drugs as inhibitors of Dicer catalyzed microRNA processing.
AID1570827	Selectivity ratio of IC50 for anti-ribosomal activity against human-bacterial hybrid ribosome containing human mitochondrial ribosome A site harboring wild type 12s rRNA to IC50 for anti-ribosomal activity against bacterial 70S hybrid ribosomes	2019	Bioorganic & medicinal chemistry, 11-15, Volume: 27, Issue:22	Use of a fluorescence assay to determine relative affinities of semisynthetic aminoglycosides to small RNAs representing bacterial and mitochondrial A sites.
AID278801	Antimicrobial activity against recombinant Escherichia coli DH5alpha expressing pBAD	2007	Antimicrobial agents and chemotherapy, Jan, Volume: 51, Issue:1	Aph(3')-IIc, an aminoglycoside resistance determinant from Stenotrophomonas maltophilia.
AID414705	Inhibition of Escherichia coli topoisomerase 4 assessed as reduction in supercoiled pBR322 DNA relaxation activity after 30 mins by electrophoresis	2009	Journal of medicinal chemistry, Apr-23, Volume: 52, Issue:8	Design, synthesis, and evaluation of novel fluoroquinolone-aminoglycoside hybrid antibiotics.
AID1879372	Binding affinity to triplex DNA1 containing 15 nucleotide-long triplex-forming region (unknown origin) at 100 uM by ITC	2022	Bioorganic & medicinal chemistry letters, 04-01, Volume: 61	5-Substituted 3, 3', 4', 7-tetramethoxyflavonoids - A novel class of potent DNA triplex specific binding ligands.
AID428871	Antibacterial activity against Escherichia coli CSH-2 by agar dilution method	2007	Antimicrobial agents and chemotherapy, Dec, Volume: 51, Issue:12	Novel plasmid-mediated 16S rRNA m1A1408 methyltransferase, NpmA, found in a clinically isolated Escherichia coli strain resistant to structurally diverse aminoglycosides.
AID609433	Binding affinity to 2-AP labeled mutant RNA3 by fluorescence binding assay	2011	Bioorganic & medicinal chemistry letters, Aug-15, Volume: 21, Issue:16	Conjugate of neamine and 2-deoxystreptamine mimic connected by an amide bond.
AID1322249	Antibacterial activity against healthcare-acquired methicillin-resistant Staphylococcus aureus ATCC 33592 by microdilution method	2016	Journal of medicinal chemistry, Oct-27, Volume: 59, Issue:20	New Broad-Spectrum Antibacterial Amphiphilic Aminoglycosides Active against Resistant Bacteria: From Neamine Derivatives to Smaller Neosamine Analogues.

Timeframe	Studies, This Drug (%)	All Drugs %
pre-1990	4975 (65.58)	18.7374
1990's	1033 (13.62)	18.2507
2000's	855 (11.27)	29.6817
2010's	590 (7.78)	24.3611
2020's	133 (1.75)	2.80
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Publication Type	This drug (%)	All Drugs (%)
Trials	460 (5.64%)	5.53%
Reviews	246 (3.02%)	6.00%
Case Studies	305 (3.74%)	4.05%
Observational	6 (0.07%)	0.25%
Other	7,134 (87.52%)	84.16%
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Substance	Relationship Strength	Studies	Trials	Classes	Roles
dinitrochlorobenzene Dinitrochlorobenzene: A skin irritant that may cause dermatitis of both primary and allergic types. Contact sensitization with DNCB has been used as a measure of cellular immunity. DNCB is also used as a reagent for the detection and determination of pyridine compounds.. 1-chloro-2,4-dinitrobenzene : A C-nitro compound that is chlorobenzene carrying a nitro substituent at each of the 2- and 4-positions.	1.98	1	0	C-nitro compound; monochlorobenzenes	allergen; epitope; sensitiser
2,3-diphosphoglycerate 2,3-Diphosphoglycerate: A highly anionic organic phosphate which is present in human red blood cells at about the same molar ratio as hemoglobin. It binds to deoxyhemoglobin but not the oxygenated form, therefore diminishing the oxygen affinity of hemoglobin. This is essential in enabling hemoglobin to unload oxygen in tissue capillaries. It is also an intermediate in the conversion of 3-phosphoglycerate to 2-phosphoglycerate by phosphoglycerate mutase (EC 5.4.2.1). (From Stryer Biochemistry, 4th ed, p160; Enzyme Nomenclature, 1992, p508). 2,3-bisphosphoglyceric acid : A bisphosphoglyceric acid that is glyceric acid carrying two phospho substituents at positions 2 and 3.	2.38	2	0	bisphosphoglyceric acid; tetronic acid derivative	human metabolite
dihydro-3-coumaric acid dihydro-3-coumaric acid: intermediate in biosynthesis of dihydrophenanthrenes from phenylalanine. 3-(3-hydroxyphenyl)propanoic acid : A monocarboxylic acid that is propionic acid carrying a 3-hydroxyphenyl substituent at C-3.	1.98	1	0	monocarboxylic acid	Escherichia coli metabolite; human xenobiotic metabolite
gamma-aminobutyric acid gamma-Aminobutyric Acid: The most common inhibitory neurotransmitter in the central nervous system.. gamma-aminobutyric acid : A gamma-amino acid that is butanoic acid with the amino substituent located at C-4.	3.49	8	0	amino acid zwitterion; gamma-amino acid; monocarboxylic acid	human metabolite; neurotransmitter; Saccharomyces cerevisiae metabolite; signalling molecule
aminolevulinic acid Aminolevulinic Acid: A compound produced from succinyl-CoA and GLYCINE as an intermediate in heme synthesis. It is used as a PHOTOCHEMOTHERAPY for actinic KERATOSIS.. 5-aminolevulinic acid : The simplest delta-amino acid in which the hydrogens at the gamma position are replaced by an oxo group. It is metabolised to protoporphyrin IX, a photoactive compound which accumulates in the skin. Used (in the form of the hydrochloride salt)in combination with blue light illumination for the treatment of minimally to moderately thick actinic keratosis of the face or scalp.	1.95	1	0	4-oxo monocarboxylic acid; amino acid zwitterion; delta-amino acid	antineoplastic agent; dermatologic drug; Escherichia coli metabolite; human metabolite; mouse metabolite; photosensitizing agent; plant metabolite; prodrug; Saccharomyces cerevisiae metabolite
acetic acid Acetic Acid: Product of the oxidation of ethanol and of the destructive distillation of wood. It is used locally, occasionally internally, as a counterirritant and also as a reagent. (Stedman, 26th ed). acetic acid : A simple monocarboxylic acid containing two carbons.	8.05	16	3	monocarboxylic acid	antimicrobial food preservative; Daphnia magna metabolite; food acidity regulator; protic solvent
acetaldehyde Acetaldehyde: A colorless, flammable liquid used in the manufacture of acetic acid, perfumes, and flavors. It is also an intermediate in the metabolism of alcohol. It has a general narcotic action and also causes irritation of mucous membranes. Large doses may cause death from respiratory paralysis.. acetaldehyde : The aldehyde formed from acetic acid by reduction of the carboxy group. It is the most abundant carcinogen in tobacco smoke.. aldehyde : A compound RC(=O)H, in which a carbonyl group is bonded to one hydrogen atom and to one R group.. acetyl group : A group, formally derived from acetic acid by dehydroxylation, which is fundamental to the biochemistry of all forms of life. When bound to coenzyme A, it is central to the metabolism of carbohydrates and fats.	2.69	3	0	aldehyde	carcinogenic agent; EC 3.5.1.4 (amidase) inhibitor; electron acceptor; Escherichia coli metabolite; human metabolite; mouse metabolite; mutagen; oxidising agent; Saccharomyces cerevisiae metabolite; teratogenic agent
acetamide acetimidic acid : A carboximidic acid that is acetic acid in which the carbonyl oxygen is replaced by an imino group.	2.05	1	0	acetamides; carboximidic acid; monocarboxylic acid amide; N-acylammonia
acetone methyl ketone : A ketone of formula RC(=O)CH3 (R =/= H).	2.64	3	0	ketone body; methyl ketone; propanones; volatile organic compound	EC 3.5.1.4 (amidase) inhibitor; human metabolite; polar aprotic solvent
adenine [no description available]	3.93	13	0	6-aminopurines; purine nucleobase	Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
allantoin [no description available]	2.37	2	0	imidazolidine-2,4-dione; ureas	Escherichia coli metabolite; human metabolite; Saccharomyces cerevisiae metabolite; vulnerary
ammonium hydroxide azane : Saturated acyclic nitrogen hydrides having the general formula NnHn+2.	13.66	96	13	azane; gas molecular entity; mononuclear parent hydride	EC 3.5.1.4 (amidase) inhibitor; metabolite; mouse metabolite; neurotoxin; NMR chemical shift reference compound; nucleophilic reagent; refrigerant
quinacrine Quinacrine: An acridine derivative formerly widely used as an antimalarial but superseded by chloroquine in recent years. It has also been used as an anthelmintic and in the treatment of giardiasis and malignant effusions. It is used in cell biological experiments as an inhibitor of phospholipase A2.. quinacrine : A member of the class of acridines that is acridine substituted by a chloro group at position 6, a methoxy group at position 2 and a [5-(diethylamino)pentan-2-yl]nitrilo group at position 9.	4.34	20	0	acridines; aromatic ether; organochlorine compound; tertiary amino compound	antimalarial; EC 1.8.1.12 (trypanothione-disulfide reductase) inhibitor
benzene [no description available]	5.12	2	1	aromatic annulene; benzenes; volatile organic compound	carcinogenic agent; environmental contaminant; non-polar solvent
benzoic acid Benzoic Acid: A fungistatic compound that is widely used as a food preservative. It is conjugated to GLYCINE in the liver and excreted as hippuric acid.. benzoic acid : A compound comprising a benzene ring core carrying a carboxylic acid substituent.. aromatic carboxylic acid : Any carboxylic acid in which the carboxy group is directly bonded to an aromatic ring.	1.98	1	0	benzoic acids	algal metabolite; antimicrobial food preservative; drug allergen; EC 1.13.11.33 (arachidonate 15-lipoxygenase) inhibitor; EC 3.1.1.3 (triacylglycerol lipase) inhibitor; human xenobiotic metabolite; plant metabolite
benzyl alcohol Benzyl Alcohol: A colorless liquid with a sharp burning taste and slight odor. It is used as a local anesthetic and to reduce pain associated with LIDOCAINE injection. Also, it is used in the manufacture of other benzyl compounds, as a pharmaceutic aid, and in perfumery and flavoring.. hydroxytoluene : Any member of the class of toluenes carrying one or more hydroxy substituents.. benzyl alcohol : An aromatic alcohol that consists of benzene bearing a single hydroxymethyl substituent.. aromatic alcohol : Any alcohol in which the alcoholic hydroxy group is attached to a carbon which is itself bonded to an aromatic ring.. aromatic primary alcohol : Any primary alcohol in which the alcoholic hydroxy group is attached to a carbon which is itself bonded to an aromatic ring.	2.04	1	0	benzyl alcohols	antioxidant; fragrance; metabolite; solvent
betaine glycine betaine : The amino acid betaine derived from glycine.	3.13	5	0	amino-acid betaine; glycine derivative	fundamental metabolite
bromide Bromides: Salts of hydrobromic acid, HBr, with the bromine atom in the 1- oxidation state. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)	2.34	2	0	halide anion; monoatomic bromine
1-butanol 1-Butanol: A four carbon linear hydrocarbon that has a hydroxy group at position 1.. butan-1-ol : A primary alcohol that is butane in which a hydrogen of one of the methyl groups is substituted by a hydroxy group. It it produced in small amounts in humans by the gut microbes.	3.28	6	0	alkyl alcohol; primary alcohol; short-chain primary fatty alcohol	human metabolite; mouse metabolite; protic solvent
carbamates [no description available]	5.7	6	1	amino-acid anion
carbon monoxide Carbon Monoxide: Carbon monoxide (CO). A poisonous colorless, odorless, tasteless gas. It combines with hemoglobin to form carboxyhemoglobin, which has no oxygen carrying capacity. The resultant oxygen deprivation causes headache, dizziness, decreased pulse and respiratory rates, unconsciousness, and death. (From Merck Index, 11th ed). carbon monoxide : A one-carbon compound in which the carbon is joined only to a single oxygen. It is a colourless, odourless, tasteless, toxic gas.	1.95	1	0	carbon oxide; gas molecular entity; one-carbon compound	biomarker; EC 1.9.3.1 (cytochrome c oxidase) inhibitor; human metabolite; ligand; metabolite; mitochondrial respiratory-chain inhibitor; mouse metabolite; neurotoxin; neurotransmitter; P450 inhibitor; probe; signalling molecule; vasodilator agent
formic acid formic acid: RN given refers to parent cpd. formic acid : The simplest carboxylic acid, containing a single carbon. Occurs naturally in various sources including the venom of bee and ant stings, and is a useful organic synthetic reagent. Principally used as a preservative and antibacterial agent in livestock feed. Induces severe metabolic acidosis and ocular injury in human subjects.	3.09	1	0	monocarboxylic acid	antibacterial agent; astringent; metabolite; protic solvent; solvent
carnitine [no description available]	2.42	2	0	amino-acid betaine	human metabolite; mouse metabolite
catechol [no description available]	2.38	2	0	catechols	allelochemical; genotoxin; plant metabolite
methane Methane: The simplest saturated hydrocarbon. It is a colorless, flammable gas, slightly soluble in water. It is one of the chief constituents of natural gas and is formed in the decomposition of organic matter. (Grant & Hackh's Chemical Dictionary, 5th ed). methane : A one-carbon compound in which the carbon is attached by single bonds to four hydrogen atoms. It is a colourless, odourless, non-toxic but flammable gas (b.p. -161degreeC).	10.19	17	5	alkane; gas molecular entity; mononuclear parent hydride; one-carbon compound	bacterial metabolite; fossil fuel; greenhouse gas
levoplast Levoplast: mixture of acetamide, 2,2-dichloro-N-(2-hydroxy-1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl)-, (R-(R,R))-, castor oil, celluloidin, collodion & tannins	3.38	1	1	C-nitro compound
choline [no description available]	4.29	6	0	cholines	allergen; Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; neurotransmitter; nutrient; plant metabolite; Saccharomyces cerevisiae metabolite
aconitic acid Aconitic Acid: A tricarboxylic acid with the formula (COOH)-CH2-C(COOH)=CH-COOH.. aconitic acid : A tricarboxylic acid that is prop-1-ene substituted by carboxy groups at positions 1, 2 and 3.	1.95	1	0	tricarboxylic acid
citric acid, anhydrous Citric Acid: A key intermediate in metabolism. It is an acid compound found in citrus fruits. The salts of citric acid (citrates) can be used as anticoagulants due to their calcium chelating ability.. citric acid : A tricarboxylic acid that is propane-1,2,3-tricarboxylic acid bearing a hydroxy substituent at position 2. It is an important metabolite in the pathway of all aerobic organisms.	2.72	3	0	tricarboxylic acid	antimicrobial agent; chelator; food acidity regulator; fundamental metabolite
chlorine chloride : A halide anion formed when chlorine picks up an electron to form an an anion.	4.44	23	0	halide anion; monoatomic chlorine	cofactor; Escherichia coli metabolite; human metabolite
hydrochloric acid Hydrochloric Acid: A strong corrosive acid that is commonly used as a laboratory reagent. It is formed by dissolving hydrogen chloride in water. GASTRIC ACID is the hydrochloric acid component of GASTRIC JUICE.. hydrogen chloride : A mononuclear parent hydride consisting of covalently bonded hydrogen and chlorine atoms.	2.4	2	0	chlorine molecular entity; gas molecular entity; hydrogen halide; mononuclear parent hydride	mouse metabolite
salicylic acid Scalp: The outer covering of the calvaria. It is composed of several layers: SKIN; subcutaneous connective tissue; the occipitofrontal muscle which includes the tendinous galea aponeurotica; loose connective tissue; and the pericranium (the PERIOSTEUM of the SKULL).	5.89	9	1	monohydroxybenzoic acid	algal metabolite; antifungal agent; antiinfective agent; EC 1.11.1.11 (L-ascorbate peroxidase) inhibitor; keratolytic drug; plant hormone; plant metabolite
gallic acid gallate : A trihydroxybenzoate that is the conjugate base of gallic acid.	3.77	11	0	trihydroxybenzoic acid	antineoplastic agent; antioxidant; apoptosis inducer; astringent; cyclooxygenase 2 inhibitor; EC 1.13.11.33 (arachidonate 15-lipoxygenase) inhibitor; geroprotector; human xenobiotic metabolite; plant metabolite
octanoic acid octanoic acid: RN given refers to parent cpd; structure in Merck Index, 9th ed, #1764. octanoic acid : A straight-chain saturated fatty acid that is heptane in which one of the hydrogens of a terminal methyl group has been replaced by a carboxy group. Octanoic acid is also known as caprylic acid.	1.92	1	0	medium-chain fatty acid; straight-chain saturated fatty acid	antibacterial agent; Escherichia coli metabolite; human metabolite
bupropion Bupropion: A propiophenone-derived antidepressant and antismoking agent that inhibits the uptake of DOPAMINE.. bupropion : An aromatic ketone that is propiophenone carrying a tert-butylamino group at position 2 and a chloro substituent at position 3 on the phenyl ring.	2.75	3	0	aromatic ketone; monochlorobenzenes; secondary amino compound	antidepressant; environmental contaminant; xenobiotic
guaiacol Guaiacol: An agent thought to have disinfectant properties and used as an expectorant. (From Martindale, The Extra Pharmacopoeia, 30th ed, p747). methylcatechol : Any member of the class of catechols carrying one or more methyl substituents.. guaiacol : A monomethoxybenzene that consists of phenol with a methoxy substituent at the ortho position.	2.63	3	0	guaiacols	disinfectant; EC 1.1.1.25 (shikimate dehydrogenase) inhibitor; expectorant; plant metabolite
hippuric acid hippuric acid: RN given refers to parent cpd; structure in Merck Index, 9th ed, #4591. N-benzoylglycine : An N-acylglycine in which the acyl group is specified as benzoyl.	1.94	1	0	N-acylglycine	human blood serum metabolite; uremic toxin
methylmalonic acid Methylmalonic Acid: A malonic acid derivative which is a vital intermediate in the metabolism of fat and protein. Abnormalities in methylmalonic acid metabolism lead to methylmalonic aciduria. This metabolic disease is attributed to a block in the enzymatic conversion of methylmalonyl CoA to succinyl CoA.. methylmalonic acid : A dicarboxylic acid that is malonic acid in which one of the methylene hydrogens is substituted by a methyl group.	1.97	1	0	C4-dicarboxylic acid	human metabolite
malic acid malic acid : A 2-hydroxydicarboxylic acid that is succinic acid in which one of the hydrogens attached to a carbon is replaced by a hydroxy group.. 2-hydroxydicarboxylic acid : Any dicarboxylic acid carrying a hydroxy group on the carbon atom at position alpha to the carboxy group.	2	1	0	2-hydroxydicarboxylic acid; C4-dicarboxylic acid	food acidity regulator; fundamental metabolite
3,4-dihydroxyphenylacetic acid 3,4-Dihydroxyphenylacetic Acid: A deaminated metabolite of LEVODOPA.. (3,4-dihydroxyphenyl)acetic acid : A dihydroxyphenylacetic acid having the two hydroxy substituents located at the 3- and 4-positions. It is a metabolite of dopamine.. dihydroxyphenylacetic acid : A dihydroxy monocarboxylic acid consisting of phenylacetic acid having two phenolic hydroxy substituents.	2.4	2	0	catechols; dihydroxyphenylacetic acid	human metabolite
aminocaproic acid Aminocaproic Acid: An antifibrinolytic agent that acts by inhibiting plasminogen activators which have fibrinolytic properties.. 6-aminohexanoic acid : An epsilon-amino acid comprising hexanoic acid carrying an amino substituent at position C-6. Used to control postoperative bleeding, and to treat overdose effects of the thrombolytic agents streptokinase and tissue plasminogen activator.	2.4	2	0	amino acid zwitterion; epsilon-amino acid; omega-amino fatty acid	antifibrinolytic drug; hematologic agent; metabolite
fosmidomycin fosmidomycin: from Streptomyces lavendulae; RN given refers to parent cpd; structure in second source. fosmidomycin : Propylphosphonic acid in which one of the hydrogens at position 3 is substituted by a formyl(hydroxy)amino group. An antibiotic obtained from Streptomyces lavendulae, it specifically inhibits DXP reductoisomerase (EC 1.1.1.267), a key enzyme in the non-mevalonate pathway of isoprenoid biosynthesis.	2.74	3	0	hydroxamic acid; phosphonic acids	antimicrobial agent; bacterial metabolite; EC 1.1.1.267 (1-deoxy-D-xylulose-5-phosphate reductoisomerase) inhibitor
creatine [no description available]	2.87	4	0	glycine derivative; guanidines; zwitterion	geroprotector; human metabolite; mouse metabolite; neuroprotective agent; nutraceutical
cytosine [no description available]	2.97	4	0	aminopyrimidine; pyrimidine nucleobase; pyrimidone	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
lactic acid Lactic Acid: A normal intermediate in the fermentation (oxidation, metabolism) of sugar. The concentrated form is used internally to prevent gastrointestinal fermentation. (From Stedman, 26th ed). 2-hydroxypropanoic acid : A 2-hydroxy monocarboxylic acid that is propanoic acid in which one of the alpha-hydrogens is replaced by a hydroxy group.	3.6	9	0	2-hydroxy monocarboxylic acid	algal metabolite; Daphnia magna metabolite
dihydrouracil hexahydropyrimidine-2,4-dione: structure in first source. 5,6-dihydrouracil : A pyrimidine obtained by formal addition of hydrogen across the 5,6-position of uracil.	1.96	1	0	pyrimidone	Escherichia coli metabolite; human metabolite; metabolite; mouse metabolite
dimethylamine [no description available]	1.99	1	0	methylamines; secondary aliphatic amine	metabolite
dimethyl sulfoxide Dimethyl Sulfoxide: A highly polar organic liquid, that is used widely as a chemical solvent. Because of its ability to penetrate biological membranes, it is used as a vehicle for topical application of pharmaceuticals. It is also used to protect tissue during CRYOPRESERVATION. Dimethyl sulfoxide shows a range of pharmacological activity including analgesia and anti-inflammation.. dimethyl sulfoxide : A 2-carbon sulfoxide in which the sulfur atom has two methyl substituents.	3.83	12	0	sulfoxide; volatile organic compound	alkylating agent; antidote; Escherichia coli metabolite; geroprotector; MRI contrast agent; non-narcotic analgesic; polar aprotic solvent; radical scavenger
ethanolamine [no description available]	2.06	1	0	ethanolamines; primary alcohol; primary amine	Escherichia coli metabolite; human metabolite; mouse metabolite
formaldehyde paraform: polymerized formaldehyde; RN given refers to parent cpd; used in root canal therapy	6.41	18	0	aldehyde; one-carbon compound	allergen; carcinogenic agent; disinfectant; EC 3.5.1.4 (amidase) inhibitor; environmental contaminant; Escherichia coli metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
glycine [no description available]	6.58	28	2	alpha-amino acid; amino acid zwitterion; proteinogenic amino acid; serine family amino acid	EC 2.1.2.1 (glycine hydroxymethyltransferase) inhibitor; fundamental metabolite; hepatoprotective agent; micronutrient; neurotransmitter; NMDA receptor agonist; nutraceutical
glycerol Moon: The natural satellite of the planet Earth. It includes the lunar cycles or phases, the lunar month, lunar landscapes, geography, and soil.	7.83	17	4	alditol; triol	algal metabolite; detergent; Escherichia coli metabolite; geroprotector; human metabolite; mouse metabolite; osmolyte; Saccharomyces cerevisiae metabolite; solvent
alpha-glycerophosphoric acid [no description available]	2.04	1	0	glycerol monophosphate	algal metabolite; human metabolite
hydrogen carbonate Bicarbonates: Inorganic salts that contain the -HCO3 radical. They are an important factor in determining the pH of the blood and the concentration of bicarbonate ions is regulated by the kidney. Levels in the blood are an index of the alkali reserve or buffering capacity.. hydrogencarbonate : The carbon oxoanion resulting from the removal of a proton from carbonic acid.	4.03	15	0	carbon oxoanion	cofactor; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
dalteparin Dalteparin: A low-molecular-weight fragment of heparin, prepared by nitrous acid depolymerization of porcine mucosal heparin. The mean molecular weight is 4000-6000 daltons. It is used therapeutically as an antithrombotic agent. (From Merck Index, 11th ed)	2.31	1	0
histamine [no description available]	4.16	17	0	aralkylamino compound; imidazoles	human metabolite; mouse metabolite; neurotransmitter
hydrogen Hydrogen: The first chemical element in the periodic table with atomic symbol H, and atomic number 1. Protium (atomic weight 1) is by far the most common hydrogen isotope. Hydrogen also exists as the stable isotope DEUTERIUM (atomic weight 2) and the radioactive isotope TRITIUM (atomic weight 3). Hydrogen forms into a diatomic molecule at room temperature and appears as a highly flammable colorless and odorless gas.. dihydrogen : An elemental molecule consisting of two hydrogens joined by a single bond.	5.7	6	1	elemental hydrogen; elemental molecule; gas molecular entity	antioxidant; electron donor; food packaging gas; fuel; human metabolite
hydroquinone [no description available]	2.05	1	0	benzenediol; hydroquinones	antioxidant; carcinogenic agent; cofactor; Escherichia coli metabolite; human xenobiotic metabolite; mouse metabolite; skin lightening agent
hydroxylamine amino alcohol : An alcohol containing an amino functional group in addition to the alcohol-defining hydroxy group.	2.01	1	0	hydroxylamines	algal metabolite; bacterial xenobiotic metabolite; EC 1.1.3.13 (alcohol oxidase) inhibitor; EC 4.2.1.22 (cystathionine beta-synthase) inhibitor; EC 4.3.1.10 (serine-sulfate ammonia-lyase) inhibitor; nitric oxide donor; nucleophilic reagent
indole [no description available]	1.93	1	0	indole; polycyclic heteroarene	Escherichia coli metabolite
iodine Iodine: A nonmetallic element of the halogen group that is represented by the atomic symbol I, atomic number 53, and atomic weight of 126.90. It is a nutritionally essential element, especially important in thyroid hormone synthesis. In solution, it has anti-infective properties and is used topically.. diiodine : Molecule comprising two covalently bonded iodine atoms with overall zero charge..	5.35	14	1	diatomic iodine	nutrient
dihydroxyphenylalanine Dihydroxyphenylalanine: A beta-hydroxylated derivative of phenylalanine. The D-form of dihydroxyphenylalanine has less physiologic activity than the L-form and is commonly used experimentally to determine whether the pharmacological effects of LEVODOPA are stereospecific.. dopa : A hydroxyphenylalanine carrying hydroxy substituents at positions 3 and 4 of the benzene ring.	4.81	6	0	hydroxyphenylalanine; non-proteinogenic alpha-amino acid; tyrosine derivative	human metabolite
kynurenine Kynurenine: A metabolite of the essential amino acid tryptophan metabolized via the tryptophan-kynurenine pathway.. kynurenine : A ketone that is alanine in which one of the methyl hydrogens is substituted by a 2-aminobenzoyl group.	2.63	3	0	aromatic ketone; non-proteinogenic alpha-amino acid; substituted aniline	human metabolite
pipecolic acid pipecolic acid: RN given refers to cpd without isomeric designation. pipecolic acid : A piperidinemonocarboxylic acid in which the carboxy group is located at position C-2.. pipecolate : A piperidinecarboxylate that is the conjugate base of pipecolic acid.	1.96	1	0	piperidinemonocarboxylic acid
thioctic acid Thioctic Acid: An octanoic acid bridged with two sulfurs so that it is sometimes also called a pentanoic acid in some naming schemes. It is biosynthesized by cleavage of LINOLEIC ACID and is a coenzyme of oxoglutarate dehydrogenase (KETOGLUTARATE DEHYDROGENASE COMPLEX). It is used in DIETARY SUPPLEMENTS.	2.39	2	0	dithiolanes; heterocyclic fatty acid; thia fatty acid	fundamental metabolite; geroprotector
methanol Methanol: A colorless, flammable liquid used in the manufacture of FORMALDEHYDE and ACETIC ACID, in chemical synthesis, antifreeze, and as a solvent. Ingestion of methanol is toxic and may cause blindness.. primary alcohol : A primary alcohol is a compound in which a hydroxy group, -OH, is attached to a saturated carbon atom which has either three hydrogen atoms attached to it or only one other carbon atom and two hydrogen atoms attached to it.. methanol : The primary alcohol that is the simplest aliphatic alcohol, comprising a methyl and an alcohol group.	3.06	5	0	alkyl alcohol; one-carbon compound; primary alcohol; volatile organic compound	amphiprotic solvent; Escherichia coli metabolite; fuel; human metabolite; mouse metabolite; Mycoplasma genitalium metabolite
inositol Inositol: An isomer of glucose that has traditionally been considered to be a B vitamin although it has an uncertain status as a vitamin and a deficiency syndrome has not been identified in man. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1379) Inositol phospholipids are important in signal transduction.. inositol : Any cyclohexane-1,2,3,4,5,6-hexol.. 1D-chiro-inositol : Belonging to the inositol family of compounds, D-chiro-inositol (DCI) is an isomer of glucose. It is an important secondary messenger in insulin signal transduction.. muco-inositol : An inositol that is cyclohexane-1,2,3,4,5,6-hexol having a (1R,2R,3r,4R,5S,6r)-configuration.	4	14	0	cyclitol; hexol
melatonin [no description available]	2.76	3	0	acetamides; tryptamines	anticonvulsant; central nervous system depressant; geroprotector; hormone; human metabolite; immunological adjuvant; mouse metabolite; radical scavenger
croton oil [no description available]	1.94	1	0	N-acyl-hexosamine
nickel Nickel: A trace element with the atomic symbol Ni, atomic number 28, and atomic weight 58.69. It is a cofactor of the enzyme UREASE.. nickel ion : A nickel atom having a net electric charge.. nickel atom : Chemical element (nickel group element atom) with atomic number 28.	8.37	42	1	metal allergen; nickel group element atom	epitope; micronutrient
niacinamide nicotinamide : A pyridinecarboxamide that is pyridine in which the hydrogen at position 3 is replaced by a carboxamide group.	5.21	12	1	pyridine alkaloid; pyridinecarboxamide; vitamin B3	anti-inflammatory agent; antioxidant; cofactor; EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor; EC 3.5.1.98 (histone deacetylase) inhibitor; Escherichia coli metabolite; geroprotector; human urinary metabolite; metabolite; mouse metabolite; neuroprotective agent; Saccharomyces cerevisiae metabolite; Sir2 inhibitor
niacin Niacin: A water-soluble vitamin of the B complex occurring in various animal and plant tissues. It is required by the body for the formation of coenzymes NAD and NADP. It has PELLAGRA-curative, vasodilating, and antilipemic properties.. vitamin B3 : Any member of a group of vitamers that belong to the chemical structural class called pyridines that exhibit biological activity against vitamin B3 deficiency. Vitamin B3 deficiency causes a condition known as pellagra whose symptoms include depression, dermatitis and diarrhea. The vitamers include nicotinic acid and nicotinamide (and their ionized and salt forms).. nicotinic acid : A pyridinemonocarboxylic acid that is pyridine in which the hydrogen at position 3 is replaced by a carboxy group.	9.91	38	2	pyridine alkaloid; pyridinemonocarboxylic acid; vitamin B3	antidote; antilipemic drug; EC 3.5.1.19 (nicotinamidase) inhibitor; Escherichia coli metabolite; human urinary metabolite; metabolite; mouse metabolite; plant metabolite; vasodilator agent
nitrates Nitrates: Inorganic or organic salts and esters of nitric acid. These compounds contain the NO3- radical.	3.65	10	0	monovalent inorganic anion; nitrogen oxoanion; reactive nitrogen species
nitroxyl nitroxyl: hydroxamic acid oxidized to nitroxyl free radical. nitroxyl : A nitrogen oxoacid consisting of an oxygen atom double-bonded to an NH group.	4.8	1	1	nitrogen oxoacid
nitrites Nitrites: Salts of nitrous acid or compounds containing the group NO2-. The inorganic nitrites of the type MNO2 (where M=metal) are all insoluble, except the alkali nitrites. The organic nitrites may be isomeric, but not identical with the corresponding nitro compounds. (Grant & Hackh's Chemical Dictionary, 5th ed)	2.89	4	0	monovalent inorganic anion; nitrogen oxoanion; reactive nitrogen species	human metabolite
orotic acid Orotic Acid: An intermediate product in PYRIMIDINE synthesis which plays a role in chemical conversions between DIHYDROFOLATE and TETRAHYDROFOLATE.. orotic acid : A pyrimidinemonocarboxylic acid that is uracil bearing a carboxy substituent at position C-6.	3.05	5	0	pyrimidinemonocarboxylic acid	Escherichia coli metabolite; metabolite; mouse metabolite
oxalic acid Oxalic Acid: A strong dicarboxylic acid occurring in many plants and vegetables. It is produced in the body by metabolism of glyoxylic acid or ascorbic acid. It is not metabolized but excreted in the urine. It is used as an analytical reagent and general reducing agent.. oxalic acid : An alpha,omega-dicarboxylic acid that is ethane substituted by carboxyl groups at positions 1 and 2.	2.36	2	0	alpha,omega-dicarboxylic acid	algal metabolite; human metabolite; plant metabolite
4-aminobenzoic acid 4-Aminobenzoic Acid: An aminobenzoic acid isomer that combines with pteridine and GLUTAMIC ACID to form FOLIC ACID. The fact that 4-aminobenzoic acid absorbs light throughout the UVB range has also resulted in its use as an ingredient in SUNSCREENS.. 4-ammoniobenzoate : A zwitterion obtained by transfer of a proton from the carboxy to the amino group of 4-aminobenzoic acid.. 4-aminobenzoic acid : An aminobenzoic acid in which the amino group is para to the carboxy group.	2.37	2	0	aminobenzoic acid; aromatic amino-acid zwitterion	allergen; Escherichia coli metabolite; plant metabolite
palmitic acid Palmitic Acid: A common saturated fatty acid found in fats and waxes including olive oil, palm oil, and body lipids.. hexadecanoic acid : A straight-chain, sixteen-carbon, saturated long-chain fatty acid.	1.94	1	0	long-chain fatty acid; straight-chain saturated fatty acid	algal metabolite; Daphnia magna metabolite; EC 1.1.1.189 (prostaglandin-E2 9-reductase) inhibitor; plant metabolite
parathion [no description available]	1.97	1	0	C-nitro compound; organic thiophosphate; organothiophosphate insecticide	acaricide; agrochemical; avicide; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; mouse metabolite
phenol [no description available]	2.66	3	0	phenols	antiseptic drug; disinfectant; human xenobiotic metabolite; mouse metabolite
phenylacetaldehyde [no description available]	2.11	1	0	alpha-CH2-containing aldehyde; phenylacetaldehydes	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
phenylacetic acid phenylacetic acid : A monocarboxylic acid that is toluene in which one of the hydrogens of the methyl group has been replaced by a carboxy group.	2.41	2	0	benzenes; monocarboxylic acid; phenylacetic acids	allergen; Aspergillus metabolite; auxin; EC 6.4.1.1 (pyruvate carboxylase) inhibitor; Escherichia coli metabolite; human metabolite; plant growth retardant; plant metabolite; Saccharomyces cerevisiae metabolite; toxin
phosphoric acid phosphoric acid: concise etchant is 37% H3PO4. phosphoric acid : A phosphorus oxoacid that consists of one oxo and three hydroxy groups joined covalently to a central phosphorus atom.	2.15	1	0	phosphoric acids	algal metabolite; fertilizer; human metabolite; NMR chemical shift reference compound; solvent
phosphoenolpyruvate Phosphoenolpyruvate: A monocarboxylic acid anion derived from selective deprotonation of the carboxy group of phosphoenolpyruvic acid. It is a metabolic intermediate in GLYCOLYSIS; GLUCONEOGENESIS; and other pathways.. phosphoenolpyruvate : A monocarboxylic acid anion resuting from selective deprotonation of the carboxy group of phosphoenolpyruvic acid.. phosphoenolpyruvic acid : A monocarboxylic acid that is acrylic acid substituted by a phosphonooxy group at position 2. It is a metabolic intermediate in pathways like glycolysis and gluconeogenesis.	1.95	1	0	carboxyalkyl phosphate; monocarboxylic acid	fundamental metabolite
phosphorylcholine Phosphorylcholine: Calcium and magnesium salts used therapeutically in hepatobiliary dysfunction.. phosphocholine : The phosphate of choline; and the parent compound of the phosphocholine family.	3.78	3	0	phosphocholines	allergen; epitope; hapten; human metabolite; mouse metabolite
porphobilinogen [no description available]	1.95	1	0	aralkylamino compound; dicarboxylic acid; pyrroles	Escherichia coli metabolite; metabolite; mouse metabolite
propylene glycol Propylene Glycol: A clear, colorless, viscous organic solvent and diluent used in pharmaceutical preparations.. propane-1,2-diol : The simplest member of the class of propane-1,2-diols, consisting of propane in which a hydrogen at position 1 and a hydrogen at position 2 are substituted by hydroxy groups. A colourless, viscous, hygroscopic, low-melting (-59degreeC) and high-boiling (188degreeC) liquid with low toxicity, it is used as a solvent, emulsifying agent, and antifreeze.	2.49	2	0	glycol; propane-1,2-diols	allergen; human xenobiotic metabolite; mouse metabolite; protic solvent
1-propanol 1-Propanol: A colorless liquid made by oxidation of aliphatic hydrocarbons that is used as a solvent and chemical intermediate.. propan-1-ol : The parent member of the class of propan-1-ols that is propane in which a hydrogen of one of the methyl groups is replaced by a hydroxy group.	2.66	3	0	propan-1-ols; short-chain primary fatty alcohol	metabolite; protic solvent
propionic acid propionic acid : A short-chain saturated fatty acid comprising ethane attached to the carbon of a carboxy group.	2.01	1	0	saturated fatty acid; short-chain fatty acid	antifungal drug
pteridines [no description available]	1.94	1	0	azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; pteridines
purine 1H-purine : The 1H-tautomer of purine.. 3H-purine : The 3H-tautomer of purine.. 9H-purine : The 9H-tautomer of purine.. 7H-purine : The 7H-tautomer of purine.	1.93	1	0	purine
putrescine [no description available]	3.36	7	0	alkane-alpha,omega-diamine	antioxidant; fundamental metabolite
pyrazinamide pyrazinecarboxamide : A monocarboxylic acid amide resulting from the formal condensation of the carboxy group of pyrazinoic acid (pyrazine-2-carboxylic acid) with ammonia. A prodrug for pyrazinoic acid, pyrazinecarboxamide is used as part of multidrug regimens for the treatment of tuberculosis.	2.76	3	0	monocarboxylic acid amide; N-acylammonia; pyrazines	antitubercular agent; prodrug
pyridoxal phosphate Pyridoxal Phosphate: This is the active form of VITAMIN B 6 serving as a coenzyme for synthesis of amino acids, neurotransmitters (serotonin, norepinephrine), sphingolipids, aminolevulinic acid. During transamination of amino acids, pyridoxal phosphate is transiently converted into pyridoxamine phosphate (PYRIDOXAMINE).. pyridoxal 5'-phosphate : The monophosphate ester obtained by condensation of phosphoric acid with the primary hydroxy group of pyridoxal.	2.48	2	0	methylpyridines; monohydroxypyridine; pyridinecarbaldehyde; vitamin B6 phosphate	coenzyme; cofactor; EC 2.7.7.7 (DNA-directed DNA polymerase) inhibitor; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
pyridoxine 4,5-bis(hydroxymethyl)-2-methylpyridin-3-ol: structure in first source. vitamin B6 : Any member of the group of pyridines that exhibit biological activity against vitamin B6 deficiency. Vitamin B6 deficiency is associated with microcytic anemia, electroencephalographic abnormalities, dermatitis with cheilosis (scaling on the lips and cracks at the corners of the mouth) and glossitis (swollen tongue), depression and confusion, and weakened immune function. Vitamin B6 consists of the vitamers pyridoxine, pyridoxal, and pyridoxamine and their respective 5'-phosphate esters (and includes their corresponding ionized and salt forms).	5.06	8	0	hydroxymethylpyridine; methylpyridines; monohydroxypyridine; vitamin B6	cofactor; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
pyrogallol benzenetriol : A triol in which three hydroxy groups are substituted onto a benzene ring.	1.94	1	0	benzenetriol; phenolic donor	plant metabolite
pyruvic acid Pyruvic Acid: An intermediate compound in the metabolism of carbohydrates, proteins, and fats. In thiamine deficiency, its oxidation is retarded and it accumulates in the tissues, especially in nervous structures. (From Stedman, 26th ed). pyruvic acid : A 2-oxo monocarboxylic acid that is the 2-keto derivative of propionic acid. It is a metabolite obtained during glycolysis.	2.02	1	0	2-oxo monocarboxylic acid	cofactor; fundamental metabolite
thiosulfates Thiosulfates: Inorganic salts of thiosulfuric acid possessing the general formula R2S2O3.. thiosulfate(2-) : A divalent inorganic anion obtained by removal of both protons from thiosulfuric acid.	1.94	1	0	divalent inorganic anion; sulfur oxide; sulfur oxoanion	human metabolite
sulfites Sulfites: Inorganic salts of sulfurous acid.. sulfites : Any sulfurous acid derivative that is a salt or an ester of sulfurous acid.. organosulfonate oxoanion : An organic anion obtained by deprotonation of the sufonate group(s) of any organosulfonic acid.. sulfite : A sulfur oxoanion that is the conjugate base of hydrogen sulfite (H2SO3).	3.33	7	0	divalent inorganic anion; sulfur oxide; sulfur oxoanion
spermidine [no description available]	3.84	12	0	polyazaalkane; triamine	autophagy inducer; fundamental metabolite; geroprotector
spermine [no description available]	4.62	27	0	polyazaalkane; tetramine	antioxidant; fundamental metabolite; immunosuppressive agent
succinic acid Succinic Acid: A water-soluble, colorless crystal with an acid taste that is used as a chemical intermediate, in medicine, the manufacture of lacquers, and to make perfume esters. It is also used in foods as a sequestrant, buffer, and a neutralizing agent. (Hawley's Condensed Chemical Dictionary, 12th ed, p1099; McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1851). succinic acid : An alpha,omega-dicarboxylic acid resulting from the formal oxidation of each of the terminal methyl groups of butane to the corresponding carboxy group. It is an intermediate metabolite in the citric acid cycle.	5.22	3	1	alpha,omega-dicarboxylic acid; C4-dicarboxylic acid	anti-ulcer drug; fundamental metabolite; micronutrient; nutraceutical; radiation protective agent
taurine [no description available]	4.96	9	1	amino sulfonic acid; zwitterion	antioxidant; Escherichia coli metabolite; glycine receptor agonist; human metabolite; mouse metabolite; nutrient; radical scavenger; Saccharomyces cerevisiae metabolite
thiamine thiamine(1+) : A primary alcohol that is 1,3-thiazol-3-ium substituted by (4-amino-2-methylpyrimidin-5-yl)methyl, methyl and 2-hydroxyethyl groups at positions 3, 4 and 5, respectively.	3.2	6	0	primary alcohol; vitamin B1	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
thymine [no description available]	2.65	3	0	pyrimidine nucleobase; pyrimidone	Escherichia coli metabolite; human metabolite; mouse metabolite
toluene methylbenzene : Any alkylbenzene that is benzene substituted with one or more methyl groups.	6.45	4	2	methylbenzene; toluenes; volatile organic compound	cholinergic antagonist; fuel additive; neurotoxin; non-polar solvent
trimethyloxamine trimethyloxamine: used in manufacture of quaternary ammonium cpds; insect attractant; warming agent for gas; oxidant; structure. trimethylamine N-oxide : A tertiary amine oxide resulting from the oxidation of the amino group of trimethylamine.	2.39	2	0	tertiary amine oxide	Escherichia coli metabolite; metabolite; osmolyte
trimethylamine [no description available]	2.41	2	0	methylamines; tertiary amine	Escherichia coli metabolite; human xenobiotic metabolite
uracil 2,4-dihydroxypyrimidine: a urinary biomarker for bipolar disorder	4.39	22	0	pyrimidine nucleobase; pyrimidone	allergen; Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; prodrug; Saccharomyces cerevisiae metabolite
uric acid Uric Acid: An oxidation product, via XANTHINE OXIDASE, of oxypurines such as XANTHINE and HYPOXANTHINE. It is the final oxidation product of purine catabolism in humans and primates, whereas in most other mammals URATE OXIDASE further oxidizes it to ALLANTOIN.. uric acid : An oxopurine that is the final oxidation product of purine metabolism.. 6-hydroxy-1H-purine-2,8(7H,9H)-dione : A tautomer of uric acid having oxo groups at C-2 and C-8 and a hydroxy group at C-6.. 7,9-dihydro-1H-purine-2,6,8(3H)-trione : An oxopurine in which the purine ring is substituted by oxo groups at positions 2, 6, and 8.	4.9	2	1	uric acid	Escherichia coli metabolite; human metabolite; mouse metabolite
urea pseudourea: clinical use; structure. isourea : A carboximidic acid that is the imidic acid tautomer of urea, H2NC(=NH)OH, and its hydrocarbyl derivatives.	9.93	64	3	isourea; monocarboxylic acid amide; one-carbon compound	Daphnia magna metabolite; Escherichia coli metabolite; fertilizer; flour treatment agent; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
uroporphyrinogen iii Uroporphyrinogens: Porphyrinogens which are intermediates in heme biosynthesis. They have four acetic acid and four propionic acid side chains attached to the pyrrole rings. Uroporphyrinogen I and III are formed from polypyrryl methane in the presence of uroporphyrinogen III cosynthetase and uroporphyrin I synthetase, respectively. They can yield uroporphyrins by autooxidation or coproporphyrinogens by decarboxylation.	1.95	1	0	uroporphyrinogen	Escherichia coli metabolite; mouse metabolite
catechin [no description available]	2.05	1	0	hydroxyflavan
8-hydroxy-2-(di-n-propylamino)tetralin 8-Hydroxy-2-(di-n-propylamino)tetralin: A serotonin 1A-receptor agonist that is used experimentally to test the effects of serotonin.. 8-OH-DPAT : A tetralin substituted at positions 1 and 7 by hydroxy and dipropylamino groups respectively	2.04	1	0	phenols; tertiary amino compound; tetralins	serotonergic antagonist
alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid: An IBOTENIC ACID homolog and glutamate agonist. The compound is the defining agonist for the AMPA subtype of glutamate receptors (RECEPTORS, AMPA). It has been used as a radionuclide imaging agent but is more commonly used as an experimental tool in cell biological studies.	2.02	1	0	non-proteinogenic alpha-amino acid
3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid 3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid: structure given in first source; NMDA receptor antagonist	1.98	1	0
gallopamil Gallopamil: Coronary vasodilator that is an analog of iproveratril (VERAPAMIL) with one more methoxy group on the benzene ring.	3.38	7	0	benzenes; organic amino compound
sk&f-38393 2,3,4,5-Tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine: A selective D1 dopamine receptor agonist used primarily as a research tool.. 1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepine-7,8-diol : A benzazepine that is 2,3,4,5-tetrahydro-3-benzazepine bearing a phenyl substituent at position 1 and two hydroxy substituents at positions 7 and 8.. SKF 38393 : A racemate comprising equimolar amounts of (R)- and (S)-SKF 38393	2.42	2	0	benzazepine; catechols; secondary amino compound
menthol Menthol: A monoterpene cyclohexanol produced from mint oils.	2.05	1	0	p-menthane monoterpenoid; secondary alcohol	volatile oil component
mandelic acid SAMMA: mandelic acid condensation polymer	2.34	2	0	2-hydroxy monocarboxylic acid; benzenes	antibacterial agent; human xenobiotic metabolite
1,10-phenanthroline 1,10-phenanthroline: RN given refers to parent cpd; inhibits Zn-dependent metalloproteinases	1.98	1	0	phenanthroline	EC 2.7.1.1 (hexokinase) inhibitor; EC 3.4.19.3 (pyroglutamyl-peptidase I) inhibitor
1,2-dimethylhydrazine 1,2-Dimethylhydrazine: A DNA alkylating agent that has been shown to be a potent carcinogen and is widely used to induce colon tumors in experimental animals.. 1,2-dimethylhydrazine : A member of the class of hydrazines that is hydrazine in which one of the hydrogens attached to each nitrogen is replaced by a methyl group. A powerful DNA alkylating agent and carcinogen, it is used to induce colon cancer in laboratory rats and mice.	2.4	2	0	hydrazines	alkylating agent; carcinogenic agent
1,3-dipropyl-8-cyclopentylxanthine DPCPX : An oxopurine that is 7H-xanthine substituted at positions 1 and 3 by propyl groups and at position 8 by a cyclohexyl group.	2.72	3	0	oxopurine	adenosine A1 receptor antagonist; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor
pk 11195 PK-11195 : A monocarboxylic acid amide obtained by formal condensation of the carboxy group of 1-(2-chlorophenyl)isoquinoline-3-carboxylic acid with the amino group of sec-butylmethylamine	2	1	0	aromatic amide; isoquinolines; monocarboxylic acid amide; monochlorobenzenes	antineoplastic agent
1-anilino-8-naphthalenesulfonate 1-anilino-8-naphthalenesulfonate: RN given refers to parent cpd. 8-anilinonaphthalene-1-sulfonic acid : A naphthalenesulfonic acid that is naphthalene-1-sulfonic acid substituted by a phenylamino group at position 8.	3.89	13	0	aminonaphthalene; naphthalenesulfonic acid	fluorescent probe
1-o-hexadecyl-2-o-methylglycerol [no description available]	2	1	0
edelfosine edelfosine: RN given refers to parent cpd. edelfosine : A racemate comprising equimolar amounts of (R)- and (S)-edelfosine.. 1-octadecyl-2-methylglycero-3-phosphocholine : A glycerophosphocholine that is glycero-3-phosphocholine substituted at positions 1 and 2 by octadecyl and methyl groups respectively.	2.01	1	0	glycerophosphocholine
17-octadecynoic acid octadec-17-ynoic acid : An acetylenic fatty acid that is octadecanoi acid (stearic acid) which has been doubly dehydrogenated at positions 17 and 18 to give the corresponding alkynoic acid.	1.99	1	0	acetylenic fatty acid; long-chain fatty acid; monounsaturated fatty acid; terminal acetylenic compound	EC 1.14.14.94 (leukotriene-B4 20-monooxygenase) inhibitor; EC 1.14.15.3 (alkane 1-monooxygenase) inhibitor; P450 inhibitor
2,4-dinitrophenol 2,4-Dinitrophenol: A toxic dye, chemically related to trinitrophenol (picric acid), used in biochemical studies of oxidative processes where it uncouples oxidative phosphorylation. It is also used as a metabolic stimulant. (Stedman, 26th ed). dinitrophenol : Members of the class of nitrophenol carrying two nitro substituents.. 2,4-dinitrophenol : A dinitrophenol having the nitro groups at the 2- and 4-positions.	2	1	0	dinitrophenol	allergen; antiseptic drug; bacterial xenobiotic metabolite; geroprotector; oxidative phosphorylation inhibitor
2-amino-2-methyl-1,3-propandiol 2-amino-2-methylpropane-1,3-diol : An aminodiol that is propane-1,3-diol substituted ny an amino and a methyl group at position 2.	2.02	1	0	aminodiol
mercaptoethanol Mercaptoethanol: A water-soluble thiol derived from hydrogen sulfide and ethanol. It is used as a reducing agent for disulfide bonds and to protect sulfhydryl groups from oxidation.	2.64	3	0	alkanethiol; primary alcohol	geroprotector
2-nitro-4-carboxyphenyl-n,n-diphenylcarbamate 2-nitro-4-carboxyphenyl-N,N-diphenylcarbamate: inhibits phospholipase C and serine esterases; structure in first source	2.4	2	0
2-aminoethoxydiphenyl borate 2-aminoethoxydiphenyl borate: is a novel membrane-penetrable modulator and transient receptor potential channel blocker; structure in first source; do not confuse with 2-APB cpd. 2-aminoethoxydiphenylborane : An organoboron compound that is diphenylborane in which the borane hydrogen is replaced by a 2-aminoethoxy group.	3.12	5	0	organoboron compound; primary amino compound	calcium channel blocker; IP3 receptor antagonist; potassium channel opener
3,4-dichloroisocoumarin 3,4-dichloroisocoumarin : A member of the class of isocoumarins that is isocoumarin substituted by chloro groups at positions 3 and 4. It is a serine protease inhibitor.	2.04	1	0	isocoumarins; organochlorine compound	geroprotector; serine protease inhibitor
3-methylcholanthrene Methylcholanthrene: A carcinogen that is often used in experimental cancer studies.. 3-methylcholanthrene : A pentacyclic ortho- and peri-fused polycyclic arene consisting of a dihydrocyclopenta[ij]tetraphene ring system with a methyl substituent at the 3-position.	2.62	3	0	ortho- and peri-fused polycyclic arene	aryl hydrocarbon receptor agonist; carcinogenic agent
4-aminopyridine [no description available]	2.7	3	0	aminopyridine; aromatic amine	avicide; orphan drug; potassium channel blocker
p-chloromercuribenzoic acid p-Chloromercuribenzoic Acid: An organic mercurial used as a sulfhydryl reagent.	2.01	1	0	chlorine molecular entity; mercuribenzoic acid
homovanillic acid Homovanillic Acid: A 3-O-methyl ETHER of (3,4-dihydroxyphenyl)acetic acid.. homovanillate : A hydroxy monocarboxylic acid anion which is obtained by deprotonation of the carboxy group of homovanillic acid.. homovanillic acid : A monocarboxylic acid that is the 3-O-methyl ether of (3,4-dihydroxyphenyl)acetic acid. It is a catecholamine metabolite.	2	1	0	guaiacols; monocarboxylic acid	human metabolite; mouse metabolite
phenytoin [no description available]	5.01	13	0	imidazolidine-2,4-dione	anticonvulsant; drug allergen; sodium channel blocker; teratogenic agent
win 52035 Win 52035: structure given in first source	1.99	1	0	aromatic ether
win 53338 WIN 53338: structure given in first source. 5-{5-[2-chloro-4-(4,5-dihydro-1,3-oxazol-2-yl)phenoxy]pentyl}-3-methylisoxazole : An isoxazole compound having a methyl substituent at the 3-position and a 5-[2-chloro-4-(4,5-dihydro-1,3-oxazol-2-yl)phenoxy]pentyl substituent at the 5-position.	1.99	1	0	isoxazoles; monochlorobenzenes	antiviral agent
ethylisopropylamiloride ethylisopropylamiloride: structure in first source. ethylisopropylamiloride : A member of the class of pyrazines that is amiloride in which the amino substitutent of the pyrazine ring that is adjacent to the chloro substituent has been substituted by an ethyl group and by an isopropyl group.	1.99	1	0	aromatic amine; guanidines; monocarboxylic acid amide; organochlorine compound; pyrazines; tertiary amino compound	anti-arrhythmia drug; neuroprotective agent; sodium channel blocker
hydroxyindoleacetic acid (5-hydroxyindol-3-yl)acetic acid : A member of the class of indole-3-acetic acids that is indole-3-acetic acid substituted by a hydroxy group at C-5.	2.66	3	0	indole-3-acetic acids	drug metabolite; human metabolite; mouse metabolite
7-nitroindazole 7-nitroindazole: an inhibitor of nitric oxide synthase; exhibits anti-nociceptive activity without increasing blood pressure	2.03	1	0
oxyquinoline Oxyquinoline: An antiseptic with mild fungistatic, bacteriostatic, anthelmintic, and amebicidal action. It is also used as a reagent and metal chelator, as a carrier for radio-indium for diagnostic purposes, and its halogenated derivatives are used in addition as topical anti-infective agents and oral antiamebics.. quinolin-8-ol : A monohydroxyquinoline that is quinoline substituted by a hydroxy group at position 8. Its fungicidal properties are used for the control of grey mould on vines and tomatoes.	2.87	4	0	monohydroxyquinoline	antibacterial agent; antifungal agrochemical; antiseptic drug; iron chelator
tacrine Tacrine: A cholinesterase inhibitor that crosses the blood-brain barrier. Tacrine has been used to counter the effects of muscle relaxants, as a respiratory stimulant, and in the treatment of Alzheimer's disease and other central nervous system disorders.. tacrine : A member of the class of acridines that is 1,2,3,4-tetrahydroacridine substituted by an amino group at position 9. It is used in the treatment of Alzheimer's disease.	2.98	4	0	acridines; aromatic amine	EC 3.1.1.7 (acetylcholinesterase) inhibitor
aa 861 2,3,5-trimethyl-6-(12-hydroxy-5,10-dodecadiynyl)-1,4-benzoquinone: structure given in first source. docebenone : A member of the class of benzoquinones that is p-benzoquinone in which the hydrogens are substituted by three methyl groups and a 12-hydroxydodeca-5,10-diyn-1-yl group.	2.42	2	0	1,4-benzoquinones; acetylenic compound; primary alcohol	EC 1.13.11.34 (arachidonate 5-lipoxygenase) inhibitor; ferroptosis inhibitor
acebutolol Acebutolol: A cardioselective beta-1 adrenergic antagonist with little effect on the bronchial receptors. The drug has stabilizing and quinidine-like effects on cardiac rhythm, as well as weak inherent sympathomimetic action.. acebutolol : An ether that is the 2-acetyl-4-(butanoylamino)phenyl ether of the primary hydroxy group of 3-(propan-2-ylamino)propane-1,2-diol.	2.75	3	0	aromatic amide; ethanolamines; ether; monocarboxylic acid amide; propanolamine; secondary amino compound	anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; sympathomimetic agent
acetaminophen Acetaminophen: Analgesic antipyretic derivative of acetanilide. It has weak anti-inflammatory properties and is used as a common analgesic, but may cause liver, blood cell, and kidney damage.. paracetamol : A member of the class of phenols that is 4-aminophenol in which one of the hydrogens attached to the amino group has been replaced by an acetyl group.	3.73	10	0	acetamides; phenols	antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; cyclooxygenase 3 inhibitor; environmental contaminant; ferroptosis inducer; geroprotector; hepatotoxic agent; human blood serum metabolite; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic
acetazolamide Acetazolamide: One of the CARBONIC ANHYDRASE INHIBITORS that is sometimes effective against absence seizures. It is sometimes useful also as an adjunct in the treatment of tonic-clonic, myoclonic, and atonic seizures, particularly in women whose seizures occur or are exacerbated at specific times in the menstrual cycle. However, its usefulness is transient often because of rapid development of tolerance. Its antiepileptic effect may be due to its inhibitory effect on brain carbonic anhydrase, which leads to an increased transneuronal chloride gradient, increased chloride current, and increased inhibition. (From Smith and Reynard, Textbook of Pharmacology, 1991, p337)	2.92	4	0	monocarboxylic acid amide; sulfonamide; thiadiazoles	anticonvulsant; diuretic; EC 4.2.1.1 (carbonic anhydrase) inhibitor
acetohexamide Acetohexamide: A sulfonylurea hypoglycemic agent that is metabolized in the liver to 1-hydrohexamide.. acetohexamide : An N-sulfonylurea that is urea in which a hydrogen attached to one of the nitrogens is replaced by a p-acetylphenylsulfonyl group, while a hydrogen attached to the other nitrogen is replaced by a cyclohexyl group.	2.05	1	0	acetophenones; N-sulfonylurea	hypoglycemic agent; insulin secretagogue
acetohydroxamic acid acetohydroxamic acid: urease inhibitor. oxime : Compounds of structure R2C=NOH derived from condensation of aldehydes or ketones with hydroxylamine. Oximes from aldehydes may be called aldoximes; those from ketones may be called ketoximes.. N-hydroxyacetimidic acid : A carbohydroximic acid consisting of acetimidic acid having a hydroxy group attached to the imide nitrogen.. acetohydroxamic acid : A member of the class of acetohydroxamic acids that is acetamide in which one of the amino hydrogens has been replaced by a hydroxy group.	2.05	1	0	acetohydroxamic acids; carbohydroximic acid	algal metabolite; EC 3.5.1.5 (urease) inhibitor
methacholine methacholine : A quaternary ammonium ion in which the nitrogen is substituted with three methyl groups and a 2-acetoxypropyl group. Parasympathomimetic bronchoconstrictor drug used in clinical diagnosis.	2.04	1	0	acetate ester; quaternary ammonium ion	bronchoconstrictor agent; cholinergic agonist; epitope; muscarinic agonist; vasodilator agent
tyrphostin ag 1024 tyrphostin AG 1024: modulates radiosensitivity in human breast cancer cells; also an IGF1 receptor inhibitor	2.01	1	0	alkylbenzene
alaproclate alaproclate: specific 5-hydroxytryptamine uptake inhibitors; RN given refers to (DL)-isomer	2.06	1	0	alpha-amino acid ester
albendazole [no description available]	5.26	3	1	aryl sulfide; benzimidazoles; benzimidazolylcarbamate fungicide; carbamate ester	anthelminthic drug; microtubule-destabilising agent; tubulin modulator
albuterol Albuterol: A short-acting beta-2 adrenergic agonist that is primarily used as a bronchodilator agent to treat ASTHMA. Albuterol is prepared as a racemic mixture of R(-) and S(+) stereoisomers. The stereospecific preparation of R(-) isomer of albuterol is referred to as levalbuterol.. albuterol : A member of the class of phenylethanolamines that is 4-(2-amino-1-hydroxyethyl)-2-(hydroxymethyl)phenol having a tert-butyl group attached to the nirogen atom. It acts as a beta-adrenergic agonist used in the treatment of asthma and chronic obstructive pulmonary disease (COPD).	2.46	2	0	phenols; phenylethanolamines; secondary amino compound	beta-adrenergic agonist; bronchodilator agent; environmental contaminant; xenobiotic
alendronate alendronic acid : A 1,1-bis(phosphonic acid) that is methanebis(phosphonic acid) in which the two methylene hydrogens are replaced by hydroxy and 3-aminopropyl groups.	2.06	1	0	1,1-bis(phosphonic acid); primary amino compound	bone density conservation agent; EC 2.5.1.1 (dimethylallyltranstransferase) inhibitor
alfuzosin alfuzosin: structure given in first source	2.05	1	0	monocarboxylic acid amide; quinazolines; tetrahydrofuranol	alpha-adrenergic antagonist; antihypertensive agent; antineoplastic agent
alpha-methylserotonin alpha-methylserotonin: potent agonist at M & D receptors of serotonin; RN given refers to parent cpd	2.43	2	0	tryptamines	serotonergic agonist
alprazolam Alprazolam: A triazolobenzodiazepine compound with antianxiety and sedative-hypnotic actions, that is efficacious in the treatment of PANIC DISORDERS, with or without AGORAPHOBIA, and in generalized ANXIETY DISORDERS. (From AMA Drug Evaluations Annual, 1994, p238). alprazolam : A member of the class of triazolobenzodiazepines that is 4H-[1,2,4]triazolo[4,3-a][1,4]benzodiazepine carrying methyl, phenyl and chloro substituents at positions 1, 6 and 8 respectively. Alprazolam is only found in individuals that have taken this drug.	2.05	1	0	organochlorine compound; triazolobenzodiazepine	anticonvulsant; anxiolytic drug; GABA agonist; muscle relaxant; sedative; xenobiotic
alprenolol Alprenolol: One of the ADRENERGIC BETA-ANTAGONISTS used as an antihypertensive, anti-anginal, and anti-arrhythmic agent.. alprenolol : A secondary alcohol that is propan-2-ol substituted by a 2-allylphenoxy group at position 1 and an isopropylamino group at position 3. It is a beta-adrenergic antagonist used as a antihypertensive, anti-arrhythmia and a sympatholytic agent.	2.75	3	0	secondary alcohol; secondary amino compound	anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; sympatholytic agent
altretamine Altretamine: A hexamethyl-2,4,6-triamine derivative of 1,3,5-triazine.	2.06	1	0	triamino-1,3,5-triazine
aluminum fluoride [no description available]	3.09	5	0	aluminium coordination entity
amantadine amant: an antiviral compound consisting of an adamantane derivative chemically linked to a water-solube polyanioic matrix; structure in first source	3.23	6	0	adamantanes; primary aliphatic amine	analgesic; antiparkinson drug; antiviral drug; dopaminergic agent; NMDA receptor antagonist; non-narcotic analgesic
ambroxol Ambroxol: A metabolite of BROMHEXINE that stimulates mucociliary action and clears the air passages in the respiratory tract. It is usually administered as the hydrochloride.	2.45	2	0	aromatic amine
diatrizoic acid Diatrizoate: A commonly used x-ray contrast medium. As DIATRIZOATE MEGLUMINE and as Diatrizoate sodium, it is used for gastrointestinal studies, angiography, and urography.. amidotrizoic acid : A member of the class of benzoic acids that is benzoic acid having iodo substituents at the 2-, 4- and 6-positions and acetamido substituents at the 3- and 5-positions. It is used, mainly as its N-methylglucamine and sodium salts, as an X-ray contrast medium in gastrointestinal studies, angiography, and urography.	1.94	1	0	acetamides; benzoic acids; organoiodine compound	environmental contaminant; radioopaque medium; xenobiotic
amifostine anhydrous Amifostine: A phosphorothioate proposed as a radiation-protective agent. It causes splenic vasodilation and may block autonomic ganglia.. amifostine : An organic thiophosphate that is the S-phospho derivative of 2-[(3-aminopropyl)amino]ethanethiol. A prodrug for the free thiol, WR-1065, which is used as a cytoprotectant in cancer chemotherapy and radiotherapy.	2.06	1	0	diamine; organic thiophosphate	antioxidant; prodrug; radiation protective agent
aminoglutethimide Aminoglutethimide: An aromatase inhibitor that is used in the treatment of advanced BREAST CANCER.. aminoglutethimide : A dicarboximide that is a six-membered cyclic compound having ethyl and 4-aminophenyl substituents at the 3-position.	2.45	2	0	dicarboximide; piperidones; substituted aniline	adrenergic agent; anticonvulsant; antineoplastic agent; EC 1.14.14.14 (aromatase) inhibitor
pimagedine pimagedine: diamine oxidase & nitric oxide synthase inhibitor; an advanced glycosylation end product inhibitor; used in the treatment of diabetic complications; structure. aminoguanidine : A one-carbon compound whose unique structure renders it capable of acting as a derivative of hydrazine, guanidine or formamide.	2.05	1	0	guanidines; one-carbon compound	EC 1.14.13.39 (nitric oxide synthase) inhibitor; EC 1.4.3.4 (monoamine oxidase) inhibitor
p-aminohippuric acid p-Aminohippuric Acid: The glycine amide of 4-aminobenzoic acid. Its sodium salt is used as a diagnostic aid to measure effective renal plasma flow (ERPF) and excretory capacity.. p-aminohippurate : A hippurate that is the conjugate base of p-aminohippuric acid, arising from deprotonation of the carboxy group.. p-aminohippuric acid : An N-acylglycine that is the 4-amino derivative of hippuric acid; used as a diagnostic agent in the measurement of renal plasma flow.	3.21	6	0	N-acylglycine	Daphnia magna metabolite
theophylline [no description available]	3.95	13	0	dimethylxanthine	adenosine receptor antagonist; anti-asthmatic drug; anti-inflammatory agent; bronchodilator agent; drug metabolite; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; fungal metabolite; human blood serum metabolite; immunomodulator; muscle relaxant; vasodilator agent
amiodarone Amiodarone: An antianginal and class III antiarrhythmic drug. It increases the duration of ventricular and atrial muscle action by inhibiting POTASSIUM CHANNELS and VOLTAGE-GATED SODIUM CHANNELS. There is a resulting decrease in heart rate and in vascular resistance.. amiodarone : A member of the class of 1-benzofurans that is 1-benzofuran substituted by a butyl group at position 2 and a 4-[2-(diethylamino)ethoxy]-3,5-diiodobenzoyl group at position 3. It is a cardiovascular drug used for the treatment of cardiac dysrhythmias.	3.12	5	0	1-benzofurans; aromatic ketone; organoiodine compound; tertiary amino compound	cardiovascular drug
amitriptyline Amitriptyline: Tricyclic antidepressant with anticholinergic and sedative properties. It appears to prevent the re-uptake of norepinephrine and serotonin at nerve terminals, thus potentiating the action of these neurotransmitters. Amitriptyline also appears to antagonize cholinergic and alpha-1 adrenergic responses to bioactive amines.. amitriptyline : An organic tricyclic compound that is 10,11-dihydro-5H-dibenzo[a,d][7]annulene substituted by a 3-(dimethylamino)propylidene group at position 5.	2.94	4	0	carbotricyclic compound; tertiary amine	adrenergic uptake inhibitor; antidepressant; environmental contaminant; tropomyosin-related kinase B receptor agonist; xenobiotic
amlodipine Amlodipine: A long-acting dihydropyridine calcium channel blocker. It is effective in the treatment of ANGINA PECTORIS and HYPERTENSION.. amlodipine : A fully substituted dialkyl 1,4-dihydropyridine-3,5-dicarboxylate derivative, which is used for the treatment of hypertension, chronic stable angina and confirmed or suspected vasospastic angina.	2.42	2	0	dihydropyridine; ethyl ester; methyl ester; monochlorobenzenes; primary amino compound	antihypertensive agent; calcium channel blocker; vasodilator agent
amobarbital Amobarbital: A barbiturate with hypnotic and sedative properties (but not antianxiety). Adverse effects are mainly a consequence of dose-related CNS depression and the risk of dependence with continued use is high. (From Martindale, The Extra Pharmacopoeia, 30th ed, p565). amobarbital : A member of the class of barbiturates that is pyrimidine-2,4,6(1H,3H,5H)-trione substituted by a 3-methylbutyl and an ethyl group at position 5. Amobarbital has been shown to exhibit sedative and hypnotic properties.	2.37	2	0	barbiturates
amprolium Amprolium: A veterinary coccidiostat that interferes with THIAMINE metabolism.. amprolium : An organic chloride salt having 1-[(4-amino-2-propylpyrimidin-5-yl)methyl]-2-methylpyridin-1-ium as the counterion. Used for prevention of coccidiosis in poultry and cattle.. amprolium(1+) : A pyridinium ion that is the cationic portion of amprolium, a veterinary drug which is used for prevention of coccidiosis in poultry and cattle.	1.95	1	0	pyridinium ion	coccidiostat
amsacrine Amsacrine: An aminoacridine derivative that intercalates into DNA and is used as an antineoplastic agent.. amsacrine : A sulfonamide that is N-phenylmethanesulfonamide substituted by a methoxy group at position 3 and an acridin-9-ylamino group at position 4. It exhibits antineoplastic activity.	2.05	1	0	acridines; aromatic ether; sulfonamide	antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor
anastrozole [no description available]	2.05	1	0	nitrile; triazoles	antineoplastic agent; EC 1.14.14.14 (aromatase) inhibitor
anethole trithione Anethole Trithione: Choleretic used to allay dry mouth and constipation due to tranquilizers.	2.05	1	0	methoxybenzenes
antazoline Antazoline: An antagonist of histamine H1 receptors.. antazoline : A member of the class of imidazolines that is 2-aminomethyl-2-imidazoline in which the exocyclic amino hydrogens are replaced by benzyl and phenyl groups. Antazoline is only found in individuals that have taken the drug.	2.04	1	0	aromatic amine; imidazolines; tertiary amino compound	cholinergic antagonist; H1-receptor antagonist; xenobiotic
9-anthroic acid 9-anthroic acid: RN given refers to unlabeled parent cpd; chloride channel blocker; do not confuse with c-ANCA (anti-neutrophil cytoplasmic antibodies) which is frequently abbreviated as ANCA. 9-anthroic acid : An anthroic acid carrying the carboxy substituent at position 9.	2	1	0	anthroic acid
anthralin Anthralin: An anthracene derivative that disrupts MITOCHONDRIA function and structure and is used for the treatment of DERMATOSES, especially PSORIASIS. It may cause FOLLICULITIS.. anthralin : An anthracene compound derived by the substitution of -OH groups for hydrogen at C-1 and C-8, and with an oxo group at C-9.	2.05	1	0	anthracenes	antipsoriatic
antipyrine Antipyrine: An analgesic and antipyretic that has been given by mouth and as ear drops. Antipyrine is often used in testing the effects of other drugs or diseases on drug-metabolizing enzymes in the liver. (From Martindale, The Extra Pharmacopoeia, 30th ed, p29). antipyrine : A pyrazolone derivative that is 1,2-dihydropyrazol-3-one substituted with methyl groups at N-1 and C-5 and with a phenyl group at N-2.	4.21	5	0	pyrazolone	antipyretic; cyclooxygenase 3 inhibitor; environmental contaminant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic
acetovanillone apocynin : An aromatic ketone that is 1-phenylethanone substituted by a hydroxy group at position 4 and a methoxy group at position 3.	2.11	1	0	acetophenones; aromatic ketone; methyl ketone	antirheumatic drug; EC 1.6.3.1. [NAD(P)H oxidase (H2O2-forming)] inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; peripheral nervous system drug; plant metabolite
arcaine arcaine: RN given refers to parent cpd; structure. 1,4-diguanidinobutane : A guanidine derivative consisting of butane having guanidino groups at the 1- and 4-positions.	1.98	1	0	guanidines
aristolochic acid i aristolochic acid I: phospholipase A inhibitor. aristolochic acid A : An aristolochic acid that is phenanthrene-1-carboxylic acid that is substituted by a methylenedioxy group at the 3,4 positions, by a methoxy group at position 8, and by a nitro group at position 10. It is the most abundant of the aristolochic acids and is found in almost all Aristolochia (birthworts or pipevines) species. It has been tried in a number of treatments for inflammatory disorders, mainly in Chinese and folk medicine. However, there is concern over their use as aristolochic acid is both carcinogenic and nephrotoxic.	2.44	2	0	aristolochic acids; aromatic ether; C-nitro compound; cyclic acetal; monocarboxylic acid; organic heterotetracyclic compound	carcinogenic agent; metabolite; mutagen; nephrotoxin; toxin
aspirin Aspirin: The prototypical analgesic used in the treatment of mild to moderate pain. It has anti-inflammatory and antipyretic properties and acts as an inhibitor of cyclooxygenase which results in the inhibition of the biosynthesis of prostaglandins. Aspirin also inhibits platelet aggregation and is used in the prevention of arterial and venous thrombosis. (From Martindale, The Extra Pharmacopoeia, 30th ed, p5). acetylsalicylate : A benzoate that is the conjugate base of acetylsalicylic acid, arising from deprotonation of the carboxy group.. acetylsalicylic acid : A member of the class of benzoic acids that is salicylic acid in which the hydrogen that is attached to the phenolic hydroxy group has been replaced by an acetoxy group. A non-steroidal anti-inflammatory drug with cyclooxygenase inhibitor activity.	4.17	17	0	benzoic acids; phenyl acetates; salicylates	anticoagulant; antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; drug allergen; EC 1.1.1.188 (prostaglandin-F synthase) inhibitor; geroprotector; non-narcotic analgesic; non-steroidal anti-inflammatory drug; plant activator; platelet aggregation inhibitor; prostaglandin antagonist; teratogenic agent
astemizole Astemizole: Antihistamine drug now withdrawn from the market in many countries because of rare but potentially fatal side effects.. astemizole : A piperidine compound having a 2-(4-methoxyphenyl)ethyl group at the 1-position and an N-[(4-fluorobenzyl)benzimidazol-2-yl]amino group at the 4-position.	2.04	1	0	benzimidazoles; piperidines	anti-allergic agent; anticoronaviral agent; H1-receptor antagonist
atenolol Atenolol: A cardioselective beta-1 adrenergic blocker possessing properties and potency similar to PROPRANOLOL, but without a negative inotropic effect.. atenolol : An ethanolamine compound having a (4-carbamoylmethylphenoxy)methyl group at the 1-position and an N-isopropyl substituent.	3.15	5	0	ethanolamines; monocarboxylic acid amide; propanolamine	anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; environmental contaminant; sympatholytic agent; xenobiotic
azathioprine Azathioprine: An immunosuppressive agent used in combination with cyclophosphamide and hydroxychloroquine in the treatment of rheumatoid arthritis. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), this substance has been listed as a known carcinogen. (Merck Index, 11th ed). azathioprine : A thiopurine that is 6-mercaptopurine in which the mercapto hydrogen is replaced by a 1-methyl-4-nitroimidazol-5-yl group. It is a prodrug for mercaptopurine and is used as an immunosuppressant, prescribed for the treatment of inflammatory conditions and after organ transplantation and also for treatment of Crohn's didease and MS.	3.36	7	0	aryl sulfide; C-nitro compound; imidazoles; thiopurine	antimetabolite; antineoplastic agent; carcinogenic agent; DNA synthesis inhibitor; hepatotoxic agent; immunosuppressive agent; prodrug
azobenzene azobenzene: photosensor molecule known to undergo reversible isomerization from trans to cis on illumination with photons of appropriate wavelength; RN given refers to cpd without isomeric designation; structure. (E)-azobenzene : The (E)-isomer of azobenzene.. (Z)-azobenzene : The (Z)-isomer of azobenzene.. azobenzene : A molecule whose structure comprises two phenyl rings linked by a N=N double bond; the parent compound of the azobenzene class of compounds.	2.13	1	0	azobenzenes
azosemide azosemide : A sulfonamide that is benzenesulfonamide which is substituted at positions 2, 4, and 5 by chlorine, (2-thienylmethyl)amino and 1H-tetrazol-5-yl groups, respectively. It is a diuretic that has been used in the management of oedema and hypertension.	2.05	1	0	monochlorobenzenes; sulfonamide; tetrazoles; thiophenes	loop diuretic
aztreonam Aztreonam: A monocyclic beta-lactam antibiotic originally isolated from Chromobacterium violaceum. It is resistant to beta-lactamases and is used in gram-negative infections, especially of the meninges, bladder, and kidneys. It may cause a superinfection with gram-positive organisms.. aztreonam : A synthetic monocyclic beta-lactam antibiotic (monobactam), used primarily to treat infections caused by Gram-negative bacteria. It inhibits mucopeptide synthesis in the bacterial cell wall, thereby blocking peptidoglycan crosslinking.	4.05	3	1
baclofen [no description available]	2.05	1	0	amino acid zwitterion; gamma-amino acid; monocarboxylic acid; monochlorobenzenes; primary amino compound	central nervous system depressant; GABA agonist; muscle relaxant
barbital 5,5-diethylbarbituric acid : A member of the class of barbiturates, the structure of which is that of barbituric acid substituted at C-5 by two ethyl groups. Formerly used as a hypnotic (sleeping aid).	2.45	2	0	barbiturates	drug allergen
bay-k-8644 3-Pyridinecarboxylic acid, 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ester: A dihydropyridine derivative, which, in contrast to NIFEDIPINE, functions as a calcium channel agonist. The compound facilitates Ca2+ influx through partially activated voltage-dependent Ca2+ channels, thereby causing vasoconstrictor and positive inotropic effects. It is used primarily as a research tool.. Bay-K-8644 : A racemate comprising equimolar amounts of (R)- and (S)-Bay-K-8644. methyl 2,6-dimethyl-5-nitro-4-[2-(trifluoromethyl)phenyl]-1,4-dihydropyridine-3-carboxylate : A pentasubstituted dihydropyridine carrying methoxycarbonyl, 2-(trifluoromethyl)phenyl and nitro substituents at positions 3, 4 and 5 respectively as well as two methyl substituents at positions 2 and 6.	2.89	4	0	(trifluoromethyl)benzenes; C-nitro compound; dihydropyridine; methyl ester
bendazac bendazac : A monocarboxylic acid that is glycolic acid in which the hydrogen attached to the 2-hydroxy group is replaced by a 1-benzyl-1H-indazol-3-yl group. Although it has anti-inflammatory, antinecrotic, choleretic and antilipidaemic properties and has been used for the treatment of various inflammatory skin disorders, its principal effect is to inhibit the denaturation of proteins. Its lysine salt is used in the management of cataracts.	2.46	2	0	indazoles; monocarboxylic acid	non-steroidal anti-inflammatory drug; radical scavenger
bendroflumethiazide Bendroflumethiazide: A thiazide diuretic with actions and uses similar to those of HYDROCHLOROTHIAZIDE. It has been used in the treatment of familial hyperkalemia, hypertension, edema, and urinary tract disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p810). bendroflumethiazide : A sulfonamide consisting of 7-sulfamoyl-3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxide in which the hydrogen at position 6 is substituted by a trifluoromethyl group and that at position 3 is substituted by a benzyl group.	2.04	1	0	benzothiadiazine; sulfonamide	antihypertensive agent; diuretic
benserazide Benserazide: An inhibitor of DOPA DECARBOXYLASE that does not enter the central nervous system. It is often given with LEVODOPA in the treatment of parkinsonism to prevent the conversion of levodopa to dopamine in the periphery, thereby increasing the amount that reaches the central nervous system and reducing the required dose. It has no antiparkinson actions when given alone.. benserazide : A carbohydrazide that results from the formal condensation of the carboxy group of DL-serine with the primary amino group of 4-(hydrazinylmethyl)benzene-1,2,3-triol. An aromatic-L-amino-acid decarboxylase inhibitor (DOPA decarboxylase inhibitor) that does not enter the central nervous system, it is used as its hydrochloride salt as an adjunct to levodopa in the treatment of parkinsonism. By preventing the conversion of levodopa to dopamine in the periphery, it causes an increase in the amount of levodopa reaching the central nervous system and so reduces the required dose. Benserazide has no antiparkinson actions when given alone.	2.06	1	0	carbohydrazide; catechols; primary alcohol; primary amino compound	antiparkinson drug; dopaminergic agent; EC 4.1.1.28 (aromatic-L-amino-acid decarboxylase) inhibitor
benzamide benzamide : An aromatic amide that consists of benzene bearing a single carboxamido substituent. The parent of the class of benzamides.	2.04	1	0	benzamides
benzbromarone Benzbromarone: Uricosuric that acts by increasing uric acid clearance. It is used in the treatment of gout.. benzbromarone : 1-Benzofuran substituted at C-2 and C-3 by an ethyl group and a 3,5-dibromo-4-hydroxybenzoyl group respectively. An inhibitor of CYP2C9, it is used as an anti-gout medication.	2.97	4	0	1-benzofurans; aromatic ketone	uricosuric drug
benzethonium Benzethonium: Bactericidal cationic quaternary ammonium surfactant used as a topical anti-infective agent. It is an ingredient in medicaments, deodorants, mouthwashes, etc., and is used to disinfect apparatus, etc., in the food processing and pharmaceutical industries, in surgery, and also as a preservative. The compound is toxic orally as a result of neuromuscular blockade.	3.78	3	0	alkylbenzene
benzo(a)pyrene Benzo(a)pyrene: A potent mutagen and carcinogen. It is a public health concern because of its possible effects on industrial workers, as an environmental pollutant, an as a component of tobacco smoke.. benzo[a]pyrene : An ortho- and peri-fused polycyclic arene consisting of five fused benzene rings.	1.93	1	0	ortho- and peri-fused polycyclic arene	carcinogenic agent; mouse metabolite
benzocaine Benzocaine: A surface anesthetic that acts by preventing transmission of impulses along NERVE FIBERS and at NERVE ENDINGS.. dextran sulfate sodium : An organic sodium salt of dextran sulfate. It induces colitis in mice.. benzocaine : A benzoate ester having 4-aminobenzoic acid as the acid component and ethanol as the alcohol component. A surface anaesthetic, it is used to suppress the gag reflex, and as a lubricant and topical anaesthetic on the larynx, mouth, nasal cavity, respiratory tract, oesophagus, rectum, urinary tract, and vagina.	6.91	25	0	benzoate ester; substituted aniline	allergen; antipruritic drug; sensitiser; topical anaesthetic
benzquinamide [no description available]	2.04	1	0	monocarboxylic acid amide	antiemetic; antipsychotic agent; H1-receptor antagonist; muscarinic antagonist; sedative
bepridil Bepridil: A long-acting calcium-blocking agent with significant anti-anginal activity. The drug produces significant coronary vasodilation and modest peripheral effects. It has antihypertensive and selective anti-arrhythmia activities and acts as a calmodulin antagonist.. bepridil : A tertiary amine in which the substituents on nitrogen are benzyl, phenyl and 3-(2-methylpropoxy)-2-(pyrrolidin-1-yl)propyl.	2.04	1	0	pyrrolidines; tertiary amine	anti-arrhythmia drug; antihypertensive agent; calcium channel blocker; vasodilator agent
berberine [no description available]	4.1	3	1	alkaloid antibiotic; berberine alkaloid; botanical anti-fungal agent; organic heteropentacyclic compound	antilipemic drug; antineoplastic agent; antioxidant; EC 1.1.1.141 [15-hydroxyprostaglandin dehydrogenase (NAD(+))] inhibitor; EC 1.1.1.21 (aldehyde reductase) inhibitor; EC 1.13.11.52 (indoleamine 2,3-dioxygenase) inhibitor; EC 1.21.3.3 (reticuline oxidase) inhibitor; EC 2.1.1.116 [3'-hydroxy-N-methyl-(S)-coclaurine 4'-O-methyltransferase] inhibitor; EC 2.1.1.122 [(S)-tetrahydroprotoberberine N-methyltransferase] inhibitor; EC 2.7.11.10 (IkappaB kinase) inhibitor; EC 3.1.1.4 (phospholipase A2) inhibitor; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; EC 3.1.3.48 (protein-tyrosine-phosphatase) inhibitor; EC 3.4.14.5 (dipeptidyl-peptidase IV) inhibitor; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; geroprotector; hypoglycemic agent; metabolite; potassium channel blocker
diminazene Diminazene: An effective trypanocidal agent.. diminazene : A triazene derivative that is triazene in which each of the terminal nitrogens is substituted by a 4-carbamimidoylphenyl group.	2.01	1	0	carboxamidine; triazene derivative	antiparasitic agent; trypanocidal drug
bethanidine Bethanidine: A guanidinium antihypertensive agent that acts by blocking adrenergic transmission. The precise mode of action is not clear.	2.04	1	0	guanidines	adrenergic antagonist; antihypertensive agent
betaxolol [no description available]	2.74	3	0	propanolamine	antihypertensive agent; beta-adrenergic antagonist; sympatholytic agent
bethanechol Bethanechol: A slowly hydrolyzing muscarinic agonist with no nicotinic effects. Bethanechol is generally used to increase smooth muscle tone, as in the GI tract following abdominal surgery or in urinary retention in the absence of obstruction. It may cause hypotension, HEART RATE changes, and BRONCHIAL SPASM.. bethanechol : The carbamic acid ester of 2-methylcholine. A slowly hydrolysed muscarinic agonist with no nicotinic effects, it is used as its chloride salt to increase smooth muscle tone, as in the gastrointestinal tract following abdominal surgery, treatment of gastro-oesophageal reflux disease, and as an alternative to catheterisation in the treatment of non-obstructive urinary retention.	2.9	4	0	carbamate ester; quaternary ammonium ion	muscarinic agonist
bicalutamide bicalutamide: approved for treatment of advanced prostate cancer. N-[4-cyano-3-(trifluoromethyl)phenyl]-3-[(4-fluorophenyl)sulfonyl]-2-hydroxy-2-methylpropanamide : A member of the class of (trifluoromethyl)benzenes that is 4-amino-2-(trifluoromethyl)benzonitrile in which one of the amino hydrogens is substituted by a 3-[(4-fluorophenyl)sulfonyl]-2-hydroxy-2-methylpropanoyl group.. bicalutamide : A racemate comprising of equal amounts of (R)-bicalutamide and (S)-bicalutamide. It is an oral non-steroidal antiandrogen used in the treatment of prostate cancer and hirsutism.	2.46	2	0	(trifluoromethyl)benzenes; monocarboxylic acid amide; monofluorobenzenes; nitrile; sulfone; tertiary alcohol
bay h 4502 bifonazole : A racemate comprising equimolar amounts of R- and S-bifonazole. It is a broad spectrum antifungal drug used for the treatment of fungal skin and nail infections.. 1-[biphenyl-4-yl(phenyl)methyl]imidazole : A member of the class of imidazoles carrying an alpha-(biphenyl-4-yl)benzyl substituent at position 1.	2.05	1	0	biphenyls; imidazoles
biperiden Biperiden: A muscarinic antagonist that has effects in both the central and peripheral nervous systems. It has been used in the treatment of arteriosclerotic, idiopathic, and postencephalitic parkinsonism. It has also been used to alleviate extrapyramidal symptoms induced by phenothiazine derivatives and reserpine.. biperiden : A member of the class of piperidines that is N-propylpiperidine in which the methyl hydrogens have been replaced by hydroxy, phenyl, and 5-norbornen-2-yl groups. A muscarinic antagonist affecting both the central and peripheral nervous systems, it is used in the treatment of all forms of Parkinson's disease.	2.06	1	0	piperidines; tertiary alcohol; tertiary amino compound	antidote to sarin poisoning; antidyskinesia agent; antiparkinson drug; muscarinic antagonist; parasympatholytic
bisacodyl Bisacodyl: A diphenylmethane stimulant laxative used for the treatment of CONSTIPATION and for bowel evacuation. (From Martindale, The Extra Pharmacopoeia, 30th ed, p871)	2.66	3	0	diarylmethane
bisbenzimidazole Bisbenzimidazole: A benzimidazole antifilarial agent; it is fluorescent when it binds to certain nucleotides in DNA, thus providing a tool for the study of DNA replication; it also interferes with mitosis.	3.66	9	0	bibenzimidazole; N-methylpiperazine	anthelminthic drug; fluorochrome
bisindolylmaleimide i bisindolylmaleimide I: a bis(indolyl)maleimide	3.51	8	0
bisoprolol Bisoprolol: A cardioselective beta-1 adrenergic blocker. It is effective in the management of HYPERTENSION and ANGINA PECTORIS.	2.46	2	0	secondary alcohol; secondary amine	anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; sympatholytic agent
bromazepam Bromazepam: One of the BENZODIAZEPINES that is used in the treatment of ANXIETY DISORDERS.	2.05	1	0	organic molecular entity
bromhexine Bromhexine: A mucolytic agent used in the treatment of respiratory disorders associated with viscid or excessive mucus. (From Martindale, The Extra Pharmacopoeia, 30th ed, p744). bromhexine : A substituted aniline that is 2,4-dibromoaniline which is substituted at position 6 by a [cyclohexyl(methyl)amino]methyl group. It is used (as the monohydrochloride salt) as a mucolytic for the treatment of respiratory disorders associated with productive cough (i.e. a cough characterised by the production of sputum).	2.46	2	0	organobromine compound; substituted aniline; tertiary amino compound	mucolytic
bromisovalum Bromisovalum: A sedative and mild hypnotic with potentially toxic effects.. bromisoval : A racemate comprising equimolar amounts of (R)- and (S)-bromisoval. It was previously used for its hypnotic and sedative properties but the use of bromides is now deprecated due to the possibility of the toxic accumulation of bromine in the body.. 2-bromo-N-carbamoyl-3-methylbutanamide : An N-acylurea that is urea in which one of the hydrogens is replaced by a 2-bromo-3-methybutanoyl group.	2.05	1	0	N-acylurea; organobromine compound
brotizolam brotizolam: structure	2.05	1	0	organic molecular entity
bumetanide [no description available]	2.75	3	0	amino acid; benzoic acids; sulfonamide	diuretic; EC 3.6.3.49 (channel-conductance-controlling ATPase) inhibitor
bunitrolol bunitrolol: was heading 1975-94 (see under PROPANOLAMINES 1975-90); KO 1366 was see BUNITROLOL 1975-94; use PROPANOLAMINES to search BUNITROLOL 1975-94; a beta-adrenergic receptor antagonist with weak antiarrhythmic activity and minor ability to decrease the heart rate	2.04	1	0	aromatic ether
bupivacaine Bupivacaine: A widely used local anesthetic agent.. 1-butyl-N-(2,6-dimethylphenyl)piperidine-2-carboxamide : A piperidinecarboxamide obtained by formal condensation of the carboxy group of N-butylpipecolic acid with the amino group of 2,6-dimethylaniline.. bupivacaine : A racemate composed of equimolar amounts of dextrobupivacaine and levobupivacaine. Used (in the form of its hydrochloride hydrate) as a local anaesthetic.	2.05	1	0	aromatic amide; piperidinecarboxamide; tertiary amino compound
bupranolol Bupranolol: An adrenergic-beta-2 antagonist that has been used for cardiac arrhythmia, angina pectoris, hypertension, glaucoma, and as an antithrombotic.	2.04	1	0	aromatic ether
buspirone Buspirone: An anxiolytic agent and serotonin receptor agonist belonging to the azaspirodecanedione class of compounds. Its structure is unrelated to those of the BENZODIAZAPINES, but it has an efficacy comparable to DIAZEPAM.. buspirone : An azaspiro compound that is 8-azaspiro[4.5]decane-7,9-dione substituted at the nitrogen atom by a 4-(piperazin-1-yl)butyl group which in turn is substituted by a pyrimidin-2-yl group at the N(4) position.	2.74	3	0	azaspiro compound; N-alkylpiperazine; N-arylpiperazine; organic heteropolycyclic compound; piperidones; pyrimidines	anxiolytic drug; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; sedative; serotonergic agonist
busulfan [no description available]	2.75	3	0	methanesulfonate ester	alkylating agent; antineoplastic agent; carcinogenic agent; insect sterilant; teratogenic agent
butalbital butalbital: management of butalbital withdrawal can be simplified by using a phenobarbital-loading protocol; RN given refers to parent cpd. butalbital : A member of the class of barbiturates that is barbituric acid in which the hydrogens at position 5 are substituted by an allyl group and an isobutyl group. Frequently combined with other medicines, such as aspirin, paracetamol and codeine, it is used for treatment of pain and headache.	2.45	2	0	barbiturates	analgesic; sedative
caffeine [no description available]	4.79	32	0	purine alkaloid; trimethylxanthine	adenosine A2A receptor antagonist; adenosine receptor antagonist; adjuvant; central nervous system stimulant; diuretic; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; environmental contaminant; food additive; fungal metabolite; geroprotector; human blood serum metabolite; mouse metabolite; mutagen; plant metabolite; psychotropic drug; ryanodine receptor agonist; xenobiotic
verapamil Verapamil: A calcium channel blocker that is a class IV anti-arrhythmia agent.. verapamil : A racemate comprising equimolar amounts of dexverapamil and (S)-verapamil. An L-type calcium channel blocker of the phenylalkylamine class, it is used (particularly as the hydrochloride salt) in the treatment of hypertension, angina pectoris and cardiac arrhythmia, and as a preventive medication for migraine.. 2-(3,4-dimethoxyphenyl)-5-{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino}-2-(propan-2-yl)pentanenitrile : A tertiary amino compound that is 3,4-dimethoxyphenylethylamine in which the hydrogens attached to the nitrogen are replaced by a methyl group and a 4-cyano-4-(3,4-dimethoxyphenyl)-5-methylhexyl group.	4.8	32	0	aromatic ether; nitrile; polyether; tertiary amino compound
beta-glycerophosphoric acid beta-glycerophosphoric acid: plays role in mineralization of bone in vitro. glycerol 2-phosphate : A glycerol monophosphate having the phosphate group at the 2-position.	2	1	0	glycerol monophosphate	Escherichia coli metabolite; plant metabolite
metrizoate Metrizoic Acid: A diagnostic radiopaque that usually occurs as the sodium salt.	2.04	1	0	monocarboxylic acid	radioopaque medium
calmidazolium calmidazolium: powerful inhibitor of or red blood cell Ca++-ATPase & Ca++ transport into inside-out red blood cell vesicles; RN refers to chloride; structure in first source; an antagonist of calmodulin. calmidazolium : An imidazolium ion that is imidazolium cation substituted by a bis(4-chlorophenyl)methyl group at position 1 and a 2-[(2,4-dichlorobenzyl)oxy]-2-(2,4-dichlorophenyl)ethyl group at position 3. It acts as an antagonist of calmodulin, a calcium binding messenger protein.	2.68	3	0	imidazolium ion	apoptosis inducer; calmodulin antagonist
camphor, (+-)-isomer [no description available]	1.95	1	0	bornane monoterpenoid; cyclic monoterpene ketone	plant metabolite
candesartan cilexetil candesartan cilexetil: a prodrug which is metabolized to an active form candesartan to exert its biological effects	2.05	1	0	biphenyls
carbamazepine Carbamazepine: A dibenzazepine that acts as a sodium channel blocker. It is used as an anticonvulsant for the treatment of grand mal and psychomotor or focal SEIZURES. It may also be used in the management of BIPOLAR DISORDER, and has analgesic properties.. carbamazepine : A dibenzoazepine that is 5H-dibenzo[b,f]azepine carrying a carbamoyl substituent at the azepine nitrogen, used as an anticonvulsant.	2.74	3	0	dibenzoazepine; ureas	analgesic; anticonvulsant; antimanic drug; drug allergen; EC 3.5.1.98 (histone deacetylase) inhibitor; environmental contaminant; glutamate transporter activator; mitogen; non-narcotic analgesic; sodium channel blocker; xenobiotic
carbazochrome carbazochrome: a hemostatic which increases capillary resistance & activates platelet factors, Note: Adona is a multimeaning tradename	2.04	1	0
carbinoxamine carbinoxamine: Note: tradenames that start with Histex refer to more than one drug. carbinoxamine : An organochlorine compound that is 2-(4-chlorobenzyl)pyridine in which one of the benzylic hydrogens is substituted by 2-(dimethylamino)ethoxy group. It is an ethanolamine-type antihistamine, used as its maleate salt for treating hay fever, as well as mild cases of Parkinson's disease.	2.46	2	0	monochlorobenzenes; pyridines; tertiary amino compound	anti-allergic agent; antiparkinson drug; H1-receptor antagonist; muscarinic antagonist
carisoprodol Carisoprodol: A centrally acting skeletal muscle relaxant whose mechanism of action is not completely understood but may be related to its sedative actions. It is used as an adjunct in the symptomatic treatment of musculoskeletal conditions associated with painful muscle spasm. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1202). carisoprodol : A carbamate ester that is the mono-N-isopropyl derivative of meprobamate (which is a significant metabolite). Carisoprodol interrupts neuronal communication within the reticular formation and spinal cord, resulting in sedation and alteration in pain perception. It is used as a muscle relaxant in the symptomatic treatment of musculoskeletal conditions associated with painful muscle spasm.	2.05	1	0	carbamate ester	muscle relaxant
carmustine Carmustine: A cell-cycle phase nonspecific alkylating antineoplastic agent. It is used in the treatment of brain tumors and various other malignant neoplasms. (From Martindale, The Extra Pharmacopoeia, 30th ed, p462) This substance may reasonably be anticipated to be a carcinogen according to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985). (From Merck Index, 11th ed). carmustine : A member of the class of N-nitrosoureas that is 1,3-bis(2-chloroethyl)urea in which one of the nitrogens is substituted by a nitroso group.	2.74	3	0	N-nitrosoureas; organochlorine compound	alkylating agent; antineoplastic agent
carprofen carprofen: RN given refers to cpd without isomeric designation. carprofen : Propanoic acid in which one of the methylene hydrogens is substituted by a 6-chloro-9H-carbazol-2-yl group. A non-steroidal anti-inflammatory drug, it is no longer used in human medicine but is still used for treatment of arthritis in elderly dogs.	2.05	1	0	carbazoles; organochlorine compound	EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-steroidal anti-inflammatory drug; photosensitizing agent
carvedilol [no description available]	2.05	1	0	carbazoles; secondary alcohol; secondary amino compound	alpha-adrenergic antagonist; antihypertensive agent; beta-adrenergic antagonist; cardiovascular drug; vasodilator agent
carbonyl cyanide m-chlorophenyl hydrazone Carbonyl Cyanide m-Chlorophenyl Hydrazone: A proton ionophore. It is commonly used as an uncoupling agent and inhibitor of photosynthesis because of its effects on mitochondrial and chloroplast membranes.. CCCP : A member of the class of monochlorobenzenes that is benzene substituted by 2-(1,3-dinitrilopropan-2-ylidene)hydrazinyl and chloro groups at positions 1 and 3, respectively. It is a mitochondrial depolarizing agent that induces reactive oxygen species mediated cell death.	2.66	3	0	hydrazone; monochlorobenzenes; nitrile	antibacterial agent; geroprotector; ionophore
cefuroxime Cefuroxime: Broad-spectrum cephalosporin antibiotic resistant to beta-lactamase. It has been proposed for infections with gram-negative and gram-positive organisms, GONORRHEA, and HAEMOPHILUS.. cefuroxime : A 3-(carbamoyloxymethyl)cephalosporin compound having a 7-(2Z)-2-(furan-2-yl)-2-(methoxyimino)acetamido side chain.	2.39	2	0	carbamate ester; cephalosporin
celecoxib [no description available]	2.05	1	0	organofluorine compound; pyrazoles; sulfonamide; toluenes	cyclooxygenase 2 inhibitor; geroprotector; non-narcotic analgesic; non-steroidal anti-inflammatory drug
cetirizine Cetirizine: A potent second-generation histamine H1 antagonist that is effective in the treatment of allergic rhinitis, chronic urticaria, and pollen-induced asthma. Unlike many traditional antihistamines, it does not cause drowsiness or anticholinergic side effects.. cetirizine : A member of the class of piperazines that is piperazine in which the hydrogens attached to nitrogen are replaced by a (4-chlorophenyl)(phenyl)methyl and a 2-(carboxymethoxy)ethyl group respectively.	2.05	1	0	ether; monocarboxylic acid; monochlorobenzenes; piperazines	anti-allergic agent; environmental contaminant; H1-receptor antagonist; xenobiotic
cetyltrimethylammonium ion Cetrimonium: Cetyltrimethylammonium compound whose salts and derivatives are used primarily as topical antiseptics.. cetyltrimethylammonium ion : A quaternary ammonium ion in which the substituents on nitrogen are one hexadecyl and three methyl groups.	2.11	1	0	quaternary ammonium ion
chelerythrine chelerythrine : A benzophenanthridine alkaloid isolated from the root of Zanthoxylum simulans, Chelidonium majus L., and other Papaveraceae.	3.62	9	0	benzophenanthridine alkaloid; organic cation	antibacterial agent; antineoplastic agent; EC 2.7.11.13 (protein kinase C) inhibitor
chloral hydrate [no description available]	3.76	2	1	aldehyde hydrate; ethanediol; organochlorine compound	general anaesthetic; mouse metabolite; sedative; xenobiotic
chlorambucil Chlorambucil: A nitrogen mustard alkylating agent used as antineoplastic for chronic lymphocytic leukemia, Hodgkin's disease, and others. Although it is less toxic than most other nitrogen mustards, it has been listed as a known carcinogen in the Fourth Annual Report on Carcinogens (NTP 85-002, 1985). (Merck Index, 11th ed). chlorambucil : A monocarboxylic acid that is butanoic acid substituted at position 4 by a 4-[bis(2-chloroethyl)amino]phenyl group. A chemotherapy drug that can be used in combination with the antibody obinutuzumab for the treatment of chronic lymphocytic leukemia.	2.46	2	0	aromatic amine; monocarboxylic acid; nitrogen mustard; organochlorine compound; tertiary amino compound	alkylating agent; antineoplastic agent; carcinogenic agent; drug allergen; immunosuppressive agent
chlorcyclizine chlorcyclizine: was heading 1964-94 (Prov 1964-73); CHLOROCYCLIZINE & HISTACHLORAZINE were see CHLORCYCLIZINE 1977-94; use PIPERAZINES to search CHLORCYCLIZINE 1966-94; histamine H1-blocker used both orally and topically in allergies and also for the prevention of motion sickness	2.04	1	0	diarylmethane
chlordiazepoxide Chlordiazepoxide: An anxiolytic benzodiazepine derivative with anticonvulsant, sedative, and amnesic properties. It has also been used in the symptomatic treatment of alcohol withdrawal.. chlordiazepoxide : A benzodiazepine that is 3H-1,4-benzodiazepine 4-oxide substituted by a chloro group at position 7, a phenyl group at position 5 and a methylamino group at position 2.	2.46	2	0	benzodiazepine
chlormezanone Chlormezanone: A non-benzodiazepine that is used in the management of anxiety. It has been suggested for use in the treatment of muscle spasm.. chlormezanone : A 1,3-thiazine that is 1,3-thiazinan-4-one S,S-dioxide in which a hydrogen at position 2 is substituted by a 4-chlorophenyl group and the hydrogen attached to the nitrogen is substituted by methyl. A non-benzodiazepine muscle relaxant, it was used in the management of anxiety and in the treatment of muscle spasms until being discontinued worldwide by its manufacturer in 1996, due to rare but serious cutaneous reactions.	2.46	2	0	1,3-thiazine; lactam; monochlorobenzenes; sulfone	antipsychotic agent; anxiolytic drug; muscle relaxant
chloroquine Chloroquine: The prototypical antimalarial agent with a mechanism that is not well understood. It has also been used to treat rheumatoid arthritis, systemic lupus erythematosus, and in the systemic therapy of amebic liver abscesses.. chloroquine : An aminoquinoline that is quinoline which is substituted at position 4 by a [5-(diethylamino)pentan-2-yl]amino group at at position 7 by chlorine. It is used for the treatment of malaria, hepatic amoebiasis, lupus erythematosus, light-sensitive skin eruptions, and rheumatoid arthritis.	6.4	13	1	aminoquinoline; organochlorine compound; secondary amino compound; tertiary amino compound	anticoronaviral agent; antimalarial; antirheumatic drug; autophagy inhibitor; dermatologic drug
chlorothiazide Chlorothiazide: A thiazide diuretic with actions and uses similar to those of HYDROCHLOROTHIAZIDE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p812). thiazide : Heterocyclic compound with sulfur and nitrogen in the ring.. chlorothiazide : 4H-1,2,4-benzothiadiazine 1,1-dioxide in which the hydrogen at position is substituted by chlorine and that at position 7 is substituted by a sulfonamide group. A diuretic, it is used for treatment of oedema and hypertension.	2.92	4	0	benzothiadiazine	antihypertensive agent; diuretic
chloroxine chloroxine : A monohydroxyquinoline that is quinolin-8-ol in which the hydrogens at positions 5 and 7 have been substituted by chlorine. A synthetic antibacterial prepared by chlorination of quinolin-8-ol, it is used for the treatment of dandruff and seborrhoeic dermatitis of the scalp.	2.04	1	0	monohydroxyquinoline; organochlorine compound	antibacterial agent; antifungal drug; antiseborrheic
chloroxylenol chloroxylenol: topical antiseptic; RN given refers to parent cpd; structure. 4-chloro-3,5-dimethylphenol : A member of the class of phenols that is 3,5-xylenol which is substituted at position 4 by chlorine. It is bactericidal against most Gram-positive bacteria but less effective against Staphylococci and Gram-negative bacteria, and often inactive against Pseudomonas species. It is ineffective against bacterial spores.	3.49	2	0	monochlorobenzenes; phenols	antiseptic drug; disinfectant; molluscicide
chlorpheniramine Chlorpheniramine: A histamine H1 antagonist used in allergic reactions, hay fever, rhinitis, urticaria, and asthma. It has also been used in veterinary applications. One of the most widely used of the classical antihistaminics, it generally causes less drowsiness and sedation than PROMETHAZINE.. chlorphenamine : A tertiary amino compound that is propylamine which is substituted at position 3 by a pyridin-2-yl group and a p-chlorophenyl group and in which the hydrogens attached to the nitrogen are replaced by methyl groups. A histamine H1 antagonist, it is used to relieve the symptoms of hay fever, rhinitis, urticaria, and asthma.	2.73	3	0	monochlorobenzenes; pyridines; tertiary amino compound	anti-allergic agent; antidepressant; antipruritic drug; H1-receptor antagonist; histamine antagonist; serotonin uptake inhibitor
chlorpromazine Chlorpromazine: The prototypical phenothiazine antipsychotic drug. Like the other drugs in this class chlorpromazine's antipsychotic actions are thought to be due to long-term adaptation by the brain to blocking DOPAMINE RECEPTORS. Chlorpromazine has several other actions and therapeutic uses, including as an antiemetic and in the treatment of intractable hiccup.. chlorpromazine : A substituted phenothiazine in which the ring nitrogen at position 10 is attached to C-3 of an N,N-dimethylpropanamine moiety.	4.05	15	0	organochlorine compound; phenothiazines; tertiary amine	anticoronaviral agent; antiemetic; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; phenothiazine antipsychotic drug
chlorpropamide Chlorpropamide: A sulfonylurea hypoglycemic agent used in the treatment of non-insulin-dependent diabetes mellitus not responding to dietary modification. (From Martindale, The Extra Pharmacopoeia, 30th ed, p277). chlorpropamide : An N-sulfonylurea that is urea in which a hydrogen attached to one of the nitrogens is substituted by 4-chlorobenzenesulfonyl group and a hydrogen attached to the other nitrogen is substituted by propyl group. Chlorpropamide is a hypoglycaemic agent used in the treatment of type 2 (non-insulin-dependent) diabetes mellitus not responding to dietary modification.	2.97	4	0	monochlorobenzenes; N-sulfonylurea	hypoglycemic agent; insulin secretagogue
chlorzoxazone Chlorzoxazone: A centrally acting central muscle relaxant with sedative properties. It is claimed to inhibit muscle spasm by exerting an effect primarily at the level of the spinal cord and subcortical areas of the brain. (From Martindale, The Extra Pharmacopoea, 30th ed, p1202). chlorzoxazone : A member of the class of 1,3-benzoxazoles that is 1,3-benzoxazol-2-ol in which the hydrogen atom at position 5 is substituted by chlorine. A centrally acting muscle relaxant with sedative properties, it is used for the symptomatic treatment of painful muscle spasm.	2.46	2	0	1,3-benzoxazoles; heteroaryl hydroxy compound; organochlorine compound	muscle relaxant; sedative
ciglitazone ciglitazone: structure given in second source; PPAR agonist used for type II diabetes. ciglitazone : An aromatic ether that consists of 1,3-thiazolidine-2,4-dione with position 5 substituted by a 4-[(1-methylcyclohexyl)methoxy]benzyl group. A selective PPARgamma agonist.	2.05	1	0	aromatic ether; thiazolidinone	antineoplastic agent; insulin-sensitizing drug
cimetidine Cimetidine: A histamine congener, it competitively inhibits HISTAMINE binding to HISTAMINE H2 RECEPTORS. Cimetidine has a range of pharmacological actions. It inhibits GASTRIC ACID secretion, as well as PEPSIN and GASTRIN output.. cimetidine : A member of the class of guanidines that consists of guanidine carrying a methyl substituent at position 1, a cyano group at position 2 and a 2-{[(5-methyl-1H-imidazol-4-yl)methyl]sulfanyl}ethyl group at position 3. It is a H2-receptor antagonist that inhibits the production of acid in stomach.	5.62	14	0	aliphatic sulfide; guanidines; imidazoles; nitrile	adjuvant; analgesic; anti-ulcer drug; H2-receptor antagonist; P450 inhibitor
cinoxacin Cinoxacin: Synthetic antimicrobial related to OXOLINIC ACID and NALIDIXIC ACID and used in URINARY TRACT INFECTIONS.. cinoxacin : A member of the class of cinnolines that is 6,7-methylenedioxycinnolin-4(1H)-one bearing an ethyl group at position 1 and a carboxylic acid group at position 3. An analogue of oxolinic acid, it has similar antibacterial actions. It was formerly used for the treatment of urinary tract infections.	2.05	1	0	cinnolines; oxacycle; oxo carboxylic acid	antibacterial drug; antiinfective agent
ciprofibrate [no description available]	2.74	3	0	cyclopropanes; monocarboxylic acid; organochlorine compound	antilipemic drug
ciprofloxacin Ciprofloxacin: A broad-spectrum antimicrobial carboxyfluoroquinoline.. ciprofloxacin : A quinolone that is quinolin-4(1H)-one bearing cyclopropyl, carboxylic acid, fluoro and piperazin-1-yl substituents at positions 1, 3, 6 and 7, respectively.	10.71	46	9	aminoquinoline; cyclopropanes; fluoroquinolone antibiotic; N-arylpiperazine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone; zwitterion	antibacterial drug; antiinfective agent; antimicrobial agent; DNA synthesis inhibitor; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; environmental contaminant; topoisomerase IV inhibitor; xenobiotic
cisapride Cisapride: A substituted benzamide used for its prokinetic properties. It is used in the management of gastroesophageal reflux disease, functional dyspepsia, and other disorders associated with impaired gastrointestinal motility. (Martindale The Extra Pharmacopoeia, 31st ed). cisapride : The amide resulting from formal condensation of 4-amino-5-chloro-2-methoxybenzoic acid with cis-1-[3-(4-fluorophenoxy)propyl]-3-methoxypiperidin-4-amine. It has been used (as its monohydrate or as its tartrate) for the treatment of gastro-oesophageal reflux disease and for non-ulcer dyspepsia, but its propensity to cause cardiac arrhythmias resulted in its complete withdrawal from many countries, including the U.K., and restrictions on its use elsewhere.	4.11	3	1	benzamides
citalopram Citalopram: A furancarbonitrile that is one of the serotonin uptake inhibitors used as an antidepressant. The drug is also effective in reducing ethanol uptake in alcoholics and is used in depressed patients who also suffer from TARDIVE DYSKINESIA in preference to tricyclic antidepressants, which aggravate dyskinesia.. citalopram : A racemate comprising equimolar amounts of (R)-citalopram and its enantiomer, escitalopram. It is used as an antidepressant, although only escitalopram is active.. 1-[3-(dimethylamino)propyl]-1-(4-fluorophenyl)-1,3-dihydro-2-benzofuran-5-carbonitrile : A nitrile that is 1,3-dihydro-2-benzofuran-5-carbonitrile in which one of the hydrogens at position 1 is replaced by a p-fluorophenyl group, while the other is replaced by a 3-(dimethylamino)propyl group.	2.45	2	0	2-benzofurans; cyclic ether; nitrile; organofluorine compound; tertiary amino compound
clenbuterol Clenbuterol: A substituted phenylaminoethanol that has beta-2 adrenomimetic properties at very low doses. It is used as a bronchodilator in asthma.. clenbuterol : A substituted aniline that is 2,6-dichloroaniline in which the hydrogen at position 4 has been replaced by a 2-(tert-butylamino)-1-hydroxyethyl group.	1.99	1	0	amino alcohol; dichlorobenzene; ethanolamines; primary arylamine; secondary amino compound; substituted aniline	beta-adrenergic agonist; bronchodilator agent; sympathomimetic agent
clioquinol Clioquinol: A potentially neurotoxic 8-hydroxyquinoline derivative long used as a topical anti-infective, intestinal antiamebic, and vaginal trichomonacide. The oral preparation has been shown to cause subacute myelo-optic neuropathy and has been banned worldwide.. 5-chloro-7-iodoquinolin-8-ol : A monohydroxyquinoline that is quinolin-8-ol in which the hydrogens at positions 5 and 7 are replaced by chlorine and iodine, respectively. It has antibacterial and atifungal properties, and is used in creams for the treatment of skin infections. It has also been investigated as a chelator of copper and zinc ions for the possible treatment of Alzheimer's disease.	7.67	31	6	monohydroxyquinoline; organochlorine compound; organoiodine compound	antibacterial agent; antifungal agent; antimicrobial agent; antineoplastic agent; antiprotozoal drug; chelator; copper chelator
clobazam Clobazam: A benzodiazepine derivative that is a long-acting GABA-A RECEPTOR agonist. It is used as an antiepileptic in the treatment of SEIZURES, including seizures associated with LENNOX-GASTAUT SYNDROME. It is also used as an anxiolytic, for the short-term treatment of acute ANXIETY.. clobazam : 7-Chloro-1H-1,5-benzodiazepine-2,4(3H,5H)-dione in which the hydrogen attached to the nitrogen at position 1 is substituted by a methyl group, whilst that attached to the other nitrogen is substituted by a phenyl group. It is used for the short-term management of acute anxiety and as an adjunct in the treatment of epilepsy in association with other antiepileptics.	2.05	1	0	1,4-benzodiazepinone; organochlorine compound	anticonvulsant; anxiolytic drug; GABA modulator
clofazimine Clofazimine: A fat-soluble riminophenazine dye used for the treatment of leprosy. It has been used investigationally in combination with other antimycobacterial drugs to treat Mycobacterium avium infections in AIDS patients. Clofazimine also has a marked anti-inflammatory effect and is given to control the leprosy reaction, erythema nodosum leprosum. (From AMA Drug Evaluations Annual, 1993, p1619). clofazimine : 3-Isopropylimino-3,5-dihydro-phenazine in which the hydrogen at position 5 is substituted substituted by a 4-chlorophenyl group, and that at position 2 is substituted by a (4-chlorophenyl)amino group. A dark red crystalline solid, clofazimine is an antimycobacterial and is one of the main drugs used for the treatment of multi-bacillary leprosy. However, it can cause red/brown discolouration of the skin, so other treatments are often preferred in light-skinned patients.	2.74	3	0	monochlorobenzenes; phenazines	dye; leprostatic drug; non-steroidal anti-inflammatory drug
clofibrate angiokapsul: contains clofibrate & insoitolnicotinate	10.4	48	2	aromatic ether; ethyl ester; monochlorobenzenes	anticholesteremic drug; antilipemic drug; geroprotector; PPARalpha agonist
clofibric acid Clofibric Acid: An antilipemic agent that is the biologically active metabolite of CLOFIBRATE.. clofibric acid : A monocarboxylic acid that is isobutyric acid substituted at position 2 by a p-chlorophenoxy group. It is a metabolite of the drug clofibrate.	1.95	1	0	aromatic ether; monocarboxylic acid; monochlorobenzenes	anticholesteremic drug; antilipemic drug; antineoplastic agent; herbicide; marine xenobiotic metabolite; PPARalpha agonist
clomiphene [no description available]	2.05	1	0	tertiary amine	estrogen antagonist; estrogen receptor modulator
clomipramine Clomipramine: A tricyclic antidepressant similar to IMIPRAMINE that selectively inhibits the uptake of serotonin in the brain. It is readily absorbed from the gastrointestinal tract and demethylated in the liver to form its primary active metabolite, desmethylclomipramine.. clomipramine : A dibenzoazepine that is 10,11-dihydro-5H-dibenzo[b,f]azepine which is substituted by chlorine at position 3 and in which the hydrogen attached to the nitrogen is replaced by a 3-(dimethylamino)propyl group. One of the more sedating tricyclic antidepressants, it is used as the hydrochloride salt for the treatment of depression as well as obsessive-compulsive disorder and phobias.	2.45	2	0	dibenzoazepine	anticoronaviral agent; antidepressant; EC 1.8.1.12 (trypanothione-disulfide reductase) inhibitor; serotonergic antagonist; serotonergic drug; serotonin uptake inhibitor
clonazepam Clonazepam: An anticonvulsant used for several types of seizures, including myotonic or atonic seizures, photosensitive epilepsy, and absence seizures, although tolerance may develop. It is seldom effective in generalized tonic-clonic or partial seizures. The mechanism of action appears to involve the enhancement of GAMMA-AMINOBUTYRIC ACID receptor responses.. clonazepam : 1,3-Dihydro-2H-1,4-benzodiazepin-2-one in which the hydrogens at positions 5 and 7 are substituted by 2-chlorophenyl and nitro groups, respectively. It is used in the treatment of all types of epilepsy and seizures, as well as myoclonus and associated abnormal movements, and panic disorders. However, its use can be limited by the development of tolerance and by sedation.	1.99	1	0	1,4-benzodiazepinone; monochlorobenzenes	anticonvulsant; anxiolytic drug; GABA modulator
clonidine Clonidine: An imidazoline sympatholytic agent that stimulates ALPHA-2 ADRENERGIC RECEPTORS and central IMIDAZOLINE RECEPTORS. It is commonly used in the management of HYPERTENSION.. clonidine (amino form) : A clonidine that is 4,5-dihydro-1H-imidazol-2-amine in which one of the amino hydrogens is replaced by a 2,6-dichlorophenyl group.	2.97	4	0	clonidine; imidazoline
4-chloro-N-(2,6-dimethyl-1-piperidinyl)-3-sulfamoylbenzamide [no description available]	2.05	1	0	sulfonamide
clotiazepam clotiazepam: was heading 1975-94 (see under AZEPINES 1978-90; was Y 6047 see under AZEPINES 1975-77); Y 6047 was see CLOTIAZEPAM 1978-94; use AZEPINES to search CLOTIAZEPAM 1975-94; thienodiazepine derivative with actions similar to those of benzodiazepines	2.05	1	0	organic molecular entity
clotrimazole [no description available]	3.26	6	0	conazole antifungal drug; imidazole antifungal drug; imidazoles; monochlorobenzenes	antiinfective agent; environmental contaminant; xenobiotic
cromolyn cromoglycic acid : A dicarboxylic acid that is the bis-chromone derivative of glycerol. It is effective as a mast cell stabilizer.	2.06	1	0	chromones; dicarboxylic acid	anti-asthmatic drug; calcium channel blocker
cyclandelate Cyclandelate: A direct-acting SMOOTH MUSCLE relaxant used to dilate BLOOD VESSELS.. cyclandelate : The ester obtained by formal condensation of mandelic acid and 3,3,5-tricyclohexanol. It is a direct-acting smooth muscle relaxant used to dilate blood vessels.	2.45	2	0	carboxylic ester; secondary alcohol	vasodilator agent
cyclofenil Cyclofenil: A gonadal stimulant and inducer of ovulation. It is used in the treatment of infertility and amenorrhea, but is thought to be less effective than CLOMIPHENE.	2.46	2	0	organic molecular entity
cycloleucine Cycloleucine: An amino acid formed by cyclization of leucine. It has cytostatic, immunosuppressive and antineoplastic activities.. 1-aminocyclopentanecarboxylic acid : A non-proteinogenic alpha-amino acid that is cyclopentane substituted at position 1 by amino and carboxy groups.	2.9	4	0	non-proteinogenic alpha-amino acid	EC 2.5.1.6 (methionine adenosyltransferase) inhibitor
cyclopenthiazide Cyclopenthiazide: Thiazide diuretic also used as an antihypertensive agent.	2.36	2	0	benzothiadiazine
cyclopentolate Cyclopentolate: A parasympatholytic anticholinergic used solely to obtain mydriasis or cycloplegia.. cyclopentolate : A carboxylic ester resulting from the formal condensation of (1-hydroxycyclopentyl)(phenyl)acetic acid with N,N-dimethylethanolamine. A tertiary amine antimuscarinic with actions similar to atropine, it is used as its hydrochloride salt to produce mydriasis (excessive dilation of the pupil) and cycloplegia (paralysis of the ciliary muscle of the eye) for opthalmic diagnostic procedures. It acts more quickly than atropine and has a shorter duration of action.	2.37	2	0	carboxylic ester; tertiary alcohol; tertiary amino compound	diagnostic agent; muscarinic antagonist; mydriatic agent; parasympatholytic
cypermethrin cypermethrin : A carboxylic ester resulting from the formal condensation between 3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxylic acid and the alcoholic hydroxy group of hydroxy(3-phenoxyphenyl)acetonitrile.. zeta-cypermethrin : A diastereoisomeric mixture comprising the isomeric pair (1R)-cis-(alphaS)- and (1S)-trans-(alphaR)-cypermethrin together with the isomeric pair (1S)-cis-(alphaS)- and (1S)-trans-(alphaS)-cypermethrin where the ratio between the isomeric pairs lies in the range 45:55 to 55:45.	1.99	1	0	aromatic ether; cyclopropanecarboxylate ester; nitrile; organochlorine compound	agrochemical; molluscicide; pyrethroid ester acaricide; pyrethroid ester insecticide
cyproheptadine Cyproheptadine: A serotonin antagonist and a histamine H1 blocker used as antipruritic, appetite stimulant, antiallergic, and for the post-gastrectomy dumping syndrome, etc.. cyproheptadine : The product resulting from the formal oxidative coupling of position 5 of 5H-dibenzo[a,d]cycloheptene with position 4 of 1-methylpiperidine resulting in the formation of a double bond between the two fragments. It is a sedating antihistamine with antimuscarinic and calcium-channel blocking actions. It is used (particularly as the hydrochloride sesquihydrate) for the relief of allergic conditions including rhinitis, conjunctivitis due to inhalant allergens and foods, urticaria and angioedema, and in pruritic skin disorders. Unlike other antihistamines, it is also a seratonin receptor antagonist, making it useful in conditions such as vascular headache and anorexia.	2.05	1	0	piperidines; tertiary amine	anti-allergic agent; antipruritic drug; gastrointestinal drug; H1-receptor antagonist; serotonergic antagonist
cystamine [no description available]	1.94	1	0	organic disulfide; primary amino compound	EC 2.3.2.13 (protein-glutamine gamma-glutamyltransferase) inhibitor
danthron danthron: structure. chrysazin : A dihydroxyanthraquinone that is anthracene-9,10-dione substituted by hydroxy groups at positions 1 and 8.	2.05	1	0	dihydroxyanthraquinone	apoptosis inducer; plant metabolite
dantrolene Dantrolene: Skeletal muscle relaxant that acts by interfering with excitation-contraction coupling in the muscle fiber. It is used in spasticity and other neuromuscular abnormalities. Although the mechanism of action is probably not central, dantrolene is usually grouped with the central muscle relaxants.. dantrolene : The hydrazone resulting from the formal condensation of 5-(4-nitrophenyl)furfural with 1-aminohydantoin. A ryanodine receptor antagonist used for the relief of chronic severe spasticity and malignant hyperthermia.	2.69	3	0	hydrazone; imidazolidine-2,4-dione	muscle relaxant; neuroprotective agent; ryanodine receptor antagonist
dapi DAPI: RN given refers to parent cpd.	3.13	5	0	indoles	fluorochrome
dapsone [no description available]	2.89	4	0	substituted aniline; sulfone	anti-inflammatory drug; antiinfective agent; antimalarial; leprostatic drug
debrisoquin Debrisoquin: An adrenergic neuron-blocking drug similar in effects to GUANETHIDINE. It is also noteworthy in being a substrate for a polymorphic cytochrome P-450 enzyme. Persons with certain isoforms of this enzyme are unable to properly metabolize this and many other clinically important drugs. They are commonly referred to as having a debrisoquin 4-hydroxylase polymorphism.	2.04	1	0	carboxamidine; isoquinolines	adrenergic agent; antihypertensive agent; human metabolite; sympatholytic agent
deferoxamine Deferoxamine: Natural product isolated from Streptomyces pilosus. It forms iron complexes and is used as a chelating agent, particularly in the mesylate form.. desferrioxamine B : An acyclic desferrioxamine that is butanedioic acid in which one of the carboxy groups undergoes formal condensation with the primary amino group of N-(5-aminopentyl)-N-hydroxyacetamide and the second carboxy group undergoes formal condensation with the hydroxyamino group of N(1)-(5-aminopentyl)-N(1)-hydroxy-N(4)-[5-(hydroxyamino)pentyl]butanediamide. It is a siderophore native to Streptomyces pilosus biosynthesised by the DesABCD enzyme cluster as a high affinity Fe(III) chelator.	2.72	3	0	acyclic desferrioxamine	bacterial metabolite; ferroptosis inhibitor; iron chelator; siderophore
dequalinium Dequalinium: A topical bacteriostat that is available as various salts. It is used in wound dressings and mouth infections and may also have antifungal action, but may cause skin ulceration.. dequalinium : A quinolinium ion comprising decane in which one methyl hydrogen at each end of the molecule has been replaced by a 4-amino-2-methylquinolin-1-yl group.	2.34	2	0	quinolinium ion	antifungal agent; antineoplastic agent; antiseptic drug; mitochondrial NADH:ubiquinone reductase inhibitor
desipramine Desipramine: A tricyclic dibenzazepine compound that potentiates neurotransmission. Desipramine selectively blocks reuptake of norepinephrine from the neural synapse, and also appears to impair serotonin transport. This compound also possesses minor anticholinergic activity, through its affinity to muscarinic receptors.. desipramine : A dibenzoazepine consisting of 10,11-dihydro-5H-dibenzo[b,f]azepine substituted on nitrogen with a 3-(methylamino)propyl group.	3.13	5	0	dibenzoazepine; secondary amino compound	adrenergic uptake inhibitor; alpha-adrenergic antagonist; antidepressant; cholinergic antagonist; drug allergen; EC 3.1.4.12 (sphingomyelin phosphodiesterase) inhibitor; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; H1-receptor antagonist; serotonin uptake inhibitor
nordazepam Nordazepam: An intermediate in the metabolism of DIAZEPAM to OXAZEPAM. It may have actions similar to those of diazepam.. nordazepam : A 1,4-benzodiazepinone having phenyl and chloro substituents at positions 5 and 7 respectively; it has anticonvulsant, anxiolytic, muscle relaxant and sedative properties but is used primarily in the treatment of anxiety.	2.46	2	0	1,4-benzodiazepinone; organochlorine compound	anticonvulsant; anxiolytic drug; GABA modulator; human metabolite; sedative
amphetamine Amphetamine: A powerful central nervous system stimulant and sympathomimetic. Amphetamine has multiple mechanisms of action including blocking uptake of adrenergics and dopamine, stimulation of release of monamines, and inhibiting monoamine oxidase. Amphetamine is also a drug of abuse and a psychotomimetic. The l- and the d,l-forms are included here. The l-form has less central nervous system activity but stronger cardiovascular effects. The d-form is DEXTROAMPHETAMINE.. 1-phenylpropan-2-amine : A primary amine that is isopropylamine in which a hydrogen attached to one of the methyl groups has been replaced by a phenyl group.. amphetamine : A racemate comprising equimolar amounts of (R)-amphetamine (also known as levamphetamine or levoamphetamine) and (S)-amphetamine (also known as dexamfetamine or dextroamphetamine.	2.45	2	0	primary amine
eflornithine Eflornithine: An inhibitor of ORNITHINE DECARBOXYLASE, the rate limiting enzyme of the polyamine biosynthetic pathway.. eflornithine : A fluoroamino acid that is ornithine substituted by a difluoromethyl group at position 2.	3.26	6	0	alpha-amino acid; fluoroamino acid	trypanocidal drug
r 59022 R 59022: diacylglycerol kinase inhibitor; structure given in first source; platelet activator factor antagonist	3.09	5	0	diarylmethane
diazepam Diazepam: A benzodiazepine with anticonvulsant, anxiolytic, sedative, muscle relaxant, and amnesic properties and a long duration of action. Its actions are mediated by enhancement of GAMMA-AMINOBUTYRIC ACID activity.. diazepam : A 1,4-benzodiazepinone that is 1,3-dihydro-2H-1,4-benzodiazepin-2-one substituted by a chloro group at position 7, a methyl group at position 1 and a phenyl group at position 5.	3.4	7	0	1,4-benzodiazepinone; organochlorine compound	anticonvulsant; anxiolytic drug; environmental contaminant; sedative; xenobiotic
diazoxide Diazoxide: A benzothiadiazine derivative that is a peripheral vasodilator used for hypertensive emergencies. It lacks diuretic effect, apparently because it lacks a sulfonamide group.. diazoxide : A benzothiadiazine that is the S,S-dioxide of 2H-1,2,4-benzothiadiazine which is substituted at position 3 by a methyl group and at position 7 by chlorine. A peripheral vasodilator, it increases the concentration of glucose in the plasma and inhibits the secretion of insulin by the beta- cells of the pancreas. It is used orally in the management of intractable hypoglycaemia and intravenously in the management of hypertensive emergencies.	2.46	2	0	benzothiadiazine; organochlorine compound; sulfone	antihypertensive agent; beta-adrenergic agonist; bronchodilator agent; cardiotonic drug; diuretic; K-ATP channel agonist; sodium channel blocker; sympathomimetic agent; vasodilator agent
dibucaine Dibucaine: A local anesthetic of the amide type now generally used for surface anesthesia. It is one of the most potent and toxic of the long-acting local anesthetics and its parenteral use is restricted to spinal anesthesia. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1006). cinchocaine : A monocarboxylic acid amide that is the 2-(diethylamino)ethyl amide of 2-butoxyquinoline-4-carboxylic acid. One of the most potent and toxic of the long-acting local anesthetics, its parenteral use was restricted to spinal anesthesia. It is now generally only used (usually as the hydrochloride) in creams and ointments and in suppositories for temporary relief of pain and itching associated with skin and anorectal conditions.	5.16	6	2	aromatic ether; monocarboxylic acid amide; tertiary amino compound	topical anaesthetic
diclofenac Diclofenac: A non-steroidal anti-inflammatory agent (NSAID) with antipyretic and analgesic actions. It is primarily available as the sodium salt.. diclofenac : A monocarboxylic acid consisting of phenylacetic acid having a (2,6-dichlorophenyl)amino group at the 2-position.	5.47	8	2	amino acid; aromatic amine; dichlorobenzene; monocarboxylic acid; secondary amino compound	antipyretic; drug allergen; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; environmental contaminant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic
ddt 1,1-bis(p-chlorophenyl)-2,2,2-trichloroethane: structure in first source	2.05	1	0	benzenoid aromatic compound; chlorophenylethane; monochlorobenzenes; organochlorine insecticide	bridged diphenyl acaricide; carcinogenic agent; endocrine disruptor; persistent organic pollutant
dichlorphenamide Dichlorphenamide: A carbonic anhydrase inhibitor that is used in the treatment of glaucoma.. diclofenamide : A sulfonamide that is benzene-1,3-disulfonamide in which the hydrogens at positions 4 and 5 are substituted by chlorine. An oral carbonic anhydrase inhibitor, it partially suppresses the secretion (inflow) of aqueous humor in the eye and so reduces intraocular pressure. It is used for the treatment of glaucoma.	2.04	1	0	dichlorobenzene; sulfonamide	antiglaucoma drug; EC 4.2.1.1 (carbonic anhydrase) inhibitor; ophthalmology drug
diphenidol diphenidol: shows anti-arrhythmic activity; RN given refers to unlabeled parent cpd. diphenidol : A tertiary alcohol that is butan-1-ol substituted by two phenyl groups at position 1 and a piperidin-1-yl group at position 4.	2.04	1	0	benzenes; piperidines; tertiary alcohol	antiemetic
diflunisal Diflunisal: A salicylate derivative and anti-inflammatory analgesic with actions and side effects similar to those of ASPIRIN.. diflunisal : An organofluorine compound comprising salicylic acid having a 2,4-difluorophenyl group at the 5-position.	2.05	1	0	monohydroxybenzoic acid; organofluorine compound	non-narcotic analgesic; non-steroidal anti-inflammatory drug
dimercaprol Dimercaprol: An anti-gas warfare agent that is effective against Lewisite (dichloro(2-chlorovinyl)arsine) and formerly known as British Anti-Lewisite or BAL. It acts as a chelating agent and is used in the treatment of arsenic, gold, and other heavy metal poisoning.. dimercaprol : A dithiol that is propane-1,2-dithiol in which one of the methyl hydrogens is replaced by a hydroxy group. a chelating agent originally developed during World War II as an experimental antidote against the arsenic-based poison gas Lewisite, it has been used clinically since 1949 for the treatment of poisoning by arsenic, mercury and gold. It can also be used for treatment of poisoning by antimony, bismuth and possibly thallium, and (with sodium calcium edetate) in cases of acute leaad poisoning. Administration is by (painful) intramuscular injection of a suspension of dimercaprol in peanut oil, typically every 4 hours for 2-10 days depending on the toxicity. In the past, dimercaprol was also used for the treatment of Wilson's disease, a severely debilitating genetic disorder in which the body tends to retain copper, with resultant liver and brain injury.	2.35	2	0	dithiol; primary alcohol	chelator
dimetridazole Dimetridazole: A compound used to treat histomoniasis in poultry.. dimetridazole : A C-nitro compound that is 5-nitroimidazole in which the hydrogens at positions 1 and 2 are replaced by methyl groups. An antiprotozoal drug, it has been banned by both the Government of Canada and the European Union as a livestock feed additive owing to suspicions of it being carcinogenic.	2.65	3	0	C-nitro compound; imidazoles	antiparasitic agent; antiprotozoal drug
diphenhydramine Diphenhydramine: A histamine H1 antagonist used as an antiemetic, antitussive, for dermatoses and pruritus, for hypersensitivity reactions, as a hypnotic, an antiparkinson, and as an ingredient in common cold preparations. It has some undesired antimuscarinic and sedative effects.. diphenhydramine : An ether that is the benzhydryl ether of 2-(dimethylamino)ethanol. It is a H1-receptor antagonist used as a antipruritic and antitussive drug.. antitussive : An agent that suppresses cough. Antitussives have a central or a peripheral action on the cough reflex, or a combination of both. Compare with expectorants, which are considered to increase the volume of secretions in the respiratory tract, so facilitating their removal by ciliary action and coughing, and mucolytics, which decrease the viscosity of mucus, facilitating its removal by ciliary action and expectoration.	4.34	6	0	ether; tertiary amino compound	anti-allergic agent; antidyskinesia agent; antiemetic; antiparkinson drug; antipruritic drug; antitussive; H1-receptor antagonist; local anaesthetic; muscarinic antagonist; oneirogen; sedative
dipyridamole Dipyridamole: A phosphodiesterase inhibitor that blocks uptake and metabolism of adenosine by erythrocytes and vascular endothelial cells. Dipyridamole also potentiates the antiaggregating action of prostacyclin. (From AMA Drug Evaluations Annual, 1994, p752). dipyridamole : A pyrimidopyrimidine that is 2,2',2'',2'''-(pyrimido[5,4-d]pyrimidine-2,6-diyldinitrilo)tetraethanol substituted by piperidin-1-yl groups at positions 4 and 8 respectively. A vasodilator agent, it inhibits the formation of blood clots.	2.73	3	0	piperidines; pyrimidopyrimidine; tertiary amino compound; tetrol	adenosine phosphodiesterase inhibitor; EC 3.5.4.4 (adenosine deaminase) inhibitor; platelet aggregation inhibitor; vasodilator agent
disopyramide Disopyramide: A class I anti-arrhythmic agent (one that interferes directly with the depolarization of the cardiac membrane and thus serves as a membrane-stabilizing agent) with a depressant action on the heart similar to that of guanidine. It also possesses some anticholinergic and local anesthetic properties.. disopyramide : A monocarboxylic acid amide that is butanamide substituted by a diisopropylamino group at position 4, a phenyl group at position 2 and a pyridin-2-yl group at position 2. It is used as a anti-arrhythmia drug.	2.74	3	0	monocarboxylic acid amide; pyridines; tertiary amino compound	anti-arrhythmia drug
stallimycin [no description available]	2.36	2	0
disulfiram [no description available]	4.97	9	1	organic disulfide; organosulfur acaricide	angiogenesis inhibitor; antineoplastic agent; apoptosis inducer; EC 1.2.1.3 [aldehyde dehydrogenase (NAD(+))] inhibitor; EC 3.1.1.1 (carboxylesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; EC 5.99.1.2 (DNA topoisomerase) inhibitor; ferroptosis inducer; fungicide; NF-kappaB inhibitor
valproic acid Valproic Acid: A fatty acid with anticonvulsant and anti-manic properties that is used in the treatment of EPILEPSY and BIPOLAR DISORDER. The mechanisms of its therapeutic actions are not well understood. It may act by increasing GAMMA-AMINOBUTYRIC ACID levels in the brain or by altering the properties of VOLTAGE-GATED SODIUM CHANNELS.. valproic acid : A branched-chain saturated fatty acid that comprises of a propyl substituent on a pentanoic acid stem.	3.39	7	0	branched-chain fatty acid; branched-chain saturated fatty acid	anticonvulsant; antimanic drug; EC 3.5.1.98 (histone deacetylase) inhibitor; GABA agent; neuroprotective agent; psychotropic drug; teratogenic agent
doxepin Doxepin: A dibenzoxepin tricyclic compound. It displays a range of pharmacological actions including maintaining adrenergic innervation. Its mechanism of action is not fully understood, but it appears to block reuptake of monoaminergic neurotransmitters into presynaptic terminals. It also possesses anticholinergic activity and modulates antagonism of histamine H(1)- and H(2)-receptors.. doxepin : A dibenzooxepine that is 6,11-dihydrodibenzo[b,e]oxepine substituted by a 3-(dimethylamino)propylidene group at position 11. It is used as an antidepressant drug.	2.46	2	0	dibenzooxepine; tertiary amino compound	antidepressant
doxylamine Doxylamine: Histamine H1 antagonist with pronounced sedative properties. It is used in allergies and as an antitussive, antiemetic, and hypnotic. Doxylamine has also been administered in veterinary applications and was formerly used in PARKINSONISM.	2.04	1	0	pyridines; tertiary amine	anti-allergic agent; antiemetic; antitussive; cholinergic antagonist; H1-receptor antagonist; histamine antagonist; sedative
droperidol Droperidol: A butyrophenone with general properties similar to those of HALOPERIDOL. It is used in conjunction with an opioid analgesic such as FENTANYL to maintain the patient in a calm state of neuroleptanalgesia with indifference to surroundings but still able to cooperate with the surgeon. It is also used as a premedicant, as an antiemetic, and for the control of agitation in acute psychoses. (From Martindale, The Extra Pharmacopoeia, 29th ed, p593). droperidol : An organofluorine compound that is haloperidol in which the hydroxy group has been eliminated with the introduction of a double bond in the piperidine ring, and the 4-chlorophenyl group has been replaced by a benzimidazol-2-on-1-yl group. It is used in the management of chemotherapy-induced nausea and vomiting, and in conjunction with an opioid analgesic such as fentanyl to maintain the patient in a calm state of neuroleptanalgesia with indifference to surroundings but still able to cooperate with the surgeon.	2.05	1	0	aromatic ketone; benzimidazoles; organofluorine compound	anaesthesia adjuvant; antiemetic; dopaminergic antagonist; first generation antipsychotic
dyphylline Dyphylline: A THEOPHYLLINE derivative with broncho- and vasodilator properties. It is used in the treatment of asthma, cardiac dyspnea, and bronchitis.. dyphylline : An oxopurine that is theophylline bearing a 2,3-dihydroxypropyl group at the 7 position. It has broncho- and vasodilator properties, and is used in the treatment of asthma, cardiac dyspnea, and bronchitis. It is also an ingredient in preparations that have been promoted for coughs.	2.04	1	0	oxopurine; propane-1,2-diols	bronchodilator agent; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; muscle relaxant; vasodilator agent
econazole Econazole: An imidazole derivative that is commonly used as a topical antifungal agent.. econazole : A racemate composed of equimolar amounts of (R)- and (S)-econazole. Used (as its nitrate salt) to treat skin infections such as athlete's foot, jock itch, ringworm and other fungal skin infections.. 1-{2-(4-chlorobenzyloxy)-2-(2,4-dichlorophenyl)ethyl}imidazole : A member of the class of imidazoles that is 1-(2,4-dichlorophenyl)-2-(imidazol-1-yl)ethanol in which the hydroxyl hydrogen is replaced by a 4-chlorobenzyl group.	4.06	3	1	dichlorobenzene; ether; imidazoles; monochlorobenzenes
edrophonium Edrophonium: A rapid-onset, short-acting cholinesterase inhibitor used in cardiac arrhythmias and in the diagnosis of myasthenia gravis. It has also been used as an antidote to curare principles.. edrophonium : A quaternary ammonium ion that is N-ethyl-N,N-dimethylanilinium in which one of the meta positions is substituted by a hydroxy group. It is a reversible inhibitor of cholinesterase, with a rapid onset (30-60 seconds after injection) but a short duration of action (5-15 minutes). The chloride salt is used in myasthenia gravis both diagnostically and to distinguish between under- or over-treatment with other anticholinesterases. It has also been used for the reversal of neuromuscular blockade in anaesthesia, and for the management of poisoning due to tetrodotoxin, a neuromuscular blocking toxin found in puffer fish and other marine animals.	1.94	1	0	phenols; quaternary ammonium ion	antidote; diagnostic agent; EC 3.1.1.8 (cholinesterase) inhibitor
enflurane Enflurane: An extremely stable inhalation anesthetic that allows rapid adjustments of anesthesia depth with little change in pulse or respiratory rate.. enflurane : An ether in which the oxygen atom is connected to 2-chloro-1,1,2-trifluoroethyl and difluoromethyl groups.	2.05	1	0	ether; organochlorine compound; organofluorine compound	anaesthetic
enoxacin Enoxacin: A broad-spectrum 6-fluoronaphthyridinone antibacterial agent that is structurally related to NALIDIXIC ACID.. enoxacin : A 1,8-naphthyridine derivative that is 1,4-dihydro-1,8-naphthyridine with an ethyl group at the 1 position, a carboxy group at the 3-position, an oxo sustituent at the 4-position, a fluoro substituent at the 5-position and a piperazin-1-yl group at the 7 position. An antibacterial, it is used in the treatment of urinary-tract infections and gonorrhoea.	2.05	1	0	1,8-naphthyridine derivative; amino acid; fluoroquinolone antibiotic; monocarboxylic acid; N-arylpiperazine; quinolone antibiotic	antibacterial drug; DNA synthesis inhibitor
erythrosine Fluoresceins: A family of spiro(isobenzofuran-1(3H),9'-(9H)xanthen)-3-one derivatives. These are used as dyes, as indicators for various metals, and as fluorescent labels in immunoassays.	3.22	6	0
estazolam Estazolam: A benzodiazepine with anticonvulsant, hypnotic, and muscle relaxant properties. It has been shown in some cases to be more potent than DIAZEPAM or NITRAZEPAM.. estazolam : A triazolo[4,3-a][1,4]benzodiazepine having a phenyl group at position 6 and a chloro substituent at position 8. A short-acting benzodiazepine with general properties similar to diazepam, it is given by mouth as a hypnotic in the short-term management of insomnia.	2.05	1	0	triazoles; triazolobenzodiazepine	anticonvulsant; anxiolytic drug; GABA modulator
ethacrynic acid Ethacrynic Acid: A compound that inhibits symport of sodium, potassium, and chloride primarily in the ascending limb of Henle, but also in the proximal and distal tubules. This pharmacological action results in excretion of these ions, increased urinary output, and reduction in extracellular fluid. This compound has been classified as a loop or high ceiling diuretic.. etacrynic acid : An aromatic ether that is phenoxyacetic acid in which the phenyl ring is substituted by chlorines at positions 2 and 3, and by a 2-methylidenebutanoyl group at position 4. It is a loop diuretic used to treat high blood pressure resulting from diseases such as congestive heart failure, liver failure, and kidney failure. It is also a glutathione S-transferase (EC 2.5.1.18) inhibitor.	5.77	17	0	aromatic ether; aromatic ketone; dichlorobenzene; monocarboxylic acid	EC 2.5.1.18 (glutathione transferase) inhibitor; ion transport inhibitor; loop diuretic
ether Ether: A mobile, very volatile, highly flammable liquid used as an inhalation anesthetic and as a solvent for waxes, fats, oils, perfumes, alkaloids, and gums. It is mildly irritating to skin and mucous membranes.. ether : An organooxygen compound with formula ROR, where R is not hydrogen.. diethyl ether : An ether in which the oxygen atom is linked to two ethyl groups.	2.62	3	0	ether; volatile organic compound	inhalation anaesthetic; non-polar solvent; refrigerant
profenamine profenamine: was heading 1972-94 (see under PHENOTHIAZINES 1972-90); use PHENOTHIAZINES to search ETHOPROPAZINE 1972-94. profenamine : A member of the class of phenothiazines that is phenothiazine in which the hydrogen attached to the nitrogen is substituted by a 2-(diethylamino)propyl group. An antimuscarinic, it is used as the hydrochloride for the symptomatic treatment of Parkinson's disease.	2.04	1	0	phenothiazines; tertiary amino compound	adrenergic antagonist; antidyskinesia agent; antiparkinson drug; histamine antagonist; muscarinic antagonist
ethoxyresorufin ethoxyresorufin: structure	1.99	1	0	phenoxazine
ethoxzolamide Ethoxzolamide: A carbonic anhydrase inhibitor used as diuretic and in glaucoma. It may cause hypokalemia.. ethoxzolamide : A sulfonamide that is 1,3-benzothiazole-2-sulfonamide which is substituted by an ethoxy group at position 6. A carbonic anhydrase inhibitor, it has been used in the treatment of glaucoma, and as a diuretic.	2.05	1	0	aromatic ether; benzothiazoles; sulfonamide	antiglaucoma drug; diuretic; EC 4.2.1.1 (carbonic anhydrase) inhibitor
ethyl loflazepate ethyl loflazepate: structure given in first source	2.04	1	0	organic molecular entity
ethylenediamine ethylenediamine: RN given refers to parent cpd; edamine is the recommended contraction for the ethylenediamine radical. ethylenediamine : An alkane-alpha,omega-diamine in which the alkane is ethane.	3.48	8	0	alkane-alpha,omega-diamine	GABA agonist
etidronate Etidronic Acid: A diphosphonate which affects calcium metabolism. It inhibits ectopic calcification and slows down bone resorption and bone turnover.. etidronic acid : A 1,1-bis(phosphonic acid) that is (ethane-1,1-diyl)bis(phosphonic acid) having a hydroxy substituent at the 1-position. It inhibits the formation, growth, and dissolution of hydroxyapatite crystals by chemisorption to calcium phosphate surfaces.	2.06	1	0	1,1-bis(phosphonic acid)	antineoplastic agent; bone density conservation agent; chelator
etizolam etizolam: structure given in first source	2.04	1	0	organic molecular entity
etodolac Etodolac: A non-steroidal anti-inflammatory agent and cyclooxygenase-2 (COX-2) inhibitor with potent analgesic and anti-arthritic properties. It has been shown to be effective in the treatment of OSTEOARTHRITIS; RHEUMATOID ARTHRITIS; ANKYLOSING SPONDYLITIS; and in the alleviation of postoperative pain (PAIN, POSTOPERATIVE).. etodolac : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens is substituted by a 1,8-diethyl-1,3,4,9-tetrahydropyrano[3,4-b]indol-1-yl moiety. A preferential inhibitor of cyclo-oxygenase 2 and non-steroidal anti-inflammatory, it is used for the treatment of rheumatoid arthritis and osteoarthritis, and for the alleviation of postoperative pain. Administered as the racemate, only the (S)-enantiomer is active.	2.75	3	0	monocarboxylic acid; organic heterotricyclic compound	antipyretic; cyclooxygenase 2 inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug
brl 42810 [no description available]	2.97	4	0	2-aminopurines; acetate ester	antiviral drug; prodrug
felbamate Felbamate: A PEGylated phenylcarbamate derivative that acts as an antagonist of NMDA RECEPTORS. It is used as an anticonvulsant, primarily for the treatment of SEIZURES in severe refractory EPILEPSY.. felbamate : The bis(carbamate ester) of 2-phenylpropane-1,3-diol. An anticonvulsant, it is used in the treatment of epilepsy.	2.97	4	0	carbamate ester	anticonvulsant; neuroprotective agent
felodipine Felodipine: A dihydropyridine calcium antagonist with positive inotropic effects. It lowers blood pressure by reducing peripheral vascular resistance through a highly selective action on smooth muscle in arteriolar resistance vessels.. felodipine : The mixed (methyl, ethyl) diester of 4-(2,3-dichlorophenyl)-2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylic acid. A calcium-channel blocker, it lowers blood pressure by reducing peripheral vascular resistance through a highly selective action on smooth muscle in arteriolar resistance vessels. It is used in the management of hypertension and angina pectoris.	2.72	3	0	dichlorobenzene; dihydropyridine; ethyl ester; methyl ester	anti-arrhythmia drug; antihypertensive agent; calcium channel blocker; vasodilator agent
fenfluramine Fenfluramine: A centrally active drug that apparently both blocks serotonin uptake and provokes transport-mediated serotonin release.. fenfluramine : A secondary amino compound that is 1-phenyl-propan-2-amine in which one of the meta-hydrogens is substituted by trifluoromethyl, and one of the hydrogens attached to the nitrogen is substituted by an ethyl group. It binds to the serotonin reuptake pump, causing inhbition of serotonin uptake and release of serotonin. The resulting increased levels of serotonin lead to greater serotonin receptor activation which in turn lead to enhancement of serotoninergic transmission in the centres of feeding behavior located in the hypothalamus. This suppresses the appetite for carbohydrates. Fenfluramine was used as the hydrochloride for treatment of diabetes and obesity. It was withdrawn worldwide after reports of heart valve disease and pulmonary hypertension.	2.04	1	0	(trifluoromethyl)benzenes; secondary amino compound	appetite depressant; serotonergic agonist; serotonin uptake inhibitor
fenofibrate Pharmavit: a polyvitamin product, comprising vitamins A, D2, B1, B2, B6, C, E, nicotinamide, & calcium pantothene; may be a promising agent for application to human populations exposed to carcinogenic and genetic hazards of ionizing radiation; RN from CHEMLINE	2.93	4	0	aromatic ether; chlorobenzophenone; isopropyl ester; monochlorobenzenes	antilipemic drug; environmental contaminant; geroprotector; xenobiotic
fenoprofen Fenoprofen: A propionic acid derivative that is used as a non-steroidal anti-inflammatory agent.. fenoprofen : A monocarboxylic acid that is propanoic acid in which one of the hydrogens at position 2 is substituted by a 3-phenoxyphenyl group. A non-steroidal anti-inflammatory drug, the dihydrate form of the calcium salt is used for the management of mild to moderate pain and for the relief of pain and inflammation associated with disorders such as arthritis. It is pharmacologically similar to aspirin, but causes less gastrointestinal bleeding.	2.46	2	0	monocarboxylic acid	antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; drug allergen; non-narcotic analgesic; non-steroidal anti-inflammatory drug
berotek Fenoterol: A synthetic adrenergic beta-2 agonist that is used as a bronchodilator and tocolytic.. fenoterol : A member of the class resorcinols that is 5-(1-hydroxyethyl)benzene-1,3-diol in which one of the methyl hydrogens is replaced by a 1-(4-hydroxyphenyl)propan-2-amino group. A beta2-adrenergic agonist, it is used (as the hydrobromide salt) as a bronchodilator in the management of reversible airway obstruction.	2.74	3	0	resorcinols; secondary alcohol; secondary amino compound	beta-adrenergic agonist; bronchodilator agent; sympathomimetic agent; tocolytic agent
fentanyl Fentanyl: A potent narcotic analgesic, abuse of which leads to habituation or addiction. It is primarily a mu-opioid agonist. Fentanyl is also used as an adjunct to general anesthetics, and as an anesthetic for induction and maintenance. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1078). fentanyl : A monocarboxylic acid amide resulting from the formal condensation of the aryl amino group of N-phenyl-1-(2-phenylethyl)piperidin-4-amine with propanoic acid.	2.05	1	0	anilide; monocarboxylic acid amide; piperidines	adjuvant; anaesthesia adjuvant; anaesthetic; intravenous anaesthetic; mu-opioid receptor agonist; opioid analgesic
fipexide fipexide: regulates dopaminergic systems at macromolecular level	2.06	1	0	benzodioxoles
flavoxate Flavoxate: A drug that has been used in various urinary syndromes and as an antispasmodic. Its therapeutic usefulness and its mechanism of action are not clear. It may have local anesthetic activity and direct relaxing effects on smooth muscle as well as some activity as a muscarinic antagonist.. flavoxate : A carboxylic ester resulting from the formal condensation of 3-methylflavone-8-carboxylic acid with 2-(1-piperidinyl)ethanol.	2.46	2	0	carboxylic ester; flavones; piperidines; tertiary amino compound	antispasmodic drug; muscarinic antagonist; parasympatholytic
flecainide Flecainide: A potent anti-arrhythmia agent, effective in a wide range of ventricular and atrial ARRHYTHMIAS and TACHYCARDIAS.. flecainide : A monocarboxylic acid amide obtained by formal condensation of the carboxy group of 2,5-bis(2,2,2-trifluoroethoxy)benzoic acid with the primary amino group of piperidin-2-ylmethylamine. An antiarrhythmic agent used (in the form of its acetate salt) to prevent and treat tachyarrhythmia (abnormal fast rhythm of the heart).	2.74	3	0	aromatic ether; monocarboxylic acid amide; organofluorine compound; piperidines	anti-arrhythmia drug
fluconazole Fluconazole: Triazole antifungal agent that is used to treat oropharyngeal CANDIDIASIS and cryptococcal MENINGITIS in AIDS.. fluconazole : A member of the class of triazoles that is propan-2-ol substituted at position 1 and 3 by 1H-1,2,4-triazol-1-yl groups and at position 2 by a 2,4-difluorophenyl group. It is an antifungal drug used for the treatment of mucosal candidiasis and for systemic infections including systemic candidiasis, coccidioidomycosis, and cryptococcosis.	4.93	8	1	conazole antifungal drug; difluorobenzene; tertiary alcohol; triazole antifungal drug	environmental contaminant; P450 inhibitor; xenobiotic
flucytosine Flucytosine: A fluorinated cytosine analog that is used as an antifungal agent.. flucytosine : An organofluorine compound that is cytosine that is substituted at position 5 by a fluorine. A prodrug for the antifungal 5-fluorouracil, it is used for the treatment of systemic fungal infections.	2.68	3	0	aminopyrimidine; nucleoside analogue; organofluorine compound; pyrimidine antifungal drug; pyrimidone	prodrug
flufenamic acid Flufenamic Acid: An anthranilic acid derivative with analgesic, anti-inflammatory, and antipyretic properties. It is used in musculoskeletal and joint disorders and administered by mouth and topically. (From Martindale, The Extra Pharmacopoeia, 30th ed, p16). flufenamic acid : An aromatic amino acid consisting of anthranilic acid carrying an N-(trifluoromethyl)phenyl substituent. An analgesic and anti-inflammatory, it is used in rheumatic disorders.	2.45	2	0	aromatic amino acid; organofluorine compound	antipyretic; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug
fluphenazine [no description available]	2	1	0	N-alkylpiperazine; organofluorine compound; phenothiazines	anticoronaviral agent; dopaminergic antagonist; phenothiazine antipsychotic drug
flumazenil Flumazenil: A potent benzodiazepine receptor antagonist. Since it reverses the sedative and other actions of benzodiazepines, it has been suggested as an antidote to benzodiazepine overdoses.. flumazenil : An organic heterotricyclic compound that is 5,6-dihydro-4H-imidazo[1,5-a][1,4]benzodiazepine which is substituted at positions 3, 5, 6, and 8 by ethoxycarbonyl, methyl, oxo, and fluoro groups, respectively. It is used as an antidote to benzodiazepine overdose.	4.05	4	0	ethyl ester; imidazobenzodiazepine; organofluorine compound	antidote to benzodiazepine poisoning; GABA antagonist
flunitrazepam Flunitrazepam: A benzodiazepine with pharmacologic actions similar to those of DIAZEPAM that can cause ANTEROGRADE AMNESIA. Some reports indicate that it is used as a date rape drug and suggest that it may precipitate violent behavior. The United States Government has banned the importation of this drug.. flunitrazepam : A 1,4-benzodiazepinone that is nitrazepam substituted by a methyl group at position 1 and by a fluoro group at position 2'. It is a potent hypnotic, sedative, and amnestic drug used to treat chronic insomnia.	2.05	1	0	1,4-benzodiazepinone; C-nitro compound; monofluorobenzenes	anxiolytic drug; GABAA receptor agonist; sedative
fluorescite fluorescein (acid form) : A xanthene dye that is highly fluorescent and commonly used as a fluorescent tracer.	2.05	1	0	benzoic acids; cyclic ketone; hydroxy monocarboxylic acid; organic heterotricyclic compound; phenols; xanthene dye	fluorescent dye; radioopaque medium
fluorouracil Fluorouracil: A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the THYMIDYLATE SYNTHETASE conversion of deoxyuridylic acid to thymidylic acid.. 5-fluorouracil : A nucleobase analogue that is uracil in which the hydrogen at position 5 is replaced by fluorine. It is an antineoplastic agent which acts as an antimetabolite - following conversion to the active deoxynucleotide, it inhibits DNA synthesis (by blocking the conversion of deoxyuridylic acid to thymidylic acid by the cellular enzyme thymidylate synthetase) and so slows tumour growth.	4.16	17	0	nucleobase analogue; organofluorine compound	antimetabolite; antineoplastic agent; environmental contaminant; immunosuppressive agent; radiosensitizing agent; xenobiotic
fluoxetine Fluoxetine: The first highly specific serotonin uptake inhibitor. It is used as an antidepressant and often has a more acceptable side-effects profile than traditional antidepressants.. fluoxetine : A racemate comprising equimolar amounts of (R)- and (S)-fluoxetine. A selective serotonin reuptake inhibitor (SSRI), it is used (generally as the hydrochloride salt) for the treatment of depression (and the depressive phase of bipolar disorder), bullimia nervosa, and obsessive-compulsive disorder.. N-methyl-3-phenyl-3-[4-(trifluoromethyl)phenoxy]propan-1-amine : An aromatic ether consisting of 4-trifluoromethylphenol in which the hydrogen of the phenolic hydroxy group is replaced by a 3-(methylamino)-1-phenylpropyl group.	2.97	4	0	(trifluoromethyl)benzenes; aromatic ether; secondary amino compound
fluphenazine depot fluphenazine decanoate : The prodrug of fluphenazine, an antipsychotic drug used for the symptomatic management of psychosis in patients with schizophrenia.	2.04	1	0	decanoate ester; N-alkylpiperazine; organofluorine compound; phenothiazines	dopaminergic antagonist; phenothiazine antipsychotic drug; prodrug
fluphenazine enanthate [no description available]	2.04	1	0	phenothiazines
flurazepam Flurazepam: A benzodiazepine derivative used mainly as a hypnotic.. flurazepam : A 1,4-benzodiazepinone that is 1,3-dihydro-2H-1,4-benzodiazepin-2-one substituted by a 2-(diethylamino)ethyl group, 2-fluorophenyl group and chloro group at positions 1, 5 and 7, respectively. It is a partial agonist of GABAA receptors and used for the treatment of insomnia.	2.04	1	0	1,4-benzodiazepinone; monofluorobenzenes; organochlorine compound; tertiary amino compound	anticonvulsant; anxiolytic drug; GABAA receptor agonist; sedative
flurbiprofen Flurbiprofen: An anti-inflammatory analgesic and antipyretic of the phenylalkynoic acid series. It has been shown to reduce bone resorption in periodontal disease by inhibiting CARBONIC ANHYDRASE.. flurbiprofen : A monocarboxylic acid that is a 2-fluoro-[1,1'-biphenyl-4-yl] moiety linked to C-2 of propionic acid. A non-steroidal anti-inflammatory, analgesic and antipyretic, it is used as a pre-operative anti-miotic as well as orally for arthritis or dental pain.	2.46	2	0	fluorobiphenyl; monocarboxylic acid	antipyretic; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug
flutamide Flutamide: An antiandrogen with about the same potency as cyproterone in rodent and canine species.	2.98	4	0	(trifluoromethyl)benzenes; monocarboxylic acid amide	androgen antagonist; antineoplastic agent
flutazolam flutazolam: structure	2.04	1	0	hemiaminal ether; organic molecular entity
fomepizole Fomepizole: A pyrazole and competitive inhibitor of ALCOHOL DEHYDROGENASE that is used for the treatment of poisoning by ETHYLENE GLYCOL or METHANOL.. fomepizole : A member of the class of pyrazoles that is 1H-pyrazole substituted by a methyl group at position 4.	2.05	1	0	pyrazoles	antidote; EC 1.1.1.1 (alcohol dehydrogenase) inhibitor; protective agent
foscarnet Foscarnet: An antiviral agent used in the treatment of cytomegalovirus retinitis. Foscarnet also shows activity against human herpesviruses and HIV.. phosphonoformic acid : Phosphoric acid in which one of the hydroxy groups is replaced by a carboxylic acid group. It is used as the trisodium salt as an antiviral agent in the treatment of cytomegalovirus retinitis (CMV retinitis, an inflamation of the retina that can lead to blindness) and as an alternative to ganciclovir for AIDS patients who require concurrent antiretroviral therapy but are unable to tolerate ganciclovir due to haematological toxicity.	2.46	2	0	carboxylic acid; one-carbon compound; phosphonic acids	antiviral drug; geroprotector; HIV-1 reverse transcriptase inhibitor; sodium-dependent Pi-transporter inhibitor
furazolidone Furazolidone: A nitrofuran derivative with antiprotozoal and antibacterial activity. Furazolidone acts by gradual inhibition of monoamine oxidase. (From Martindale, The Extra Pharmacopoeia, 30th ed, p514). furazolidone : A member of the class of oxazolidines that is 1,3-oxazolidin-2-one in which the hydrogen attached to the nitrogen is replaced by an N-{[(5-nitro-2-furyl)methylene]amino} group. It has antibacterial and antiprotozoal properties, and is used in the treatment of giardiasis and cholera.	7.37	64	2	nitrofuran antibiotic; oxazolidines	antibacterial drug; antiinfective agent; antitrichomonal drug; EC 1.4.3.4 (monoamine oxidase) inhibitor
furosemide Furosemide: A benzoic-sulfonamide-furan. It is a diuretic with fast onset and short duration that is used for EDEMA and chronic RENAL INSUFFICIENCY.. furosemide : A chlorobenzoic acid that is 4-chlorobenzoic acid substituted by a (furan-2-ylmethyl)amino and a sulfamoyl group at position 2 and 5 respectively. It is a diuretic used in the treatment of congestive heart failure.	4.17	17	0	chlorobenzoic acid; furans; sulfonamide	environmental contaminant; loop diuretic; xenobiotic
gabapentin Gabapentin: A cyclohexane-gamma-aminobutyric acid derivative that is used for the treatment of PARTIAL SEIZURES; NEURALGIA; and RESTLESS LEGS SYNDROME.. gabapentin : A gamma-amino acid that is cyclohexane substituted at position 1 by aminomethyl and carboxymethyl groups. Used for treatment of neuropathic pain and restless legs syndrome.	2.05	1	0	gamma-amino acid	anticonvulsant; calcium channel blocker; environmental contaminant; xenobiotic
vanoxerine vanoxerine: structure given in first source. vanoxerine : An N-alkylpiperazine that consists of piperazine bearing 2-bis(4-fluorophenyl)methoxy]ethyl and 3-phenylpropyl groups at positions 1 and 4 respectively. Potent, competitive inhibitor of dopamine uptake (Ki = 1 nM for inhibition of striatal dopamine uptake). Has > 100-fold lower affinity for the noradrenalin and 5-HT uptake carriers. Also a potent sigma ligand (IC50 = 48 nM). Centrally active following systemic administration.	2.45	2	0	ether; N-alkylpiperazine; organofluorine compound; tertiary amino compound	dopamine uptake inhibitor
gemfibrozil [no description available]	6.19	14	0	aromatic ether	antilipemic drug
gentamicin Gentamicins: A complex of closely related aminoglycosides obtained from MICROMONOSPORA purpurea and related species. They are broad-spectrum antibiotics, but may cause ear and kidney damage. They act to inhibit PROTEIN BIOSYNTHESIS.	16.86	457	22
glafenine Glafenine: An anthranilic acid derivative with analgesic properties used for the relief of all types of pain.. glafenine : A carboxylic ester that is 2,3-dihydroxypropyl anthranilate in which the amino group is substituted by a 7-chloroquinolin-4-yl group. A non-steroidal anti-inflammatory drug, glafenine and its hydrochloride salt were used for the relief of all types of pain, but high incidence of anaphylactic reactions resulted in their withdrawal from the market.	2.46	2	0	aminoquinoline; carboxylic ester; glycol; organochlorine compound; secondary amino compound	inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug
gliclazide Gliclazide: An oral sulfonylurea hypoglycemic agent which stimulates insulin secretion.	2.74	3	0	N-sulfonylurea	hypoglycemic agent; insulin secretagogue; radical scavenger
glimepiride glimepiride: structure given in first source	2.46	2	0	sulfonamide
glipizide Glipizide: An oral hypoglycemic agent which is rapidly absorbed and completely metabolized.. glipizide : An N-sulfonylurea that is glyburide in which the (5-chloro-2-methoxybenzoyl group is replaced by a (5-methylpyrazin-2-yl)carbonyl group. An oral hypoglycemic agent, it is used in the treatment of type 2 diabetes mellitus.	2.05	1	0	aromatic amide; monocarboxylic acid amide; N-sulfonylurea; pyrazines	EC 2.7.1.33 (pantothenate kinase) inhibitor; hypoglycemic agent; insulin secretagogue
glutaral Glutaral: One of the protein CROSS-LINKING REAGENTS that is used as a disinfectant for sterilization of heat-sensitive equipment and as a laboratory reagent, especially as a fixative.. glutaraldehyde : A dialdehyde comprised of pentane with aldehyde functions at C-1 and C-5.	3.27	6	0	dialdehyde	cross-linking reagent; disinfectant; fixative
glutethimide Glutethimide: A hypnotic and sedative. Its use has been largely superseded by other drugs.	2.05	1	0	piperidines
glyburide Glyburide: An antidiabetic sulfonylurea derivative with actions like those of chlorpropamide. glyburide : An N-sulfonylurea that is acetohexamide in which the acetyl group is replaced by a 2-(5-chloro-2-methoxybenzamido)ethyl group.	3.14	5	0	monochlorobenzenes; N-sulfonylurea	anti-arrhythmia drug; EC 2.7.1.33 (pantothenate kinase) inhibitor; EC 3.6.3.49 (channel-conductance-controlling ATPase) inhibitor; hypoglycemic agent
gö6983 [no description available]	2.02	1	0	indoles; maleimides
go 6976 [no description available]	2.02	1	0	indolocarbazole; organic heterohexacyclic compound	EC 2.7.11.13 (protein kinase C) inhibitor
gossypol Gossypol: A dimeric sesquiterpene found in cottonseed (GOSSYPIUM). The (-) isomer is active as a male contraceptive (CONTRACEPTIVE AGENTS, MALE) whereas toxic symptoms are associated with the (+) isomer.	2.05	1	0
granisetron [no description available]	2.05	1	0	aromatic amide; indazoles
guaiazulene guaiazulene: structure	2.05	1	0	sesquiterpene
guaifenesin Guaifenesin: An expectorant that also has some muscle relaxing action. It is used in many cough preparations.	5.28	7	2	methoxybenzenes
guanethidine Guanethidine: An antihypertensive agent that acts by inhibiting selectively transmission in post-ganglionic adrenergic nerves. It is believed to act mainly by preventing the release of norepinephrine at nerve endings and causes depletion of norepinephrine in peripheral sympathetic nerve terminals as well as in tissues.. guanethidine : A member of the class of guanidines in which one of the hydrogens of the amino group has been replaced by a 2-azocan-1-ylethyl group.. guanethidine sulfate : A organic sulfate salt composed of two molecules of guanethidine and one of sulfuric acid.	2.68	3	0	azocanes; guanidines	adrenergic antagonist; antihypertensive agent; sympatholytic agent
guanfacine Guanfacine: A centrally acting antihypertensive agent with specificity towards ADRENERGIC ALPHA-2 RECEPTORS.	2.05	1	0	acetamides
guanidine Guanidine: A strong organic base existing primarily as guanidium ions at physiological pH. It is found in the urine as a normal product of protein metabolism. It is also used in laboratory research as a protein denaturant. (From Martindale, the Extra Pharmacopoeia, 30th ed and Merck Index, 12th ed) It is also used in the treatment of myasthenia and as a fluorescent probe in HPLC.. guanidine : An aminocarboxamidine, the parent compound of the guanidines.	2.73	3	0	carboxamidine; guanidines; one-carbon compound
1-(5-isoquinolinesulfonyl)-2-methylpiperazine 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine: A specific protein kinase C inhibitor, which inhibits superoxide release from human neutrophils (PMN) stimulated with phorbol myristate acetate or synthetic diacylglycerol.. 1-(5-isoquinolinesulfonyl)-2-methylpiperazine : A member of the class of N-sulfonylpiperazines that is 2-methylpiperazine substituted at position 1 by a 5-isoquinolinesulfonyl group.	5.09	17	0	isoquinolines; N-sulfonylpiperazine	EC 2.7.11.13 (protein kinase C) inhibitor
n-(2-aminoethyl)-5-isoquinolinesulfonamide [no description available]	1.99	1	0
ha 1004 N-(2-guanidinoethyl)-5-isoquinolinesulfonamide: structure given in first source	1.98	1	0	isoquinolines
fasudil fasudil: intracellular calcium antagonist; structure in first source. fasudil : An isoquinoline substituted by a (1,4-diazepan-1-yl)sulfonyl group at position 5. It is a Rho-kinase inhibitor and its hydrochloride hydrate form is approved for the treatment of cerebral vasospasm and cerebral ischemia.	2.05	1	0	isoquinolines; N-sulfonyldiazepane	antihypertensive agent; calcium channel blocker; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; geroprotector; neuroprotective agent; nootropic agent; vasodilator agent
haloperidol Haloperidol: A phenyl-piperidinyl-butyrophenone that is used primarily to treat SCHIZOPHRENIA and other PSYCHOSES. It is also used in schizoaffective disorder, DELUSIONAL DISORDERS, ballism, and TOURETTE SYNDROME (a drug of choice) and occasionally as adjunctive therapy in INTELLECTUAL DISABILITY and the chorea of HUNTINGTON DISEASE. It is a potent antiemetic and is used in the treatment of intractable HICCUPS. (From AMA Drug Evaluations Annual, 1994, p279). haloperidol : A compound composed of a central piperidine structure with hydroxy and p-chlorophenyl substituents at position 4 and an N-linked p-fluorobutyrophenone moiety.	3.92	13	0	aromatic ketone; hydroxypiperidine; monochlorobenzenes; organofluorine compound; tertiary alcohol	antidyskinesia agent; antiemetic; dopaminergic antagonist; first generation antipsychotic; serotonergic antagonist
halothane [no description available]	4.55	8	0	haloalkane; organobromine compound; organochlorine compound; organofluorine compound	inhalation anaesthetic
harmaline Harmaline: A beta-carboline alkaloid isolated from seeds of PEGANUM.. harmaline : A harmala alkaloid in which the harman skeleton is methoxy-substituted at C-7 and has been reduced across the 3,4 bond.	3.46	2	0	harmala alkaloid	oneirogen
hexachlorophene Hexachlorophene: A chlorinated bisphenol antiseptic with a bacteriostatic action against Gram-positive organisms, but much less effective against Gram-negative organisms. It is mainly used in soaps and creams and is an ingredient of various preparations used for skin disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p797). hexachlorophene : An organochlorine compound that is diphenylmethane in which each of the phenyl groups is substituted by chlorines at positions 2, 3, and 5, and by a hydroxy group at position 6. An antiseptic that is effective against Gram-positive organisms, it is used in soaps and creams for the treatment of various skin disorders. It is also used in agriculture as an acaricide and fungicide, but is not approved for such use within the European Union.	8.34	23	3	bridged diphenyl fungicide; polyphenol; trichlorobenzene	acaricide; antibacterial agent; antifungal agrochemical; antiseptic drug
miltefosine miltefosine: hexadecyl phosphocholine derivative of cisplatin; did not substantially activate HIV long terminal repeat; less toxic than cisplatin. miltefosine : A phospholipid that is the hexadecyl monoester of phosphocholine.	3.53	2	0	phosphocholines; phospholipid	anti-inflammatory agent; anticoronaviral agent; antifungal agent; antineoplastic agent; antiprotozoal drug; apoptosis inducer; immunomodulator; protein kinase inhibitor
hexestrol [no description available]	2.05	1	0	stilbenoid
hexetidine Hexetidine: A bactericidal and fungicidal antiseptic. It is used as a 0.1% mouthwash for local infections and oral hygiene. (From Martindale, The Extra Pharmacopoeia, 30th ed, p797)	3.77	2	1	organic heteromonocyclic compound; organonitrogen heterocyclic compound
hexobarbital Hexobarbital: A barbiturate that is effective as a hypnotic and sedative.. hexobarbital : A member of the class of barbiturates taht is barbituric acid substituted at N-1 by methyl and at C-5 by methyl and cyclohex-1-enyl groups.	2.05	1	0	barbiturates
hexylresorcinol [no description available]	2.04	1	0	resorcinols
beta-thujaplicin beta-thujaplicin: structure. beta-thujaplicin : A monoterpenoid that is cyclohepta-2,4,6-trien-1-one substituted by a hydroxy group at position 2 and an isopropyl group at position 4. Isolated from Thuja plicata and Chamaecyparis obtusa, it exhibits antimicrobial activities.	2.02	1	0	cyclic ketone; enol; monoterpenoid	antibacterial agent; antifungal agent; antineoplastic agent; antiplasmodial drug; plant metabolite
ethidium Ethidium: A trypanocidal agent and possible antiviral agent that is widely used in experimental cell biology and biochemistry. Ethidium has several experimentally useful properties including binding to nucleic acids, noncompetitive inhibition of nicotinic acetylcholine receptors, and fluorescence among others. It is most commonly used as the bromide.. ethidium : The fluorescent compound widely used in experimental cell biology and biochemistry to reveal double-stranded DNA and RNA.	3.74	11	0	phenanthridines	fluorochrome; intercalator
homochlorocyclizine homochlorocyclizine: RN given refers to parent cpd	2.04	1	0	diarylmethane
hydralazine Hydralazine: A direct-acting vasodilator that is used as an antihypertensive agent.. hydralazine : The 1-hydrazino derivative of phthalazine; a direct-acting vasodilator that is used as an antihypertensive agent.	2.45	2	0	azaarene; hydrazines; ortho-fused heteroarene; phthalazines	antihypertensive agent; vasodilator agent
hydrochlorothiazide Hydrochlorothiazide: A thiazide diuretic often considered the prototypical member of this class. It reduces the reabsorption of electrolytes from the renal tubules. This results in increased excretion of water and electrolytes, including sodium, potassium, chloride, and magnesium. It is used in the treatment of several disorders including edema, hypertension, diabetes insipidus, and hypoparathyroidism.. hydrochlorothiazide : A benzothiadiazine that is 3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxide substituted by a chloro group at position 6 and a sulfonamide at 7. It is diuretic used for the treatment of hypertension and congestive heart failure.	2.75	3	0	benzothiadiazine; organochlorine compound; sulfonamide	antihypertensive agent; diuretic; environmental contaminant; xenobiotic
hydroflumethiazide Hydroflumethiazide: A thiazide diuretic with actions and uses similar to those of HYDROCHLOROTHIAZIDE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p822). hydroflumethiazide : A benzothiadiazine consisting of a 3,4-dihydro-HH-1,2,4-benzothiadiazine bicyclic system dioxygenated on sulfur and carrying trifluoromethyl and aminosulfonyl groups at positions 6 and 7 respectively. A diuretic with actions and uses similar to those of hydrochlorothiazide.	2.37	2	0	benzothiadiazine; thiazide	antihypertensive agent; diuretic
hydroxyurea [no description available]	2.46	2	0	one-carbon compound; ureas	antimetabolite; antimitotic; antineoplastic agent; DNA synthesis inhibitor; EC 1.17.4.1 (ribonucleoside-diphosphate reductase) inhibitor; genotoxin; immunomodulator; radical scavenger; teratogenic agent
hydroxyzine Hydroxyzine: A histamine H1 receptor antagonist that is effective in the treatment of chronic urticaria, dermatitis, and histamine-mediated pruritus. Unlike its major metabolite CETIRIZINE, it does cause drowsiness. It is also effective as an antiemetic, for relief of anxiety and tension, and as a sedative.. hydroxyzine : A N-alkylpiperazine that is piperzine in which the nitrogens atoms are substituted by 2-(2-hydroxyethoxy)ethyl and (4-chlorophenyl)(phenyl)methyl groups respectively.	2.97	4	0	hydroxyether; monochlorobenzenes; N-alkylpiperazine	anticoronaviral agent; antipruritic drug; anxiolytic drug; dermatologic drug; H1-receptor antagonist
ibuprofen Midol: combination of cinnamedrine, phenacetin, aspirin & caffeine	3.5	8	0	monocarboxylic acid	antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; drug allergen; environmental contaminant; geroprotector; non-narcotic analgesic; non-steroidal anti-inflammatory drug; radical scavenger; xenobiotic
phenelzine Phenelzine: One of the MONOAMINE OXIDASE INHIBITORS used to treat DEPRESSION; PHOBIC DISORDERS; and PANIC.	2.37	2	0	primary amine
lidocaine Lidocaine: A local anesthetic and cardiac depressant used as an antiarrhythmia agent. Its actions are more intense and its effects more prolonged than those of PROCAINE but its duration of action is shorter than that of BUPIVACAINE or PRILOCAINE.. lidocaine : The monocarboxylic acid amide resulting from the formal condensation of N,N-diethylglycine with 2,6-dimethylaniline.	5.27	17	0	benzenes; monocarboxylic acid amide; tertiary amino compound	anti-arrhythmia drug; drug allergen; environmental contaminant; local anaesthetic; xenobiotic
alverine alverine : A tertiary amine having one ethyl and two 3-phenylprop-1-yl groups attached to the nitrogen. An antispasmodic that acts directly on intestinal and uterine smooth muscle, it is used (particularly as the citrate salt) in the treatment of irritable bowel syndrome.	2.05	1	0	tertiary amine	antispasmodic drug
ici 118551 [no description available]	2.05	1	0	indanes
idebenone [no description available]	2.05	1	0	1,4-benzoquinones; primary alcohol	antioxidant; ferroptosis inhibitor
ifenprodil ifenprodil: NMDA receptor antagonist	2.68	3	0	piperidines
ifosfamide [no description available]	4.1	3	1	ifosfamides	alkylating agent; antineoplastic agent; environmental contaminant; immunosuppressive agent; xenobiotic
imipramine Imipramine: The prototypical tricyclic antidepressant. It has been used in major depression, dysthymia, bipolar depression, attention-deficit disorders, agoraphobia, and panic disorders. It has less sedative effect than some other members of this therapeutic group.. imipramine : A dibenzoazepine that is 5H-dibenzo[b,f]azepine substituted by a 3-(dimethylamino)propyl group at the nitrogen atom.	3.42	7	0	dibenzoazepine	adrenergic uptake inhibitor; antidepressant; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor
amrinone Amrinone: A positive inotropic cardiotonic (CARDIOTONIC AGENTS) with vasodilator properties, phosphodiesterase 3 inhibitory activity, and the ability to stimulate calcium ion influx into the cardiac cell.. amrinone : A 3,4'-bipyridine substituted at positions 5 and 6 by an amino group and a keto function respectively. A pyridine phosphodiesterase 3 inhibitor, it is a drug that may improve the prognosis in patients with congestive heart failure.	2.97	4	0	bipyridines	EC 3.1.4.* (phosphoric diester hydrolase) inhibitor
incadronate [no description available]	2.03	1	0	1,1-bis(phosphonic acid)
indapamide Indapamide: A benzamide-sulfonamide-indole derived DIURETIC that functions by inhibiting SODIUM CHLORIDE SYMPORTERS.. indapamide : A sulfonamide formed by condensation of the carboxylic group of 4-chloro-3-sulfamoylbenzoic acid with the amino group of 2-methyl-2,3-dihydro-1H-indol-1-amine.	2.46	2	0	indoles; organochlorine compound; sulfonamide	antihypertensive agent; diuretic
indomethacin Indomethacin: A non-steroidal anti-inflammatory agent (NSAID) that inhibits CYCLOOXYGENASE, which is necessary for the formation of PROSTAGLANDINS and other AUTACOIDS. It also inhibits the motility of POLYMORPHONUCLEAR LEUKOCYTES.. indometacin : A member of the class of indole-3-acetic acids that is indole-3-acetic acid in which the indole ring is substituted at positions 1, 2 and 5 by p-chlorobenzoyl, methyl, and methoxy groups, respectively. A non-steroidal anti-inflammatory drug, it is used in the treatment of musculoskeletal and joint disorders including osteoarthritis, rheumatoid arthritis, gout, bursitis and tendinitis.	4.55	25	0	aromatic ether; indole-3-acetic acids; monochlorobenzenes; N-acylindole	analgesic; drug metabolite; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; environmental contaminant; gout suppressant; non-steroidal anti-inflammatory drug; xenobiotic metabolite; xenobiotic
iodamide Iodamide: An ionic monomeric contrast medium. (From Martindale, The Extra Pharmacopoeia, 30th ed, p706). iodamide : A benzoic acid compound having iodo substituents at the 2-, 4- and 6-positions, an acetamido substituent at the 3-position and an acetamidomethyl substituent at the 5-position.	2.04	1	0	benzoic acids; organoiodine compound	radioopaque medium
iodoquinol Iodoquinol: One of the halogenated 8-quinolinols widely used as an intestinal antiseptic, especially as an antiamebic agent. It is also used topically in other infections and may cause CNS and eye damage. It is known by very many similar trade names world-wide.. iodoquinol : A monohydroxyquinoline that is quinolin-8-ol in which the hydrogens at positions 5 and 7 are replaced by iodine. It is considered the drug of choice for treating asymptomatic or moderate forms of amoebiasis.	1.93	1	0	monohydroxyquinoline; organoiodine compound	antiamoebic agent; antibacterial agent; antiprotozoal drug; antiseptic drug
iohexol Iohexol: An effective non-ionic, water-soluble contrast agent which is used in myelography, arthrography, nephroangiography, arteriography, and other radiographic procedures. Its low systemic toxicity is the combined result of low chemotoxicity and low osmolality.. iohexol : A benzenedicarboxamide compound having N-(2,3-dihydroxypropyl)carbamoyl groups at the 1- and 3-positions, iodo substituents at the 2-, 4- and 6-positions and an N-(2,3-dihydroxypropyl)acetamido group at the 5-position.	2.46	2	0	benzenedicarboxamide; organoiodine compound	environmental contaminant; radioopaque medium; xenobiotic
iothalamic acid Iothalamic Acid: A contrast medium in diagnostic radiology with properties similar to those of diatrizoic acid. It is used primarily as its sodium and meglumine (IOTHALAMATE MEGLUMINE) salts.	2.46	2	0	organic molecular entity
iodipamide Iodipamide: A water-soluble radiographic contrast media for cholecystography and intravenous cholangiography.. adipiodone : An organoiodine compound that is 3-amino-2,4,6-triiodobenzoic acid in which one of the amino hydrogens is substituted by a 6-(3-carboxy-2,4,6-triiodoanilino)-6-oxohexanoyl group. It is a water-soluble radiographic contrast media for cholecystography and intravenous cholangiography.	2.45	2	0	benzoic acids; organoiodine compound; secondary carboxamide	radioopaque medium
iotroxic acid iotroxic acid: RN given refers to parent cpd; structure	2.06	1	0	organic molecular entity
iproniazid [no description available]	2.93	4	0	carbohydrazide; pyridines
avapro Irbesartan: A spiro compound, biphenyl and tetrazole derivative that acts as an angiotensin II type 1 receptor antagonist. It is used in the management of HYPERTENSION, and in the treatment of kidney disease.. irbesartan : A biphenylyltetrazole that is an angiotensin II receptor antagonist used mainly for the treatment of hypertension.	2.05	1	0	azaspiro compound; biphenylyltetrazole	angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic
1-methyl-3-isobutylxanthine 1-Methyl-3-isobutylxanthine: A potent cyclic nucleotide phosphodiesterase inhibitor; due to this action, the compound increases cyclic AMP and cyclic GMP in tissue and thereby activates CYCLIC NUCLEOTIDE-REGULATED PROTEIN KINASES. 3-isobutyl-1-methylxanthine : An oxopurine that is xanthine which is substituted at positions 1 and 3 by methyl and isobutyl groups, respectively.	3.24	6	0	3-isobutyl-1-methylxanthine
isocarboxazid Isocarboxazid: An MAO inhibitor that is effective in the treatment of major depression, dysthymic disorder, and atypical depression. It also is useful in the treatment of panic disorder and the phobic disorders. (From AMA, Drug Evaluations Annual, 1994, p311)	2.47	2	0	benzenes
isoflurane Isoflurane: A stable, non-explosive inhalation anesthetic, relatively free from significant side effects.	2.05	1	0	organofluorine compound	inhalation anaesthetic
isoniazid Hydra: A genus of freshwater polyps in the family Hydridae, order Hydroida, class HYDROZOA. They are of special interest because of their complex organization and because their adult organization corresponds roughly to the gastrula of higher animals.. hydrazide : Compounds derived from oxoacids RkE(=O)l(OH)m (l =/= 0) by replacing -OH by -NRNR2 (R groups are commonly H). (IUPAC).	4.36	21	0	carbohydrazide	antitubercular agent; drug allergen
isopropamide iodide [no description available]	2.04	1	0	diarylmethane
2-propanol 2-Propanol: An isomer of 1-PROPANOL. It is a colorless liquid having disinfectant properties. It is used in the manufacture of acetone and its derivatives and as a solvent. Topically, it is used as an antiseptic.. propan-2-ol : A secondary alcohol that is propane in which one of the hydrogens attached to the central carbon is substituted by a hydroxy group.	4.29	4	1	secondary alcohol; secondary fatty alcohol	protic solvent
isoproterenol Isoproterenol: Isopropyl analog of EPINEPHRINE; beta-sympathomimetic that acts on the heart, bronchi, skeletal muscle, alimentary tract, etc. It is used mainly as bronchodilator and heart stimulant.. isoprenaline : A secondary amino compound that is noradrenaline in which one of the hydrogens attached to the nitrogen is replaced by an isopropyl group. A sympathomimetic acting almost exclusively on beta-adrenergic receptors, it is used (mainly as the hydrochloride salt) as a bronghodilator and heart stimulant for the management of a variety of cardiac disorders.	3.77	11	0	catechols; secondary alcohol; secondary amino compound	beta-adrenergic agonist; bronchodilator agent; cardiotonic drug; sympathomimetic agent
isoxsuprine Isoxsuprine: A beta-adrenergic agonist that causes direct relaxation of uterine and vascular smooth muscle. Its vasodilating actions are greater on the arteries supplying skeletal muscle than on those supplying skin. It is used in the treatment of peripheral vascular disease and in premature labor.	2.45	2	0	alkylbenzene
isradipine Isradipine: A potent antagonist of CALCIUM CHANNELS that is highly selective for VASCULAR SMOOTH MUSCLE. It is effective in the treatment of chronic stable angina pectoris, hypertension, and congestive cardiac failure.	2.41	2	0	benzoxadiazole; dihydropyridine; isopropyl ester; methyl ester
itraconazole [no description available]	2.46	2	0	piperazines
staurosporine aglycone staurosporine aglycone: metabolite from culture broth of Nocardiopsis sp.; a neurotrophin antag; inhibits BDNF TrkB receptor	2.38	2	0
ketamine Ketamine: A cyclohexanone derivative used for induction of anesthesia. Its mechanism of action is not well understood, but ketamine can block NMDA receptors (RECEPTORS, N-METHYL-D-ASPARTATE) and may interact with sigma receptors.. ketamine : A member of the class of cyclohexanones in which one of the hydrogens at position 2 is substituted by a 2-chlorophenyl group, while the other is substituted by a methylamino group.	2.75	3	0	cyclohexanones; monochlorobenzenes; secondary amino compound	analgesic; environmental contaminant; intravenous anaesthetic; neurotoxin; NMDA receptor antagonist; xenobiotic
ketanserin Ketanserin: A selective serotonin receptor antagonist with weak adrenergic receptor blocking properties. The drug is effective in lowering blood pressure in essential hypertension. It also inhibits platelet aggregation. It is well tolerated and is particularly effective in older patients.. ketanserin : A member of the class of quinazolines that is quinazoline-2,4(1H,3H)-dione which is substituted at position 3 by a 2-[4-(p-fluorobenzoyl)piperidin-1-yl]ethyl group.	3.14	5	0	aromatic ketone; organofluorine compound; piperidines; quinazolines	alpha-adrenergic antagonist; antihypertensive agent; cardiovascular drug; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; serotonergic antagonist
ketoconazole 1-acetyl-4-(4-{[2-(2,4-dichlorophenyl)-2-(1H-imidazol-1-ylmethyl)-1,3-dioxolan-4-yl]methoxy}phenyl)piperazine : A dioxolane that is 1,3-dioxolane which is substituted at positions 2, 2, and 4 by imidazol-1-ylmethyl, 2,4-dichlorophenyl, and [para-(4-acetylpiperazin-1-yl)phenoxy]methyl groups, respectively.	4.49	7	0	dichlorobenzene; dioxolane; ether; imidazoles; N-acylpiperazine; N-arylpiperazine
ketoprofen Ketoprofen: An IBUPROFEN-type anti-inflammatory analgesic and antipyretic. It is used in the treatment of rheumatoid arthritis and osteoarthritis.. ketoprofen : An oxo monocarboxylic acid that consists of propionic acid substituted by a 3-benzoylphenyl group at position 2.	2.75	3	0	benzophenones; oxo monocarboxylic acid	antipyretic; drug allergen; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; environmental contaminant; non-steroidal anti-inflammatory drug; xenobiotic
ketorolac Ketorolac: A pyrrolizine carboxylic acid derivative structurally related to INDOMETHACIN. It is an NSAID and is used principally for its analgesic activity. (From Martindale The Extra Pharmacopoeia, 31st ed). ketorolac : A racemate comprising equimolar amounts of (R)-(+)- and (S)-(-)-5-benzoyl-2,3-dihydro-1H-pyrrolizine-1-carboxylic acid. While only the (S)-(-) enantiomer is a COX1 and COX2 inhibitor, the (R)-(+) enantiomer exhibits potent analgesic activity. A non-steroidal anti-inflammatory drug, ketorolac is mainly used (generally as the tromethamine salt) for its potent analgesic properties in the short-term management of post-operative pain, and in eye drops to relieve the ocular itching associated with seasonal allergic conjunctivitis. It was withdrawn from the market in many countries in 1993 following association with haemorrhage and renal failure.. 5-benzoyl-2,3-dihydro-1H-pyrrolizine-1-carboxylic acid : A member of the class of pyrrolizines that is 2,3-dihydro-1H-pyrrolizine which is substituted at positions 1 and 5 by carboxy and benzoyl groups, respectively.	3	4	0	amino acid; aromatic ketone; monocarboxylic acid; pyrrolizines; racemate	analgesic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug
ketotifen Ketotifen: A cycloheptathiophene blocker of histamine H1 receptors and release of inflammatory mediators. It has been proposed for the treatment of asthma, rhinitis, skin allergies, and anaphylaxis.. ketotifen : An organic heterotricyclic compound that is 4,9-dihydro-10H-benzo[4,5]cyclohepta[1,2-b]thiophen-10-one which is substituted at position 4 by a 1-methylpiperidin-4-ylidene group. A blocker of histamine H1 receptors with a stabilising action on mast cells, it is used (usually as its hydrogen fumarate salt) for the treatment of asthma, where it may take several weeks to exert its full effect.	2.04	1	0	cyclic ketone; olefinic compound; organic heterotricyclic compound; organosulfur heterocyclic compound; piperidines; tertiary amino compound	anti-asthmatic drug; H1-receptor antagonist
khellin Khellin: A vasodilator that also has bronchodilatory action. It has been employed in the treatment of angina pectoris, in the treatment of asthma, and in conjunction with ultraviolet light A, has been tried in the treatment of vitiligo. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1024). khellin : A furanochrome in which the basic tricyclic skeleton is substituted at positions 4 and 9 with methoxy groups and at position 7 with a methyl group. A major constituent of the plant Ammi visnaga it is a herbal folk medicine used for various illnesses, its main effect being as a vasodilator.	3.04	5	0	furanochromone; organic heterotricyclic compound; oxacycle	anti-asthmatic agent; bronchodilator agent; cardiovascular drug; vasodilator agent
kynurenic acid Kynurenic Acid: A broad-spectrum excitatory amino acid antagonist used as a research tool.. kynurenic acid : A quinolinemonocarboxylic acid that is quinoline-2-carboxylic acid substituted by a hydroxy group at C-4.	2.87	4	0	monohydroxyquinoline; quinolinemonocarboxylic acid	G-protein-coupled receptor agonist; human metabolite; neuroprotective agent; nicotinic antagonist; NMDA receptor antagonist; Saccharomyces cerevisiae metabolite
2-amino-3-phosphonopropionic acid 2-amino-3-phosphonopropionic acid: metabotropic glutamate receptor antagonist; do not confuse AP-3 used as an abbreviation for this with enhancer-binding protein AP-3 (a trans-activator) or clathrin assembly protein AP-3. 2-amino-3-phosphonopropanoic acid : A non-proteinogenc alpha-amino acid that is alanine in which one of the hydrogens of the terminal methyl group has been replaced by a dihydroxy(oxido)-lambda(5)-phosphanyl group.	1.97	1	0	alanine derivative; non-proteinogenic alpha-amino acid; phosphonic acids	human metabolite; metabotropic glutamate receptor antagonist
labetalol Labetalol: A salicylamide derivative that is a non-cardioselective blocker of BETA-ADRENERGIC RECEPTORS and ALPHA-1 ADRENERGIC RECEPTORS.. labetalol : A diastereoisomeric mixture of approximately equal amounts of all four possible stereoisomers ((R,S)-labetolol, (S,R)-labetolol, (S,S)-labetalol and (R,R)-labetalol). It is an adrenergic antagonist used to treat high blood pressure.. 2-hydroxy-5-{1-hydroxy-2-[(4-phenylbutan-2-yl)amino]ethyl}benzamide : A member of the class of benzamides that is benzamide substituted by a hydroxy group at position 2 and by a 1-hydroxy-2-[(4-phenylbutan-2-yl)amino]ethyl group at position 5.	3.15	5	0	benzamides; benzenes; phenols; primary carboxamide; salicylamides; secondary alcohol; secondary amino compound
lamotrigine [no description available]	2.46	2	0	1,2,4-triazines; dichlorobenzene; primary arylamine	anticonvulsant; antidepressant; antimanic drug; calcium channel blocker; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; environmental contaminant; excitatory amino acid antagonist; geroprotector; non-narcotic analgesic; xenobiotic
lansoprazole Lansoprazole: A 2,2,2-trifluoroethoxypyridyl derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS. Lansoprazole is a racemic mixture of (R)- and (S)-isomers.	2.97	4	0	benzimidazoles; pyridines; sulfoxide	anti-ulcer drug; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor
beta-lapachone beta-lapachone: antineoplastic inhibitor of reverse transcriptase, DNA topoisomerase, and DNA polymerase. beta-lapachone : A benzochromenone that is 3,4-dihydro-2H-benzo[h]chromene-5,6-dione substituted by geminal methyl groups at position 2. Isolated from Tabebuia avellanedae, it exhibits antineoplastic and anti-inflammatory activities.	2.05	1	0	benzochromenone; orthoquinones	anti-inflammatory agent; antineoplastic agent; plant metabolite
lauric acid dodecanoic acid : A straight-chain, twelve-carbon medium-chain saturated fatty acid with strong bactericidal properties; the main fatty acid in coconut oil and palm kernel oil.	2.04	1	0	medium-chain fatty acid; straight-chain saturated fatty acid	algal metabolite; antibacterial agent; plant metabolite
leflunomide Leflunomide: An isoxazole derivative that inhibits dihydroorotate dehydrogenase, the fourth enzyme in the pyrimidine biosynthetic pathway. It is used an immunosuppressive agent in the treatment of RHEUMATOID ARTHRITIS and PSORIATIC ARTHRITIS.. leflunomide : A monocarboxylic acid amide obtained by formal condensation of the carboxy group of 5-methyl-1,2-oxazole-4-carboxylic acid with the anilino group of 4-(trifluoromethyl)aniline. The prodrug of teriflunomide.	2.74	3	0	(trifluoromethyl)benzenes; isoxazoles; monocarboxylic acid amide	antineoplastic agent; antiparasitic agent; EC 1.3.98.1 [dihydroorotate oxidase (fumarate)] inhibitor; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; hepatotoxic agent; immunosuppressive agent; non-steroidal anti-inflammatory drug; prodrug; pyrimidine synthesis inhibitor; tyrosine kinase inhibitor
lofepramine Lofepramine: A psychotropic IMIPRAMINE derivative that acts as a tricyclic antidepressant and possesses few anticholinergic properties. It is metabolized to DESIPRAMINE.	2.05	1	0	aromatic ketone; dibenzoazepine; monochlorobenzenes; tertiary amino compound	antidepressant
lomustine [no description available]	2.05	1	0	N-nitrosoureas; organochlorine compound	alkylating agent; antineoplastic agent
loperamide Loperamide: One of the long-acting synthetic ANTIDIARRHEALS; it is not significantly absorbed from the gut, and has no effect on the adrenergic system or central nervous system, but may antagonize histamine and interfere with acetylcholine release locally.. loperamide : A synthetic piperidine derivative, effective against diarrhoea resulting from gastroenteritis or inflammatory bowel disease.	2.69	3	0	monocarboxylic acid amide; monochlorobenzenes; piperidines; tertiary alcohol	anticoronaviral agent; antidiarrhoeal drug; mu-opioid receptor agonist
loratadine Loratadine: A second-generation histamine H1 receptor antagonist used in the treatment of allergic rhinitis and urticaria. Unlike most classical antihistamines (HISTAMINE H1 ANTAGONISTS) it lacks central nervous system depressing effects such as drowsiness.. loratadine : A benzocycloheptapyridine that is 6,11-dihydro-5H-benzo[5,6]cyclohepta[1,2-b]pyridine substituted by a chloro group at position 8 and a 1-(ethoxycarbonyl)piperidin-4-ylidene group at position 11. It is a H1-receptor antagonist commonly employed in the treatment of allergic disorders.	3.85	2	1	benzocycloheptapyridine; ethyl ester; N-acylpiperidine; organochlorine compound; tertiary carboxamide	anti-allergic agent; cholinergic antagonist; geroprotector; H1-receptor antagonist
lorazepam Lorazepam: A benzodiazepine used as an anti-anxiety agent with few side effects. It also has hypnotic, anticonvulsant, and considerable sedative properties and has been proposed as a preanesthetic agent.	4.29	4	1	benzodiazepine
losartan Losartan: An antagonist of ANGIOTENSIN TYPE 1 RECEPTOR with antihypertensive activity due to the reduced pressor effect of ANGIOTENSIN II.. losartan : A biphenylyltetrazole where a 1,1'-biphenyl group is attached at the 5-position and has an additional trisubstituted imidazol-1-ylmethyl group at the 4'-position	2.44	2	0	biphenylyltetrazole; imidazoles	angiotensin receptor antagonist; anti-arrhythmia drug; antihypertensive agent; endothelin receptor antagonist
loxapine Loxapine: An antipsychotic agent used in SCHIZOPHRENIA.	2.04	1	0	dibenzooxazepine	antipsychotic agent; dopaminergic antagonist
ly 303511 LY 303511: inhibitor of phosphatidylinositol 3-kinase	2.05	1	0	N-arylpiperazine
2-(4-morpholinyl)-8-phenyl-4h-1-benzopyran-4-one 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one: specific inhibitor of phosphatidylinositol 3-kinase; structure in first source	3.27	6	0	chromones; morpholines; organochlorine compound	autophagy inhibitor; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; geroprotector
mafenide Mafenide: A sulfonamide that inhibits the enzyme CARBONIC ANHYDRASE and is used as a topical anti-bacterial agent, especially in burn therapy.	4.33	6	0	aromatic amine
malathion Malathion: A wide spectrum aliphatic organophosphate insecticide widely used for both domestic and commercial agricultural purposes.. malathion : A racemate comprising equimolar amounts of (R) and (S)-malathion. It is a broad spectrum organophosphate proinsecticide used to control a wide range of pests including Coleoptera, Diptera, fruit flies, mosquitos and spider mites.. diethyl 2-[(dimethoxyphosphorothioyl)thio]succinate : A diester that is diethyl succinate in which position 2 is substituted by a (dimethoxyphosphorothioyl)thio group.	2.05	1	0	diester; ethyl ester; organic thiophosphate
diisopropyl 1,3-dithiol-2-ylidenemalonate diisopropyl 1,3-dithiol-2-ylidenemalonate: structure in first source	2.05	1	0	isopropyl ester
maprotiline Maprotiline: A bridged-ring tetracyclic antidepressant that is both mechanistically and functionally similar to the tricyclic antidepressants, including side effects associated with its use.	2.74	3	0	anthracenes
mazindol Mazindol: Tricyclic anorexigenic agent unrelated to and less toxic than AMPHETAMINE, but with some similar side effects. It inhibits uptake of catecholamines and blocks the binding of cocaine to the dopamine uptake transporter.	2.05	1	0	organic molecular entity
edaravone [no description available]	2.1	1	0	pyrazolone	antioxidant; radical scavenger
mebendazole Mebendazole: A benzimidazole that acts by interfering with CARBOHYDRATE METABOLISM and inhibiting polymerization of MICROTUBULES.. mebendazole : A carbamate ester that is methyl 1H-benzimidazol-2-ylcarbamate substituted by a benzoyl group at position 5.	2.76	3	0	aromatic ketone; benzimidazoles; carbamate ester	antinematodal drug; microtubule-destabilising agent; tubulin modulator
mechlorethamine nitrogen mustard : Compounds having two beta-haloalkyl groups bound to a nitrogen atom, as in (X-CH2-CH2)2NR.	3.04	5	0	nitrogen mustard; organochlorine compound	alkylating agent
meclizine Meclizine: A histamine H1 antagonist used in the treatment of motion sickness, vertigo, and nausea during pregnancy and radiation sickness.	2.46	2	0	diarylmethane
meclofenoxate Meclofenoxate: An ester of DIMETHYLAMINOETHANOL and para-chlorophenoxyacetic acid.	2.05	1	0	monocarboxylic acid
mefenamic acid Mefenamic Acid: A non-steroidal anti-inflammatory agent with analgesic, anti-inflammatory, and antipyretic properties. It is an inhibitor of cyclooxygenase.. mefenamic acid : An aminobenzoic acid that is anthranilic acid in which one of the hydrogens attached to the nitrogen is replaced by a 2,3-dimethylphenyl group. Although classed as a non-steroidal anti-inflammatory drug, its anti-inflammatory properties are considered to be minor. It is used to relieve mild to moderate pain, including headaches, dental pain, osteoarthritis and rheumatoid arthritis.	2.05	1	0	aminobenzoic acid; secondary amino compound	analgesic; antipyretic; antirheumatic drug; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; environmental contaminant; non-steroidal anti-inflammatory drug; xenobiotic
memantine [no description available]	2.04	1	0	adamantanes; primary aliphatic amine	antidepressant; antiparkinson drug; dopaminergic agent; neuroprotective agent; NMDA receptor antagonist
vitamin k 3 Vitamin K 3: A synthetic naphthoquinone without the isoprenoid side chain and biological activity, but can be converted to active vitamin K2, menaquinone, after alkylation in vivo.	2.9	4	0	1,4-naphthoquinones; vitamin K	angiogenesis inhibitor; antineoplastic agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor; human urinary metabolite; nutraceutical
meperidine Meperidine: A narcotic analgesic that can be used for the relief of most types of moderate to severe pain, including postoperative pain and the pain of labor. Prolonged use may lead to dependence of the morphine type; withdrawal symptoms appear more rapidly than with morphine and are of shorter duration.. pethidine : A piperidinecarboxylate ester that is piperidine which is substituted by a methyl group at position 1 and by phenyl and ethoxycarbonyl groups at position 4. It is an analgesic which is used for the treatment of moderate to severe pain, including postoperative pain and labour pain.	2.38	2	0	ethyl ester; piperidinecarboxylate ester; tertiary amino compound	antispasmodic drug; kappa-opioid receptor agonist; mu-opioid receptor agonist; opioid analgesic
mephenesin Mephenesin: A centrally acting muscle relaxant with a short duration of action.. 1-(2-methylphenyl)glycerol : A glycerol ether in which a single 2-methylphenyl group is attached at position 1 of glycerol via an ether linkage.	1.96	1	0	aromatic ether; glycerol ether
mephenytoin Mephenytoin: An anticonvulsant effective in tonic-clonic epilepsy (EPILEPSY, TONIC-CLONIC). It may cause blood dyscrasias.. mephenytoin : An imidazolidine-2,4-dione (hydantoin) in which the imidazolidine nucleus carries a methyl group at N-3 and has ethyl and phenyl substituents at C-5. An anticonvulsant, it is no longer available in the USA or the UK but is still studied largely because of its interesting hydroxylation polymorphism.	2.05	1	0	imidazolidine-2,4-dione	anticonvulsant
mepivacaine Mepivacaine: A local anesthetic that is chemically related to BUPIVACAINE but pharmacologically related to LIDOCAINE. It is indicated for infiltration, nerve block, and epidural anesthesia. Mepivacaine is effective topically only in large doses and therefore should not be used by this route. (From AMA Drug Evaluations, 1994, p168). mepivacaine : A piperidinecarboxamide in which N-methylpipecolic acid and 2,6-dimethylaniline have combined to form the amide bond. It is used as a local amide-type anaesthetic.	2.05	1	0	piperidinecarboxamide	drug allergen; local anaesthetic
meprobamate Meprobamate: A carbamate with hypnotic, sedative, and some muscle relaxant properties, although in therapeutic doses reduction of anxiety rather than a direct effect may be responsible for muscle relaxation. Meprobamate has been reported to have anticonvulsant actions against petit mal seizures, but not against grand mal seizures (which may be exacerbated). It is used in the treatment of ANXIETY DISORDERS, and also for the short-term management of INSOMNIA but has largely been superseded by the BENZODIAZEPINES. (From Martindale, The Extra Pharmacopoeia, 30th ed, p603)	2.05	1	0	organic molecular entity
mesalamine Mesalamine: An anti-inflammatory agent, structurally related to the SALICYLATES, which is active in INFLAMMATORY BOWEL DISEASE. It is considered to be the active moiety of SULPHASALAZINE. (From Martindale, The Extra Pharmacopoeia, 30th ed). mesalamine : A monohydroxybenzoic acid that is salicylic acid substituted by an amino group at the 5-position.	2.05	1	0	amino acid; aromatic amine; monocarboxylic acid; monohydroxybenzoic acid; phenols	non-steroidal anti-inflammatory drug
mesoridazine Mesoridazine: A phenothiazine antipsychotic with effects similar to CHLORPROMAZINE.. mesoridazine : A phenothiazine substituted at position 2 (para to the S atom) by a methylsulfinyl group, and on the nitrogen by a 2-(1-methylpiperidin-2-yl)ethyl group.	2.04	1	0	phenothiazines; sulfoxide; tertiary amino compound	dopaminergic antagonist; first generation antipsychotic
metaproterenol Metaproterenol: A beta-2 adrenergic agonist used in the treatment of ASTHMA and BRONCHIAL SPASM.. orciprenaline : A racemate composed of equimolar amounts of (R)- and (S)-orciprenaline. Used (as its sulfate salt) to relax the airway muscles and improve breathing for patients suffering from asthma or bronchitis.. 5-[1-hydroxy-2-(isopropanylamino)ethyl]benzene-1,3-diol : A member of the class of resorcinols bearing an additional 1-hydroxy-2-(isopropanylamino)ethyl substituent at position 5 of resorcinol itself.	2.75	3	0	aralkylamino compound; phenylethanolamines; resorcinols; secondary alcohol; secondary amino compound
metformin Metformin: A biguanide hypoglycemic agent used in the treatment of non-insulin-dependent diabetes mellitus not responding to dietary modification. Metformin improves glycemic control by improving insulin sensitivity and decreasing intestinal absorption of glucose. (From Martindale, The Extra Pharmacopoeia, 30th ed, p289). metformin : A member of the class of guanidines that is biguanide the carrying two methyl substituents at position 1.	6.08	8	1	guanidines	environmental contaminant; geroprotector; hypoglycemic agent; xenobiotic
methadone Methadone: A synthetic opioid that is used as the hydrochloride. It is an opioid analgesic that is primarily a mu-opioid agonist. It has actions and uses similar to those of MORPHINE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1082-3). methadone : A racemate comprising equimolar amounts of dextromethadone and levomethadone. It is a opioid analgesic which is used as a painkiller and as a substitute for heroin in the treatment of heroin addiction.. 6-(dimethylamino)-4,4-diphenylheptan-3-one : A ketone that is heptan-3-one substituted by a dimethylamino group at position 6 and two phenyl groups at position 4.	2.46	2	0	benzenes; diarylmethane; ketone; tertiary amino compound
methapyrilene Methapyrilene: Histamine H1 antagonist with sedative action used as a hypnotic and in allergies.. methapyrilene : A member of the class of ethylenediamine derivatives that is ethylenediamine in which one of the nitrogens is substituted by two methyl groups, and the other nitrogen is substituted by a 2-pyridyl group and a (2-thienyl)methyl group.	2.04	1	0	ethylenediamine derivative	anti-allergic agent; carcinogenic agent; H1-receptor antagonist; sedative
methenamine Methenamine: An anti-infective agent most commonly used in the treatment of urinary tract infections. Its anti-infective action derives from the slow release of formaldehyde by hydrolysis at acidic pH. (From Martindale, The Extra Pharmacopoeia, 30th ed, p173). hexamethylenetetramine : A polycyclic cage that is adamantane in which the carbon atoms at positions 1, 3, 5 and 7 are replaced by nitrogen atoms.	4.56	8	0	polyazaalkane; polycyclic cage; tetramine	antibacterial drug
methocarbamol Methocarbamol: A centrally acting muscle relaxant whose mode of action has not been established. It is used as an adjunct in the symptomatic treatment of musculoskeletal conditions associated with painful muscle spasm. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1206). methocarbamol : A racemate comprising equimolar amounts of (R)- and (S)-methocarbamol. A centrally acting skeletal muscle relaxant, it is used as an adjunct in the short-term symptomatic treatment of painful muscle spasm. The (R)-enantiomer is more active than the (S)-enantiomer.. 2-hydroxy-3-(2-methoxyphenoxy)propyl carbamate : A carbamate ester that is glycerol in which one of the primary alcohol groups has been converted to its 2-methoxyphenyl ether while the other has been converted to the corresponding carbamate ester.	2.04	1	0	aromatic ether; carbamate ester; secondary alcohol
methoxsalen Methoxsalen: A naturally occurring furocoumarin compound found in several species of plants, including Psoralea corylifolia. It is a photoactive substance that forms DNA ADDUCTS in the presence of ultraviolet A irradiation.. methoxsalen : A member of the class of psoralens that is 7H-furo[3,2-g]chromen-7-one in which the 9 position is substituted by a methoxy group. It is a constituent of the fruits of Ammi majus. Like other psoralens, trioxsalen causes photosensitization of the skin. It is administered topically or orally in conjunction with UV-A for phototherapy treatment of vitiligo and severe psoriasis.	2.05	1	0	aromatic ether; psoralens	antineoplastic agent; cross-linking reagent; dermatologic drug; photosensitizing agent; plant metabolite
methoxyflurane Methoxyflurane: An inhalation anesthetic. Currently, methoxyflurane is rarely used for surgical, obstetric, or dental anesthesia. If so employed, it should be administered with NITROUS OXIDE to achieve a relatively light level of anesthesia, and a neuromuscular blocking agent given concurrently to obtain the desired degree of muscular relaxation. (From AMA Drug Evaluations Annual, 1994, p180). methoxyflurane : An ether in which the two groups attached to the central oxygen atom are methyl and 2,2-dichloro-1,1-difluoroethyl.	2.05	1	0	ether; organochlorine compound; organofluorine compound	hepatotoxic agent; inhalation anaesthetic; nephrotoxic agent; non-narcotic analgesic
nocodazole [no description available]	2.71	3	0	aromatic ketone; benzimidazoles; carbamate ester; thiophenes	antimitotic; antineoplastic agent; microtubule-destabilising agent; tubulin modulator
methyl salicylate methyl salicylate: used in over-the-counter liniments, ointments, lotions for relief of musculoskeletal aches and pains; has hemolytic effect on human & sheep erythrocytes; RN given refers to parent cpd; structure in Merck Index, 9th ed, #5990. methyl salicylate : A benzoate ester that is the methyl ester of salicylic acid.	2.05	1	0	benzoate ester; methyl ester; salicylates	flavouring agent; insect attractant; metabolite
methyl methanesulfonate [no description available]	2.03	1	0	methanesulfonate ester	alkylating agent; apoptosis inducer; carcinogenic agent; genotoxin; mutagen
methylphenidate Methylphenidate: A central nervous system stimulant used most commonly in the treatment of ATTENTION DEFICIT DISORDER in children and for NARCOLEPSY. Its mechanisms appear to be similar to those of DEXTROAMPHETAMINE. The d-isomer of this drug is referred to as DEXMETHYLPHENIDATE HYDROCHLORIDE.. methylphenidate : A racemate comprising equimolar amounts of the two threo isomers of methyl phenyl(piperidin-2-yl)acetate. A central stimulant and indirect-acting sympathomimetic, is used (generally as the hydrochloride salt) in the treatment of hyperactivity disorders in children and for the treatment of narcolepsy.. methyl phenyl(piperidin-2-yl)acetate : A amino acid ester that is methyl phenylacetate in which one of the hydrogens alpha to the carbonyl group is replaced by a piperidin-2-yl group.	2.87	4	0	beta-amino acid ester; methyl ester; piperidines
methyprylon methyprylon: was heading 1973-94 (see under HYPNOTICS AND SEDATIVES 1963-72); use PIPERIDONES to search METHYPRYLON 1973-94	2.45	2	0	organic molecular entity
metoclopramide Metoclopramide: A dopamine D2 antagonist that is used as an antiemetic.. metoclopramide : A member of the class of benzamides resulting from the formal condensation of 4-amino-5-chloro-2-methoxybenzoic acid with the primary amino group of N,N-diethylethane-1,2-diamine.	2.46	2	0	benzamides; monochlorobenzenes; substituted aniline; tertiary amino compound	antiemetic; dopaminergic antagonist; environmental contaminant; gastrointestinal drug; xenobiotic
metolazone Metolazone: A quinazoline-sulfonamide derived DIURETIC that functions by inhibiting SODIUM CHLORIDE SYMPORTERS.. metolazone : A quinazoline that consists of 1,2,3,4-tetrahydroquinazolin-4-one bearing additional methyl, 2-tolyl, sulfamyl and chloro substituents at positions 2, 3, 6 and 7 respectively. A quinazoline diuretic, with properties similar to thiazide diuretics.	2.46	2	0	organochlorine compound; quinazolines; sulfonamide	antihypertensive agent; diuretic; ion transport inhibitor
metoprolol Metoprolol: A selective adrenergic beta-1 blocking agent that is commonly used to treat ANGINA PECTORIS; HYPERTENSION; and CARDIAC ARRHYTHMIAS.. metoprolol : A propanolamine that is 1-(propan-2-ylamino)propan-2-ol substituted by a 4-(2-methoxyethyl)phenoxy group at position 1.	3.15	5	0	aromatic ether; propanolamine; secondary alcohol; secondary amino compound	antihypertensive agent; beta-adrenergic antagonist; environmental contaminant; geroprotector; xenobiotic
metronidazole Metronidazole: A nitroimidazole used to treat AMEBIASIS; VAGINITIS; TRICHOMONAS INFECTIONS; GIARDIASIS; ANAEROBIC BACTERIA; and TREPONEMAL INFECTIONS.. metronidazole : A member of the class of imidazoles substituted at C-1, -2 and -5 with 2-hydroxyethyl, nitro and methyl groups respectively. It has activity against anaerobic bacteria and protozoa, and has a radiosensitising effect on hypoxic tumour cells. It may be given by mouth in tablets, or as the benzoate in an oral suspension. The hydrochloride salt can be used in intravenous infusions. Metronidazole is a prodrug and is selective for anaerobic bacteria due to their ability to intracellularly reduce the nitro group of metronidazole to give nitroso-containing intermediates. These can covalently bind to DNA, disrupting its helical structure, inducing DNA strand breaks and inhibiting bacterial nucleic acid synthesis, ultimately resulting in bacterial cell death.	13.37	101	30	C-nitro compound; imidazoles; primary alcohol	antiamoebic agent; antibacterial drug; antimicrobial agent; antiparasitic agent; antitrichomonal drug; environmental contaminant; prodrug; radiosensitizing agent; xenobiotic
metyrapone Metyrapone: An inhibitor of the enzyme STEROID 11-BETA-MONOOXYGENASE. It is used as a test of the feedback hypothalamic-pituitary mechanism in the diagnosis of CUSHING SYNDROME.. metyrapone : An aromatic ketone that is 3,3-dimethylbutan-2-one in which the methyl groups at positions 1 and 4 are replaced by pyridin-3-yl groups. A steroid 11beta-monooxygenase (EC 1.14.15.4) inhibitor, it is used in the diagnosis of adrenal insufficiency.	2.74	3	0	aromatic ketone	antimetabolite; diagnostic agent; EC 1.14.15.4 (steroid 11beta-monooxygenase) inhibitor
mexiletine Mexiletine: Antiarrhythmic agent pharmacologically similar to LIDOCAINE. It may have some anticonvulsant properties.. mexiletine : An aromatic ether which is 2,6-dimethylphenyl ether of 2-aminopropan-1-ol.	2.46	2	0	aromatic ether; primary amino compound	anti-arrhythmia drug
mianserin Mianserin: A tetracyclic compound with antidepressant effects. It may cause drowsiness and hematological problems. Its mechanism of therapeutic action is not well understood, although it apparently blocks alpha-adrenergic, histamine H1, and some types of serotonin receptors.. mianserin : A dibenzoazepine (specifically 1,2,3,4,10,14b-hexahydrodibenzo[c,f]pyrazino[1,2-a]azepine) methyl-substituted on N-2. Closely related to (and now mostly superseded by) the tetracyclic antidepressant mirtazapinean, it is an atypical antidepressant used in the treatment of depression throughout Europe and elsewhere.	2.94	4	0	dibenzoazepine	adrenergic uptake inhibitor; alpha-adrenergic antagonist; antidepressant; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; geroprotector; H1-receptor antagonist; histamine agonist; sedative; serotonergic antagonist
miconazole Miconazole: An imidazole antifungal agent that is used topically and by intravenous infusion.. 1-[2-(2,4-dichlorobenzyloxy)-2-(2,4-dichlorophenyl)ethyl]imidazole : A member of the class of imidazoles that is 1-(2,4-dichlorophenyl)-2-(imidazol-1-yl)ethanol in which the hydroxyl hydrogen is replaced by a 2,4-dichlorobenzyl group.. miconazole : A racemate composed of equimolar amounts of (R)- and (S)-miconazole. Used (as its nitrate salt) to treat skin infections such as athlete's foot, jock itch, ringworm and other fungal skin infections. It inhibits the synthesis of ergosterol, a critical component of fungal cell membranes.	5.9	9	3	dichlorobenzene; ether; imidazoles
midazolam Midazolam: A short-acting hypnotic-sedative drug with anxiolytic and amnestic properties. It is used in dentistry, cardiac surgery, endoscopic procedures, as preanesthetic medication, and as an adjunct to local anesthesia. The short duration and cardiorespiratory stability makes it useful in poor-risk, elderly, and cardiac patients. It is water-soluble at pH less than 4 and lipid-soluble at physiological pH.. midazolam : An imidazobenzodiazepine that is 4H-imidazo[1,5-a][1,4]benzodiazepine which is substituted by a methyl, 2-fluorophenyl and chloro groups at positions 1, 6 and 8, respectively.	2.74	3	0	imidazobenzodiazepine; monofluorobenzenes; organochlorine compound	anticonvulsant; antineoplastic agent; anxiolytic drug; apoptosis inducer; central nervous system depressant; GABAA receptor agonist; general anaesthetic; muscle relaxant; sedative
milrinone [no description available]	2.04	1	0	bipyridines; nitrile; pyridone	cardiotonic drug; EC 3.1.4.17 (3',5'-cyclic-nucleotide phosphodiesterase) inhibitor; platelet aggregation inhibitor; vasodilator agent
minoxidil Minoxidil: A potent direct-acting peripheral vasodilator (VASODILATOR AGENTS) that reduces peripheral resistance and produces a fall in BLOOD PRESSURE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p371). minoxidil : A pyrimidine N-oxide that is pyrimidine-2,4-diamine 3-oxide substituted by a piperidin-1-yl group at position 6.	3.16	5	0	dialkylarylamine; tertiary amino compound
mirtazapine Mirtazapine: A piperazinoazepine tetracyclic compound that enhances the release of NOREPINEPHRINE and SEROTONIN through blockage of presynaptic ALPHA-2 ADRENERGIC RECEPTORS. It also blocks both 5-HT2 and 5-HT3 serotonin receptors and is a potent HISTAMINE H1 RECEPTOR antagonist. It is used for the treatment of depression, and may also be useful for the treatment of anxiety disorders.	2.05	1	0	benzazepine; tetracyclic antidepressant	alpha-adrenergic antagonist; anxiolytic drug; H1-receptor antagonist; histamine antagonist; oneirogen; serotonergic antagonist
mitotane Mitotane: A derivative of the insecticide DICHLORODIPHENYLDICHLOROETHANE that specifically inhibits cells of the adrenal cortex and their production of hormones. It is used to treat adrenocortical tumors and causes CNS damage, but no bone marrow depression.	2.05	1	0	diarylmethane
mitoxantrone Mitoxantrone: An anthracenedione-derived antineoplastic agent.. mitoxantrone : A dihydroxyanthraquinone that is 1,4-dihydroxy-9,10-anthraquinone which is substituted by 6-hydroxy-1,4-diazahexyl groups at positions 5 and 8.	2.46	2	0	dihydroxyanthraquinone	analgesic; antineoplastic agent
moclobemide Moclobemide: A reversible inhibitor of monoamine oxidase type A; (RIMA); (see MONOAMINE OXIDASE INHIBITORS) that has antidepressive properties.. moclobemide : A member of the class of benzamides that is benzamide substituted by a chloro group at position 4 and a 2-(morpholin-4-yl)ethyl group at the nitrogen atom. It acts as a reversible monoamine oxidase inhibitor and is used in the treatment of depression.	2.05	1	0	benzamides; monochlorobenzenes; morpholines	antidepressant; environmental contaminant; xenobiotic
modafinil Modafinil: A benzhydryl acetamide compound, central nervous system stimulant, and CYP3A4 inducing agent that is used in the treatment of NARCOLEPSY and SLEEP WAKE DISORDERS.. modafinil : A racemate comprising equimolar amounts of armodafinil and (S)-modafinil. A central nervous system stimulant, it is used for the treatment of sleeping disorders such as narcolepsy, obstructive sleep apnoea, and shift-work sleep disorder. The optical enantiomers of modafinil have similar pharmacological actions in animals.. 2-[(diphenylmethyl)sulfinyl]acetamide : A sulfoxide that is dimethylsulfoxide in which two hydrogens attached to one of the methyl groups are replaced by phenyl groups, while one hydrogen attached to the other methyl group is replaced by a carbamoyl (aminocarbonyl) group.	2.45	2	0	monocarboxylic acid amide; sulfoxide
moxisylyte Moxisylyte: An alpha-adrenergic blocking agent that is used in Raynaud's disease. It is also used locally in the eye to reverse the mydriasis caused by phenylephrine and other sympathomimetic agents. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1312)	2.97	4	0	monoterpenoid
deet N,N-diethyl-m-toluamide : A monocarboxylic acid amide resulting from the formal condensation of the carboxy group of m-toluic acid with the nitrogen of diethylamine. First developed by the U.S. Army in 1946 for use by military personnel in insect-infested areas, it is the most widely used insect repellent worldwide.	2.05	1	0	benzamides; monocarboxylic acid amide	environmental contaminant; insect repellent; xenobiotic
n-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide: calmodulin antagonist; structure given in first source. N-(4-aminobutyl)-5-chloronaphthalene-2-sulfonamide : A sulfonamide that is 5-chloronaphthalene-2-sulfonamide in which one of the hydrogens of the nitrogen atom is substituted by a 4-aminobutyl group.	1.99	1	0	naphthalenes; organochlorine compound; primary amino compound; sulfonamide
n-(6-aminohexyl)-1-naphthalenesulfonamide N-(6-aminohexyl)-1-naphthalenesulfonamide: calmodulin antagonist; RN given refers to parent cpd	1.98	1	0	naphthalenes; sulfonic acid derivative
acecainide Acecainide: A major metabolite of PROCAINAMIDE. Its anti-arrhythmic action may cause cardiac toxicity in kidney failure.. N-acetylprocainamide : A benzamide obtained via formal condensation of 4-acetamidobenzoic acid and 2-(diethylamino)ethylamine.	2.05	1	0	acetamides; benzamides	anti-arrhythmia drug
ethylmaleimide Ethylmaleimide: A sulfhydryl reagent that is widely used in experimental biochemical studies.	3.07	5	0	maleimides	anticoronaviral agent; EC 1.3.1.8 [acyl-CoA dehydrogenase (NADP(+))] inhibitor; EC 2.1.1.122 [(S)-tetrahydroprotoberberine N-methyltransferase] inhibitor; EC 2.7.1.1 (hexokinase) inhibitor
clorgyline Clorgyline: An antidepressive agent and monoamine oxidase inhibitor related to PARGYLINE.. clorgyline : An aromatic ether that is the 2,4-dichlorophenyl ether of 3-aminopropan-1-ol in which the nitrogen is substituted by a methyl group and a prop-1-yn-3-yl group. A monoamine oxidase inhibitor, it was formerly used as an antidepressant.	2.45	2	0	aromatic ether; dichlorobenzene; terminal acetylenic compound; tertiary amino compound	antidepressant; EC 1.4.3.4 (monoamine oxidase) inhibitor
apnea Apnea: A transient absence of spontaneous respiration.	5.43	21	0	purine nucleoside
nabumetone Nabumetone: A butanone non-steroidal anti-inflammatory drug and cyclooxygenase-2 (COX2) inhibitor that is used in the management of pain associated with OSTEOARTHRITIS and RHEUMATOID ARTHRITIS.. nabumetone : A methyl ketone that is 2-butanone in which one of the methyl hydrogens at position 4 is replaced by a 6-methoxy-2-naphthyl group. A prodrug that is converted to the active metabolite, 6-methoxy-2-naphthylacetic acid, following oral administration. It is shown to have a slightly lower risk of gastrointestinal side effects than most other non-steroidal anti-inflammatory drugs.	2.05	1	0	methoxynaphthalene; methyl ketone	cyclooxygenase 2 inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; prodrug
nadolol [no description available]	2.05	1	0	tetralins
nafamostat nafamostat: inhibitor of trypsin, plasmin, pancreatic kallikrein, plasma kallikrein & thrombin; strongly inhibits esterolytic activities of C1r & C1 esterase complement-mediated hemolysis; antineoplastic	2.08	1	0	benzoic acids; guanidines
nalidixic acid [no description available]	9.55	75	2	1,8-naphthyridine derivative; monocarboxylic acid; quinolone antibiotic	antibacterial drug; antimicrobial agent; DNA synthesis inhibitor
naphazoline Naphazoline: An adrenergic vasoconstrictor agent used as a decongestant.	3.44	2	0	naphthalenes
nefazodone nefazodone: may be useful as an opiate adjunct	3.31	6	0	aromatic ether; monochlorobenzenes; N-alkylpiperazine; N-arylpiperazine; triazoles	alpha-adrenergic antagonist; analgesic; antidepressant; serotonergic antagonist; serotonin uptake inhibitor
nefopam Nefopam: Non-narcotic analgesic chemically similar to ORPHENADRINE. Its mechanism of action is unclear. It is used for the relief of acute and chronic pain. (From Martindale, The Extra Pharmacopoeia, 30th ed, p26). nefopam : A racemate comprising equal amounts of (R)- and (S)-nefopam. The hydrochloride is a centrally acting non-opiate analgesic commonly used for the treatment of moderate to severe pain.. 5-methyl-1-phenyl-3,4,5,6-tetrahydro-1H-2,5-benzoxazocine : A member of the class of benzoxazocines that is 3,4,5,6-tetrahydro-1H-2,5-benzoxazocine substituted by phenyl and methyl groups at positions 1 and 5 respectively.	2.05	1	0	benzoxazocine; tertiary amino compound
neostigmine Neostigmine: A cholinesterase inhibitor used in the treatment of myasthenia gravis and to reverse the effects of muscle relaxants such as gallamine and tubocurarine. Neostigmine, unlike PHYSOSTIGMINE, does not cross the blood-brain barrier.. neostigmine : A quaternary ammonium ion comprising an anilinium ion core having three methyl substituents on the aniline nitrogen, and a 3-[(dimethylcarbamoyl)oxy] substituent at position 3. It is a parasympathomimetic which acts as a reversible acetylcholinesterase inhibitor.	4.3	20	0	quaternary ammonium ion	antidote to curare poisoning; EC 3.1.1.7 (acetylcholinesterase) inhibitor
nevirapine Nevirapine: A potent, non-nucleoside reverse transcriptase inhibitor used in combination with nucleoside analogues for treatment of HIV INFECTIONS and AIDS.. nevirapine : A dipyridodiazepine that is 5,11-dihydro-6H-dipyrido[3,2-b:2',3'-e][1,4]diazepine which is substituted by methyl, oxo, and cyclopropyl groups at positions 4, 6, and 11, respectively. A non-nucleoside reverse transcriptase inhibitor with activity against HIV-1, it is used in combination with other antiretrovirals for the treatment of HIV infection.	2.75	3	0	cyclopropanes; dipyridodiazepine	antiviral drug; HIV-1 reverse transcriptase inhibitor
nialamide Nialamide: An MAO inhibitor that is used as an antidepressive agent.	2.46	2	0	organonitrogen compound; organooxygen compound
nicardipine Nicardipine: A potent calcium channel blockader with marked vasodilator action. It has antihypertensive properties and is effective in the treatment of angina and coronary spasms without showing cardiodepressant effects. It has also been used in the treatment of asthma and enhances the action of specific antineoplastic agents.. nicardipine : A racemate comprising equimolar amounts of (R)- and (S)-nicardipine. It is a calcium channel blocker which is used to treat hypertension.. 2-[benzyl(methyl)amino]ethyl methyl 2,6-dimethyl-4-(3-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxylate : A dihydropyridine that is 1,4-dihydropyridine substituted by a methyl, {2-[benzyl(methyl)amino]ethoxy}carbonyl, 3-nitrophenyl, methoxycarbonyl and methyl groups at positions 2, 3, 4, 5 and 6, respectively.	3.09	5	0	benzenes; C-nitro compound; diester; dihydropyridine; methyl ester; tertiary amino compound
niceritrol Niceritrol: An ester of nicotinic acid that lowers cholesterol and triglycerides in total plasma and in the VLD- and LD-lipoprotein fractions.	2.05	1	0	organic molecular entity
nifedipine Nifedipine: A potent vasodilator agent with calcium antagonistic action. It is a useful anti-anginal agent that also lowers blood pressure.	4.3	19	0	C-nitro compound; dihydropyridine; methyl ester	calcium channel blocker; human metabolite; tocolytic agent; vasodilator agent
niflumic acid Niflumic Acid: An analgesic and anti-inflammatory agent used in the treatment of rheumatoid arthritis.	2.42	2	0	aromatic carboxylic acid; pyridines
nilutamide [no description available]	2.05	1	0	(trifluoromethyl)benzenes; C-nitro compound; imidazolidinone	androgen antagonist; antineoplastic agent
nimesulide nimesulide: structure. nimesulide : An aromatic ether having phenyl and 2-methylsulfonamido-5-nitrophenyl as the two aryl groups.	2.71	3	0	aromatic ether; C-nitro compound; sulfonamide	cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug
nimetazepam nimetazepam : A nitrazepam which is substituted at positions 1 by a methyl group. It is used as an anticonvulsant and as a hypnotic for the short-term management of insomnia.	2.04	1	0	1,4-benzodiazepinone; C-nitro compound	anticonvulsant; antispasmodic drug; GABA modulator; sedative
nimodipine Nimodipine: A calcium channel blockader with preferential cerebrovascular activity. It has marked cerebrovascular dilating effects and lowers blood pressure.. nimodipine : A dihydropyridine that is 1,4-dihydropyridine which is substituted by methyl groups at positions 2 and 6, a (2-methoxyethoxy)carbonyl group at position 3, a m-nitrophenyl group at position 4, and an isopropoxycarbonyl group at position 5. An L-type calcium channel blocker, it acts particularly on cerebral circulation, and is used both orally and intravenously for the prevention and treatment of subarachnoid hemorrhage from ruptured intracranial aneurysm.	3.51	8	0	2-methoxyethyl ester; C-nitro compound; dicarboxylic acids and O-substituted derivatives; diester; dihydropyridine; isopropyl ester	antihypertensive agent; calcium channel blocker; cardiovascular drug; vasodilator agent
nipecotic acid nipecotic acid: RN given refers to cpd without isomeric designation. nipecotic acid : A piperidinemonocarboxylic acid that is piperidine in which one of the hydrogens at position 3 is substituted by a carboxylic acid group.	2.4	2	0	beta-amino acid; piperidinemonocarboxylic acid
nisoldipine Nisoldipine: A dihydropyridine calcium channel antagonist that acts as a potent arterial vasodilator and antihypertensive agent. It is also effective in patients with cardiac failure and angina.. nisoldipine : A racemate consisting of equimolar amounts of (R)- and (S)-nisoldipine. A calcium channel blocker, it is used in the treatment of hypertension and angina pectoris.. methyl 2-methylpropyl 2,6-dimethyl-4-(2-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxylate : A dihydropyridine that is 1,4-dihydropyridine which is substituted by methyl groups at positions 2 and 6, a methoxycarbonyl group at position 3, an o-nitrophenyl group at position 4, and an isobutoxycarbonyl group at position 5. The racemate, a calcium channel blocker, is used in the treatment of hypertension and angina pectoris.	2.71	3	0	C-nitro compound; dicarboxylic acids and O-substituted derivatives; diester; dihydropyridine; methyl ester
nitrazepam Nitrazepam: A benzodiazepine derivative used as an anticonvulsant and hypnotic.. nitrazepam : A 1,4-benzodiazepinone that is 1,3-dihydro-2H-1,4-benzodiazepin-2-one which is substituted at positions 5 and 7 by phenyl and nitro groups, respectively. It is used as a hypnotic for the short-term management of insomnia and for the treatment of epileptic spasms in infants (West's syndrome).	2.74	3	0	1,4-benzodiazepinone; C-nitro compound	anticonvulsant; antispasmodic drug; drug metabolite; GABA modulator; sedative
nitrendipine Nitrendipine: A calcium channel blocker with marked vasodilator action. It is an effective antihypertensive agent and differs from other calcium channel blockers in that it does not reduce glomerular filtration rate and is mildly natriuretic, rather than sodium retentive.. nitrendipine : A dihydropyridine that is 1,4-dihydropyridine substituted by methyl groups at positions 2 and 6, a 3-nitrophenyl group at position 4, a ethoxycarbonyl group at position 3 and a methoxycarbonyl group at position 5. It is a calcium-channel blocker used in the treatment of hypertension.	3.53	8	0	C-nitro compound; dicarboxylic acids and O-substituted derivatives; diester; dihydropyridine; ethyl ester; methyl ester	antihypertensive agent; calcium channel blocker; geroprotector; vasodilator agent
nitroglycerin Nitroglycerin: A volatile vasodilator which relieves ANGINA PECTORIS by stimulating GUANYLATE CYCLASE and lowering cytosolic calcium. It is also sometimes used for TOCOLYSIS and explosives.. nitroglycerol : A nitrate ester that is glycerol in which nitro group(s) replace the hydrogen(s) attached to one or more of the hydroxy groups.. nitroglycerin : A nitroglycerol that is glycerol in which the hydrogen atoms of all three hydroxy groups are replaced by nitro groups. It acts as a prodrug, releasing nitric oxide to open blood vessels and so alleviate heart pain.	2.05	1	0	nitroglycerol	explosive; muscle relaxant; nitric oxide donor; prodrug; tocolytic agent; vasodilator agent; xenobiotic
nitromide nitromide: antibacterial agent for prevention & treatment of Salmonella pullorum infections in chickens & turkeys & for fowl typhoid & paratyphoid; used in feed; structure	1.95	1	0
nizatidine [no description available]	2.75	3	0	1,3-thiazoles; C-nitro compound; carboxamidine; organic sulfide; tertiary amino compound	anti-ulcer drug; cholinergic drug; H2-receptor antagonist
nomifensine Nomifensine: An isoquinoline derivative that prevents dopamine reuptake into synaptosomes. The maleate was formerly used in the treatment of depression. It was withdrawn worldwide in 1986 due to the risk of acute hemolytic anemia with intravascular hemolysis resulting from its use. In some cases, renal failure also developed. (From Martindale, The Extra Pharmacopoeia, 30th ed, p266). nomifensine : An N-methylated tetrahydroisoquinoline carrying phenyl and amino substituents at positions C-4 and C-8, respectively.	2.71	3	0	isoquinolines	dopamine uptake inhibitor
masoprocol nordihydroguaretic acid: antioxidant compound found in the creosote bush (Larrea tridentata)	2.05	1	0	catechols; lignan; tetrol	antioxidant; ferroptosis inhibitor; geroprotector; plant metabolite
norfloxacin Norfloxacin: A synthetic fluoroquinolone (FLUOROQUINOLONES) with broad-spectrum antibacterial activity against most gram-negative and gram-positive bacteria. Norfloxacin inhibits bacterial DNA GYRASE.. norfloxacin : A quinolinemonocarboxylic acid with broad-spectrum antibacterial activity against most gram-negative and gram-positive bacteria. Norfloxacin is bactericidal and its mode of action depends on blocking of bacterial DNA replication by binding itself to an enzyme called DNA gyrase.	5.55	9	2	fluoroquinolone antibiotic; N-arylpiperazine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone	antibacterial drug; DNA synthesis inhibitor; environmental contaminant; xenobiotic
nortriptyline Nortriptyline: A metabolite of AMITRIPTYLINE that is also used as an antidepressive agent. Nortriptyline is used in major depression, dysthymia, and atypical depressions.. nortriptyline : An organic tricyclic compound that is 10,11-dihydro-5H-dibenzo[a,d][7]annulene substituted by a 3-(methylamino)propylidene group at position 5. It is an active metabolite of amitriptyline.	2.97	4	0	organic tricyclic compound; secondary amine	adrenergic uptake inhibitor; analgesic; antidepressant; antineoplastic agent; apoptosis inducer; drug metabolite
5-nitro-2-(3-phenylpropylamino)benzoic acid 5-nitro-2-(3-phenylpropylamino)benzoic acid: structure given in first source; chloride channel antagonist	1.97	1	0	nitrobenzoic acid
ns 2028 NS 2028: structure in first source	2.04	1	0
n-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide: structure given in first source. NS-398 : A C-nitro compound that is N-methylsulfonyl-4-nitroaniline bearing an additional cyclohexyloxy substituent at position 2.	2.04	1	0	aromatic ether; C-nitro compound; sulfonamide	antineoplastic agent; cyclooxygenase 2 inhibitor
octopamine Octopamine: An alpha-adrenergic sympathomimetic amine, biosynthesized from tyramine in the CNS and platelets and also in invertebrate nervous systems. It is used to treat hypotension and as a cardiotonic. The natural D(-) form is more potent than the L(+) form in producing cardiovascular adrenergic responses. It is also a neurotransmitter in some invertebrates.. octopamine : A member of the class of phenylethanolamines that is phenol which is substituted at the para- position by a 2-amino-1-hydroxyethyl group. A biogenic phenylethanolamine which has been found to act as a neurotransmitter, neurohormone or neuromodulator in invertebrates.	2.64	3	0	phenylethanolamines; tyramines	neurotransmitter
ofloxacin Ofloxacin: A synthetic fluoroquinolone antibacterial agent that inhibits the supercoiling activity of bacterial DNA GYRASE, halting DNA REPLICATION.. 9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid : An oxazinoquinoline that is 2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinolin-7-one substituted by methyl, carboxy, fluoro, and 4-methylpiperazin-1-yl groups at positions 3, 6, 9, and 10, respectively.. ofloxacin : A racemate comprising equimolar amounts of levofloxacin and dextrofloxacin. It is a synthetic fluoroquinolone antibacterial agent which inhibits the supercoiling activity of bacterial DNA gyrase, halting DNA replication.	8.57	23	6	3-oxo monocarboxylic acid; N-arylpiperazine; N-methylpiperazine; organofluorine compound; oxazinoquinoline
omeprazole Omeprazole: A 4-methoxy-3,5-dimethylpyridyl, 5-methoxybenzimidazole derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits an H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.. omeprazole : A racemate comprising equimolar amounts of (R)- and (S)-omeprazole.. 5-methoxy-2-{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl}-1H-benzimidazole : A member of the class of benzimidazoles that is 1H-benzimidazole which is substituted by a [4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl group at position 2 and a methoxy group at position 5.	2.74	3	0	aromatic ether; benzimidazoles; pyridines; sulfoxide
ondansetron Ondansetron: A competitive serotonin type 3 receptor antagonist. It is effective in the treatment of nausea and vomiting caused by cytotoxic chemotherapy drugs, including cisplatin, and has reported anxiolytic and neuroleptic properties.	2.75	3	0	carbazoles
orphenadrine Orphenadrine: A muscarinic antagonist used to treat drug-induced parkinsonism and to relieve pain from muscle spasm.. orphenadrine : A tertiary amino compound which is the phenyl-o-tolylmethyl ether of 2-(dimethylamino)ethanol.	2.05	1	0	ether; tertiary amino compound	antidyskinesia agent; antiparkinson drug; H1-receptor antagonist; muscarinic antagonist; muscle relaxant; NMDA receptor antagonist; parasympatholytic
oxamniquine Oxamniquine: An anthelmintic with schistosomicidal activity against Schistosoma mansoni, but not against other Schistosoma spp. Oxamniquine causes worms to shift from the mesenteric veins to the liver where the male worms are retained; the female worms return to the mesentery, but can no longer release eggs. (From Martindale, The Extra Pharmacopoeia, 31st ed, p121). oxamniquine : A racemate comprising equimolar amounts of (R)- and (S)-oxamniquine. An anthelmintic, it is administered orally for the treatment of schistomiasis caused by Schistosoma mansoni (but not by other Schistosoma species); intramuscular administration is no longer used as it causes severe pain at the injection site.. {2-[(isopropylamino)methyl]-7-nitro-1,2,3,4-tetrahydroquinolin-6-yl}methanol : A member of the class of quinolines that is 1,2,3,4-tetrahydroquinoline which is substituted at positions 2, 6, and 7 by (isopropylamino)methyl, hydroxymethyl, and nitro groups, respectively.	2.45	2	0	aromatic primary alcohol; C-nitro compound; quinolines; secondary amino compound
oxaprozin Oxaprozin: An oxazole-propionic acid derivative, cyclooxygenase inhibitor, and non-steroidal anti-inflammatory drug that is used in the treatment of pain and inflammation associated with of OSTEOARTHRITIS; RHEUMATOID ARTHRITIS; and ARTHRITIS, JUVENILE.. oxaprozin : A monocarboxylic acid that is a propionic acid derivative having a 4,5-diphenyl-1,3-oxazol-2-yl substituent at position 3. It is non-steroidal anti-inflammatory drug commonly used to relieve the pain and inflammatory responses associated with osteoarthritis and rheumatoid arthritis.	2.05	1	0	1,3-oxazoles; monocarboxylic acid	analgesic; non-steroidal anti-inflammatory drug
oxatomide oxatomide: structure; an anti-allergic & an anti-asthmatic. oxatomide : A member of the class of benzimidazoles that is 1,3-dihydro-2H-benzimidazol-2-one substituted by a 3-[4-(diphenylmethyl)piperazin-1-yl]propyl group at position 1. It is an anti-allergic drug.	2.05	1	0	benzimidazoles; diarylmethane; N-alkylpiperazine	anti-allergic agent; anti-inflammatory agent; geroprotector; H1-receptor antagonist; serotonergic antagonist
oxazepam Oxazepam: A benzodiazepine used in the treatment of anxiety, alcohol withdrawal, and insomnia.. oxazepam : A 1,4-benzodiazepinone that is 1,3-dihydro-2H-1,4-benzodiazepin-2-one substituted by a chloro group at position 7, a hydroxy group at position 3 and phenyl group at position 5.	2.46	2	0	1,4-benzodiazepinone; organochlorine compound	anxiolytic drug; environmental contaminant; xenobiotic
oxethazaine [no description available]	2.05	1	0	amino acid amide
oxidopamine Oxidopamine: A neurotransmitter analogue that depletes noradrenergic stores in nerve endings and induces a reduction of dopamine levels in the brain. Its mechanism of action is related to the production of cytolytic free-radicals.. oxidopamine : A benzenetriol that is phenethylamine in which the hydrogens at positions 2, 4, and 5 on the phenyl ring are replaced by hydroxy groups. It occurs naturally in human urine, but is also produced as a metabolite of the drug DOPA (used for the treatment of Parkinson's disease).	1.98	1	0	benzenetriol; catecholamine; primary amino compound	drug metabolite; human metabolite; neurotoxin
oxolinic acid quinolone antibiotic : An organonitrogen heterocyclic antibiotic whose structure contains a quinolone or quinolone-related skeleton.	2.04	1	0	aromatic carboxylic acid; organic heterotricyclic compound; oxacycle; quinolinemonocarboxylic acid; quinolone antibiotic	antibacterial drug; antifungal agent; antiinfective agent; antimicrobial agent; enzyme inhibitor
oxotremorine Oxotremorine: A non-hydrolyzed muscarinic agonist used as a research tool.	2.38	2	0	N-alkylpyrrolidine
oxprenolol Oxprenolol: A beta-adrenergic antagonist used in the treatment of hypertension, angina pectoris, arrhythmias, and anxiety.	2.46	2	0	aromatic ether
oxybenzone oxybenzone : A hydroxybenzophenone that is benzophenone which is substituted at the 2- and 4-positions of one of the benzene rings by hydroxy and methoxy groups respectively.	2.05	1	0	hydroxybenzophenone; monomethoxybenzene	dermatologic drug; environmental contaminant; protective agent; ultraviolet filter; xenobiotic
oxybutynin oxybutynin: RN given refers to parent cpd. oxybutynin : A racemate comprising equimolar amounts of (R)-oxybutynin and esoxybutynin. An antispasmodic used for the treatment of overactive bladder.	2.46	2	0	acetylenic compound; carboxylic ester; racemate; tertiary alcohol; tertiary amino compound	antispasmodic drug; calcium channel blocker; local anaesthetic; muscarinic antagonist; muscle relaxant; parasympatholytic
oxymetazoline Oxymetazoline: A direct acting sympathomimetic used as a vasoconstrictor to relieve nasal congestion. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1251). oxymetazoline : A member of the class of phenols that is 2,4-dimethylphenol which is substituted at positions 3 and 6 by 4,5-dihydro-1H-imidazol-2-ylmethyl and tert-butyl groups, respectively. A direct-acting sympathomimetic with marked alpha-adrenergic activity, it is a vasoconstrictor that is used (generally as the hydrochloride salt) to relieve nasal congestion.	3.04	1	0	carboxamidine; imidazolines; phenols	alpha-adrenergic agonist; nasal decongestant; sympathomimetic agent; vasoconstrictor agent
oxyphenbutazone Oxyphenbutazone: A non-steroidal anti-inflammatory drug. Oxyphenbutazone eyedrops have been used abroad in the management of postoperative ocular inflammation, superficial eye injuries, and episcleritis. (From AMA, Drug Evaluations Annual, 1994, p2000) It had been used by mouth in rheumatic disorders such as ankylosing spondylitis, osteoarthritis, and rheumatoid arthritis but such use is no longer considered justified owing to the risk of severe hematological adverse effects. (From Martindale, The Extra Pharmacopoeia, 30th ed, p27). oxyphenbutazone : A metabolite of phenylbutazone obtained by hydroxylation at position 4 of one of the phenyl rings. Commonly used (as its hydrate) to treat pain, swelling and stiffness associated with arthritis and gout, it was withdrawn from the market 1984 following association with blood dyscrasis and Stevens-Johnson syndrome.	2.05	1	0	phenols; pyrazolidines	antimicrobial agent; antineoplastic agent; antipyretic; drug metabolite; gout suppressant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic metabolite
aminosalicylic acid Aminosalicylic Acid: An antitubercular agent often administered in association with ISONIAZID. The sodium salt of the drug is better tolerated than the free acid.. 4-aminosalicylic acid : An aminobenzoic acid that is salicylic acid substituted by an amino group at position 4.	7.07	11	1	aminobenzoic acid; phenols	antitubercular agent
pamidronate [no description available]	2.45	2	0	phosphonoacetic acid
pantoprazole Pantoprazole: 2-pyridinylmethylsulfinylbenzimidazole proton pump inhibitor that is used in the treatment of GASTROESOPHAGEAL REFLUX and PEPTIC ULCER.. pantoprazole : A member of the class of benzimidazoles that is 1H-benzimidazole substituted by a difluoromethoxy group at position 5 and a [(3,4-dimethoxypyridin-2-yl)methyl]sulfinyl group at position 2.	2.05	1	0	aromatic ether; benzimidazoles; organofluorine compound; pyridines; sulfoxide	anti-ulcer drug; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor; environmental contaminant; xenobiotic
papaverine Papaverine: An alkaloid found in opium but not closely related to the other opium alkaloids in its structure or pharmacological actions. It is a direct-acting smooth muscle relaxant used in the treatment of impotence and as a vasodilator, especially for cerebral vasodilation. The mechanism of its pharmacological actions is not clear, but it apparently can inhibit phosphodiesterases and it may have direct actions on calcium channels.. papaverine : A benzylisoquinoline alkaloid that is isoquinoline substituted by methoxy groups at positions 6 and 7 and a 3,4-dimethoxybenzyl group at position 1. It has been isolated from Papaver somniferum.	2.05	1	0	benzylisoquinoline alkaloid; dimethoxybenzene; isoquinolines	antispasmodic drug; vasodilator agent
pargyline Pargyline: A monoamine oxidase inhibitor with antihypertensive properties.	2.67	3	0	aromatic amine
pd 153035 4-((3-bromophenyl)amino)-6,7-dimethoxyquinazoline: structure given in first source. PD-153035 : A member of the class of quinazolines carrying a 3-bromophenylamino substituent at position 4 and two methoxy substituents at positions 6 and 7.	2.04	1	0	aromatic amine; aromatic ether; bromobenzenes; quinazolines; secondary amino compound	EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; epidermal growth factor receptor antagonist
pd 98059 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one: inhibits MAP kinase kinase (MEK) activity, p42 MAPK and p44 MAPK; structure in first source. 2-(2-amino-3-methoxyphenyl)chromen-4-one : A member of the class of monomethoxyflavones that is 3'-methoxyflavone bearing an additional amino substituent at position 2'.	3.11	5	0	aromatic amine; monomethoxyflavone	EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; geroprotector
pemoline Pemoline: A central nervous system stimulant used in fatigue and depressive states and to treat hyperkinetic disorders in children.. pemoline : A member of the class of 1,3-oxazoles that is 1,3-oxazol-4(5H)-one which is substituted by an amino group at position 2 and by a phenyl group at position 5. A central nervous system stimulant, it was used to treat hyperactivity disorders in children, but withdrawn from use following reports of serious hepatotoxicity.	2.46	2	0	1,3-oxazoles	central nervous system stimulant
pentamidine Pentamidine: Antiprotozoal agent effective in trypanosomiasis, leishmaniasis, and some fungal infections; used in treatment of PNEUMOCYSTIS pneumonia in HIV-infected patients. It may cause diabetes mellitus, central nervous system damage, and other toxic effects.. pentamidine : A diether consisting of pentane-1,5-diol in which both hydroxyl hydrogens have been replaced by 4-amidinophenyl groups. A trypanocidal drug that is used for treatment of cutaneous leishmaniasis and Chagas disease.	2.72	3	0	aromatic ether; carboxamidine; diether	anti-inflammatory agent; antifungal agent; calmodulin antagonist; chemokine receptor 5 antagonist; EC 2.3.1.48 (histone acetyltransferase) inhibitor; NMDA receptor antagonist; S100 calcium-binding protein B inhibitor; trypanocidal drug; xenobiotic
pentobarbital Pentobarbital: A short-acting barbiturate that is effective as a sedative and hypnotic (but not as an anti-anxiety) agent and is usually given orally. It is prescribed more frequently for sleep induction than for sedation but, like similar agents, may lose its effectiveness by the second week of continued administration. (From AMA Drug Evaluations Annual, 1994, p236). pentobarbital : A member of the class of barbiturates, the structure of which is that of barbituric acid substituted at C-5 by ethyl and sec-pentyl groups.	3.98	4	0	barbiturates	GABAA receptor agonist
pentoxifylline [no description available]	2.74	3	0	oxopurine
perazine Perazine: A phenothiazine antipsychotic with actions and uses similar to those of CHLORPROMAZINE. Extrapyramidal symptoms may be more common than other side effects.. perazine : A phenothiazine derivative in which 10H-phenothiazinecarries a 3-(4-methylpiperazin-1-yl)propyl substituent at the N-10 position.	2.05	1	0	N-alkylpiperazine; N-methylpiperazine; phenothiazines	dopaminergic antagonist; phenothiazine antipsychotic drug
perhexiline Perhexiline: 2-(2,2-Dicyclohexylethyl)piperidine. Coronary vasodilator used especially for angina of effort. It may cause neuropathy and hepatitis.	2.46	2	0	piperidines	cardiovascular drug
perphenazine Perphenazine: An antipsychotic phenothiazine derivative with actions and uses similar to those of CHLORPROMAZINE.. perphenazine : A phenothiazine derivative in which the phenothiazine tricycle carries a chloro substituent at the 2-position and a 3-[4-(2-hydroxyethyl)piperazin-1-yl]propyl group at N-10.	2.74	3	0	N-(2-hydroxyethyl)piperazine; N-alkylpiperazine; organochlorine compound; phenothiazines	antiemetic; dopaminergic antagonist; phenothiazine antipsychotic drug
phenacemide phenacemide: anti-epileptic drug; structure	2.04	1	0	acetamides
phenacetin Saridon: contains phenacetin, caffeine, propyphenazone & pyrithyldione	3.23	6	0	acetamides; aromatic ether	cyclooxygenase 3 inhibitor; non-narcotic analgesic; peripheral nervous system drug
phenazopyridine Phenazopyridine: A local anesthetic that has been used in urinary tract disorders. Its use is limited by problems with toxicity (primarily blood disorders) and potential carcinogenicity.. phenazopyridine : A diaminopyridine that is 2,6-diaminopyridine substituted at position 3 by a phenylazo group. A local anesthetic that has topical analgesic effect on mucosa lining of the urinary tract. Its use is limited by problems with toxicity (primarily blood disorders) and potential carcinogenicity.	2.04	1	0	diaminopyridine; monoazo compound	anticoronaviral agent; carcinogenic agent; local anaesthetic; non-narcotic analgesic
phenindione Phenindione: An indandione that has been used as an anticoagulant. Phenindione has actions similar to WARFARIN, but it is now rarely employed because of its higher incidence of severe adverse effects. (From Martindale, The Extra Pharmacopoeia, 30th ed, p234)	2.04	1	0	aromatic ketone; beta-diketone	anticoagulant
pheniramine Pheniramine: One of the HISTAMINE H1 ANTAGONISTS with little sedative action. It is used in treatment of hay fever, rhinitis, allergic dermatoses, and pruritus.	3.47	2	0	pyridines; tertiary amino compound
phenobarbital Phenobarbital: A barbituric acid derivative that acts as a nonselective central nervous system depressant. It potentiates GAMMA-AMINOBUTYRIC ACID action on GABA-A RECEPTORS, and modulates chloride currents through receptor channels. It also inhibits glutamate induced depolarizations.. phenobarbital : A member of the class of barbiturates, the structure of which is that of barbituric acid substituted at C-5 by ethyl and phenyl groups.	5.15	11	1	barbiturates	anticonvulsant; drug allergen; excitatory amino acid antagonist; sedative
phenolphthalein Phenolphthalein: An acid-base indicator which is colorless in acid solution, but turns pink to red as the solution becomes alkaline. It is used medicinally as a cathartic.	2.45	2	0	phenols
phenolsulfonphthalein Phenolsulfonphthalein: Red dye, pH indicator, and diagnostic aid for determination of renal function. It is used also for studies of the gastrointestinal and other systems.. phenol red : 3H-2,1-Benzoxathiole 1,1-dioxide in which both of the hydrogens at position 3 have been substituted by 4-hydroxyphenyl groups. A pH indicator changing colour from yellow below pH 6.8 to bright pink above pH 8.2, it is commonly used as an indicator in cell cultures and in home swimming pool test kits. It is also used in the (now infrequently performed) phenolsulfonphthalein (PSP) test for estimation of overall blood flow through the kidney.	1.96	1	0	2,1-benzoxathiole; arenesulfonate ester; phenols; sultone	acid-base indicator; diagnostic agent; two-colour indicator
phenoxybenzamine Phenoxybenzamine: An alpha-adrenergic antagonist with long duration of action. It has been used to treat hypertension and as a peripheral vasodilator.	3.82	4	0	aromatic amine
phentermine Phentermine: A central nervous system stimulant and sympathomimetic with actions and uses similar to those of DEXTROAMPHETAMINE. It has been used most frequently in the treatment of obesity.	2.46	2	0	primary amine	adrenergic agent; appetite depressant; central nervous system drug; central nervous system stimulant; dopaminergic agent; sympathomimetic agent
oxophenylarsine oxophenylarsine: inhibits protein-tyrosine-phosphatase. phenylarsine oxide : An arsine oxide derived from phenylarsine.	2.4	2	0	arsine oxides	antineoplastic agent; apoptosis inducer; EC 3.1.3.48 (protein-tyrosine-phosphatase) inhibitor
phenylbutazone Phenylbutazone: A butyl-diphenyl-pyrazolidinedione that has anti-inflammatory, antipyretic, and analgesic activities. It has been used in ANKYLOSING SPONDYLITIS; RHEUMATOID ARTHRITIS; and REACTIVE ARTHRITIS.. phenylbutazone : A member of the class of pyrazolidines that is 1,2-diphenylpyrazolidine-3,5-dione carrying a butyl group at the 4-position.	4.16	5	0	pyrazolidines	antirheumatic drug; EC 1.1.1.184 [carbonyl reductase (NADPH)] inhibitor; metabolite; non-narcotic analgesic; non-steroidal anti-inflammatory drug; peripheral nervous system drug
phloretin [no description available]	3.45	2	0	dihydrochalcones	antineoplastic agent; plant metabolite
phthalylsulfathiazole phthalylsulfathiazole: minor descriptor (63-86); on-line & INDEX MEDICUS search SULFATHIAZOLES (66-86); RN given refers to parent cpd. phthalylsulfathiazole : A sulfonamide incorporating 2-carboxybenzamido and 1,3-thiazol-2-yl moieties that is a broad-spectrum antibiotic indicated in the treatment of dysentery, colitis, gastroenteritis and intestinal surgery.	5.59	10	2	1,3-thiazoles; dicarboxylic acid monoamide; sulfonamide antibiotic; sulfonamide
moxonidine moxonidine: structure given in first source	2.75	3	0	organohalogen compound; pyrimidines
pinacidil Pinacidil: A guanidine that opens POTASSIUM CHANNELS producing direct peripheral vasodilatation of the ARTERIOLES. It reduces BLOOD PRESSURE and peripheral resistance and produces fluid retention. (Martindale The Extra Pharmacopoeia, 31st ed)	2.05	1	0	pyridines
pindolol Pindolol: A moderately lipophilic beta blocker (ADRENERGIC BETA-ANTAGONISTS). It is non-cardioselective and has intrinsic sympathomimetic actions, but little membrane-stabilizing activity. (From Martindale, The Extra Pharmocopoeia, 30th ed, p638). pindolol : A member of the class of indols which is the 2-hydroxy-3-(isopropylamino)propyl ether derivative of 1H-indol-4-ol.	2.74	3	0	indoles; secondary amine	antiglaucoma drug; antihypertensive agent; beta-adrenergic antagonist; serotonergic antagonist; vasodilator agent
pioglitazone Pioglitazone: A thiazolidinedione and PPAR GAMMA agonist that is used in the treatment of TYPE 2 DIABETES MELLITUS.. pioglitazone : A member of the class of thiazolidenediones that is 1,3-thiazolidine-2,4-dione substituted by a benzyl group at position 5 which in turn is substituted by a 2-(5-ethylpyridin-2-yl)ethoxy group at position 4 of the phenyl ring. It exhibits hypoglycemic activity.	2.79	3	0	aromatic ether; pyridines; thiazolidinediones	antidepressant; cardioprotective agent; EC 2.7.1.33 (pantothenate kinase) inhibitor; EC 6.2.1.3 (long-chain-fatty-acid--CoA ligase) inhibitor; ferroptosis inhibitor; geroprotector; hypoglycemic agent; insulin-sensitizing drug; PPARgamma agonist; xenobiotic
pipemidic acid Pipemidic Acid: Antimicrobial against Gram negative and some Gram positive bacteria. It is protein bound and concentrated in bile and urine and used for gastrointestinal, biliary, and urinary infections.. pipemidic acid : A pyridopyrimidine that is 5-oxo-5,8-dihydropyrido[2,3-d]pyrimidine-6-carboxylic acid substituted at position 2 by a piperazin-1-yl group and at position 8 by an ethyl group. A synthetic broad-spectrum antibacterial, it is used for treatment of gastrointestinal, biliary, and urinary infections.	2.4	2	0	amino acid; monocarboxylic acid; N-arylpiperazine; pyridopyrimidine; quinolone antibiotic	antibacterial drug; DNA synthesis inhibitor
piperazine [no description available]	2.05	1	0	azacycloalkane; piperazines; saturated organic heteromonocyclic parent	anthelminthic drug
pirbuterol pirbuterol: structure	2.46	2	0	pyridines
pirenzepine Pirenzepine: An antimuscarinic agent that inhibits gastric secretion at lower doses than are required to affect gastrointestinal motility, salivary, central nervous system, cardiovascular, ocular, and urinary function. It promotes the healing of duodenal ulcers and due to its cytoprotective action is beneficial in the prevention of duodenal ulcer recurrence. It also potentiates the effect of other antiulcer agents such as CIMETIDINE and RANITIDINE. It is generally well tolerated by patients.	2.92	4	0	pyridobenzodiazepine	anti-ulcer drug; antispasmodic drug; muscarinic antagonist
potassium chloride Potassium Chloride: A white crystal or crystalline powder used in BUFFERS; FERTILIZERS; and EXPLOSIVES. It can be used to replenish ELECTROLYTES and restore WATER-ELECTROLYTE BALANCE in treating HYPOKALEMIA.. potassium chloride : A metal chloride salt with a K(+) counterion.	5.44	15	1	inorganic chloride; inorganic potassium salt; potassium salt	fertilizer
potassium iodide Potassium Iodide: An inorganic compound that is used as a source of iodine in thyrotoxic crisis and in the preparation of thyrotoxic patients for thyroidectomy. (From Dorland, 27th ed). potassium iodide : A metal iodide salt with a K(+) counterion. It is a scavenger of hydroxyl radicals.	2.35	2	0	potassium salt	expectorant; radical scavenger
4-aminobenzoic acid para-Aminobenzoates: Benzoic acids, salts, or esters that contain an amino group attached to carbon number 4 of the benzene ring structure.. 4-aminobenzoate : An aromatic amino-acid anion that is the conjugate base of 4-aminobenzoic acid.	2.01	1	0	aminobenzoate; aromatic amino-acid anion	Escherichia coli metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid: a novel antagonist that selectively blocks P2 purinoceptor receptors; a useful tool to study co-transmission in tissues when ATP and coexisting neurotransmitters act in concert. 5'-phosphopyridoxal-6-azobenzene-2,4-disulfonic acid : An arenesulfonic acid that is pyridoxal 5'-phosphate carrying an additional 2,4-disulfophenylazo substituent at position 6.	2.1	1	0	arenesulfonic acid; azobenzenes; methylpyridines; monohydroxypyridine; organic phosphate; pyridinecarbaldehyde	purinergic receptor P2X antagonist
practolol Practolol: A beta-1 adrenergic antagonist that has been used in the emergency treatment of CARDIAC ARRYTHMIAS.. practolol : N-(4-Hydroxyphenyl)acetamide in which the hydrogen of the phenolic hydroxy group is substituted by a 3-(isopropylaminoamino)-2-hydroxypropyl group. A selective beta blocker, it has been used in the emergency treatment of cardiac arrhythmias.	2.39	2	0	acetamides; ethanolamines; propanolamine; secondary alcohol; secondary amino compound	anti-arrhythmia drug; beta-adrenergic antagonist
pyranoprofen pyranoprofen: RN given refers to unlabled parent cpd; structure given in first source	2.04	1	0	pyridochromene
praziquantel azinox: Russian drug	2.46	2	0	isoquinolines
prazosin Prazosin: A selective adrenergic alpha-1 antagonist used in the treatment of HEART FAILURE; HYPERTENSION; PHEOCHROMOCYTOMA; RAYNAUD DISEASE; PROSTATIC HYPERTROPHY; and URINARY RETENTION.. prazosin : A member of the class of piperazines that is piperazine substituted by a furan-2-ylcarbonyl group and a 4-amino-6,7-dimethoxyquinazolin-2-yl group at positions 1 and 4 respectively.	3.72	10	0	aromatic ether; furans; monocarboxylic acid amide; piperazines; quinazolines	alpha-adrenergic antagonist; antihypertensive agent; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor
primaquine Primaquine: An aminoquinoline that is given by mouth to produce a radical cure and prevent relapse of vivax and ovale malarias following treatment with a blood schizontocide. It has also been used to prevent transmission of falciparum malaria by those returning to areas where there is a potential for re-introduction of malaria. Adverse effects include anemias and GI disturbances. (From Martindale, The Extra Pharmacopeia, 30th ed, p404). primaquine : An N-substituted diamine that is pentane-1,4-diamine substituted by a 6-methoxyquinolin-8-yl group at the N(4) position. It is a drug used in the treatment of malaria and Pneumocystis pneumonia.	2.75	3	0	aminoquinoline; aromatic ether; N-substituted diamine	antimalarial
primidone Primidone: A barbiturate derivative that acts as a GABA modulator and anti-epileptic agent. It is partly metabolized to PHENOBARBITAL in the body and owes some of its actions to this metabolite.. primidone : A pyrimidone that is dihydropyrimidine-4,6(1H,5H)-dione substituted by an ethyl and a phenyl group at position 5. It is used as an anticonvulsant for treatment of various types of seizures.	2.46	2	0	pyrimidone	anticonvulsant; environmental contaminant; xenobiotic
probenecid Probenecid: The prototypical uricosuric agent. It inhibits the renal excretion of organic anions and reduces tubular reabsorption of urate. Probenecid has also been used to treat patients with renal impairment, and, because it reduces the renal tubular excretion of other drugs, has been used as an adjunct to antibacterial therapy.. probenecid : A sulfonamide in which the nitrogen of 4-sulfamoylbenzoic acid is substituted with two propyl groups.	2.45	2	0	benzoic acids; sulfonamide	uricosuric drug
probucol Probucol: A drug used to lower LDL and HDL cholesterol yet has little effect on serum-triglyceride or VLDL cholesterol. (From Martindale, The Extra Pharmacopoeia, 30th ed, p993).. probucol : A dithioketal that is propane-2,2-dithiol in which the hydrogens attached to both sulfur atoms are replaced by 3,5-di-tert-butyl-4-hydroxyphenyl groups. An anticholesteremic drug with antioxidant and anti-inflammatory properties, it is used to treat high levels of cholesterol in blood.	9.37	21	3	dithioketal; polyphenol	anti-inflammatory drug; anticholesteremic drug; antilipemic drug; antioxidant; cardiovascular drug
procainamide Procainamide: A class Ia antiarrhythmic drug that is structurally-related to PROCAINE.. procainamide : A benzamide that is 4-aminobenzamide substituted on the amide N by a 2-(diethylamino)ethyl group. It is a pharmaceutical antiarrhythmic agent used for the medical treatment of cardiac arrhythmias.	2.74	3	0	benzamides	anti-arrhythmia drug; platelet aggregation inhibitor; sodium channel blocker
procaine Procaine: A local anesthetic of the ester type that has a slow onset and a short duration of action. It is mainly used for infiltration anesthesia, peripheral nerve block, and spinal block. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1016).. procaine : A benzoate ester, formally the result of esterification of 4-aminobenzoic acid with 2-diethylaminoethanol but formed experimentally by reaction of ethyl 4-aminobenzoate with 2-diethylaminoethanol.	4.98	13	0	benzoate ester; substituted aniline; tertiary amino compound	central nervous system depressant; drug allergen; local anaesthetic; peripheral nervous system drug
procarbazine Procarbazine: An antineoplastic agent used primarily in combination with mechlorethamine, vincristine, and prednisone (the MOPP protocol) in the treatment of Hodgkin's disease.. procarbazine : A benzamide obtained by formal condensation of the carboxy group of 4-[(2-methylhydrazino)methyl]benzoic acid with the amino group of isopropylamine. An antineoplastic chemotherapy drug used for treatment of Hodgkin's lymphoma. Metabolism yields azo-procarbazine and hydrogen peroxide, which results in the breaking of DNA strands.	2.05	1	0	benzamides; hydrazines	antineoplastic agent
prochlorperazine Prochlorperazine: A phenothiazine antipsychotic used principally in the treatment of NAUSEA; VOMITING; and VERTIGO. It is more likely than CHLORPROMAZINE to cause EXTRAPYRAMIDAL DISORDERS. (From Martindale, The Extra Pharmacopoeia, 30th ed, p612). prochlorperazine : A member of the class of phenothiazines that is 10H-phenothiazine having a chloro substituent at the 2-position and a 3-(4-methylpiperazin-1-yl)propyl group at the N-10 position.	2.68	3	0	N-alkylpiperazine; N-methylpiperazine; organochlorine compound; phenothiazines	alpha-adrenergic antagonist; antiemetic; cholinergic antagonist; dopamine receptor D2 antagonist; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; first generation antipsychotic
procyclidine Procyclidine: A muscarinic antagonist that crosses the blood-brain barrier and is used in the treatment of drug-induced extrapyramidal disorders and in parkinsonism.. procyclidine : A tertiary alcohol that consists of propan-1-ol substituted by a cyclohexyl and a phenyl group at position 1 and a pyrrolidin-1-yl group at position 3.	2.06	1	0	pyrrolidines; tertiary alcohol	antidyskinesia agent; antiparkinson drug; muscarinic antagonist
proglumide Proglumide: A drug that exerts an inhibitory effect on gastric secretion and reduces gastrointestinal motility. It is used clinically in the drug therapy of gastrointestinal ulcers.. proglumide : A racemate composed of equal amounts of (R)- and (S)-proglumide. A non-selective CCK antagonist that was used primarily for treatment of stomach ulcers, but has been replaced by newer drugs.. N(2)-benzoyl-N,N-dipropyl-alpha-glutamine : A dicarboxylic acid monoamide obtained by formal condensation of the alpha-carboxy group of N-benzoylglutamic acid with dippropylamine.	2.04	1	0	benzamides; dicarboxylic acid monoamide; glutamine derivative; racemate	anti-ulcer drug; cholecystokinin antagonist; cholinergic antagonist; delta-opioid receptor agonist; drug metabolite; gastrointestinal drug; opioid analgesic; xenobiotic metabolite
promazine Promazine: A phenothiazine with actions similar to CHLORPROMAZINE but with less antipsychotic activity. It is primarily used in short-term treatment of disturbed behavior and as an antiemetic.. promazine : A phenothiazine deriative in which the phenothiazine tricycle has a 3-(dimethylaminopropyl) group at the N-10 position.	2.04	1	0	phenothiazines; tertiary amine	antiemetic; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; H1-receptor antagonist; muscarinic antagonist; phenothiazine antipsychotic drug; serotonergic antagonist
promethazine Promethazine: A phenothiazine derivative with histamine H1-blocking, antimuscarinic, and sedative properties. It is used as an antiallergic, in pruritus, for motion sickness and sedation, and also in animals.. promethazine : A tertiary amine that is a substituted phenothiazine in which the ring nitrogen at position 10 is attached to C-3 of an N,N-dimethylpropan-2-amine moiety.	3.36	7	0	phenothiazines; tertiary amine	anti-allergic agent; anticoronaviral agent; antiemetic; antipruritic drug; H1-receptor antagonist; local anaesthetic; sedative
propantheline Propantheline: A muscarinic antagonist used as an antispasmodic, in rhinitis, in urinary incontinence, and in the treatment of ulcers. At high doses it has nicotinic effects resulting in neuromuscular blocking.	1.97	1	0	xanthenes
propidium Propidium: Quaternary ammonium analog of ethidium; an intercalating dye with a specific affinity to certain forms of DNA and, used as diiodide, to separate them in density gradients; also forms fluorescent complexes with cholinesterase which it inhibits.	2.04	1	0	phenanthridines; quaternary ammonium ion	fluorochrome; intercalator
propiomazine propiomazine: was heading 1966-94 (prov 1966-72); use PHENOTHIAZINES to search PROPIOMAZINE 1966-94; phenothiazine derivative used for sedation and as an antiemetic during labor. propiomazine : A member of the class of phenothiazines that is 10H-phenothiazine substituted by a 2-(dimethylamino)propyl group at nitrogen atom and a propanoyl group at position 2.	2.04	1	0	aromatic ketone; phenothiazines; tertiary amino compound	dopaminergic antagonist; histamine antagonist; muscarinic antagonist; phenothiazine antipsychotic drug; sedative; serotonergic antagonist
propiverine propiverine: anticholinergic used for overactive bladder syndrome	2.05	1	0	diarylmethane
propofol Propofol: An intravenous anesthetic agent which has the advantage of a very rapid onset after infusion or bolus injection plus a very short recovery period of a couple of minutes. (From Smith and Reynard, Textbook of Pharmacology, 1992, 1st ed, p206). Propofol has been used as ANTICONVULSANTS and ANTIEMETICS.. propofol : A phenol resulting from the formal substitution of the hydrogen at the 2 position of 1,3-diisopropylbenzene by a hydroxy group.	2.44	2	0	phenols	anticonvulsant; antiemetic; intravenous anaesthetic; radical scavenger; sedative
propranolol Propranolol: A widely used non-cardioselective beta-adrenergic antagonist. Propranolol has been used for MYOCARDIAL INFARCTION; ARRHYTHMIA; ANGINA PECTORIS; HYPERTENSION; HYPERTHYROIDISM; MIGRAINE; PHEOCHROMOCYTOMA; and ANXIETY but adverse effects instigate replacement by newer drugs.. propranolol : A propanolamine that is propan-2-ol substituted by a propan-2-ylamino group at position 1 and a naphthalen-1-yloxy group at position 3.	3.81	11	0	naphthalenes; propanolamine; secondary amine	anti-arrhythmia drug; antihypertensive agent; anxiolytic drug; beta-adrenergic antagonist; environmental contaminant; human blood serum metabolite; vasodilator agent; xenobiotic
protriptyline Protriptyline: Tricyclic antidepressant similar in action and side effects to IMIPRAMINE. It may produce excitation.	2.74	3	0	carbotricyclic compound	antidepressant
proxyphylline [no description available]	2.04	1	0	oxopurine
pyridinolcarbamate Pyridinolcarbamate: A drug that has been given by mouth in the treatment of atherosclerosis and other vascular disorders, hyperlipidemias, and thrombo-embolic disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1408)	2.05	1	0	pyridines
pyrilamine Pyrilamine: A histamine H1 antagonist. It has mild hypnotic properties and some local anesthetic action and is used for allergies (including skin eruptions) both parenterally and locally. It is a common ingredient of cold remedies.. mepyramine : An ethylenediamine derivative that is ethylenediamine in which one of the amino nitrogens is substituted by two methyl groups and the remaining amino nitrogen is substituted by a 4-methoxybenzyl and a pyridin-2-yl group.	2.94	4	0	aromatic ether; ethylenediamine derivative	H1-receptor antagonist
pyrimethamine Maloprim: contains above 2 cpds	5.01	2	1	aminopyrimidine; monochlorobenzenes	antimalarial; antiprotozoal drug; EC 1.5.1.3 (dihydrofolate reductase) inhibitor
quetiapine [no description available]	2.06	1	0	dibenzothiazepine; N-alkylpiperazine; N-arylpiperazine	adrenergic antagonist; dopaminergic antagonist; histamine antagonist; second generation antipsychotic; serotonergic antagonist
ranitidine [no description available]	2.75	3	0	aralkylamine
opc 12759 rebamipide: structure in first source; RN refers to (+-)-isomer; inhibits gastric xanthine oxidase	2.05	1	0	secondary carboxamide
resorcinol resorcinol: RN given refers to parent cpd; structure in Merck Index, 9th ed, #7951. resorcinol : A benzenediol that is benzene dihydroxylated at positions 1 and 3.	1.94	1	0	benzenediol; phenolic donor; resorcinols	erythropoietin inhibitor; sensitiser
1,6-bis(cyclohexyloximinocarbonyl)hexane 1,6-bis(cyclohexyloximinocarbonyl)hexane: selective inhibitor of canine platelet diglyceride lipase	2.4	2	0	carbamate ester; organonitrogen compound
riluzole Riluzole: A glutamate antagonist (RECEPTORS, GLUTAMATE) used as an anticonvulsant (ANTICONVULSANTS) and to prolong the survival of patients with AMYOTROPHIC LATERAL SCLEROSIS.	2.05	1	0	benzothiazoles
risperidone Risperidone: A selective blocker of DOPAMINE D2 RECEPTORS and SEROTONIN 5-HT2 RECEPTORS that acts as an atypical antipsychotic agent. It has been shown to improve both positive and negative symptoms in the treatment of SCHIZOPHRENIA.. risperidone : A member of the class of pyridopyrimidines that is 2-methyl-6,7,8,9-tetrahydropyrido[1,2-a]pyrimidin-4-one carrying an additional 2-[4-(6-fluoro-1,2-benzoxazol-3-yl)piperidin-1-yl]ethyl group at position 2.	2.46	2	0	1,2-benzoxazoles; heteroarylpiperidine; organofluorine compound; pyridopyrimidine	alpha-adrenergic antagonist; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; H1-receptor antagonist; psychotropic drug; second generation antipsychotic; serotonergic antagonist
rizatriptan rizatriptan: structure given in first source; RN given refers to benzoate	2.04	1	0	tryptamines	anti-inflammatory drug; serotonergic agonist; vasoconstrictor agent
ro 31-8220 Ro 31-8220: a protein kinase C inhibitor	2.43	2	0	imidothiocarbamic ester; indoles; maleimides	EC 2.7.11.13 (protein kinase C) inhibitor
rofecoxib [no description available]	2.74	3	0	butenolide; sulfone	analgesic; cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug
rolipram [no description available]	2.04	1	0	pyrrolidin-2-ones	antidepressant; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor
saccharin Saccharin: Flavoring agent and non-nutritive sweetener.. saccharin : A 1,2-benzisothiazole having a keto-group at the 3-position and two oxo substituents at the 1-position. It is used as an artificial sweetening agent.	2.46	2	0	1,2-benzisothiazole; N-sulfonylcarboxamide	environmental contaminant; sweetening agent; xenobiotic
salicylamide salamide: a major impurity of hydrochlorothiazide; structure in first source	2.05	1	0	phenols; salicylamides	antirheumatic drug; non-narcotic analgesic
salicylsalicylic acid salicylsalicylic acid: structure. salsalate : A dimeric benzoate ester obtained by intermolecular condensation between the carboxy of one molecule of salicylic acid with the phenol group of a second. It is a prodrug for salycylic acid that is used for treatment of rheumatoid arthritis and osteoarthritis and also shows activity against type II diabetes.	2.04	1	0	benzoate ester; benzoic acids; phenols; salicylates	antineoplastic agent; antirheumatic drug; EC 3.5.2.6 (beta-lactamase) inhibitor; hypoglycemic agent; non-narcotic analgesic; non-steroidal anti-inflammatory drug; prodrug
secobarbital Secobarbital: A barbiturate that is used as a sedative. Secobarbital is reported to have no anti-anxiety activity.. secobarbital : A member of the class of barbiturates that is barbituric acid in which the hydrogens at position 5 are substituted by prop-2-en-1-yl and pentan-2-yl groups.	2.4	2	0	barbiturates	anaesthesia adjuvant; GABA modulator; sedative
sevoflurane Sevoflurane: A non-explosive inhalation anesthetic used in the induction and maintenance of general anesthesia. It does not cause respiratory irritation and may also prevent PLATELET AGGREGATION.. sevoflurane : An ether compound having fluoromethyl and 1,1,1,3,3,3-hexafluoroisopropyl as the two alkyl groups.	2.05	1	0	ether; organofluorine compound	central nervous system depressant; inhalation anaesthetic; platelet aggregation inhibitor
sibutramine sibutramine: serotonin and norepinephrine transporter inhibitor; Meridia is tradename for sibutramine hydrochloride	2.05	1	0	organochlorine compound; tertiary amino compound	anti-obesity agent; serotonin uptake inhibitor
sulfadiazine Sulfadiazine: One of the short-acting SULFONAMIDES used in combination with PYRIMETHAMINE to treat toxoplasmosis in patients with acquired immunodeficiency syndrome and in newborns with congenital infections.. sulfadiazine : A sulfonamide consisting of pyrimidine with a 4-aminobenzenesulfonamido group at the 2-position.. diazine : The parent structure of the diazines.	6.19	34	1	pyrimidines; substituted aniline; sulfonamide antibiotic; sulfonamide	antiinfective agent; antimicrobial agent; antiprotozoal drug; coccidiostat; drug allergen; EC 1.1.1.153 [sepiapterin reductase (L-erythro-7,8-dihydrobiopterin forming)] inhibitor; EC 2.5.1.15 (dihydropteroate synthase) inhibitor; environmental contaminant; xenobiotic
sodium fluoride [no description available]	6.26	11	1	fluoride salt	mutagen
ipodate Ipodate: Ionic monomeric contrast media. Usually the sodium or calcium salts are used for examination of the gall bladder and biliary tract. (From Martindale, The Extra Pharmacopoeia, 30th ed, p704)	2.04	1	0
risedronic acid Risedronic Acid: A pyridine and diphosphonic acid derivative that acts as a CALCIUM CHANNEL BLOCKER and inhibits BONE RESORPTION.	2.45	2	0	pyridines
sotalol Sotalol: An adrenergic beta-antagonist that is used in the treatment of life-threatening arrhythmias.. sotalol : A sulfonamide that is N-phenylmethanesulfonamide in which the phenyl group is substituted at position 4 by a 1-hydroxy-2-(isopropylamino)ethyl group. It has both beta-adrenoreceptor blocking (Vaughan Williams Class II) and cardiac action potential duration prolongation (Vaughan Williams Class III) antiarrhythmic properties. It is used (usually as the hydrochloride salt) for the management of ventricular and supraventricular arrhythmias.	3.15	5	0	ethanolamines; secondary alcohol; secondary amino compound; sulfonamide	anti-arrhythmia drug; beta-adrenergic antagonist; environmental contaminant; xenobiotic
4-phenylbutyric acid, sodium salt sodium phenylbutyrate : The organic sodium salt of 4-phenylbutyric acid. A prodrug for phenylacetate, it is used to treat urea cycle disorders.	2.05	1	0	organic sodium salt	EC 3.5.1.98 (histone deacetylase) inhibitor; geroprotector; neuroprotective agent; orphan drug; prodrug
sq 22536 9-(tetrahydrofuryl)adenine : A nucleoside analogue that is adenine in which the nitrogen at position 9 has been substituted by a tetrahydrofuran-2-yl group. It is an adenylate cyclase inhibitor.	2.04	1	0	nucleoside analogue; oxolanes	EC 4.6.1.1 (adenylate cyclase) inhibitor
stearic acid octadecanoic acid : A C18 straight-chain saturated fatty acid component of many animal and vegetable lipids. As well as in the diet, it is used in hardening soaps, softening plastics and in making cosmetics, candles and plastics.	1.93	1	0	long-chain fatty acid; saturated fatty acid; straight-chain saturated fatty acid	algal metabolite; Daphnia magna metabolite; human metabolite; plant metabolite
imatinib [no description available]	2.05	1	0	aromatic amine; benzamides; N-methylpiperazine; pyridines; pyrimidines	antineoplastic agent; apoptosis inducer; tyrosine kinase inhibitor
vorinostat Vorinostat: A hydroxamic acid and anilide derivative that acts as a HISTONE DEACETYLASE inhibitor. It is used in the treatment of CUTANEOUS T-CELL LYMPHOMA and SEZARY SYNDROME.. vorinostat : A dicarboxylic acid diamide comprising suberic (octanedioic) acid coupled to aniline and hydroxylamine. A histone deacetylase inhibitor, it is marketed under the name Zolinza for the treatment of cutaneous T cell lymphoma (CTCL).	2.05	1	0	dicarboxylic acid diamide; hydroxamic acid	antineoplastic agent; apoptosis inducer; EC 3.5.1.98 (histone deacetylase) inhibitor
succinylcholine Succinylcholine: A quaternary skeletal muscle relaxant usually used in the form of its bromide, chloride, or iodide. It is a depolarizing relaxant, acting in about 30 seconds and with a duration of effect averaging three to five minutes. Succinylcholine is used in surgical, anesthetic, and other procedures in which a brief period of muscle relaxation is called for.. succinylcholine : A quaternary ammonium ion that is the bis-choline ester of succinic acid.	3.46	8	0	quaternary ammonium ion; succinate ester	drug allergen; muscle relaxant; neuromuscular agent
succinylsulfathiazole succinylsulfathiazole: intestinal antimicrobial agent; structure	2.4	2	0	1,3-thiazoles
sulfacetamide Sulfacetamide: An anti-bacterial agent that is used topically to treat skin infections and orally for urinary tract infections.. sulfacetamide : A sulfonamide that is sulfanilamide acylated on the sulfonamide nitrogen.	6.22	10	4	N-sulfonylcarboxamide; substituted aniline	antibacterial drug; antiinfective agent; antimicrobial agent; EC 2.5.1.15 (dihydropteroate synthase) inhibitor
sulfadimethoxine Sulfadimethoxine: A sulfanilamide that is used as an anti-infective agent.. sulfadimethoxine : A sulfonamide consisting of pyrimidine having methoxy substituents at the 2- and 6-positions and a 4-aminobenzenesulfonamido group at the 4-position.	3.06	5	0	aromatic ether; pyrimidines; substituted aniline; sulfonamide antibiotic; sulfonamide	antiinfective agent; antimicrobial agent; drug allergen; environmental contaminant; xenobiotic
sulfaguanidine Sulfaguanidine: A sulfanilamide antimicrobial agent that is used to treat enteric infections.. sulfaguanidine : A sulfonamide incorporating a guanidine moiety used to block the synthesis of folic acid; mostly used in veterinary medicine	3.44	8	0	sulfonamide antibiotic	antiinfective agent
sulfamerazine [no description available]	2.65	3	0	pyrimidines; sulfonamide antibiotic; sulfonamide	antiinfective agent; drug allergen
sulfameter Sulfameter: Long acting sulfonamide used in leprosy, urinary, and respiratory tract infections.. sulfamethoxydiazine : A sulfonamide consisting of pyrimidine having a methoxy substituent at the 5-position and a 4-aminobenzenesulfonamido group at the 2-position.	2.05	1	0	pyrimidines; sulfonamide antibiotic; sulfonamide	antiinfective agent; leprostatic drug; renal agent
sulfamethazine Sulfamethazine: A sulfanilamide anti-infective agent. It has a spectrum of antimicrobial action similar to other sulfonamides.. sulfamethazine : A sulfonamide consisting of pyrimidine with methyl substituents at the 4- and 6-positions and a 4-aminobenzenesulfonamido group at the 2-position.	5.13	11	1	pyrimidines; sulfonamide antibiotic; sulfonamide	antibacterial drug; antiinfective agent; antimicrobial agent; carcinogenic agent; drug allergen; EC 2.5.1.15 (dihydropteroate synthase) inhibitor; environmental contaminant; ligand; xenobiotic
sulfamethizole Sulfamethizole: A sulfathiazole antibacterial agent.. sulfamethizole : A sulfonamide consisting of a 1,3,4-thiadiazole nucleus with a methyl substituent at C-5 and a 4-aminobenzenesulfonamido group at C-2.	4.84	8	1	sulfonamide antibiotic; sulfonamide; thiadiazoles	antiinfective agent; antimicrobial agent; drug allergen; EC 2.5.1.15 (dihydropteroate synthase) inhibitor
sulfamethoxazole Sulfamethoxazole: A bacteriostatic antibacterial agent that interferes with folic acid synthesis in susceptible bacteria. Its broad spectrum of activity has been limited by the development of resistance. (From Martindale, The Extra Pharmacopoeia, 30th ed, p208). sulfamethoxazole : An isoxazole (1,2-oxazole) compound having a methyl substituent at the 5-position and a 4-aminobenzenesulfonamido group at the 3-position.	7.76	34	6	isoxazoles; substituted aniline; sulfonamide antibiotic; sulfonamide	antibacterial agent; antiinfective agent; antimicrobial agent; drug allergen; EC 1.1.1.153 [sepiapterin reductase (L-erythro-7,8-dihydrobiopterin forming)] inhibitor; EC 2.5.1.15 (dihydropteroate synthase) inhibitor; environmental contaminant; epitope; P450 inhibitor; xenobiotic
sulfamethoxypyridazine Sulfamethoxypyridazine: A sulfanilamide antibacterial agent.. sulfamethoxypyridazine : A sulfonamide consisting of pyridazine having a methoxy substituent at the 6-position and a 4-aminobenzenesulfonamido group at the 3-position.	4.58	6	1	pyridazines; sulfonamide antibiotic; sulfonamide	antiinfective agent; drug allergen; EC 2.5.1.15 (dihydropteroate synthase) inhibitor
sulfanilamide [no description available]	4.24	19	0	substituted aniline; sulfonamide antibiotic; sulfonamide	antibacterial agent; drug allergen; EC 4.2.1.1 (carbonic anhydrase) inhibitor
sulfaphenazole Sulfaphenazole: A sulfonilamide anti-infective agent.. sulfaphenazole : A sulfonamide that is sulfanilamide in which the sulfonamide nitrogen is substituted by a 1-phenyl-1H-pyrazol-5-yl group. It is a selective inhibitor of cytochrome P450 (CYP) 2C9 isozyme, and antibacterial agent.	2.38	2	0	primary amino compound; pyrazoles; substituted aniline; sulfonamide antibiotic; sulfonamide	antibacterial drug; EC 1.14.13.181 (13-deoxydaunorubicin hydroxylase) inhibitor; EC 1.14.13.67 (quinine 3-monooxygenase) inhibitor; P450 inhibitor
sulfapyridine Sulfapyridine: Antibacterial, potentially toxic, used to treat certain skin diseases.. sulfapyridine : A sulfonamide consisting of pyridine with a 4-aminobenzenesulfonamido group at the 2-position.	2.05	1	0	pyridines; substituted aniline; sulfonamide antibiotic; sulfonamide	antiinfective agent; dermatologic drug; drug allergen; environmental contaminant; xenobiotic
sulfasalazine Sulfasalazine: A drug that is used in the management of inflammatory bowel diseases. Its activity is generally considered to lie in its metabolic breakdown product, 5-aminosalicylic acid (see MESALAMINE) released in the colon. (From Martindale, The Extra Pharmacopoeia, 30th ed, p907). sulfasalazine : An azobenzene consisting of diphenyldiazene having a carboxy substituent at the 4-position, a hydroxy substituent at the 3-position and a 2-pyridylaminosulphonyl substituent at the 4'-position.	4.45	7	0
sulfathiazole Sulfathiazole: A sulfathiazole compound that is used as a short-acting anti-infective agent. It is no longer commonly used systemically due to its toxicity, but may still be applied topically in combination with other drugs for the treatment of vaginal and skin infections, and is still used in veterinary medicine.. sulfathiazole : A 1,3-thiazole compound having a 4-aminobenzenesulfonamido group at the 2-position.	2.64	3	0	1,3-thiazoles; substituted aniline; sulfonamide antibiotic; sulfonamide	antiinfective agent; drug allergen; EC 2.5.1.15 (dihydropteroate synthase) inhibitor; environmental contaminant; xenobiotic
sulfinpyrazone Sulfinpyrazone: A uricosuric drug that is used to reduce the serum urate levels in gout therapy. It lacks anti-inflammatory, analgesic, and diuretic properties.	2.05	1	0	pyrazolidines; sulfoxide	uricosuric drug
sulfisomidine Sulfisomidine: A sulfanilamide antibacterial agent.. sulfisomidine : A sulfonamide consisting of pyrimidine having methyl substituents at the 2- and 6-positions and a 4-aminobenzenesulfonamido group at the 4-position.	2.86	4	0	pyrimidines; sulfonamide antibiotic; sulfonamide	antiinfective agent
sulfisoxazole Sulfisoxazole: A short-acting sulfonamide antibacterial with activity against a wide range of gram- negative and gram-positive organisms.. sulfisoxazole : A sulfonamide antibacterial with an oxazole substituent. It has antibiotic activity against a wide range of gram-negative and gram-positive organisms.	5.12	15	0	isoxazoles; sulfonamide antibiotic; sulfonamide	antibacterial drug; drug allergen
sulfobromophthalein Sulfobromophthalein: A phenolphthalein that is used as a diagnostic aid in hepatic function determination.	2.04	1	0	2-benzofurans; organobromine compound; organosulfonic acid; phenols	dye
2-(octylamino)-1-[4-(propan-2-ylthio)phenyl]-1-propanol [no description available]	2.46	2	0	alkylbenzene
sulpiride Sulpiride: A dopamine D2-receptor antagonist. It has been used therapeutically as an antidepressant, antipsychotic, and as a digestive aid. (From Merck Index, 11th ed). sulpiride : A member of the class of benzamides obtained from formal condensation between the carboxy group of 2-methoxy-5-sulfamoylbenzoic acid and the primary amino group of (1-ethylpyrrolidin-2-yl)methylamine.	2.75	3	0	benzamides; N-alkylpyrrolidine; sulfonamide	antidepressant; antiemetic; antipsychotic agent; dopaminergic antagonist
sultopride [no description available]	2.46	2	0	salicylamides
sumatriptan Sumatriptan: A serotonin agonist that acts selectively at 5HT1 receptors. It is used in the treatment of MIGRAINE DISORDERS.. sumatriptan : A sulfonamide that consists of N,N-dimethyltryptamine bearing an additional (N-methylsulfamoyl)methyl substituent at position 5. Selective agonist for a vascular 5-HT1 receptor subtype (probably a member of the 5-HT1D family). Used (in the form of its succinate salt) for the acute treatment of migraine with or without aura in adults.	2.74	3	0	sulfonamide; tryptamines	serotonergic agonist; vasoconstrictor agent
suprofen Suprofen: An IBUPROFEN-type anti-inflammatory analgesic and antipyretic. It inhibits prostaglandin synthesis and has been proposed as an anti-arthritic.. suprofen : An aromatic ketone that is thiophene substituted at C-2 by a 4-(1-carboxyethyl)benzoyl group.	2.05	1	0	aromatic ketone; monocarboxylic acid; thiophenes	antirheumatic drug; drug allergen; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; peripheral nervous system drug
suramin Suramin: A polyanionic compound with an unknown mechanism of action. It is used parenterally in the treatment of African trypanosomiasis and it has been used clinically with diethylcarbamazine to kill the adult Onchocerca. (From AMA Drug Evaluations Annual, 1992, p1643) It has also been shown to have potent antineoplastic properties.. suramin : A member of the class of phenylureas that is urea in which each of the amino groups has been substituted by a 3-({2-methyl-5-[(4,6,8-trisulfo-1-naphthyl)carbamoyl]phenyl}carbamoyl)phenyl group. An activator of both the rabbit skeletal muscle RyR1 and sheep cardiac RyR2 isoform ryanodine receptor channels, it has been used for the treatment of human African trypanosomiasis for over 100 years.	2.9	4	0	naphthalenesulfonic acid; phenylureas; secondary carboxamide	angiogenesis inhibitor; antinematodal drug; antineoplastic agent; apoptosis inhibitor; EC 2.7.11.13 (protein kinase C) inhibitor; GABA antagonist; GABA-gated chloride channel antagonist; purinergic receptor P2 antagonist; ryanodine receptor agonist; trypanocidal drug
gatifloxacin Gatifloxacin: A fluoroquinolone antibacterial agent and DNA TOPOISOMERASE II inhibitor that is used as an ophthalmic solution for the treatment of BACTERIAL CONJUNCTIVITIS.. gatifloxacin : A monocarboxylic acid that is 4-oxo-1,4-dihydroquinoline-3-carboxylic acid which is substituted on the nitrogen by a cyclopropyl group and at positions 6, 7, and 8 by fluoro, 3-methylpiperazin-1-yl, and methoxy groups, respectively. Gatifloxacin is an antibiotic of the fourth-generation fluoroquinolone family, that like other members of that family, inhibits the bacterial topoisomerase type-II enzymes.	2.05	1	0	N-arylpiperazine; organofluorine compound; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone	antiinfective agent; antimicrobial agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor
tegafur [no description available]	2.05	1	0	organohalogen compound; pyrimidines
temazepam Temazepam: A benzodiazepine that acts as a GAMMA-AMINOBUTYRIC ACID modulator and anti-anxiety agent.	2.05	1	0	benzodiazepine
temozolomide [no description available]	5.01	2	1	imidazotetrazine; monocarboxylic acid amide; triazene derivative	alkylating agent; antineoplastic agent; prodrug
terazosin Terazosin: induces decreased blood pressure; used in the treatment of benign prostatic hyperplasia	2.45	2	0	furans; piperazines; primary amino compound; quinazolines	alpha-adrenergic antagonist; antihypertensive agent; antineoplastic agent
terbutaline Terbutaline: A selective beta-2 adrenergic agonist used as a bronchodilator and tocolytic.. terbutaline : A member of the class of phenylethanolamines that is catechol substituted at position 5 by a 2-(tert-butylamino)-1-hydroxyethyl group.	3.15	5	0	phenylethanolamines; resorcinols	anti-asthmatic drug; beta-adrenergic agonist; bronchodilator agent; EC 3.1.1.7 (acetylcholinesterase) inhibitor; hypoglycemic agent; sympathomimetic agent; tocolytic agent
terfenadine Terfenadine: A selective histamine H1-receptor antagonist devoid of central nervous system depressant activity. The drug was used for ALLERGY but withdrawn due to causing LONG QT SYNDROME.	2.05	1	0	diarylmethane
tetracaine Tetracaine: A potent local anesthetic of the ester type used for surface and spinal anesthesia.. tetracaine : A benzoate ester in which 4-N-butylbenzoic acid and 2-(dimethylamino)ethanol have combined to form the ester bond; a local ester anaesthetic (ester caine) used for surface and spinal anaesthesia.	5.83	7	1	benzoate ester; tertiary amino compound	local anaesthetic
tetraethylammonium Tetraethylammonium: A potassium-selective ion channel blocker. (From J Gen Phys 1994;104(1):173-90)	2.9	4	0	quaternary ammonium ion
thalidomide Thalidomide: A piperidinyl isoindole originally introduced as a non-barbiturate hypnotic, but withdrawn from the market due to teratogenic effects. It has been reintroduced and used for a number of immunological and inflammatory disorders. Thalidomide displays immunosuppressive and anti-angiogenic activity. It inhibits release of TUMOR NECROSIS FACTOR-ALPHA from monocytes, and modulates other cytokine action.. thalidomide : A racemate comprising equimolar amounts of R- and S-thalidomide.. 2-(2,6-dioxopiperidin-3-yl)-1H-isoindole-1,3(2H)-dione : A dicarboximide that is isoindole-1,3(2H)-dione in which the hydrogen attached to the nitrogen is substituted by a 2,6-dioxopiperidin-3-yl group.	2.45	2	0	phthalimides; piperidones
thiabendazole Tresaderm: dermatologic soln containing dexamethasone, thiabendazole & neomycin sulfate	4.31	6	0	1,3-thiazoles; benzimidazole fungicide; benzimidazoles	antifungal agrochemical; antinematodal drug
thioridazine Thioridazine: A phenothiazine antipsychotic used in the management of PHYCOSES, including SCHIZOPHRENIA.. thioridazine : A phenothiazine derivative having a methylsulfanyl subsitituent at the 2-position and a (1-methylpiperidin-2-yl)ethyl] group at the N-10 position.	2.45	2	0	phenothiazines; piperidines	alpha-adrenergic antagonist; dopaminergic antagonist; EC 1.8.1.12 (trypanothione-disulfide reductase) inhibitor; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; first generation antipsychotic; H1-receptor antagonist; serotonergic antagonist
thiotepa Thiotepa: A very toxic alkylating antineoplastic agent also used as an insect sterilant. It causes skin, gastrointestinal, CNS, and bone marrow damage. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), thiotepa may reasonably be anticipated to be a carcinogen (Merck Index, 11th ed).	2.38	2	0	aziridines
thiram Thiram: A dithiocarbamate chemical, used commercially in the rubber processing industry and as a fungicide. In vivo studies indicate that it inactivates the enzyme GLUTATHIONE REDUCTASE. It has mutagenic activity and may induce chromosomal aberrations.. thiram : An organic disulfide that results from the formal oxidative dimerisation of N,N-dimethyldithiocarbamic acid. It is widely used as a fungicidal seed treatment.	3.99	4	0	organic disulfide	antibacterial drug; antifungal agrochemical; antiseptic drug
tiaprofenic acid tiaprofenic acid: RN given refers to parent cpd; structure. tiaprofenic acid : An aromatic ketone that is thiophene substituted at C-2 by benzoyl and at C-4 by a 1-carboxyethyl group.	2.05	1	0	aromatic ketone; monocarboxylic acid; thiophenes	drug allergen; non-steroidal anti-inflammatory drug
tiaramide tiaramide: NTA-194, solantal, FK 1160 refer to mono-HCl salt; RN given refers to parent cpd; structure	2.04	1	0	benzothiazoles
ticlopidine Ticlopidine: An effective inhibitor of platelet aggregation commonly used in the placement of STENTS in CORONARY ARTERIES.. ticlopidine : A thienopyridine that is 4,5,6,7-tetrahydrothieno[3,2-c]pyridine in which the hydrogen attached to the nitrogen is replaced by an o-chlorobenzyl group.	2.74	3	0	monochlorobenzenes; thienopyridine	anticoagulant; fibrin modulating drug; hematologic agent; P2Y12 receptor antagonist; platelet aggregation inhibitor
tilorone Tilorone: An antiviral agent used as its hydrochloride. It is the first recognized synthetic, low-molecular-weight compound that is an orally active interferon inducer, and is also reported to have antineoplastic and anti-inflammatory actions.. tilorone : A member of the class of fluoren-9-ones that is 9H-fluoren-9-one which is substituted by a 2-(diethylamino)ethoxy group at positions 2 and 7. It is an interferon inducer and a selective alpha7 nicotinic acetylcholine receptor (alpha7 nAChR) agonist. Its hydrochloride salt is used as an antiviral drug.	2.45	2	0	aromatic ether; diether; fluoren-9-ones; tertiary amino compound	anti-inflammatory agent; antineoplastic agent; antiviral agent; interferon inducer; nicotinic acetylcholine receptor agonist
tinidazole Tinidazole: A nitroimidazole alkylating agent that is used as an antitrichomonal agent against TRICHOMONAS VAGINALIS; ENTAMOEBA HISTOLYTICA; and GIARDIA LAMBLIA infections. It also acts as an antibacterial agent for the treatment of BACTERIAL VAGINOSIS and anaerobic bacterial infections.. tinidazole : 1H-imidazole substituted at C-1 by a (2-ethylsulfonyl)ethyl group, at C-2 by a methyl group and at C-5 by a nitro group. It is used as an antiprotozoal, antibacterial agent.	4.6	3	2	imidazoles	antiamoebic agent; antibacterial drug; antiparasitic agent; antiprotozoal drug
tiopronin Tiopronin: Sulfhydryl acylated derivative of GLYCINE.	2.45	2	0	N-acyl-amino acid
tizanidine tizanidine: RN given refers to parent cpd; structure. tizanidine : 2,1,3-Benzothiadiazole substituted at C-4 by a Delta(1)-imidazolin-2-ylamino group and at C-4 by a chloro group. It is an agonist at alpha2-adrenergic receptor sites.	2.74	3	0	benzothiadiazole; imidazoles	alpha-adrenergic agonist; muscle relaxant
8-(n,n-diethylamino)octyl-3,4,5-trimethoxybenzoate 8-(N,N-diethylamino)octyl-3,4,5-trimethoxybenzoate: intracellular calcium antagonist; RN given refers to parent cpd	3.69	10	0	trihydroxybenzoic acid
tolazamide Tolazamide: A sulphonylurea hypoglycemic agent with actions and uses similar to those of CHLORPROPAMIDE.. tolazamide : An N-sulfonylurea that is 1-tosylurea in which a hydrogen attached to the nitrogen at position 3 is replaced by an azepan-1-yl group. A hypoglycemic agent, it is used for the treatment of type 2 diabetes mellitus.	2.05	1	0	N-sulfonylurea	hypoglycemic agent; potassium channel blocker
tolbutamide Tolbutamide: A sulphonylurea hypoglycemic agent with actions and uses similar to those of CHLORPROPAMIDE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p290). tolbutamide : An N-sulfonylurea that consists of 1-butylurea having a tosyl group attached at the 3-position.	4.67	6	1	N-sulfonylurea	human metabolite; hypoglycemic agent; insulin secretagogue; potassium channel blocker
tolnaftate [no description available]	4.26	4	1	monothiocarbamic ester	antifungal drug
tolperisone Tolperisone: A centrally acting muscle relaxant that has been used for the symptomatic treatment of spasticity and muscle spasm. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1211)	2.45	2	0	aromatic ketone
ultram 2-[(dimethylamino)methyl]-1-(3-methoxyphenyl)cyclohexanol : A tertiary alcohol that is cyclohexanol substituted at positions 1 and 2 by 3-methoxyphenyl and dimethylaminomethyl groups respectively.	2.74	3	0	aromatic ether; tertiary alcohol; tertiary amino compound
tramazoline [no description available]	3.74	2	1	tetralins
tranexamic acid Tranexamic Acid: Antifibrinolytic hemostatic used in severe hemorrhage.	2.75	3	0	amino acid
trapidil Trapidil: A coronary vasodilator agent.	2.46	2	0	triazolopyrimidines
trazodone Trazodone: A serotonin uptake inhibitor that is used as an antidepressive agent. It has been shown to be effective in patients with major depressive disorders and other subsets of depressive disorders. It is generally more useful in depressive disorders associated with insomnia and anxiety. This drug does not aggravate psychotic symptoms in patients with schizophrenia or schizoaffective disorders. (From AMA Drug Evaluations Annual, 1994, p309). trazodone : An N-arylpiperazine in which one nitrogen is substituted by a 3-chlorophenyl group, while the other is substituted by a 3-(3-oxo[1,2,4]triazolo[4,3-a]pyridin-2(3H)-yl)propyl group.	2.75	3	0	monochlorobenzenes; N-alkylpiperazine; N-arylpiperazine; triazolopyridine	adrenergic antagonist; antidepressant; anxiolytic drug; H1-receptor antagonist; sedative; serotonin uptake inhibitor
triamterene Triamterene: A pteridinetriamine compound that inhibits SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS.. triamterene : Pteridine substituted at positions 2, 4 and 7 with amino groups and at position 6 with a phenyl group. A sodium channel blocker, it is used as a diuretic in the treatment of hypertension and oedema.	2.05	1	0	pteridines	diuretic; sodium channel blocker
trichlormethiazide Trichlormethiazide: A thiazide diuretic with properties similar to those of HYDROCHLOROTHIAZIDE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p830). trichlormethiazide : A benzothiadiazine, hydrogenated at positions 2, 3 and 4 and substituted with an aminosulfonyl group at C-7, a chloro substituent at C-6 and a dichloromethyl group at C-3 and with S-1 as an S,S-dioxide. A sulfonamide antibiotic, it is used as a diuretic to treat oedema (including that associated with heart failure) and hypertension.	2.04	1	0	benzothiadiazine; sulfonamide antibiotic	antihypertensive agent; diuretic
triclosan [no description available]	3.78	2	1	aromatic ether; dichlorobenzene; monochlorobenzenes; phenols	antibacterial agent; antimalarial; drug allergen; EC 1.3.1.9 [enoyl-[acyl-carrier-protein] reductase (NADH)] inhibitor; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; fungicide; persistent organic pollutant; xenobiotic
trientine Trientine: An ethylenediamine derivative used as stabilizer for EPOXY RESINS, as ampholyte for ISOELECTRIC FOCUSING and as chelating agent for copper in HEPATOLENTICULAR DEGENERATION.. TETA : An azamacrocyle in which four nitrogen atoms at positions 1, 4, 8 and 11 of a fouteen-membered ring are each substituted with a carboxymethyl group.. 2,2,2-tetramine : A polyazaalkane that is decane in which the carbon atoms at positions 1, 4, 7 and 10 are replaced by nitrogens.	1.96	1	0	polyazaalkane; tetramine	copper chelator
trifluoperazine [no description available]	3.59	9	0	N-alkylpiperazine; N-methylpiperazine; organofluorine compound; phenothiazines	antiemetic; calmodulin antagonist; dopaminergic antagonist; EC 1.8.1.12 (trypanothione-disulfide reductase) inhibitor; EC 5.3.3.5 (cholestenol Delta-isomerase) inhibitor; phenothiazine antipsychotic drug
trifluperidol Trifluperidol: A butyrophenone with general properties similar to those of HALOPERIDOL. It is used in the treatment of PSYCHOSES including MANIA and SCHIZOPHRENIA. (From Martindale, The Extra Pharmacopoeia, 30th ed, p621)	2.04	1	0	aromatic ketone
triflupromazine Triflupromazine: A phenothiazine used as an antipsychotic agent and as an antiemetic.. triflupromazine : A member of the class of phenothiazines that is 10H-phenothiazine having a trifluoromethyl subsitituent at the 2-position and a 3-(dimethylamino)propyl group at the N-10 position.	2.05	1	0	organofluorine compound; phenothiazines; tertiary amine	anticoronaviral agent; antiemetic; dopaminergic antagonist; first generation antipsychotic
trimebutine Trimebutine: Proposed spasmolytic with possible local anesthetic action used in gastrointestinal disorders.	2.04	1	0	trihydroxybenzoic acid
trimeprazine Trimeprazine: A phenothiazine derivative that is used as an antipruritic.	1.95	1	0	phenothiazines
trimethadione Trimethadione: An anticonvulsant effective in absence seizures, but generally reserved for refractory cases because of its toxicity. (From AMA Drug Evaluations Annual, 1994, p378). trimethadione : An oxazolidinone that is 1,3-oxazolidine-2,4-dione substituted by methyl groups at positions 3, 5 and 5. It is an antiepileptic agent.	2.45	2	0	oxazolidinone	anticonvulsant; geroprotector
trimethoprim Trimethoprim: A pyrimidine inhibitor of dihydrofolate reductase, it is an antibacterial related to PYRIMETHAMINE. It is potentiated by SULFONAMIDES and the TRIMETHOPRIM, SULFAMETHOXAZOLE DRUG COMBINATION is the form most often used. It is sometimes used alone as an antimalarial. TRIMETHOPRIM RESISTANCE has been reported.. trimethoprim : An aminopyrimidine antibiotic whose structure consists of pyrimidine 2,4-diamine and 1,2,3-trimethoxybenzene moieties linked by a methylene bridge.	9.66	46	10	aminopyrimidine; methoxybenzenes	antibacterial drug; diuretic; drug allergen; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; environmental contaminant; xenobiotic
trimipramine Trimipramine: Tricyclic antidepressant similar to IMIPRAMINE, but with more antihistaminic and sedative properties.. trimipramine : A dibenzoazepine that is 10,11-dihydro-5H-dibenzo[b,f]azepine substituted by a 3-(dimethylamino)-2-methylpropyl group at the nitrogen atom. It is used as an antidepressant.	2.04	1	0	dibenzoazepine; tertiary amino compound	antidepressant; environmental contaminant; xenobiotic
tripelennamine Tripelennamine: A histamine H1 antagonist with low sedative action but frequent gastrointestinal irritation. It is used to treat ASTHMA; HAY FEVER; URTICARIA; and RHINITIS; and also in veterinary applications. Tripelennamine is administered by various routes, including topically.	3.47	2	0	aromatic amine
troglitazone Troglitazone: A chroman and thiazolidinedione derivative that acts as a PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORS (PPAR) agonist. It was formerly used in the treatment of TYPE 2 DIABETES MELLITUS, but has been withdrawn due to hepatotoxicity.	2.97	4	0	chromanes; thiazolidinone	anticoagulant; anticonvulsant; antineoplastic agent; antioxidant; EC 6.2.1.3 (long-chain-fatty-acid--CoA ligase) inhibitor; ferroptosis inhibitor; hypoglycemic agent; platelet aggregation inhibitor; vasodilator agent
tyramine [no description available]	3.33	7	0	monoamine molecular messenger; primary amino compound; tyramines	EC 3.1.1.8 (cholinesterase) inhibitor; Escherichia coli metabolite; human metabolite; mouse metabolite; neurotransmitter
delavirdine Delavirdine: A potent, non-nucleoside reverse transcriptase inhibitor with activity specific for HIV-1.. delavirdine : The amide resulting from the formal condensation of 5-[(methylsulfonyl)amino]-1H-indole-2-carboxylic acid and 4-amino group of 1-[3-(isopropylamino)pyridin-2-yl]piperazine, delavirdine is a non-nucleoside reverse transcriptase inhibitor with activity specific for HIV-1. Viral resistance emerges rapidly when delavirdine is used alone, so it is therefore used (as the methanesulfonic acid salt) with other antiretrovirals for combination therapy of HIV infection.	2.04	1	0	aminopyridine; indolecarboxamide; N-acylpiperazine; sulfonamide	antiviral drug; HIV-1 reverse transcriptase inhibitor
urapidil [no description available]	2.75	3	0	piperazines
venlafaxine venlafaxine : A tertiary amino compound that is N,N-dimethylethanamine substituted at position 1 by a 1-hydroxycyclohexyl and 4-methoxyphenyl group.	3.15	5	0	cyclohexanols; monomethoxybenzene; tertiary alcohol; tertiary amino compound	adrenergic uptake inhibitor; analgesic; antidepressant; dopamine uptake inhibitor; environmental contaminant; serotonin uptake inhibitor; xenobiotic
vesnarinone [no description available]	2.05	1	0	organic molecular entity
vigabatrin [no description available]	2.46	2	0	gamma-amino acid	anticonvulsant; EC 2.6.1.19 (4-aminobutyrate--2-oxoglutarate transaminase) inhibitor
viloxazine Viloxazine: A morpholine derivative used as an antidepressant. It is similar in action to IMIPRAMINE.	2.05	1	0	aromatic ether
w 7 W 7: RN given refers to parent cpd; structure; calmodulin antagonist	3.5	8	0
pirinixic acid pirinixic acid: structure	2.05	1	0	aryl sulfide; organochlorine compound; pyrimidines
xanthurenic acid xanthurenic acid : A quinolinemonocarboxylic acid that is quinoline-2-carboxylic acid substituted by hydroxy groups at C-4 and C-8.	1.93	1	0	dihydroxyquinoline; quinolinemonocarboxylic acid	animal metabolite; iron chelator; metabotropic glutamate receptor agonist; vesicular glutamate transport inhibitor
xylazine Xylazine: An adrenergic alpha-2 agonist used as a sedative, analgesic and centrally acting muscle relaxant in VETERINARY MEDICINE.. xylazine : A methyl benzene that is 1,3-dimethylbenzene which is substituted by a 5,6-dihydro-4H-1,3-thiazin-2-ylnitrilo group at position 2. It is an alpha2 adrenergic receptor agonist and frequently used in veterinary medicine as an emetic and sedative with analgesic and muscle relaxant properties.	1.99	1	0	1,3-thiazine; methylbenzene; secondary amino compound	alpha-adrenergic agonist; analgesic; emetic; muscle relaxant; sedative
xylometazoline xylometazoline: RN given refers to parent cpd; structure	1.97	1	0	alkylbenzene
ici 204,219 zafirlukast: a leukotriene D4 receptor antagonist	2.46	2	0	carbamate ester; indoles; N-sulfonylcarboxamide	anti-asthmatic agent; leukotriene antagonist
zolpidem Zolpidem: An imidazopyridine derivative and short-acting GABA-A receptor agonist that is used for the treatment of INSOMNIA.. zolpidem : An imidazo[1,2-a]pyridine compound having a 4-tolyl group at the 2-position, an N,N-dimethylcarbamoylmethyl group at the 3-position and a methyl substituent at the 6-position.	2.05	1	0	imidazopyridine	central nervous system depressant; GABA agonist; sedative
zonisamide Zonisamide: A benzisoxazole and sulfonamide derivative that acts as a CALCIUM CHANNEL blocker. It is used primarily as an adjunctive antiepileptic agent for the treatment of PARTIAL SEIZURES, with or without secondary generalization.. zonisamide : A 1,2-benzoxazole compound having a sulfamoylmethyl substituent at the 3-position.	2.05	1	0	1,2-benzoxazoles; sulfonamide	anticonvulsant; antioxidant; central nervous system drug; protective agent; T-type calcium channel blocker
guanidine hydrochloride [no description available]	2.05	1	0	one-carbon compound; organic chloride salt	protein denaturant
hydrocortisone acetate hydrocortisone acetate: RN given refers to cpd without isomeric designation	4.85	8	1	cortisol ester; tertiary alpha-hydroxy ketone
cortisone acetate Cortisone Acetate: The acetate ester of cortisone that is used mainly for replacement therapy in adrenocortical insufficiency and in the treatment of many allergic and inflammatory disorders.	2.05	1	0	corticosteroid hormone
mitomycin Mitomycin: An antineoplastic antibiotic produced by Streptomyces caespitosus. It is one of the bi- or tri-functional ALKYLATING AGENTS causing cross-linking of DNA and inhibition of DNA synthesis.. mitomycin : A family of aziridine-containing natural products isolated from Streptomyces caespitosus or Streptomyces lavendulae.	3.37	7	0	mitomycin	alkylating agent; antineoplastic agent
oxyphenonium Oxyphenonium: A quaternary ammonium anticholinergic agent with peripheral side effects similar to those of ATROPINE. It is used as an adjunct in the treatment of gastric and duodenal ulcer, and to relieve visceral spasms. The drug has also been used in the form of eye drops for mydriatic effect.	1.94	1	0	acylcholine
corticosterone [no description available]	2.87	4	0	11beta-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone	human metabolite; mouse metabolite
prednisolone Prednisolone: A glucocorticoid with the general properties of the corticosteroids. It is the drug of choice for all conditions in which routine systemic corticosteroid therapy is indicated, except adrenal deficiency states.. prednisolone : A glucocorticoid that is prednisone in which the oxo group at position 11 has been reduced to the corresponding beta-hydroxy group. It is a drug metabolite of prednisone.	10.91	88	8	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	adrenergic agent; anti-inflammatory drug; antineoplastic agent; drug metabolite; environmental contaminant; immunosuppressive agent; xenobiotic
estriol hormonin: estrogen replacement; each tablet contains 600 ug micronized 17beta-estradiol, 270 ug estriol and 1.4 mg estrone. chlorapatite : A phosphate mineral with the formula Ca5(PO4)3Cl.	2.43	2	0	16alpha-hydroxy steroid; 17beta-hydroxy steroid; 3-hydroxy steroid	estrogen; human metabolite; human xenobiotic metabolite; mouse metabolite
lysergic acid diethylamide Lysergic Acid Diethylamide: Semisynthetic derivative of ergot (Claviceps purpurea). It has complex effects on serotonergic systems including antagonism at some peripheral serotonin receptors, both agonist and antagonist actions at central nervous system serotonin receptors, and possibly effects on serotonin turnover. It is a potent hallucinogen, but the mechanisms of that effect are not well understood.. lysergic acid diethylamide : An ergoline alkaloid arising from formal condensation of lysergic acid with diethylamine.	2.04	1	0	ergoline alkaloid; monocarboxylic acid amide; organic heterotetracyclic compound	dopamine agonist; hallucinogen; serotonergic agonist
reserpine Reserpine: An alkaloid found in the roots of Rauwolfia serpentina and R. vomitoria. Reserpine inhibits the uptake of norepinephrine into storage vesicles resulting in depletion of catecholamines and serotonin from central and peripheral axon terminals. It has been used as an antihypertensive and an antipsychotic as well as a research tool, but its adverse effects limit its clinical use.. reserpine : An alkaloid found in the roots of Rauwolfia serpentina and R. vomitoria.	3.08	5	0	alkaloid ester; methyl ester; yohimban alkaloid	adrenergic uptake inhibitor; antihypertensive agent; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; environmental contaminant; first generation antipsychotic; plant metabolite; xenobiotic
cephaloridine Cephaloridine: A cephalosporin antibiotic.. cefaloridine : A cephalosporin compound having pyridinium-1-ylmethyl and 2-thienylacetamido side-groups. A first-generation semisynthetic derivative of cephalosporin C.	15.99	51	8	beta-lactam antibiotic allergen; cephalosporin; semisynthetic derivative	antibacterial drug
phentolamine Phentolamine: A nonselective alpha-adrenergic antagonist. It is used in the treatment of hypertension and hypertensive emergencies, pheochromocytoma, vasospasm of RAYNAUD DISEASE and frostbite, clonidine withdrawal syndrome, impotence, and peripheral vascular disease.. phentolamine : A substituted aniline that is 3-aminophenol in which the hydrogens of the amino group are replaced by 4-methylphenyl and 4,5-dihydro-1H-imidazol-2-ylmethyl groups respectively. An alpha-adrenergic antagonist, it is used for the treatment of hypertension.	2.74	3	0	imidazoles; phenols; substituted aniline; tertiary amino compound	alpha-adrenergic antagonist; vasodilator agent
sorbitol D-glucitol : The D-enantiomer of glucitol (also known as D-sorbitol).	7.15	10	4	glucitol	cathartic; Escherichia coli metabolite; food humectant; human metabolite; laxative; metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite; sweetening agent
alloxan Alloxan: Acidic compound formed by oxidation of URIC ACID. It is isolated as an efflorescent crystalline hydrate.. alloxan : A member of the class of pyrimidones, the structure of which is that of perhydropyrimidine substituted at C-2, -4, -5 and -6 by oxo groups.	2.37	2	0	pyrimidone	hyperglycemic agent; metabolite
thymidine [no description available]	4.44	23	0	pyrimidine 2'-deoxyribonucleoside	Escherichia coli metabolite; human metabolite; metabolite; mouse metabolite
floxuridine Floxuridine: An antineoplastic antimetabolite that is metabolized to fluorouracil when administered by rapid injection; when administered by slow, continuous, intra-arterial infusion, it is converted to floxuridine monophosphate. It has been used to treat hepatic metastases of gastrointestinal adenocarcinomas and for palliation in malignant neoplasms of the liver and gastrointestinal tract.. floxuridine : A pyrimidine 2'-deoxyribonucleoside compound having 5-fluorouracil as the nucleobase; used to treat hepatic metastases of gastrointestinal adenocarcinomas and for palliation in malignant neoplasms of the liver and gastrointestinal tract.	2.45	2	0	nucleoside analogue; organofluorine compound; pyrimidine 2'-deoxyribonucleoside	antimetabolite; antineoplastic agent; antiviral drug; radiosensitizing agent
piperonyl butoxide [no description available]	2.05	1	0	benzodioxoles	pesticide synergist
benzimidazole 1H-benzimidazole : The 1H-tautomer of benzimidazole.	2.51	2	0	benzimidazole; polycyclic heteroarene
triethylenemelamine Triethylenemelamine: Toxic alkylating agent used in industry; also as antineoplastic and research tool to produce chromosome aberrations and cancers.	2.34	2	0	1,3,5-triazines	alkylating agent; insect sterilant
bromouracil Bromouracil: 5-Bromo-2,4(1H,3H)-pyrimidinedione. Brominated derivative of uracil that acts as an antimetabolite, substituting for thymine in DNA. It is used mainly as an experimental mutagen, but its deoxyriboside (BROMODEOXYURIDINE) is used to treat neoplasms.. 5-bromouracil : A pyrimidine having keto groups at the 2- and 4-positions and a bromo group at the 5-position. Used mainly as an experimental mutagen.	2.05	1	0	nucleobase analogue; pyrimidines	mutagen
3,3',5-triiodothyroacetic acid tiratricol : A monocarboxylic acid that is (4-hydroxy-3,5-diiodophenyl)acetic acid in which the phenolic hydroxy group has been replaced by a 4-hydroxy-3-iodophenoxy group. It is a thyroid hormone analogue that has been used in the treatment of thyroid hormone resistance syndrome.	2.05	1	0
hydroxyproline Hydroxyproline: A hydroxylated form of the imino acid proline. A deficiency in ASCORBIC ACID can result in impaired hydroxyproline formation.. hydroxyproline : A proline derivative that is proline substituted by at least one hydroxy group.	2.45	2	0	4-hydroxyproline; L-alpha-amino acid zwitterion	human metabolite; mouse metabolite; plant metabolite
histamine dihydrochloride Ceplene: Tradename for histamine dihydrochloride.	2.05	1	0
thyroxine Thyroxine: The major hormone derived from the thyroid gland. Thyroxine is synthesized via the iodination of tyrosines (MONOIODOTYROSINE) and the coupling of iodotyrosines (DIIODOTYROSINE) in the THYROGLOBULIN. Thyroxine is released from thyroglobulin by proteolysis and secreted into the blood. Thyroxine is peripherally deiodinated to form TRIIODOTHYRONINE which exerts a broad spectrum of stimulatory effects on cell metabolism.. thyroxine : An iodothyronine compound having iodo substituents at the 3-, 3'-, 5- and 5'-positions.	8.55	13	2	2-halophenol; iodophenol; L-phenylalanine derivative; non-proteinogenic L-alpha-amino acid; thyroxine zwitterion; thyroxine	antithyroid drug; human metabolite; mouse metabolite; thyroid hormone
dextroamphetamine Dextroamphetamine: The d-form of AMPHETAMINE. It is a central nervous system stimulant and a sympathomimetic. It has also been used in the treatment of narcolepsy and of attention deficit disorders and hyperactivity in children. Dextroamphetamine has multiple mechanisms of action including blocking uptake of adrenergics and dopamine, stimulating release of monamines, and inhibiting monoamine oxidase. It is also a drug of abuse and a psychotomimetic.. (S)-amphetamine : A 1-phenylpropan-2-amine that has S configuration.	2.74	3	0	1-phenylpropan-2-amine	adrenergic agent; adrenergic uptake inhibitor; dopamine uptake inhibitor; dopaminergic agent; neurotoxin; sympathomimetic agent
carbachol Carbachol: A slowly hydrolyzed CHOLINERGIC AGONIST that acts at both MUSCARINIC RECEPTORS and NICOTINIC RECEPTORS.	4.29	19	0	ammonium salt; carbamate ester	cardiotonic drug; miotic; muscarinic agonist; nicotinic acetylcholine receptor agonist; non-narcotic analgesic
norethindrone acetate norethisterone acetate : A 3-oxo Delta(4)-steroid that is norethisterone in which the hydroxy group has been converted to its acetate ester.	2.45	2	0	3-oxo-Delta(4) steroid; acetate ester; terminal acetylenic compound	progestin; synthetic oral contraceptive
spironolactone Spironolactone: A potassium sparing diuretic that acts by antagonism of aldosterone in the distal renal tubules. It is used mainly in the treatment of refractory edema in patients with congestive heart failure, nephrotic syndrome, or hepatic cirrhosis. Its effects on the endocrine system are utilized in the treatments of hirsutism and acne but they can lead to adverse effects. (From Martindale, The Extra Pharmacopoeia, 30th ed, p827). spironolactone : A steroid lactone that is 17alpha-pregn-4-ene-21,17-carbolactone substituted by an oxo group at position 3 and an alpha-acetylsulfanyl group at position 7.	5.06	10	1	3-oxo-Delta(4) steroid; oxaspiro compound; steroid lactone; thioester	aldosterone antagonist; antihypertensive agent; diuretic; environmental contaminant; xenobiotic
cyclobarbital cyclobarbital: was heading 1977-94 (see under BARBITURATES 1977-90); CYCLOBARBITONE, HEXEMAL, & TETRAHYDROPHENOBARBITAL were see CYCLOBARBITAL 1977-94; use BARBITURATES to search CYCLOBARBITAL 1977-94; short to intermediate duration barbiturate used as hypnotic and sedative	2.45	2	0	barbiturates
aldosterone [no description available]	2.92	4	0	11beta-hydroxy steroid; 18-oxo steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid hormone; mineralocorticoid; primary alpha-hydroxy ketone; steroid aldehyde	human metabolite; mouse metabolite
allobarbital allobarbital: was heading 1976-94 (see under BARBITURATES 1976-90); ALLOBARBITONE, DIALLYLBARBITAL, DIALLYLBARBITURIC ACID, & DIALLYLMAL were see ALLOBARBITAL 1976-94; use BARBITURATES to search ALLOBARBITAL 1976-94; a barbiturate derivative with effects of intermediate duration; at lower doses, it is used as a sedative; at higher doses, it displays hypnotic effects	2.05	1	0	barbiturates
penicillamine Penicillamine: 3-Mercapto-D-valine. The most characteristic degradation product of the penicillin antibiotics. It is used as an antirheumatic and as a chelating agent in Wilson's disease.. penicillamine : An alpha-amino acid having the structure of valine substituted at the beta position with a sulfanyl group.	2.89	4	0	non-proteinogenic alpha-amino acid; penicillamine	antirheumatic drug; chelator; copper chelator; drug allergen
trichlorfon Trichlorfon: An organochlorophosphate cholinesterase inhibitor that is used as an insecticide for the control of flies and roaches. It is also used in anthelmintic compositions for animals. (From Merck, 11th ed). trichlorfon : A phosphonic ester that is dimethyl phosphonate in which the hydrogen atom attched to the phosphorous is substituted by a 2,2,2-trichloro-1-hydroxyethyl group.	2.05	1	0	organic phosphonate; organochlorine compound; phosphonic ester	agrochemical; anthelminthic drug; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; insecticide
norethandrolone Norethandrolone: A synthetic hormone with anabolic and androgenic properties and moderate progestational activity.	2.04	1	0	corticosteroid hormone
prednisone Prednisone: A synthetic anti-inflammatory glucocorticoid derived from CORTISONE. It is biologically inert and converted to PREDNISOLONE in the liver.. prednisone : A synthetic glucocorticoid drug that is particularly effective as an immunosuppressant, and affects virtually all of the immune system. Prednisone is a prodrug that is converted by the liver into prednisolone (a beta-hydroxy group instead of the oxo group at position 11), which is the active drug and also a steroid.	7.11	28	1	11-oxo steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	adrenergic agent; anti-inflammatory drug; antineoplastic agent; immunosuppressive agent; prodrug
estrone Hydroxyestrones: Estrone derivatives substituted with one or more hydroxyl groups in any position. They are important metabolites of estrone and other estrogens.	2.05	1	0	17-oxo steroid; 3-hydroxy steroid; phenolic steroid; phenols	antineoplastic agent; bone density conservation agent; estrogen; human metabolite; mouse metabolite
fluprednisolone Fluprednisolone: A synthetic glucocorticoid with anti-inflammatory properties.	5.09	10	1	fluorinated steroid
oxandrolone Oxandrolone: A synthetic hormone with anabolic and androgenic properties.	4.7	5	0	17beta-hydroxy steroid; 3-oxo steroid; anabolic androgenic steroid; oxa-steroid	anabolic agent; androgen
androsterone [no description available]	1.94	1	0	17-oxo steroid; 3alpha-hydroxy steroid; androstanoid; C19-steroid	androgen; anticonvulsant; human blood serum metabolite; human metabolite; human urinary metabolite; mouse metabolite; pheromone
dehydroepiandrosterone Dehydroepiandrosterone: A major C19 steroid produced by the ADRENAL CORTEX. It is also produced in small quantities in the TESTIS and the OVARY. Dehydroepiandrosterone (DHEA) can be converted to TESTOSTERONE; ANDROSTENEDIONE; ESTRADIOL; and ESTRONE. Most of DHEA is sulfated (DEHYDROEPIANDROSTERONE SULFATE) before secretion.. dehydroepiandrosterone : An androstanoid that is androst-5-ene substituted by a beta-hydroxy group at position 3 and an oxo group at position 17. It is a naturally occurring steroid hormone produced by the adrenal glands.	2.05	1	0	17-oxo steroid; 3beta-hydroxy-Delta(5)-steroid; androstanoid	androgen; human metabolite; mouse metabolite
nad [no description available]	2.05	1	0	NAD	geroprotector
penicillin g Penicillin G: A penicillin derivative commonly used in the form of its sodium or potassium salts in the treatment of a variety of infections. It is effective against most gram-positive bacteria and against gram-negative cocci. It has also been used as an experimental convulsant because of its actions on GAMMA-AMINOBUTYRIC ACID mediated synaptic transmission.. benzylpenicillin : A penicillin in which the substituent at position 6 of the penam ring is a phenylacetamido group.	11.22	137	7	penicillin allergen; penicillin	antibacterial drug; drug allergen; epitope
idoxuridine [no description available]	3.44	8	0	organoiodine compound; pyrimidine 2'-deoxyribonucleoside	antiviral drug; DNA synthesis inhibitor
metaraminol Metaraminol: A sympathomimetic agent that acts predominantly at alpha-1 adrenergic receptors. It has been used primarily as a vasoconstrictor in the treatment of HYPOTENSION.. metaraminol : A member of the class of phenylethanolamines that is 2-amino-1-phenylethanol substituted by a methyl group at position 2 and a phenolic hydroxy group at position 1. A sympathomimetic agent , it is used in the treatment of hypotension.	1.94	1	0	phenylethanolamines	alpha-adrenergic agonist; sympathomimetic agent; vasoconstrictor agent
pilocarpine Pilocarpine: A slowly hydrolyzed muscarinic agonist with no nicotinic effects. Pilocarpine is used as a miotic and in the treatment of glaucoma.. (+)-pilocarpine : The (+)-enantiomer of pilocarpine.	3.22	6	0	pilocarpine	antiglaucoma drug
dimethylphenylpiperazinium iodide Dimethylphenylpiperazinium Iodide: A selective nicotinic cholinergic agonist used as a research tool. DMPP activates nicotinic receptors in autonomic ganglia but has little effect at the neuromuscular junction.	1.97	1	0	N-arylpiperazine; organic iodide salt; piperazinium salt; quaternary ammonium salt	nicotinic acetylcholine receptor agonist
triiodothyronine Triiodothyronine: A T3 thyroid hormone normally synthesized and secreted by the thyroid gland in much smaller quantities than thyroxine (T4). Most T3 is derived from peripheral monodeiodination of T4 at the 5' position of the outer ring of the iodothyronine nucleus. The hormone finally delivered and used by the tissues is mainly T3.. 3,3',5-triiodo-L-thyronine : An iodothyronine compound having iodo substituents at the 3-, 3'- and 5-positions. Although some is produced in the thyroid, most of the 3,3',5-triiodo-L-thyronine in the body is generated by mono-deiodination of L-thyroxine in the peripheral tissues. Its metabolic activity is about 3 to 5 times that of L-thyroxine. The sodium salt is used in the treatment of hypothyroidism.	3.1	5	0	2-halophenol; amino acid zwitterion; iodophenol; iodothyronine	human metabolite; mouse metabolite; thyroid hormone
diethylnitrosamine Diethylnitrosamine: A nitrosamine derivative with alkylating, carcinogenic, and mutagenic properties.. N-nitrosodiethylamine : A nitrosamine that is N-ethylethanamine substituted by a nitroso group at the N-atom.	2.05	1	0	nitrosamine	carcinogenic agent; hepatotoxic agent; mutagen
isoflurophate Isoflurophate: A di-isopropyl-fluorophosphate which is an irreversible cholinesterase inhibitor used to investigate the NERVOUS SYSTEM.	2.64	3	0	dialkyl phosphate
biguanides Biguanides: Derivatives of biguanide (the structure formula HN(C(NH)NH2)2) that are primarily used as oral HYPOGLYCEMIC AGENTS for the treatment of DIABETES MELLITUS, TYPE 2 and PREDIABETES.. biguanides : A class of oral hypoglycemic drugs used for diabetes mellitus or prediabetes treatment. They have a structure based on the 2-carbamimidoylguanidine skeleton.	7.38	15	1	guanidines
carbon tetrachloride Carbon Tetrachloride: A solvent for oils, fats, lacquers, varnishes, rubber waxes, and resins, and a starting material in the manufacturing of organic compounds. Poisoning by inhalation, ingestion or skin absorption is possible and may be fatal. (Merck Index, 11th ed). tetrachloromethane : A chlorocarbon that is methane in which all the hydrogens have been replaced by chloro groups.	3.08	5	0	chlorocarbon; chloromethanes	hepatotoxic agent; refrigerant
alanine Alanine: A non-essential amino acid that occurs in high levels in its free state in plasma. It is produced from pyruvate by transamination. It is involved in sugar and acid metabolism, increases IMMUNITY, and provides energy for muscle tissue, BRAIN, and the CENTRAL NERVOUS SYSTEM.. alanine : An alpha-amino acid that consists of propionic acid bearing an amino substituent at position 2.	4.04	15	0	alanine zwitterion; alanine; L-alpha-amino acid; proteinogenic amino acid; pyruvate family amino acid	EC 4.3.1.15 (diaminopropionate ammonia-lyase) inhibitor; fundamental metabolite
serine Serine: A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.. serine : An alpha-amino acid that is alanine substituted at position 3 by a hydroxy group.	3.56	9	0	L-alpha-amino acid; proteinogenic amino acid; serine family amino acid; serine zwitterion; serine	algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
desoxycorticosterone acetate Desoxycorticosterone Acetate: The 21-acetate derivative of desoxycorticosterone.	2.04	1	0	corticosteroid hormone
benz(a)anthracene benz(a)anthracene: 4 fused rings of which one is angular in contrast to the linear NAPHTHACENES. tetraphene : An angular ortho-fused polycyclic arene consisting of four fused benzene rings.	1.93	1	0	ortho-fused polycyclic arene; tetraphenes
chloramphenicol Amphenicol: Chloramphenicol and its derivatives.	21.87	652	15	C-nitro compound; carboxamide; diol; organochlorine compound	antibacterial drug; antimicrobial agent; Escherichia coli metabolite; geroprotector; Mycoplasma genitalium metabolite; protein synthesis inhibitor
aspartic acid Aspartic Acid: One of the non-essential amino acids commonly occurring in the L-form. It is found in animals and plants, especially in sugar cane and sugar beets. It may be a neurotransmitter.. aspartic acid : An alpha-amino acid that consists of succinic acid bearing a single alpha-amino substituent. L-aspartic acid : The L-enantiomer of aspartic acid.	4.73	7	1	aspartate family amino acid; aspartic acid; L-alpha-amino acid; proteinogenic amino acid	Escherichia coli metabolite; mouse metabolite; neurotransmitter
glutamine Glutamine: A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.. L-glutamine : An optically active form of glutamine having L-configuration.. glutamine : An alpha-amino acid that consists of butyric acid bearing an amino substituent at position 2 and a carbamoyl substituent at position 4.	7.7	16	1	amino acid zwitterion; glutamine family amino acid; glutamine; L-alpha-amino acid; polar amino acid zwitterion; proteinogenic amino acid	EC 1.14.13.39 (nitric oxide synthase) inhibitor; Escherichia coli metabolite; human metabolite; metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite
lysine Lysine: An essential amino acid. It is often added to animal feed.. lysine : A diamino acid that is caproic (hexanoic) acid bearing two amino substituents at positions 2 and 6.. L-lysine : An L-alpha-amino acid; the L-isomer of lysine.	4.45	23	0	aspartate family amino acid; L-alpha-amino acid zwitterion; L-alpha-amino acid; lysine; organic molecular entity; proteinogenic amino acid	algal metabolite; anticonvulsant; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite
cetrimonium bromide cetyltrimethylammonium bromide : The organic bromide salt that is the bromide salt of cetyltrimethylammonium; one of the components of the topical antiseptic cetrimide.	2.77	3	0	organic bromide salt; quaternary ammonium salt	detergent; surfactant
cyanides Cyanides: Inorganic salts of HYDROGEN CYANIDE containing the -CN radical. The concept also includes isocyanides. It is distinguished from NITRILES, which denotes organic compounds containing the -CN radical.. cyanides : Salts and C-organyl derivatives of hydrogen cyanide, HC#N.. isocyanide : The isomer HN(+)#C(-) of hydrocyanic acid, HC#N, and its hydrocarbyl derivatives RNC (RN(+)#C(-)).. cyanide : A pseudohalide anion that is the conjugate base of hydrogen cyanide.	2.63	3	0	pseudohalide anion	EC 1.9.3.1 (cytochrome c oxidase) inhibitor
chlorobutanol [no description available]	2.63	3	0	tertiary alcohol
vincristine [no description available]	2.05	1	0	acetate ester; formamides; methyl ester; organic heteropentacyclic compound; organic heterotetracyclic compound; tertiary alcohol; tertiary amino compound; vinca alkaloid	antineoplastic agent; drug; microtubule-destabilising agent; plant metabolite; tubulin modulator
physostigmine Physostigmine: A cholinesterase inhibitor that is rapidly absorbed through membranes. It can be applied topically to the conjunctiva. It also can cross the blood-brain barrier and is used when central nervous system effects are desired, as in the treatment of severe anticholinergic toxicity.	2.39	2	0	carbamate ester; indole alkaloid	antidote to curare poisoning; EC 3.1.1.8 (cholinesterase) inhibitor; miotic
sucrose Saccharum: A plant genus of the family POACEAE widely cultivated in the tropics for the sweet cane that is processed into sugar.	4.82	13	0	glycosyl glycoside	algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; osmolyte; Saccharomyces cerevisiae metabolite; sweetening agent
ethinyl estradiol Ethinyl Estradiol: A semisynthetic alkylated ESTRADIOL with a 17-alpha-ethinyl substitution. It has high estrogenic potency when administered orally, and is often used as the estrogenic component in ORAL CONTRACEPTIVES.. 17alpha-ethynylestradiol : A 3-hydroxy steroid that is estradiol substituted by a ethynyl group at position 17. It is a xenoestrogen synthesized from estradiol and has been shown to exhibit high estrogenic potency on oral administration.	3.24	6	0	17-hydroxy steroid; 3-hydroxy steroid; terminal acetylenic compound	xenoestrogen
testosterone propionate Testosterone Propionate: An ester of TESTOSTERONE with a propionate substitution at the 17-beta position.. androgen : A sex hormone that stimulates or controls the development and maintenance of masculine characteristics in vertebrates by binding to androgen receptors.	2.05	1	0	steroid ester
tubocurarine Tubocurarine: A neuromuscular blocker and active ingredient in CURARE; plant based alkaloid of Menispermaceae.. tubocurarine : A benzylisoquinoline alkaloid muscle relaxant which constitutes the active component of curare.. isoquinoline alkaloid : Any alkaloid that has a structure based on an isoquinoline nucleus. They are derived from the amino acids like tyrosine and phenylalanine.	4.35	21	0	bisbenzylisoquinoline alkaloid	drug allergen; muscle relaxant; nicotinic antagonist
9,10-dimethyl-1,2-benzanthracene 9,10-Dimethyl-1,2-benzanthracene: Polycyclic aromatic hydrocarbon found in tobacco smoke that is a potent carcinogen.. 7,12-dimethyltetraphene : A tetraphene having methyl substituents at the 7- and 12-positions. It is a potent carcinogen and is present in tobacco smoke.	1.96	1	0	ortho-fused polycyclic arene; tetraphenes	carcinogenic agent
apomorphine Apomorphine: A derivative of morphine that is a dopamine D2 agonist. It is a powerful emetic and has been used for that effect in acute poisoning. It has also been used in the diagnosis and treatment of parkinsonism, but its adverse effects limit its use.	2.46	2	0	aporphine alkaloid	alpha-adrenergic drug; antidyskinesia agent; antiparkinson drug; dopamine agonist; emetic; serotonergic drug
aminopyrine Aminopyrine: A pyrazolone with analgesic, anti-inflammatory, and antipyretic properties but has risk of AGRANULOCYTOSIS. A breath test with 13C-labeled aminopyrine has been used as a non-invasive measure of CYTOCHROME P-450 metabolic activity in LIVER FUNCTION TESTS.. aminophenazone : A pyrazolone that is 1,2-dihydro-3H-pyrazol-3-one substituted by a dimethylamino group at position 4, methyl groups at positions 1 and 5 and a phenyl group at position 2. It exhibits analgesic, anti-inflammatory, and antipyretic properties.	3.78	3	0	pyrazolone; tertiary amino compound	antipyretic; environmental contaminant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic
methyltestosterone Methyltestosterone: A synthetic hormone used for androgen replacement therapy and as an hormonal antineoplastic agent (ANTINEOPLASTIC AGENTS, HORMONAL).. methyltestosterone : A 17beta-hydroxy steroid that is testosterone bearing a methyl group at the 17alpha position.	2.05	1	0	17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; enone	anabolic agent; androgen; antineoplastic agent
tetrabenazine 9,10-dimethoxy-3-isobutyl-1,3,4,6,7,11b-hexahydro-2H-pyrido[2,1-a]isoquinolin-2-one : A benzoquinolizine that is 1,2,3,4,4a,9,10,10a-octahydrophenanthrene in which the carbon at position 10a is replaced by a nitrogen and which is substituted by an isobutyl group at position 2, an oxo group at position 3, and methoxy groups at positions 6 and 7.	2.05	1	0	benzoquinolizine; cyclic ketone; tertiary amino compound
adenosine diphosphate Adenosine Diphosphate: Adenosine 5'-(trihydrogen diphosphate). An adenine nucleotide containing two phosphate groups esterified to the sugar moiety at the 5'-position.	2.89	4	0	adenosine 5'-phosphate; purine ribonucleoside 5'-diphosphate	fundamental metabolite; human metabolite
cephalothin Cephalothin: A cephalosporin antibiotic.. cefalotin : A semisynthetic, first-generation cephalosporin antibiotic with acetoxymethyl and (2-thienylacetyl)nitrilo moieties at positions 3 and 7, respectively, of the core structure. Administered parenterally during surgery and to treat a wide spectrum of blood infections.	9.91	63	3	azabicycloalkene; beta-lactam antibiotic allergen; carboxylic acid; cephalosporin; semisynthetic derivative; thiophenes	antibacterial drug; antimicrobial agent
uridine [no description available]	3.48	8	0	uridines	drug metabolite; fundamental metabolite; human metabolite
kanamycin a Kanamycin: Antibiotic complex produced by Streptomyces kanamyceticus from Japanese soil. Comprises 3 components: kanamycin A, the major component, and kanamycins B and C, the minor components.. kanamycin : Kanamycin is a naturally occurring antibiotic complex from Streptomyces kanamyceticus that consists of several components: kanamycin A, the major component (also usually designated as kanamycin), and kanamycins B, C, D and X the minor components.	20.28	709	6	kanamycins	bacterial metabolite
bromodeoxyuridine Bromodeoxyuridine: A nucleoside that substitutes for thymidine in DNA and thus acts as an antimetabolite. It causes breaks in chromosomes and has been proposed as an antiviral and antineoplastic agent. It has been given orphan drug status for use in the treatment of primary brain tumors.	3.26	6	0	pyrimidine 2'-deoxyribonucleoside	antimetabolite; antineoplastic agent
galactose galactopyranose : The pyranose form of galactose.	4.75	10	0	D-galactose; galactopyranose	Escherichia coli metabolite; mouse metabolite
carbostyril Quinolones: A group of derivatives of naphthyridine carboxylic acid, quinoline carboxylic acid, or NALIDIXIC ACID.. quinolin-2(1H)-one : A quinolone that is 1,2-dihydroquinoline substituted by an oxo group at position 2.	3.28	6	0	monohydroxyquinoline; quinolone	bacterial xenobiotic metabolite
phenylephrine Phenylephrine: An alpha-1 adrenergic agonist used as a mydriatic, nasal decongestant, and cardiotonic agent.. phenylephrine : A member of the class of the class of phenylethanolamines that is (1R)-2-(methylamino)-1-phenylethan-1-ol carrying an additional hydroxy substituent at position 3 on the phenyl ring.	6.5	26	2	phenols; phenylethanolamines; secondary amino compound	alpha-adrenergic agonist; cardiotonic drug; mydriatic agent; nasal decongestant; protective agent; sympathomimetic agent; vasoconstrictor agent
levodopa Levodopa: The naturally occurring form of DIHYDROXYPHENYLALANINE and the immediate precursor of DOPAMINE. Unlike dopamine itself, it can be taken orally and crosses the blood-brain barrier. It is rapidly taken up by dopaminergic neurons and converted to DOPAMINE. It is used for the treatment of PARKINSONIAN DISORDERS and is usually given with agents that inhibit its conversion to dopamine outside of the central nervous system.. L-dopa : An optically active form of dopa having L-configuration. Used to treat the stiffness, tremors, spasms, and poor muscle control of Parkinson's disease	7.17	12	1	amino acid zwitterion; dopa; L-tyrosine derivative; non-proteinogenic L-alpha-amino acid	allelochemical; antidyskinesia agent; antiparkinson drug; dopaminergic agent; hapten; human metabolite; mouse metabolite; neurotoxin; plant growth retardant; plant metabolite; prodrug
edetic acid Edetic Acid: A chelating agent that sequesters a variety of polyvalent cations such as CALCIUM. It is used in pharmaceutical manufacturing and as a food additive.	6.21	27	0	ethylenediamine derivative; polyamino carboxylic acid; tetracarboxylic acid	anticoagulant; antidote; chelator; copper chelator; geroprotector
phenylethyl alcohol Phenylethyl Alcohol: An antimicrobial, antiseptic, and disinfectant that is used also as an aromatic essence and preservative in pharmaceutics and perfumery.. 2-phenylethanol : A primary alcohol that is ethanol substituted by a phenyl group at position 2.	2.1	1	0	benzenes; primary alcohol	Aspergillus metabolite; fragrance; plant growth retardant; plant metabolite; Saccharomyces cerevisiae metabolite
tyrosine Tyrosine: A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.. tyrosine : An alpha-amino acid that is phenylalanine bearing a hydroxy substituent at position 4 on the phenyl ring.	6.45	14	1	amino acid zwitterion; erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid; proteinogenic amino acid; tyrosine	EC 1.3.1.43 (arogenate dehydrogenase) inhibitor; fundamental metabolite; micronutrient; nutraceutical
cysteamine Cysteamine: A mercaptoethylamine compound that is endogenously derived from the COENZYME A degradative pathway. The fact that cysteamine is readily transported into LYSOSOMES where it reacts with CYSTINE to form cysteine-cysteamine disulfide and CYSTEINE has led to its use in CYSTINE DEPLETING AGENTS for the treatment of CYSTINOSIS.. cysteamine : An amine that consists of an ethane skeleton substituted with a thiol group at C-1 and an amino group at C-2.	2.04	1	0	amine; thiol	geroprotector; human metabolite; mouse metabolite; radiation protective agent
phlorhizin [no description available]	3.46	2	0	aryl beta-D-glucoside; dihydrochalcones; monosaccharide derivative	antioxidant; plant metabolite
mepazine mepazine: major descriptor (66-85); on-line search PHENOTHIAZINES (66-85); Index Medicus search MEPAZINE (66-85); RN given refers to parent cpd. pacatal : A phenothiazine derivative in which 10H-phenothiazine has an N-methylpiperidin-4-ylmethyl substituent at the N-10 position.	2.06	1	0	phenothiazines
acepromazine Acepromazine: A phenothiazine that is used in the treatment of PSYCHOSES.. acepromazine : A member of the class of phenothiazines that is 10H-phenothiazine substituted by an acetyl group at position 2 and a 3-(dimethylamino)propyl group at position 10.	2.02	1	0	aromatic ketone; methyl ketone; phenothiazines; tertiary amino compound	phenothiazine antipsychotic drug
methoxamine Methoxamine: An alpha-1 adrenergic agonist that causes prolonged peripheral VASOCONSTRICTION.. methoxamine : An amphetamine in which the parent 1-phenylpropan-2-amine skeleton is substituted at position 1 with an hydroxy group and the phenyl ring is 2- and 5-substituted with methoxy groups. It is an antihypotensive agent (pressor), an agonist acting directly at alpha-adrenoceptors with selectivity for the alpha-1 adrenoceptor subtype similar to phenylephrine .	3.46	2	0	amphetamines	alpha-adrenergic agonist; antihypotensive agent
adenosine monophosphate Adenosine Monophosphate: Adenine nucleotide containing one phosphate group esterified to the sugar moiety in the 2'-, 3'-, or 5'-position.	2.66	3	0	adenosine 5'-phosphate; purine ribonucleoside 5'-monophosphate	adenosine A1 receptor agonist; cofactor; EC 3.1.3.1 (alkaline phosphatase) inhibitor; EC 3.1.3.11 (fructose-bisphosphatase) inhibitor; fundamental metabolite; micronutrient; nutraceutical
methicillin Methicillin: One of the PENICILLINS which is resistant to PENICILLINASE but susceptible to a penicillin-binding protein. It is inactivated by gastric acid so administered by injection.. methicillin : A penicillin that is 6-aminopenicillanic acid in which one of the amino hydrogens is replaced by a 2,6-dimethoxybenzoyl group.	10.08	64	2	penicillin allergen; penicillin	antibacterial drug
niridazole Niridazole: An antischistosomal agent that has become obsolete.	2.39	2	0	1,3-thiazoles; C-nitro compound
cloxacillin Cloxacillin: A semi-synthetic antibiotic that is a chlorinated derivative of OXACILLIN.. cloxacillin : A semisynthetic penicillin antibiotic carrying a 3-(2-chlorophenyl)-5-methylisoxazole-4-carboxamido group at position 6.	7.91	36	2	penicillin allergen; penicillin; semisynthetic derivative	antibacterial agent; antibacterial drug
methylene blue Methylene Blue: A compound consisting of dark green crystals or crystalline powder, having a bronze-like luster. Solutions in water or alcohol have a deep blue color. Methylene blue is used as a bacteriologic stain and as an indicator. It inhibits GUANYLATE CYCLASE, and has been used to treat cyanide poisoning and to lower levels of METHEMOGLOBIN.. methylene blue : An organic chloride salt having 3,7-bis(dimethylamino)phenothiazin-5-ium as the counterion. A commonly used dye that also exhibits antioxidant, antimalarial, antidepressant and cardioprotective properties.	2.86	4	0	organic chloride salt	acid-base indicator; antidepressant; antimalarial; antimicrobial agent; antioxidant; cardioprotective agent; EC 1.4.3.4 (monoamine oxidase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; EC 4.6.1.2 (guanylate cyclase) inhibitor; fluorochrome; histological dye; neuroprotective agent; physical tracer
bretylium tosylate Bretylium Tosylate: An agent that blocks the release of adrenergic transmitters and may have other actions. It was formerly used as an antihypertensive agent, but is now proposed as an anti-arrhythmic.. bretylium tosylate : The tosylate salt of bretylium. It blocks noradrenaline release from the peripheral sympathetic nervous system, and is used in emergency medicine, cardiology, and other specialties for the acute management of ventricular tachycardia and ventricular fibrillation.	2.45	2	0	organosulfonate salt; quaternary ammonium salt	adrenergic antagonist; anti-arrhythmia drug; antihypertensive agent
leucine Leucine: An essential branched-chain amino acid important for hemoglobin formation.. leucine : A branched-chain amino acid that consists of glycine in which one of the hydrogens attached to the alpha-carbon is substituted by an isobutyl group.	5.76	29	0	amino acid zwitterion; L-alpha-amino acid; leucine; proteinogenic amino acid; pyruvate family amino acid	algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
methacholine chloride Methacholine Chloride: A quaternary ammonium parasympathomimetic agent with the muscarinic actions of ACETYLCHOLINE. It is hydrolyzed by ACETYLCHOLINESTERASE at a considerably slower rate than ACETYLCHOLINE and is more resistant to hydrolysis by nonspecific CHOLINESTERASES so that its actions are more prolonged. It is used as a parasympathomimetic bronchoconstrictor agent and as a diagnostic aid for bronchial asthma. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1116)	2.01	1	0	quaternary ammonium salt
aniline [no description available]	2.21	1	0	anilines; primary arylamine
carbaryl Carbaryl: A carbamate insecticide and parasiticide. It is a potent anticholinesterase agent belonging to the carbamate group of reversible cholinesterase inhibitors. It has a particularly low toxicity from dermal absorption and is used for control of head lice in some countries.. carbaryl : A carbamate ester obtained by the formal condensation of 1-naphthol with methylcarbamic acid.	2.05	1	0	carbamate ester; naphthalenes	acaricide; agrochemical; carbamate insecticide; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; plant growth retardant
cytidine diphosphate Cytidine Diphosphate: Cytidine 5'-(trihydrogen diphosphate). A cytosine nucleotide containing two phosphate groups esterified to the sugar moiety. Synonyms: CRPP; cytidine pyrophosphate.	2	1	0	cytidine 5'-phosphate; pyrimidine ribonucleoside 5'-diphosphate	Escherichia coli metabolite; mouse metabolite
uridine triphosphate Uridine Triphosphate: Uridine 5'-(tetrahydrogen triphosphate). A uracil nucleotide containing three phosphate groups esterified to the sugar moiety.	2.39	2	0	pyrimidine ribonucleoside 5'-triphosphate; uridine 5'-phosphate	Escherichia coli metabolite; mouse metabolite
lactose Lactose: A disaccharide of GLUCOSE and GALACTOSE in human and cow milk. It is used in pharmacy for tablets, in medicine as a nutrient, and in industry.. lactose : A glycosylglucose disaccharide, found most notably in milk, that consists of D-galactose and D-glucose fragments bonded through a beta-1->4 glycosidic linkage. The glucose fragment can be in either the alpha- or beta-pyranose form, whereas the galactose fragment can only have the beta-pyranose form.. beta-lactose : The beta-anomer of lactose.	6.45	17	3	lactose
methionine Methionine: A sulfur-containing essential L-amino acid that is important in many body functions.. methionine : A sulfur-containing amino acid that is butyric acid bearing an amino substituent at position 2 and a methylthio substituent at position 4.	5.49	22	0	aspartate family amino acid; L-alpha-amino acid; methionine zwitterion; methionine; proteinogenic amino acid	antidote to paracetamol poisoning; human metabolite; micronutrient; mouse metabolite; nutraceutical
phenylalanine Phenylalanine: An essential aromatic amino acid that is a precursor of MELANIN; DOPAMINE; noradrenalin (NOREPINEPHRINE), and THYROXINE.. L-phenylalanine : The L-enantiomer of phenylalanine.. phenylalanine : An aromatic amino acid that is alanine in which one of the methyl hydrogens is substituted by a phenyl group.	6.56	26	0	amino acid zwitterion; erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid; phenylalanine; proteinogenic amino acid	algal metabolite; EC 3.1.3.1 (alkaline phosphatase) inhibitor; Escherichia coli metabolite; human xenobiotic metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite
Mebutamate [no description available]	2.05	1	0	organic molecular entity
desoxycorticosterone Desoxycorticosterone: A steroid metabolite that is the 11-deoxy derivative of CORTICOSTERONE and the 21-hydroxy derivative of PROGESTERONE	2.86	4	0	20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; mineralocorticoid; primary alpha-hydroxy ketone	human metabolite; mouse metabolite
colchicine (S)-colchicine : A colchicine that has (S)-configuration. It is a secondary metabolite, has anti-inflammatory properties and is used to treat gout, crystal-induced joint inflammation, familial Mediterranean fever, and many other conditions.	6.61	18	0	alkaloid; colchicine	anti-inflammatory agent; gout suppressant; mutagen
gallamine triethiodide Gallamine Triethiodide: A synthetic nondepolarizing blocking drug. The actions of gallamine triethiodide are similar to those of TUBOCURARINE, but this agent blocks the cardiac vagus and may cause sinus tachycardia and, occasionally, hypertension and increased cardiac output. It should be used cautiously in patients at risk from increased heart rate but may be preferred for patients with bradycardia. (From AMA Drug Evaluations Annual, 1992, p198)	2.89	4	0
cytidine [no description available]	2.42	2	0	cytidines	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
cytidine triphosphate Cytidine Triphosphate: Cytidine 5'-(tetrahydrogen triphosphate). A cytosine nucleotide containing three phosphate groups esterified to the sugar moiety.	1.99	1	0	cytidine 5'-phosphate; pyrimidine ribonucleoside 5'-triphosphate	Escherichia coli metabolite; mouse metabolite
mebanazine mebanazine: RN given refers to parent cpd without isomeric designation; structure	2.06	1	0	benzenes
oxacillin Oxacillin: An antibiotic similar to FLUCLOXACILLIN used in resistant staphylococci infections.. oxacillin : A penicillin antibiotic carrying a 5-methyl-3-phenylisoxazole-4-carboxamide group at position 6beta.	8.66	46	2	penicillin	antibacterial agent; antibacterial drug
cycloheximide Cycloheximide: Antibiotic substance isolated from streptomycin-producing strains of Streptomyces griseus. It acts by inhibiting elongation during protein synthesis.. cycloheximide : A dicarboximide that is 4-(2-hydroxyethyl)piperidine-2,6-dione in which one of the hydrogens attached to the carbon bearing the hydroxy group is replaced by a 3,5-dimethyl-2-oxocyclohexyl group. It is an antibiotic produced by the bacterium Streptomyces griseus.	6.45	23	0	antibiotic fungicide; cyclic ketone; dicarboximide; piperidine antibiotic; piperidones; secondary alcohol	anticoronaviral agent; bacterial metabolite; ferroptosis inhibitor; neuroprotective agent; protein synthesis inhibitor
egtazic acid Egtazic Acid: A chelating agent relatively more specific for calcium and less toxic than EDETIC ACID.. ethylene glycol bis(2-aminoethyl)tetraacetic acid : A diether that is ethylene glycol in which the hydrogens of the hydroxy groups have been replaced by 2-[bis(carboxymethyl)amino]ethyl group respectively.	5.1	44	0	diether; tertiary amino compound; tetracarboxylic acid	chelator
chloroform Chloroform: A commonly used laboratory solvent. It was previously used as an anesthetic, but was banned from use in the U.S. due to its suspected carcinogenicity.. chloroform : A one-carbon compound that is methane in which three of the hydrogens are replaced by chlorines.	2.68	3	0	chloromethanes; one-carbon compound	carcinogenic agent; central nervous system drug; inhalation anaesthetic; non-polar solvent; refrigerant
fluocinolone acetonide Fluocinolone Acetonide: A glucocorticoid derivative used topically in the treatment of various skin disorders. It is usually employed as a cream, gel, lotion, or ointment. It has also been used topically in the treatment of inflammatory eye, ear, and nose disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p732). fluocinolone acetonide : A fluorinated steroid that is flunisolide in which the hydrogen at position 9 is replaced by fluorine. A corticosteroid with glucocorticoid activity, it is used (both as the anhydrous form and as the dihydrate) in creams, gels and ointments for the treatment of various skin disorders.	8.15	31	10	11beta-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; cyclic ketal; fluorinated steroid; glucocorticoid; organic heteropentacyclic compound; primary alpha-hydroxy ketone	anti-inflammatory drug; antipruritic drug
norethindrone Norethindrone: A synthetic progestational hormone with actions similar to those of PROGESTERONE but functioning as a more potent inhibitor of ovulation. It has weak estrogenic and androgenic properties. The hormone has been used in treating amenorrhea, functional uterine bleeding, endometriosis, and for CONTRACEPTION.. norethisterone : A 17beta-hydroxy steroid that is testosterone in which the hydrogen at position 17 is replaced by an ethynyl group and in which the methyl group attached to position 10 is replaced by hydrogen.	3.07	5	0	17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; terminal acetylenic compound; tertiary alcohol	progestin; synthetic oral contraceptive
norethynodrel Norethynodrel: A synthetic progestational hormone with actions and uses similar to those of PROGESTERONE. It has been used in the treatment of functional uterine bleeding and ENDOMETRIOSIS. As a contraceptive (CONTRACEPTIVE AGENTS), it has usually been administered in combination with MESTRANOL.	2.05	1	0	oxo steroid
cycloserine Cycloserine: Antibiotic substance produced by Streptomyces garyphalus.. D-cycloserine : A 4-amino-1,2-oxazolidin-3-one that has R configuration. It is an antibiotic produced by Streptomyces garyphalus or S. orchidaceus and is used as part of a multi-drug regimen for the treatment of tuberculosis when resistance to, or toxicity from, primary drugs has developed. An analogue of D-alanine, it interferes with bacterial cell wall synthesis in the cytoplasm by competitive inhibition of L-alanine racemase (which forms D-alanine from L-alanine) and D-alanine--D-alanine ligase (which incorporates D-alanine into the pentapeptide required for peptidoglycan formation and bacterial cell wall synthesis).	6.37	23	0	4-amino-1,2-oxazolidin-3-one; organonitrogen heterocyclic antibiotic; organooxygen heterocyclic antibiotic; zwitterion	antiinfective agent; antimetabolite; antitubercular agent; metabolite; NMDA receptor agonist
benziodarone benziodarone: minor descriptor (75-89); on-line & INDEX MEDICUS search BENZOFURANS (68-89) & IODOBENZOATES (74)	2.46	2	0	aromatic ketone
ampicillin Ampicillin: Semi-synthetic derivative of penicillin that functions as an orally active broad-spectrum antibiotic.. ampicillin : A penicillin in which the substituent at position 6 of the penam ring is a 2-amino-2-phenylacetamido group.	13.38	260	9	beta-lactam antibiotic; penicillin allergen; penicillin	antibacterial drug
mannitol [no description available]	7.87	20	2	mannitol	allergen; antiglaucoma drug; compatible osmolytes; Escherichia coli metabolite; food anticaking agent; food bulking agent; food humectant; food stabiliser; food thickening agent; hapten; metabolite; osmotic diuretic; sweetening agent
cytarabine [no description available]	3.26	6	0	beta-D-arabinoside; monosaccharide derivative; pyrimidine nucleoside	antimetabolite; antineoplastic agent; antiviral agent; immunosuppressive agent
phenacyl bromide phenacyl bromide: structure. phenacyl bromide : An alpha-bromoketone that is acetophenone substituted by a bromo group at position 2.	2	1	0	acetophenones; alpha-bromoketone	metabolite
ornithine Ornithine: An amino acid produced in the urea cycle by the splitting off of urea from arginine.. ornithine : An alpha-amino acid that is pentanoic acid bearing two amino substituents at positions 2 and 5.	4.29	3	0	non-proteinogenic L-alpha-amino acid; ornithine	algal metabolite; hepatoprotective agent; mouse metabolite
dinitrofluorobenzene Dinitrofluorobenzene: Irritants and reagents for labeling terminal amino acid groups.. 1-fluoro-2,4-dinitrobenzene : The organofluorine compound that is benzene with a fluoro substituent at the 1-position and two nitro substituents in the 2- and 4-positions.	1.95	1	0	C-nitro compound; organofluorine compound	agrochemical; allergen; chromatographic reagent; EC 2.7.3.2 (creatine kinase) inhibitor; protein-sequencing agent; spectrophotometric reagent
asparagine Asparagine: A non-essential amino acid that is involved in the metabolic control of cell functions in nerve and brain tissue. It is biosynthesized from ASPARTIC ACID and AMMONIA by asparagine synthetase. (From Concise Encyclopedia Biochemistry and Molecular Biology, 3rd ed). asparagine : An alpha-amino acid in which one of the hydrogens attached to the alpha-carbon of glycine is substituted by a 2-amino-2-oxoethyl group.	3.75	3	0	amino acid zwitterion; asparagine; aspartate family amino acid; L-alpha-amino acid; proteinogenic amino acid	Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite
4-hydroxypropiophenone [no description available]	2.04	1	0	acetophenones
histidine Histidine: An essential amino acid that is required for the production of HISTAMINE.. L-histidine : The L-enantiomer of the amino acid histidine.. histidine : An alpha-amino acid that is propanoic acid bearing an amino substituent at position 2 and a 1H-imidazol-4-yl group at position 3.	3.56	9	0	amino acid zwitterion; histidine; L-alpha-amino acid; polar amino acid zwitterion; proteinogenic amino acid	algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite
n-pentanol n-pentanol: RN given refers to parent cpd. pentan-1-ol : A short-chain primary fatty alcohol that is pentane in which a hydrogen of one of the methyl groups is substituted by a hydroxy group. It has been isolated from Melicope ptelefolia.	2.38	2	0	pentanol; short-chain primary fatty alcohol	human metabolite; plant metabolite
medroxyprogesterone acetate [no description available]	2.05	1	0	20-oxo steroid; 3-oxo-Delta(4) steroid; acetate ester; corticosteroid; steroid ester	adjuvant; androgen; antineoplastic agent; antioxidant; female contraceptive drug; inhibitor; progestin; synthetic oral contraceptive
veratridine [no description available]	2.45	2	0	steroid	sodium channel modulator
valine Valine: A branched-chain essential amino acid that has stimulant activity. It promotes muscle growth and tissue repair. It is a precursor in the penicillin biosynthetic pathway.. valine : A branched-chain amino acid that consists of glycine in which one of the hydrogens attached to the alpha-carbon is substituted by an isopropyl group.. L-valine : The L-enantiomer of valine.	3.82	12	0	L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid; pyruvate family amino acid; valine	algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite
threonine Threonine: An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.. threonine : An alpha-amino acid in which one of the hydrogens attached to the alpha-carbon of glycine is substituted by a 1-hydroxyethyl group.	5.51	9	2	amino acid zwitterion; aspartate family amino acid; L-alpha-amino acid; proteinogenic amino acid; threonine	algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite
mestranol [no description available]	2.66	3	0	17beta-hydroxy steroid; aromatic ether; terminal acetylenic compound	prodrug; xenoestrogen
methaqualone Methaqualone: A quinazoline derivative with hypnotic and sedative properties. It has been withdrawn from the market in many countries because of problems with abuse. (From Martindale, The Extra Pharmacopoeia, 30th ed, p604). methaqualone : A member of the class of quinazolines that is quinazolin-4-one substituted at positions 2 and 3 by methyl and o-tolyl groups respectively. A depressant that increases the activity of the GABA receptors in the brain and nervous system, it is used as a sedative and hypnotic medication. It became popular as a recreational drug and club drug in the late 1960s and 1970s.	2.05	1	0	quinazolines	GABA agonist; sedative
trypan blue VisionBlue: A trypan blue ophthalmic solution.	2.05	1	0
methandrostenolone Methandrostenolone: A synthetic steroid with anabolic properties that are more pronounced than its androgenic effects. It has little progestational activity. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1188)	2.04	1	0	organic molecular entity
chlorquinaldol Chlorquinaldol: Local anti-infective agent used for skin, gastrointestinal, and vaginal infections with fungi, protozoa, and certain bacteria. In animals, it causes central nervous system damage and is not administered parenterally. It is also used as antiseptic, fungistat, or deodorant.. chlorquinaldol : A monohydroxyquinoline that is quinolin-8-ol which is substituted by a methyl group at position 2 and by chlorine at positions 5 and 7. An antifungal and antibacterial, it was formerly used for topical treatment of skin conditions and vaginal infections.	4.43	5	1	monohydroxyquinoline; organochlorine compound	antibacterial drug; antiprotozoal drug; antiseptic drug
cordycepin [no description available]	2.05	1	0	3'-deoxyribonucleoside; adenosines	antimetabolite; nucleoside antibiotic
tryptophan Tryptophan: An essential amino acid that is necessary for normal growth in infants and for NITROGEN balance in adults. It is a precursor of INDOLE ALKALOIDS in plants. It is a precursor of SEROTONIN (hence its use as an antidepressant and sleep aid). It can be a precursor to NIACIN, albeit inefficiently, in mammals.. tryptophan : An alpha-amino acid that is alanine bearing an indol-3-yl substituent at position 3.	5.4	20	0	erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid; tryptophan zwitterion; tryptophan	antidepressant; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite
isoleucine Isoleucine: An essential branched-chain aliphatic amino acid found in many proteins. It is an isomer of LEUCINE. It is important in hemoglobin synthesis and regulation of blood sugar and energy levels.. isoleucine : A 2-amino-3-methylpentanoic acid having either (2R,3R)- or (2S,3S)-configuration.. L-isoleucine : The L-enantiomer of isoleucine.	4.92	12	0	aspartate family amino acid; isoleucine; L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid	algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
quinethazone quinethazone: RN given for cpd without isomeric designation. quinethazone : A member of the class of quinazolines that is quinazolin-4-one substituted at positions 2, 6 and 7 by ethyl, sulfamoyl and chloro groups respectively; a thiazide-like diuretic used to treat hypertension.	2.04	1	0	quinazolines	antihypertensive agent; diuretic
arginine Arginine: An essential amino acid that is physiologically active in the L-form.. arginine : An alpha-amino acid that is glycine in which the alpha-is substituted by a 3-guanidinopropyl group.	6.47	35	0	arginine; glutamine family amino acid; L-alpha-amino acid; proteinogenic amino acid	biomarker; Escherichia coli metabolite; micronutrient; mouse metabolite; nutraceutical
acetylene [no description available]	1.95	1	0	alkyne; gas molecular entity; terminal acetylenic compound
methylamine methyl group : An alkyl group that is the univalent group derived from methane by removal of a hydrogen atom.	2.38	2	0	methylamines; one-carbon compound; primary aliphatic amine	mouse metabolite
ethylene oxide Ethylene Oxide: A colorless and flammable gas at room temperature and pressure. Ethylene oxide is a bactericidal, fungicidal, and sporicidal disinfectant. It is effective against most micro-organisms, including viruses. It is used as a fumigant for foodstuffs and textiles and as an agent for the gaseous sterilization of heat-labile pharmaceutical and surgical materials. (From Reynolds, Martindale The Extra Pharmacopoeia, 30th ed, p794). oxirane : A saturated organic heteromonocyclic parent that is a three-membered heterocycle of two carbon atoms and one oxygen atom.	1.94	1	0	gas molecular entity; oxacycle; saturated organic heteromonocyclic parent	allergen; mouse metabolite; mutagen
iodoform [no description available]	2.02	1	0	iodomethanes
methanesulfonic acid [no description available]	2.34	2	0	alkanesulfonic acid; one-carbon compound	Escherichia coli metabolite
tribromoethanol tribromoethanol: major descriptor (66-90); on-line search ETHANOL (66-90); INDEX MEDICUS search TRIBROMOETHANOL (66-90)	2.04	1	0	alcohol; organobromine compound
trichloroacetic acid Trichloroacetic Acid: A strong acid used as a protein precipitant in clinical chemistry and also as a caustic for removing warts.. trichloroacetic acid : A monocarboxylic acid that is acetic acid in which all three methyl hydrogens are substituted by chlorine.	2.44	2	0	monocarboxylic acid; organochlorine compound	carcinogenic agent; metabolite; mouse metabolite
triamcinolone acetonide Triamcinolone Acetonide: An esterified form of TRIAMCINOLONE. It is an anti-inflammatory glucocorticoid used topically in the treatment of various skin disorders. Intralesional, intramuscular, and intra-articular injections are also administered under certain conditions.. triamcinolone acetonide : A synthetic glucocorticoid that is the 16,17-acetonide of triamcinolone. Used to treat various skin infections.	9.31	72	14	11beta-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; cyclic ketal; fluorinated steroid; glucocorticoid; primary alpha-hydroxy ketone	anti-allergic agent; anti-inflammatory drug
mepenzolate bromide [no description available]	2.04	1	0	diarylmethane
allylpropymal allylpropymal: RN given refers to parent cpd. aprobarbital : A member of the class of barbiturates that is pyrimidine-2,4,6(1H,3H,5H)-trione substituted by an isopropyl and a prop-1-en-3-yl group at position 5.	2.05	1	0	barbiturates
phencyclidine Phencyclidine: A hallucinogen formerly used as a veterinary anesthetic, and briefly as a general anesthetic for humans. Phencyclidine is similar to KETAMINE in structure and in many of its effects. Like ketamine, it can produce a dissociative state. It exerts its pharmacological action through inhibition of NMDA receptors (RECEPTORS, N-METHYL-D-ASPARTATE). As a drug of abuse, it is known as PCP and Angel Dust.. phencyclidine : A member of the class of piperidines that is piperidine in which the nitrogen is substituted with a 1-phenylcyclohexyl group. Formerly used as an anaesthetic agent, it exhibits both hallucinogenic and neurotoxic effects.	5.16	3	1	benzenes; piperidines	anaesthetic; neurotoxin; NMDA receptor antagonist; psychotropic drug
butobarbital butobarbital: Butobarbital should be distinguished from Butabarbital (a synonym for Secbutabarbital)	2.05	1	0	barbiturates
carbromal carbromal: was heading 1963-94 (Prov 1963-73); use UREA to search CARBROMAL 1963-94	2.04	1	0	N-acylurea
dimethyl sulfate dimethyl sulfate: RN given refers to unlabeled cpd; structure. dimethyl sulfate : The dimethyl ester of sulfuric acid.	2.7	3	0	alkyl sulfate	alkylating agent; immunosuppressive agent
tromethamine Tromethamine: An organic amine proton acceptor. It is used in the synthesis of surface-active agents and pharmaceuticals; as an emulsifying agent for cosmetic creams and lotions, mineral oil and paraffin wax emulsions, as a biological buffer, and used as an alkalizer. (From Merck, 11th ed; Martindale, The Extra Pharmacopoeia, 30th ed, p1424)	1.98	1	0	primary amino compound; triol	buffer
quinic acid (-)-quinic acid : The (-)-enantiomer of quinic acid.	2.86	4	0
tetraethoxysilane [no description available]	2.15	1	0
tri-o-cresyl phosphate tri-o-cresyl phosphate: see also related IMOL S-140	1.96	1	0
triparanol Triparanol: Antilipemic agent with high ophthalmic toxicity. According to Merck Index, 11th ed, the compound was withdrawn from the market in 1962 because of its association with the formation of irreversible cataracts.	5.28	7	0	stilbenoid	anticoronaviral agent
isoprene isoprene: used in manufacture of ''synthetic'' rubber, butyl rubber; copolymer in production of elastomers; structure. isoprene : A hemiterpene with the formula CH2=C(CH3)CH=CH2; the monomer of natural rubber and a common structure motif to the isoprenoids, a large class of other naturally occurring compounds.	4.76	10	0	alkadiene; hemiterpene; volatile organic compound	plant metabolite
trichloroethylene Trichloroethylene: A highly volatile inhalation anesthetic used mainly in short surgical procedures where light anesthesia with good analgesia is required. It is also used as an industrial solvent. Prolonged exposure to high concentrations of the vapor can lead to cardiotoxicity and neurological impairment.. triol : A chemical compound containing three hydroxy groups.	2.05	1	0	chloroethenes	inhalation anaesthetic; mouse metabolite
acrylamide [no description available]	2.03	1	0	acrylamides; N-acylammonia; primary carboxamide	alkylating agent; carcinogenic agent; Maillard reaction product; mutagen; neurotoxin
acrylic acid acrylic acid: RN given refers to parent cpd. acrylic acid : A alpha,beta-unsaturated monocarboxylic acid that is ethene substituted by a carboxy group.	4.8	1	1	alpha,beta-unsaturated monocarboxylic acid	metabolite
pantothenic acid Pantothenic Acid: A butyryl-beta-alanine that can also be viewed as pantoic acid complexed with BETA ALANINE. It is incorporated into COENZYME A and protects cells against peroxidative damage by increasing the level of GLUTATHIONE.. pantothenic acid : A member of the class of pantothenic acids that is an amide formed from pantoic acid and beta-alanine.. vitamin B5 : Any member of a group of vitamers that belong to the chemical structural class called pantothenic acids that exhibit biological activity against vitamin B5 deficiency. Deficiency of vitamin B5 is rare due to its widespread distribution in whole grain cereals, legumes and meat. Symptoms associated with vitamin B5 deficiency are difficult to asses since they are subtle and resemble those of other B vitamin deficiencies. The vitamers include (R)-pantothenic acid and its ionized and salt forms.. (R)-pantothenate : A pantothenate that is the conjugate base of (R)-pantothenic acid, obtained by deprotonation of the carboxy group.. (R)-pantothenic acid : A pantothenic acid having R-configuration.	3.45	8	0	pantothenic acid; vitamin B5	antidote to curare poisoning; geroprotector; human blood serum metabolite
sulfachlorpyridazine Sulfachlorpyridazine: A sulfonamide antimicrobial used for urinary tract infections and in veterinary medicine.. sulfachloropyridazine : A sulfonamide antimicrobial used for urinary tract infections and in veterinary medicine.	2.05	1	0	organochlorine compound; pyridazines; sulfonamide	antibacterial drug; drug allergen; EC 2.5.1.15 (dihydropteroate synthase) inhibitor
methylmethacrylate Methylmethacrylate: The methyl ester of methacrylic acid. It polymerizes easily to form POLYMETHYL METHACRYLATE. It is used as a bone cement.. methyl methacrylate : An enoate ester having methacrylic acid as the carboxylic acid component and methanol as the alcohol component.	1.97	1	0	enoate ester; methyl ester	allergen; polymerisation monomer
dehydrocholic acid Dehydrocholic Acid: A semisynthetic bile acid made from cholic acid. It is used as a cholagogue, hydrocholeretic, diuretic, and as a diagnostic aid.. 3,7,12-trioxo-5beta-cholanic acid : An oxo-5beta-cholanic acid in which three oxo substituents are located at positions 3, 7 and 12 on the cholanic acid skeleton.	2.05	1	0	12-oxo steroid; 3-oxo-5beta-steroid; 7-oxo steroid; oxo-5beta-cholanic acid	gastrointestinal drug
taurocholic acid Taurocholic Acid: The product of conjugation of cholic acid with taurine. Its sodium salt is the chief ingredient of the bile of carnivorous animals. It acts as a detergent to solubilize fats for absorption and is itself absorbed. It is used as a cholagogue and cholerectic.. taurocholate : An organosulfonate oxoanion that is the conjugate base of taurocholic acid.. taurocholic acid : A bile acid taurine conjugate of cholic acid that usually occurs as the sodium salt of bile in mammals.	2.41	2	0	amino sulfonic acid; bile acid taurine conjugate	human metabolite
rhodamine b rhodamine B: RN & N1 from 9th CI Form Index; RN given refers to parent cpd; structure in Merck Index, 9th ed, #7973; TETRAETHYLRHODAMINE was see RHODAMINES 1975-93; use RHODAMINES to search TETRAETHYLRHODAMINE 1975-93. rhodamine B : An organic chloride salt having N-[9-(2-carboxyphenyl)-6-(diethylamino)-3H-xanthen-3-ylidene]-N-ethylethanaminium as the counterion. An amphoteric dye commonly used as a fluorochrome.	4.8	1	1	organic chloride salt; xanthene dye	fluorescent probe; fluorochrome; histological dye
cyclizine Cyclizine: A histamine H1 antagonist given by mouth or parenterally for the control of postoperative and drug-induced vomiting and in motion sickness. (From Martindale, The Extra Pharmacopoeia, 30th ed, p935). cyclizine : An N-alkylpiperazine in which one nitrogen of the piperazine ring is substituted by a methyl group, while the other is substituted by a diphenylmethyl group.	2.04	1	0	N-alkylpiperazine	antiemetic; central nervous system depressant; cholinergic antagonist; H1-receptor antagonist; local anaesthetic
buclizine buclizine : An N-alkylpiperazine carrying (4-chlorophenyl)(phenyl)methyl and 4-tert-butylbenzyl groups.	2.04	1	0	monochlorobenzenes; N-alkylpiperazine	antiemetic; central nervous system depressant; cholinergic antagonist; histamine antagonist; local anaesthetic
methylprednisolone Methylprednisolone: A PREDNISOLONE derivative with similar anti-inflammatory action.. 6alpha-methylprednisolone : The 6alpha-stereoisomer of 6-methylprednisolone.	7.56	33	5	6-methylprednisolone; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	adrenergic agent; anti-inflammatory drug; antiemetic; environmental contaminant; neuroprotective agent; xenobiotic
thiopropazate thiopropazate: minor descriptor (66-72); major descriptor (73-85); on-line search PHENOTHIAZINES (66-85); Index Medicus search PHENOTHIAZINES (66-72); THIOPROPAZATE (73-85); RN given refers to parent cpd. thiopropazate : A phenothiazine derivative in which 10H-phenothiazine has a chloro subsitituent at the 2-position and a 3-[4-(2-acetoxyethyl)piperazin-1-yl]propyl group at N-10.	2.04	1	0	acetate ester; N-alkylpiperazine; organochlorine compound; phenothiazines	dopaminergic antagonist; phenothiazine antipsychotic drug
9,10-anthraquinone 9,10-anthraquinone : An anthraquinone that is anthracene in which positions 9 and 10 have been oxidised to carbonyls.	2.08	1	0	anthraquinone
acetrizoic acid Acetrizoic Acid: An iodinated radiographic contrast medium used as acetrizoate sodium in HYSTEROSALPINGOGRAPHY.	2.04	1	0	aminobenzoic acid
penicillin v Penicillin V: A broad-spectrum penicillin antibiotic used orally in the treatment of mild to moderate infections by susceptible gram-positive organisms.. phenoxymethylpenicillin : A penicillin compound having a 6beta-(phenoxyacetyl)amino side-chain.	6.57	16	1	penicillin allergen; penicillin
acetopyrrothine acetopyrrothine: structure. thiolutin : A dithiolopyrrolone antibiotic that is 4,5-dihydro[1,2]dithiolo[4,3-b]pyrrole in which the hydrogens at positions 4,5 and 6 have been replaced by methyl, oxo and acetamido groups, respectively. It is a potent inhibitor of RNA polymerases, inhibits the angiogenesis of human umbilical vein endothelial cells, and also inhibits JAMM metalloproteases.	1.92	1	0	acetamides; dithiolopyrrolone antibiotic	angiogenesis inhibitor; antibacterial agent; antifungal agent; antineoplastic agent; bacterial metabolite; chelator; EC 2.7.7.6 (RNA polymerase) inhibitor; marine metabolite; protein synthesis inhibitor; toxin
isosorbide dinitrate Isosorbide Dinitrate: A vasodilator used in the treatment of ANGINA PECTORIS. Its actions are similar to NITROGLYCERIN but with a slower onset of action.	2.05	1	0	glucitol derivative; nitrate ester	nitric oxide donor; vasodilator agent
phthalide 2-benzofuran-1(3H)-one : A gamma-lactone that is 1,3-dihydro-2-benzofuran in which the hydrogens at position 1 are replaced by an oxo group.. isobenzofuranone : A 2-benzofuran containing one or more oxo groups.	2.31	1	0	2-benzofurans; gamma-lactone
penicillanic acid Penicillanic Acid: A building block of penicillin, devoid of significant antibacterial activity. (From Merck Index, 11th ed). penicillanic acid : A penam that consists of 3,3-dimethyl-7-oxo-4-thia-1-azabicyclo[3.2.0]heptane bearing a carboxy group at position 2 and having (2S,5R)-configuration.	2.34	2	0	penicillanic acids
xylitol xylooligosaccharide: structure in first source. pentitol : An alditol obtained by reduction of any pentose.. xylooligosaccharide : An oligosaccharide comprised of xylose residues.	1.94	1	0
n-vinyl-2-pyrrolidinone N-vinyl-2-pyrrolidinone: monomer of POVIDONE; structure given in first source	7.94	14	2	pyrrolidin-2-ones
2,4-dinitrobenzenesulfonic acid 2,4-dinitrobenzenesulfonic acid: RN given refers to parent cpd; structure. 2,4-dinitrobenzenesulfonic acid : The arenesulfonic acid that is benzenesulfonic acid with two nitro substituents in the 2- and 4-positions.	1.98	1	0	arenesulfonic acid; C-nitro compound
aminacrine Aminacrine: A highly fluorescent anti-infective dye used clinically as a topical antiseptic and experimentally as a mutagen, due to its interaction with DNA. It is also used as an intracellular pH indicator.. 9-aminoacridine : An aminoacridine that is acridine in which the hydrogen at position 9 is replaced by an amino group. A fluorescent dyd and topical antiseptic agent, it is used (usually as the hydrochloride salt) in eye drops for the treatment of superficial eye infections.	2.41	2	0	aminoacridines; primary amino compound	acid-base indicator; antiinfective agent; antiseptic drug; fluorescent dye; MALDI matrix material; mutagen
pseudoephedrine Pseudoephedrine: A phenethylamine that is an isomer of EPHEDRINE which has less central nervous system effects and usage is mainly for respiratory tract decongestion.. pseudoephedrine : A member of the class of the class of phenylethanolamines that is (1S)-2-(methylamino)-1-phenylethan-1-ol in which the pro-S hydrogen at position 2 is replaced by a methyl group.	2.04	1	0	phenylethanolamines; secondary alcohol; secondary amino compound	anti-asthmatic drug; bronchodilator agent; central nervous system drug; nasal decongestant; plant metabolite; sympathomimetic agent; vasoconstrictor agent; xenobiotic
quinoxalines quinoxaline : A naphthyridine in which the nitrogens are at positions 1 and 4.	2.91	4	0	mancude organic heterobicyclic parent; naphthyridine; ortho-fused heteroarene
quinoline [no description available]	2.1	1	0	azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; quinolines
2-naphthylamine 2-Naphthylamine: A naphthalene derivative with carcinogenic action.. 2-naphthylamine : A naphthylamine carrying the amino group at position 2.	2.1	1	0	naphthylamine	carcinogenic agent
proflavine Proflavine: Topical antiseptic used mainly in wound dressings.. 3,6-diaminoacridine : An aminoacridine that is acridine that is substituted by amino groups at positions 3 and 6. A slow-acting bacteriostat that is effective against many Gram-positive bacteria (but ineffective against spores), its salts were formerly used for treatment of burns and infected wounds.	2.43	2	0	aminoacridines	antibacterial agent; antiseptic drug; carcinogenic agent; chromophore; intercalator
xanthenes Xanthenes: Compounds with three aromatic rings in linear arrangement with an OXYGEN in the center ring.	2.4	2	0	xanthene
synephrine [no description available]	2.05	1	0	ethanolamines; phenethylamine alkaloid; phenols	alpha-adrenergic agonist; plant metabolite
propylparaben Parabens: Methyl, propyl, butyl, and ethyl esters of p-hydroxybenzoic acid. They have been approved by the FDA as antimicrobial agents for foods and pharmaceuticals. (From Hawley's Condensed Chemical Dictionary, 11th ed, p872)	6.1	13	0	benzoate ester; paraben; phenols	antifungal agent; antimicrobial agent
benzoyl peroxide Benzoyl Peroxide: A peroxide derivative that has been used topically for BURNS and as a dermatologic agent in the treatment of ACNE and POISON IVY DERMATITIS. It is used also as a bleach in the food industry.	4.91	4	0	carbonyl compound
monosulfiram monosulfiram: monosulfide derivative of disulfide DISULFIRAM; structure	3.36	1	1	organosulfur compound
soman Soman: An organophosphorus compound that inhibits cholinesterase. It causes seizures and has been used as a chemical warfare agent.	1.97	1	0	phosphonic ester
pyrrolidonecarboxylic acid Pyrrolidonecarboxylic Acid: A cyclized derivative of L-GLUTAMIC ACID. Elevated blood levels may be associated with problems of GLUTAMINE or GLUTATHIONE metabolism.. 5-oxo-L-proline : An optically active form of 5-oxoproline having L-configuration.	1.99	1	0	5-oxoproline; L-proline derivative; non-proteinogenic L-alpha-amino acid	algal metabolite
trehalose alpha,alpha-trehalose : A trehalose in which both glucose residues have alpha-configuration at the anomeric carbon.	2.08	1	0	trehalose	Escherichia coli metabolite; geroprotector; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
dicloran 2,6-dichloro-4-nitroaniline : A nitroaniline that is 4-nitroaniline in which the hydrogens at positions 2 and 6 are replaced by chlorines. An agricultural fungicide, it is not approved for use in the European Union.	2.01	1	0	aromatic fungicide; dichlorobenzene; nitroaniline	antifungal agrochemical
4-bromophenacyl bromide 4-bromophenacyl bromide: phospholipidase A(2) inhibitor; structure	1.99	1	0
methylparaben methylparaben: used as a preservative in cosmetics but potentiates UV-induced damage of skin; RN given refers to parent cpd. methylparaben : A 4-hydroxybenzoate ester resulting from the formal condensation of the carboxy group of 4-hydroxybenzoic acid with methanol. It is the most frequently used antimicrobial preservative in cosmetics. It occurs naturally in several fruits, particularly in blueberries.	2.04	1	0	paraben	antifungal agent; antimicrobial food preservative; neuroprotective agent; plant metabolite
ethylbenzene [no description available]	4.8	1	1	alkylbenzene
cyclamic acid Cyclamates: Salts and esters of cyclamic acid.. cyclohexylsulfamic acid : A member of the class of sulfamic acids that is sulfamic acid carrying an N-cyclohexyl substituent.	2.35	2	0	sulfamic acids	environmental contaminant; human xenobiotic metabolite
pyridostigmine bromide Pyridostigmine Bromide: A cholinesterase inhibitor with a slightly longer duration of action than NEOSTIGMINE. It is used in the treatment of myasthenia gravis and to reverse the actions of muscle relaxants.	1.94	1	0	pyridinium salt
triethanolamine triethanolamine: RN given refers to parent cpd. triethanolamine : A tertiary amino compound that is ammonia in which each of the hydrogens is substituted by a 2-hydroxyethyl group.	2.06	1	0	amino alcohol; tertiary amino compound; triol	buffer; surfactant
boric acid [no description available]	3.35	1	1	boric acids	astringent
benzonatate benzonatate: structure in Merck Index, 9th ed, #1107. benzonatate : The ester obtained by formal condensation of 4-butylaminobenzoic acid with nonaethylene glycol monomethyl ether. Structurally related to procaine and benzocaine, it has an anaesthetic effect on the stretch sensors in the lungs, and is used as a non-narcotic cough suppressant.	2.06	1	0	benzoate ester; secondary amino compound; substituted aniline	anaesthetic; antitussive
betazole Betazole: A histamine H2 agonist used clinically to test gastric secretory function.. betazole : Pyrazole in which a hydrogen adjacent to one of the nitrogen atoms is substituted by a 2-aminoethyl group. It is a histamine H2-receptor agonist used clinically to test gastric secretory function.	3.34	1	1	primary amino compound; pyrazoles	diagnostic agent; gastrointestinal drug; histamine agonist
4-phenylenediamine 4-phenylenediamine: agent hair dye responsible for contact dermatitis; RN given refers to parent cpd. 1,4-phenylenediamine : A phenylenediamine in which the amino functions are at positions 1 and 4 of the benzene nucleus.	4.19	5	0	phenylenediamine	allergen; dye; hapten; reagent
acrolein [no description available]	2.41	2	0	enal	herbicide; human xenobiotic metabolite; toxin
allylamine Allylamine: Possesses an unusual and selective cytotoxicity for VASCULAR SMOOTH MUSCLE cells in dogs and rats. Useful for experiments dealing with arterial injury, myocardial fibrosis or cardiac decompensation.	1.97	1	0	alkylamine
glyoxal [no description available]	2	1	0	dialdehyde	agrochemical; allergen; pesticide; plant growth regulator
melamine melamine: RN given refers to parent cpd; structure. melamine : A trimer of cyanamide, with a 1,3,5-triazine skeleton.	1.92	1	0	triamino-1,3,5-triazine	xenobiotic metabolite
cyclohexanol Cyclohexanols: Monohydroxy derivatives of cyclohexanes that contain the general formula R-C6H11O. They have a camphorlike odor and are used in making soaps, insecticides, germicides, dry cleaning, and plasticizers.. cyclohexanols : An alcohol in which one or more hydroxy groups are attached to a cyclohexane skeleton.	2.35	2	0	cyclohexanols; secondary alcohol	solvent
pyrroles 1H-pyrrole : A tautomer of pyrrole that has the double bonds at positions 2 and 4.. pyrrole : A five-membered monocyclic heteroarene comprising one NH and four CH units which forms the parent compound of the pyrrole group of compounds. Its five-membered ring structure has three tautomers. A 'closed class'.. azole : Any monocyclic heteroarene consisting of a five-membered ring containing nitrogen. Azoles can also contain one or more other non-carbon atoms, such as nitrogen, sulfur or oxygen.	3.27	6	0	pyrrole; secondary amine
furan furan : A monocyclic heteroarene with a structure consisting of a 5-membered ring containing four carbons and one oxygen, with formula C4H4O. It is a toxic, flammable, low-boiling (31degreeC) colourless liquid.	2.05	1	0	furans; mancude organic heteromonocyclic parent; monocyclic heteroarene	carcinogenic agent; hepatotoxic agent; Maillard reaction product
thiophenes Thiophenes: A monocyclic heteroarene furan in which the oxygen atom is replaced by a sulfur.. thiophenes : Compounds containing at least one thiophene ring.	2.86	4	0	mancude organic heteromonocyclic parent; monocyclic heteroarene; thiophenes; volatile organic compound	non-polar solvent
hexylamine hexylamine: RN given refers to parent cpd; structure. 1-hexanamine : A 6-carbon primary aliphatic amine.	1.96	1	0	primary aliphatic amine	metabolite
diethylenetriamine diethylenetriamine: RN given refers to parent cpd	1.98	1	0	polyazaalkane; triamine
ergotamine Ergotamine: A vasoconstrictor found in ergot of Central Europe. It is a serotonin agonist that has been used as an oxytocic agent and in the treatment of MIGRAINE DISORDERS.. ergotamine : A peptide ergot alkaloid that is dihydroergotamine in which a double bond replaces the single bond between positions 9 and 10.	2.05	1	0	peptide ergot alkaloid	alpha-adrenergic agonist; mycotoxin; non-narcotic analgesic; oxytocic; serotonergic agonist; vasoconstrictor agent
estradiol dipropionate estradiol dipropionate: RN given refers to (17beta)-isomer; RN for cpd without isomeric designation not in Chemline 7/83	2.39	2	0	steroid ester
neostigmine bromide neostigmine bromide : The bromide salt of neostigmine.	2.74	3	0	bromide salt
phenformin Phenformin: A biguanide hypoglycemic agent with actions and uses similar to those of METFORMIN. Although it is generally considered to be associated with an unacceptably high incidence of lactic acidosis, often fatal, it is still available in some countries. (From Martindale, The Extra Pharmacopoeia, 30th ed, p290). phenformin : A member of the class of biguanides that is biguanide in which one of the terminal nitrogen atoms is substituted by a 2-phenylethyl group. It was used as an anti-diabetic drug but was later withdrawn from the market due to potential risk of lactic acidosis.	4.5	4	0	biguanides	antineoplastic agent; geroprotector; hypoglycemic agent
mephobarbital Mephobarbital: A barbiturate that is metabolized to PHENOBARBITAL. It has been used for similar purposes, especially in EPILEPSY, but there is no evidence mephobarbital offers any advantage over PHENOBARBITAL.. mephobarbital : A member of the class of barbiturates, the structure of which is that of barbituric acid substituted at N-1 by a methyl group and at C-5 by ethyl and phenyl groups.	2.05	1	0	barbiturates	anticonvulsant
paramethadione paramethadione: structure	2.04	1	0	oxazolidinone	anticonvulsant
hexachlorobenzene Hexachlorobenzene: An agricultural fungicide and seed treatment agent.. hexachlorobenzene : A member of the class of chlorobenzenes that is benzene in which all of the hydrogens are replaced by chlorines. An agricultural fungicide introduced in the mid-1940s and formerly used as a seed treatment, its use has been banned since 1984 under the Stockholm Convention on Persistent Organic Pollutants.	2.05	1	0	aromatic fungicide; chlorobenzenes	antifungal agrochemical; carcinogenic agent; persistent organic pollutant
trinitrotoluene Trinitrotoluene: A 2,4,6-trinitrotoluene, which is an explosive chemical that can cause skin irritation and other toxic consequences.. 2,4,6-trinitrotoluene : A trinitrotoluene having the nitro groups at positions 2, 4 and 6.	2.05	1	0	trinitrotoluene	explosive
scoparone scoparone: structure. scoparone : A member of the class of coumarins that is esculetin in which the two hydroxy groups at positions 6 and 7 are replaced by methoxy groups. It is a major constituent of the Chinese herbal medicine Yin Chen Hao, and exhibits a variety of pharmacological activities such as anti-inflammatory, anti-allergic, and anti-tumor activities.	2	1	0	aromatic ether; coumarins	anti-allergic agent; anti-inflammatory agent; antihypertensive agent; antilipemic drug; immunosuppressive agent; plant metabolite
vanillic acid Vanillic Acid: A flavoring agent. It is the intermediate product in the two-step bioconversion of ferulic acid to vanillin. (J Biotechnol 1996;50(2-3):107-13).. vanillic acid : A monohydroxybenzoic acid that is 4-hydroxybenzoic acid substituted by a methoxy group at position 3.	2.34	2	0	methoxybenzoic acid; monohydroxybenzoic acid	plant metabolite
pyrazolanthrone pyrazolanthrone: JNK (c-Jun N-terminal kinase) inhibitor; structure in first source. anthra[1,9-cd]pyrazol-6(2H)-one : A member of the class of anthrapyrazoles that is anthra[1,9-cd]pyrazole substituted at position 6 by an oxo group. An inhibitor of c-Jun N-terminal kinase.	2.05	1	0	anthrapyrazole; aromatic ketone; cyclic ketone	antineoplastic agent; c-Jun N-terminal kinase inhibitor; geroprotector
meglumine Meglumine: 1-Deoxy-1-(methylamino)-D-glucitol. A derivative of sorbitol in which the hydroxyl group in position 1 is replaced by a methylamino group. Often used in conjunction with iodinated organic compounds as contrast medium.. N-methylglucamine : A hexosamine that is D-glucitol in which the hydroxy group at position 1 is substituted by the nitrogen of a methylamino group. A crystalline base, it is used in preparing salts of certain acids for use as diagnostic radiopaque media, while its antimonate is used as an antiprotozoal in the treatment of leishmaniasis.	2.46	2	0	hexosamine; secondary amino compound
cinchophen cinchophen: was heading 1963-94; ACIPHENOCHINOLIUM was see CHINOPHEN 1978-94; use QUINOLINES to search CINCHOPHEN 1966-94	2.46	2	0	quinolines
iodohippuric acid Iodohippuric Acid: An iodine-containing compound used in pyelography as a radiopaque medium. If labeled with radioiodine, it can be used for studies of renal function.. 2-iodohippuric acid : A member of the class of benzamides resulting from the formal condensation of the carboxy group of 2-iodobenzoic acid with the amino group of glycine.	2.86	4	0	benzamides; N-acylglycine; organoiodine compound
dextrothyroxine Dextrothyroxine: The dextrorotary isomer of the synthetic THYROXINE.. D-thyroxine : The D-enantiomer of thyroxine.	8.52	20	1	D-tyrosine derivative; thyroxine
shikimic acid Shikimic Acid: A tri-hydroxy cyclohexene carboxylic acid important in biosynthesis of so many compounds that the shikimate pathway is named after it.. shikimic acid : A cyclohexenecarboxylic acid that is cyclohex-1-ene-1-carboxylic acid substituted by hydroxy groups at positions 3, 4 and 5 (the 3R,4S,5R stereoisomer). It is an intermediate metabolite in plants and microorganisms.	2.86	4	0	alpha,beta-unsaturated monocarboxylic acid; cyclohexenecarboxylic acid; hydroxy monocarboxylic acid	Escherichia coli metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
dimethyldodecylbenzylammonium dimethyldodecylbenzylammonium: RN given refers to parent cpd. benzododecinium : A quaternary ammonium ion obtained by methylation of N-benzyl-N-methyldodecan-1-amine.	1.97	1	0	quaternary ammonium ion
aluminum acetate [no description available]	3.34	1	1
benzathine benzathine: RN given refers to parent cpd with specified locants for phenylmethyl groups; structure	1.94	1	0	diamine
sterogenol hexadecylpyridinium bromide: structure in first source. cetylpyridinium bromide : A pyridinium salt that has N-hexadecylpyridinium as the cation and bromide as the anion.	2.06	1	0	bromide salt; pyridinium salt	antiseptic drug; EC 2.7.11.18 (myosin-light-chain kinase) inhibitor; surfactant
tetraphenylborate Tetraphenylborate: An anionic compound that is used as a reagent for determination of potassium, ammonium, rubidium, and cesium ions. It also uncouples oxidative phosphorylation and forms complexes with biological materials, and is used in biological assays.	2.15	1	0
anileridine anileridine: minor descriptor (64-86); on line & INDEX MEDICUS search ISONIPECOTIC ACIDS (68-86); RN given refers to parent cpd. anileridine : A piperidinecarboxylate ester that is the ethyl ester of isonipecotic acid in which the hydrogen alpha- to the carboxyl group is substituted by a phenyl group, and the hydrogen attached to the nitrogen is substituted by a 2-(4-aminophenyl)ethyl group.	2.04	1	0	ethyl ester; piperidinecarboxylate ester; substituted aniline	opioid analgesic; opioid receptor agonist
yohimbine Yohimbine: A plant alkaloid with alpha-2-adrenergic blocking activity. Yohimbine has been used as a mydriatic and in the treatment of ERECTILE DYSFUNCTION.. yohimbine : An indole alkaloid with alpha2-adrenoceptor antagonist activity. It is produced by Corynanthe johimbe and Rauwolfia serpentina.	2.91	4	0	methyl 17-hydroxy-20xi-yohimban-16-carboxylate	alpha-adrenergic antagonist; dopamine receptor D2 antagonist; serotonergic antagonist
nafcillin Nafcillin: A semi-synthetic antibiotic related to penicillin.. nafcillin : A penicillin in which the substituent at position 6 of the penam ring is a (2-ethoxy-1-naphthoyl)amino group.	3.2	6	0	penicillin allergen; penicillin	antibacterial drug
ditiocarb Ditiocarb: A chelating agent that has been used to mobilize toxic metals from the tissues of humans and experimental animals. It is the main metabolite of DISULFIRAM.. diethyldithiocarbamic acid : A member of the class of dithiocarbamic acids that is diethylcarbamic acid in which both of the oxygens are replaced by sulfur.	2.42	2	0	dithiocarbamic acids	chelator; copper chelator
mequinol mequinol: depigmenting agent; RN given refers to parent cpd	2.05	1	0	methoxybenzenes; phenols	metabolite
potassium cyanide [no description available]	1.93	1	0	cyanide salt; one-carbon compound; potassium salt	EC 1.15.1.1 (superoxide dismutase) inhibitor; EC 1.9.3.1 (cytochrome c oxidase) inhibitor; neurotoxin
quinestrol Quinestrol: The 3-cyclopentyl ether of ETHINYL ESTRADIOL. After gastrointestinal absorption, it is stored in ADIPOSE TISSUE, slowly released, and metabolized principally to the parent compound. It has been used in ESTROGEN REPLACEMENT THERAPY. (From AMA Drug Evaluations Annual, 1992, p1011)	2.05	1	0	17-hydroxy steroid; terminal acetylenic compound	xenoestrogen
sulfalene Sulfalene: Long-acting plasma-bound sulfonamide used for respiratory and urinary tract infections and also for malaria.	2.04	1	0	pyrazines; sulfonamide antibiotic; sulfonamide
dydrogesterone [no description available]	2.05	1	0	20-oxo steroid; 3-oxo-Delta(4) steroid	progestin
catechin Catechin: An antioxidant flavonoid, occurring especially in woody plants as both (+)-catechin and (-)-epicatechin (cis) forms.. catechin : Members of the class of hydroxyflavan that have a flavan-3-ol skeleton and its substituted derivatives.. rac-catechin : A racemate comprising equimolar amounts of (+)- and (-)-catechin. (+)-catechin : The (+)-enantiomer of catechin and a polyphenolic antioxidant plant metabolite.	2.4	2	0	catechin	antioxidant; plant metabolite
homoarginine L-homoarginine : An L-lysine derivative that is the L-enantiomer of homoarginine.	1.97	1	0	homoarginine; L-lysine derivative; non-proteinogenic L-alpha-amino acid	biomarker; EC 3.1.3.1 (alkaline phosphatase) inhibitor; human metabolite; rat metabolite; xenobiotic metabolite
perylene Perylene: A 20-carbon dibenz(de,kl)anthracene that can be viewed as a naphthalene fused to a phenalene or as dinaphthalene. It is used as fluorescent lipid probe in the cytochemistry of membranes and is a polycyclic hydrocarbon pollutant in soil and water. Derivatives may be carcinogenic.. perylene : An ortho- and peri-fused polycyclic arene comprising of five benzene rings that is anthracene in which the d,e and k,l sides are fused to benzene rings.	2.51	2	0	ortho- and peri-fused polycyclic arene; perylenes
quinazolines Quinazolines: A group of aromatic heterocyclic compounds that contain a bicyclic structure with two fused six-membered aromatic rings, a benzene ring and a pyrimidine ring.. quinazoline : A mancude organic heterobicyclic parent that is naphthalene in which the carbon atoms at positions 1 and 3 have been replaced by nitrogen atoms.. quinazolines : Any organic heterobicyclic compound based on a quinazoline skeleton and its substituted derivatives.	2.45	2	0	azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; quinazolines
acridines Acridines: Compounds that include the structure of acridine.. acridine : A polycyclic heteroarene that is anthracene in which one of the central CH groups is replaced by a nitrogen atom.	6.78	20	1	acridines; mancude organic heterotricyclic parent; polycyclic heteroarene	genotoxin
indazoles Indazoles: A group of heterocyclic aromatic organic compounds consisting of the fusion of BENZENE and PYRAZOLES.	4.98	2	1	indazole
adamantane Adamantane: A tricyclo bridged hydrocarbon.	1.98	1	0	adamantanes; polycyclic alkane
cyclopentane Cyclopentanes: A group of alicyclic hydrocarbons with the general formula R-C5H9.. cyclopentanes : Cyclopentane and its derivatives formed by substitution.	2.39	2	0	cycloalkane; cyclopentanes; volatile organic compound	non-polar solvent
isoxazoles Isoxazoles: Azoles with an OXYGEN and a NITROGEN next to each other at the 1,2 positions, in contrast to OXAZOLES that have nitrogens at the 1,3 positions.. isoxazole : A monocyclic heteroarene with a structure consisting of a 5-membered ring containing three carbon atoms and an oxygen and nitrogen atom adjacent to each other. It is the parent of the class of isoxazoles.. isoxazoles : Oxazoles in which the N and O atoms are adjacent.	1.97	1	0	isoxazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene
oxazoles Oxazoles: Five-membered heterocyclic ring structures containing an oxygen in the 1-position and a nitrogen in the 3-position, in distinction from ISOXAZOLES where they are at the 1,2 positions.. 1,3-oxazole : A five-membered monocyclic heteroarene that is an analogue of cyclopentadiene with O in place of CH2 at position 1 and N in place of CH at position 3.. oxazole : An azole based on a five-membered heterocyclic aromatic skeleton containing one N and one O atom.	3.58	9	0	1,3-oxazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene
thiazoles [no description available]	6.42	13	1	1,3-thiazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene
pyrazines Pyrazines: A heterocyclic aromatic organic compound with the chemical formula C4H4N2.. pyrazine : A diazine that is benzene in which the carbon atoms at positions 1 and 4 have been replaced by nitrogen atoms.	1.94	1	0	diazine; pyrazines	Daphnia magna metabolite
propantheline bromide [no description available]	2.04	1	0	xanthenes
triphenyltetrazolium triphenyltetrazolium: RN given refers to parent cpd. 2,3,5-triphenyltetrazolium : An organic cation that is tetrazole carrying three phenyl substituents at positions 2, 3 and 5.	2.1	1	0	organic cation
calcium gluconate [no description available]	3.05	1	0	calcium salt	nutraceutical
ephedrine Ephedrine: A phenethylamine found in EPHEDRA SINICA. PSEUDOEPHEDRINE is an isomer. It is an alpha- and beta-adrenergic agonist that may also enhance release of norepinephrine. It has been used for asthma, heart failure, rhinitis, and urinary incontinence, and for its central nervous system stimulatory effects in the treatment of narcolepsy and depression. It has become less extensively used with the advent of more selective agonists.. (-)-ephedrine : A phenethylamine alkaloid that is 2-phenylethanamine substituted by a methyl group at the amino nitrogen and a methyl and a hydroxy group at position 2 and 1 respectively.	3.98	4	0	phenethylamine alkaloid; phenylethanolamines	bacterial metabolite; environmental contaminant; nasal decongestant; plant metabolite; sympathomimetic agent; vasoconstrictor agent; xenobiotic
muscarine Muscarine: A toxic alkaloid found in Amanita muscaria (fly fungus) and other fungi of the Inocybe species. It is the first parasympathomimetic substance ever studied and causes profound parasympathetic activation that may end in convulsions and death. The specific antidote is atropine.	2.9	4	0	monosaccharide
hydrazine diamine : Any polyamine that contains two amino groups.	5.4	4	1	azane; hydrazines	EC 4.3.1.10 (serine-sulfate ammonia-lyase) inhibitor
chlormadinone acetate Chlormadinone Acetate: An orally active synthetic progestational hormone used often in combinations as an oral contraceptive (CONTRACEPTIVES, ORAL).	2.45	2	0	corticosteroid hormone
edrophonium bromide [no description available]	2.06	1	0
norchlorcyclizine norchlorcyclizine: RN given refers to parent cpd	2.04	1	0
2,3-dimercaptosuccinic acid [no description available]	2.05	1	0
paraoxon [no description available]	1.98	1	0	aryl dialkyl phosphate; organophosphate insecticide	EC 3.1.1.7 (acetylcholinesterase) inhibitor; mouse metabolite
dexamethasone 21-phosphate dexamethasone 21-phosphate: has anti-inflammatory activity. dexamethasone phosphate : A steroid phosphate that is the 21-O-phospho derivative of dexamethasone.	4.59	6	1	11beta-hydroxy steroid; 17-hydroxy steroid; 3-oxo-Delta(4) steroid; fluorinated steroid; steroid phosphate; tertiary alpha-hydroxy ketone	glucocorticoid receptor agonist
evans blue Evans Blue: An azo dye used in blood volume and cardiac output measurement by the dye dilution method. It is very soluble, strongly bound to plasma albumin, and disappears very slowly.. Evans blue : An organic sodium salt that is the tetrasodium salt of 6,6'-{(3,3'-dimethyl[1,1'-biphenyl]-4,4'-diyl)bis[diazene-2,1-diyl]}bis(4-amino-5-hydroxynaphthalene-1,3-disulfonate). It is sometimes used as a counterstain, especially in fluorescent methods to suppress background autofluorescence.	2.45	2	0	organic sodium salt	fluorochrome; histological dye; sodium channel blocker; teratogenic agent
testosterone enanthate [no description available]	2.05	1	0	heptanoate ester; sterol ester	androgen
opipramol Opipramol: A tricyclic antidepressant with actions similar to AMITRIPTYLINE.	2.04	1	0	dibenzoazepine
aminophylline Aminophylline: A drug combination that contains THEOPHYLLINE and ethylenediamine. It is more soluble in water than theophylline but has similar pharmacologic actions. It's most common use is in bronchial asthma, but it has been investigated for several other applications.. aminophylline : A mixture comprising of theophylline and ethylenediamine in a 2:1 ratio.	2.68	3	0	mixture	bronchodilator agent; cardiotonic drug
azacitidine Azacitidine: A pyrimidine analogue that inhibits DNA methyltransferase, impairing DNA methylation. It is also an antimetabolite of cytidine, incorporated primarily into RNA. Azacytidine has been used as an antineoplastic agent.. 5-azacytidine : An N-glycosyl-1,3,5-triazine that is 4-amino-1,3,5-triazin-2(1H)-one substituted by a beta-D-ribofuranosyl residue via an N-glycosidic linkage. An antineoplastic agent, it is used in the treatment of myeloid leukaemia.	2.69	3	0	N-glycosyl-1,3,5-triazine; nucleoside analogue	antineoplastic agent
phenyramidol phenyramidol: considered as a drug that possibly causes hepatotoxicity	2.05	1	0	aminopyridine
nicarbazin Nicarbazin: An equimolar complex of 4,4'-Dinitrocarbanilide and 2-Hydroxy-4,6-dimethylpyrimidine. A coccidiostat for poultry.	1.95	1	0	organic molecular entity
carbutamide Carbutamide: A sulfonylurea antidiabetic agent with similar actions and uses to CHLORPROPAMIDE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p277)	2.45	2	0	benzenes; sulfonamide
glymidine glymidine: was MH 1975-92 (see under SULFONAMIDES 1975-90); GLIDIAZINE & GLYCODIAZINE were see GLYMIDINE 1975-92; use SULFONAMIDES to search GLYMIDINE 1975-92; a sulfonamide hypoglycemic agent which stimulates insulin secretion. glymidine : A sulfonamide that is N-(pyrimidin-2-yl)benzenesulfonamide which is substituted at position 5 of the pyrimidine ring by a 2-methoxyethoxy group. It is a hypoglycemic drug used for the treatment of diabetes mellitus.	2.04	1	0	diether; pyrimidines; sulfonamide	hypoglycemic agent
fluocinonide Fluocinonide: A topical glucocorticoid used in the treatment of ECZEMA.	3.74	2	1	organic molecular entity
galantamine Galantamine: A benzazepine derived from norbelladine. It is found in GALANTHUS and other AMARYLLIDACEAE. It is a cholinesterase inhibitor that has been used to reverse the muscular effects of GALLAMINE TRIETHIODIDE and TUBOCURARINE and has been studied as a treatment for ALZHEIMER DISEASE and other central nervous system disorders.. galanthamine : A benzazepine alkaloid isolated from certain species of daffodils.	2.05	1	0	benzazepine alkaloid fundamental parent; benzazepine alkaloid; organic heterotetracyclic compound; tertiary amino compound	antidote to curare poisoning; cholinergic drug; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; plant metabolite
nandrolone decanoate Nandrolone Decanoate: Decanoic acid ester of nandrolone that is used as an anabolic agent to prevent or treat WASTING SYNDROME associated with severe chronic illness or HIV infection (HIV WASTING SYNDROME). It may also be used in the treatment of POSTMENOPAUSAL OSTEOPOROSIS.	2.05	1	0	steroid ester
bucladesine [no description available]	2.05	1	0	3',5'-cyclic purine nucleotide; butanamides; butyrate ester	agonist; cardiotonic drug; vasodilator agent
N-[(2-chlorophenyl)methyl]-1-[4-[[(2-chlorophenyl)methylamino]methyl]cyclohexyl]methanamine [no description available]	2.04	1	0	aromatic amine
citrulline citrulline : The parent compound of the citrulline class consisting of ornithine having a carbamoyl group at the N(5)-position.	2.88	4	0	amino acid zwitterion; citrulline	Daphnia magna metabolite; EC 1.14.13.39 (nitric oxide synthase) inhibitor; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; protective agent; Saccharomyces cerevisiae metabolite
betamethasone Betamethasone: A glucocorticoid given orally, parenterally, by local injection, by inhalation, or applied topically in the management of various disorders in which corticosteroids are indicated. Its lack of mineralocorticoid properties makes betamethasone particularly suitable for treating cerebral edema and congenital adrenal hyperplasia. (From Martindale, The Extra Pharmacopoeia, 30th ed, p724)	8.84	44	14	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; fluorinated steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	anti-asthmatic agent; anti-inflammatory drug; immunosuppressive agent
prenylamine Prenylamine: A drug formerly used in the treatment of angina pectoris but superseded by less hazardous drugs. Prenylamine depletes myocardial catecholamine stores and has some calcium channel blocking activity. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1406)	3.48	2	0	diarylmethane
perflubron perflubron: potential anti-obesity compound; reduces food adsorption; 8-carbon perfluorocarbon radiopaque compound; an oral contrast agent for use with MRI to enhance delineation of the bowel distinguishing it from adjacent organs. perflubron : A haloalkane that is perfluorooctane in which a fluorine attached to one of the terminal carbons has been replaced by a bromine.	2.05	1	0	haloalkane; organobromine compound; perfluorinated compound	blood substitute; radioopaque medium
fluorometholone Fluorometholone: A glucocorticoid employed, usually as eye drops, in the treatment of allergic and inflammatory conditions of the eye. It has also been used topically in the treatment of various skin disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p732). fluorometholone : A member of the class of glucocorticoids that is Delta(1)-progesterone substituted at positions 11beta and 17 by hydroxy groups, at position 6alpha by a methyl group and at position 9 by a fluoro group. Used for the treatment of corticosteroid-responsive inflammation of the palpebral and bulbar conjunctiva, cornea and anterior segment of the globe.	2.66	3	0	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(1),Delta(4)-steroid; fluorinated steroid; glucocorticoid; tertiary alpha-hydroxy ketone	anti-inflammatory drug
cyproterone acetate [no description available]	2.41	2	0	20-oxo steroid; 3-oxo-Delta(4) steroid; acetate ester; chlorinated steroid; steroid ester	androgen antagonist; geroprotector; progestin
lithocholic acid Lithocholic Acid: A bile acid formed from chenodeoxycholate by bacterial action, usually conjugated with glycine or taurine. It acts as a detergent to solubilize fats for absorption and is itself absorbed. It is used as cholagogue and choleretic.. lithocholic acid : A monohydroxy-5beta-cholanic acid with a alpha-hydroxy substituent at position 3. It is a bile acid obtained from chenodeoxycholic acid by bacterial action.. lithocholate : A bile acid anion that is the conjugate base of lithocholic acid.	2.65	3	0	bile acid; C24-steroid; monohydroxy-5beta-cholanic acid	geroprotector; human metabolite; mouse metabolite
nandrolone Nandrolone: C18 steroid with androgenic and anabolic properties. It is generally prepared from alkyl ethers of ESTRADIOL to resemble TESTOSTERONE but less one carbon at the 19 position.. nandrolone : A 3-oxo Delta(4)-steroid that is estr-4-en-3-one substituted by a beta-hydroxy group at position 17.	2.67	3	0	17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; anabolic androgenic steroid	human metabolite
thiazolidine-4-carboxylic acid thiazolidine-4-carboxylic acid: active against thimerosal intoxication; acts on cell membranes of tumor cells causing reverse transformation to normal cells; RN given refers to parent cpd	2.04	1	0	alpha-amino acid zwitterion; non-proteinogenic alpha-amino acid; sulfur-containing amino acid; thiazolidinemonocarboxylic acid	antidote; antioxidant; hepatoprotective agent
2-aminopurine 2-Aminopurine: A purine that is an isomer of ADENINE (6-aminopurine).. aminopurine : Any purine having at least one amino substituent.. 2-aminopurine : The parent compound of the 2-aminopurines, comprising a purine core carrying an amino substituent at the 2-position.	3.29	6	0	2-aminopurines; nucleobase analogue	antimetabolite
hydantoins Hydantoins: Compounds based on imidazolidine dione. Some derivatives are ANTICONVULSANTS.. imidazolidine-2,4-dione : An imidazolidinone with oxo groups at position 2 and 4.	5.53	5	1	imidazolidine-2,4-dione
chlorphentermine Chlorphentermine: A sympathomimetic agent that was formerly used as an anorectic. It has properties similar to those of DEXTROAMPHETAMINE. It has been implicated in lipid storage disorders and pulmonary hypertension. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1223)	2.04	1	0	amphetamines
homocystine [no description available]	2.36	2	0	amino acid zwitterion; homocystines	human metabolite
dextropropoxyphene Dextropropoxyphene: A narcotic analgesic structurally related to METHADONE. Only the dextro-isomer has an analgesic effect; the levo-isomer appears to exert an antitussive effect.. propoxyphene : A racemate of the (1R,2R)- and (1S,2R)- diastereoisomers.. dextropropoxyphene : The (1S,2R)-(+)-diastereoisomer of propoxyphene.	2.45	2	0	1-benzyl-3-(dimethylamino)-2-methyl-1-phenylpropyl propanoate	mu-opioid receptor agonist; opioid analgesic
glycyrrhetinic acid [no description available]	2.05	1	0	cyclic terpene ketone; hydroxy monocarboxylic acid; pentacyclic triterpenoid	immunomodulator; plant metabolite
chenodeoxycholic acid Chenodeoxycholic Acid: A bile acid, usually conjugated with either glycine or taurine. It acts as a detergent to solubilize fats for intestinal absorption and is reabsorbed by the small intestine. It is used as cholagogue, a choleretic laxative, and to prevent or dissolve gallstones.. chenodeoxycholic acid : A dihydroxy-5beta-cholanic acid that is (5beta)-cholan-24-oic acid substituted by hydroxy groups at positions 3 and 7 respectively.. chenodeoxycholate : Conjugate base of chenodeoxycholic acid; major species at pH 7.3.	2.88	4	0	bile acid; C24-steroid; dihydroxy-5beta-cholanic acid	human metabolite; mouse metabolite
glycocholic acid Glycocholic Acid: The glycine conjugate of CHOLIC ACID. It acts as a detergent to solubilize fats for absorption and is itself absorbed.. glycocholic acid : A bile acid glycine conjugate having cholic acid as the bile acid component.. glycocholate : A cholanic acid conjugate anion that is the conjugate base of glycocholic acid, obtained by deprotonation of the carboxy group; major species at pH 7.3.	1.95	1	0	bile acid glycine conjugate	human metabolite
fusarium Fusarium: A mitosporic Hypocreales fungal genus, various species of which are important parasitic pathogens of plants and a variety of vertebrates. Teleomorphs include GIBBERELLA.	2.46	2	0
lucanthone Lucanthone: One of the SCHISTOSOMICIDES, it has been replaced largely by HYCANTHONE and more recently PRAZIQUANTEL. (From Martindale The Extrapharmacopoeia, 30th ed., p46). lucanthone : A thioxanthen-9-one compound having a methyl substituent at the 1-position and a 2-[(diethylamino)ethyl]amino substituent at the 4-position. Formerly used for the treatment of schistosomiasis. It is a prodrug, being metabolised to hycanthone.	2.04	1	0	thioxanthenes	adjuvant; antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; mutagen; photosensitizing agent; prodrug; schistosomicide drug
dichloralantipyrine dichloralantipyrine: 1:2 compound of antipyrine with chloral hydrate	2.04	1	0
emetine Emetine: The principal alkaloid of ipecac, from the ground roots of Uragoga (or Cephaelis) ipecacuanha or U. acuminata, of the Rubiaceae. It is used as an amebicide in many different preparations and may cause serious cardiac, hepatic, or renal damage and violent diarrhea and vomiting. Emetine inhibits protein synthesis in EUKARYOTIC CELLS but not PROKARYOTIC CELLS.. emetine : A pyridoisoquinoline comprising emetam having methoxy substituents at the 6'-, 7'-, 10- and 11-positions. It is an antiprotozoal agent and emetic. It inhibits SARS-CoV2, Zika and Ebola virus replication and displays antimalarial, antineoplastic and antiamoebic properties.	2.67	3	0	isoquinoline alkaloid; pyridoisoquinoline	antiamoebic agent; anticoronaviral agent; antiinfective agent; antimalarial; antineoplastic agent; antiprotozoal drug; antiviral agent; autophagy inhibitor; emetic; expectorant; plant metabolite; protein synthesis inhibitor
dihydralazine Dihydralazine: 1,4-Dihydrazinophthalazine. An antihypertensive agent with actions and uses similar to those of HYDRALAZINE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p354)	2.45	2	0	phthalazines
reticulin Reticulin: A scleroprotein fibril consisting mostly of type III collagen. Reticulin fibrils are extremely thin, with a diameter of between 0.5 and 2 um. They are involved in maintaining the structural integrity in a variety of organs.	2	1	0	benzylisoquinoline alkaloid; benzyltetrahydroisoquinoline; isoquinolinol	plant metabolite
ninhydrin Ninhydrin: 2,2-Dihydroxy-1H-indene-1,3-(2H)-dione. Reagent toxic to skin and mucus membranes. It is used in chemical assay for peptide bonds, i.e., protein determinations and has radiosensitizing properties.. ninhydrin : A member of the class of indanones that is indane-1,3-dione bearing two additional hydroxy substituents at position 2.	2.11	1	0	aromatic ketone; beta-diketone; indanones; ketone hydrate	colour indicator; human metabolite
bicuculline Bicuculline: An isoquinoline alkaloid obtained from Dicentra cucullaria and other plants. It is a competitive antagonist for GABA-A receptors.. bicuculline : A benzylisoquinoline alkaloid that is 6-methyl-5,6,7,8-tetrahydro[1,3]dioxolo[4,5-g]isoquinoline which is substituted at the 5-pro-S position by a (6R)-8-oxo-6,8-dihydrofuro[3,4-e][1,3]benzodioxol-6-yl group. A light-sensitive competitive antagonist of GABAA receptors. It was originally identified in 1932 in plant alkaloid extracts and has been isolated from Dicentra cucullaria, Adlumia fungosa, Fumariaceae, and several Corydalis species.	2.39	2	0	benzylisoquinoline alkaloid; isoquinoline alkaloid; isoquinolines	agrochemical; central nervous system stimulant; GABA-gated chloride channel antagonist; GABAA receptor antagonist; neurotoxin
kainic acid Kainic Acid: (2S-(2 alpha,3 beta,4 beta))-2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic acid. Ascaricide obtained from the red alga Digenea simplex. It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose.	2.69	3	0	dicarboxylic acid; L-proline derivative; non-proteinogenic L-alpha-amino acid; pyrrolidinecarboxylic acid	antinematodal drug; excitatory amino acid agonist
phenylpropanolamine Phenylpropanolamine: A sympathomimetic that acts mainly by causing release of NOREPINEPHRINE but also has direct agonist activity at some adrenergic receptors. It is most commonly used as a nasal vasoconstrictor and an appetite depressant.. phenylpropanolamine : An amphetamine in which the parent 1-phenylpropan-2-amine skeleton is substituted at position 1 with an hydroxy group. A decongestant and appetite suppressant, it is commonly used in prescription and over-the-counter cough and cold preparations.. (-)-norephedrine : An amphetamine that is propylbenzene substituted by a hydroxy group at position 1 and by an amino group at position 2 (the 1R,2S-stereoisomer). It is a plant alkaloid.	2.05	1	0	amphetamines; phenethylamine alkaloid	plant metabolite
alpha-aminopyridine alpha-aminopyridine: RN given refers to parent cpd; structure in Merck Index, 9th ed, #485. aminopyridine : Compounds containing a pyridine skeleton substituted by one or more amine groups.	2.66	3	0
thiazolidines Thiazolidines: Reduced (protonated) form of THIAZOLES. They can be oxidized to THIAZOLIDINEDIONES.	2.47	2	0	thiazolidine
mustard gas Mustard Gas: Severe irritant and vesicant of skin, eyes, and lungs. It may cause blindness and lethal lung edema and was formerly used as a war gas. The substance has been proposed as a cytostatic and for treatment of psoriasis. It has been listed as a known carcinogen in the Fourth Annual Report on Carcinogens (NTP-85-002, 1985) (Merck, 11th ed).. bis(2-chloroethyl) sulfide : An ethyl sulfide that is diethyl sulfide in which a hydrogen from each of the terminal methyl groups is replaced by a chlorine. It is a powerful vesicant regulated under the Chemical Weapons Convention.	2.46	2	0	ethyl sulfide; organochlorine compound	alkylating agent; carcinogenic agent; vesicant
oleanolic acid [no description available]	2.17	1	0	hydroxy monocarboxylic acid; pentacyclic triterpenoid	plant metabolite
dihydroergotamine Dihydroergotamine: A 9,10alpha-dihydro derivative of ERGOTAMINE. It is used as a vasoconstrictor, specifically for the therapy of MIGRAINE DISORDERS.. dihydroergotamine : Ergotamine in which a single bond replaces the double bond between positions 9 and 10. A semisynthetic ergot alkaloid with weaker oxytocic and vasoconstrictor properties than ergotamine, it is used (as the methanesulfonic or tartaric acid salts) for the treatment of migraine and orthostatic hypotension.	2.75	3	0	ergot alkaloid; semisynthetic derivative	dopamine agonist; non-narcotic analgesic; serotonergic agonist; sympatholytic agent; vasoconstrictor agent
methallenestril methallenestril: RN given refers to parent cpd	2.04	1	0	naphthalenes
podophyllotoxin Podophyllum: A genus of poisonous American herbs, family BERBERIDACEAE. The roots yield PODOPHYLLOTOXIN and other pharmacologically important agents. The plant was formerly used as a cholagogue and cathartic. It is different from the European mandrake, MANDRAGORA.	2.05	1	0	furonaphthodioxole; lignan; organic heterotetracyclic compound	antimitotic; antineoplastic agent; keratolytic drug; microtubule-destabilising agent; plant metabolite; tubulin modulator
hesperidin Hesperidin: A flavanone glycoside found in CITRUS fruit peels.. hesperidin : A disaccharide derivative that consists of hesperetin substituted by a 6-O-(alpha-L-rhamnopyranosyl)-beta-D-glucopyranosyl moiety at position 7 via a glycosidic linkage.	2.05	1	0	3'-hydroxyflavanones; 4'-methoxyflavanones; dihydroxyflavanone; disaccharide derivative; flavanone glycoside; monomethoxyflavanone; rutinoside	mutagen
medroxyprogesterone [no description available]	1.95	1	0	17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(4) steroid; tertiary alpha-hydroxy ketone	contraceptive drug; progestin; synthetic oral contraceptive
androstenediol Androstenediol: An intermediate in TESTOSTERONE biosynthesis, found in the TESTIS or the ADRENAL GLANDS. Androstenediol, derived from DEHYDROEPIANDROSTERONE by the reduction of the 17-keto group (17-HYDROXYSTEROID DEHYDROGENASES), is converted to TESTOSTERONE by the oxidation of the 3-beta hydroxyl group to a 3-keto group (3-HYDROXYSTEROID DEHYDROGENASES).. androst-5-ene-3beta,17beta-diol : A 3beta-hydroxy-Delta(5)-steroid that is 3beta-hydroxyandrost-5-ene carrying an additional hydroxy group at position 17beta.	2.04	1	0	17beta-hydroxy steroid; 3beta-hydroxy-Delta(5)-steroid	androgen; human metabolite; mouse metabolite; radiation protective agent
luminol Luminol: 5-Amino-2,3-dihydro-1,4-phthalazinedione. Substance that emits light on oxidation. It is used in chemical determinations.	2.45	2	0
dimenhydrinate gravinol: has antioxidant and ant-inflammatory activities; structure in first source	1.94	1	0	diarylmethane
copper gluconate Gluconates: Derivatives of gluconic acid (the structural formula HOCH2(CHOH)4COOH), including its salts and esters.	1.94	1	0	organic molecular entity
azomycin azomycin: RN given refers to parent cpd with specified locant; structure	5.16	6	2	C-nitro compound; imidazoles	antitubercular agent
herniarin herniarin: methoxy analog of umbelliferone; structure. herniarin : A member of the class of coumarins that is coumarin substituted by a methoxy group at position 7.	1.94	1	0	coumarins	fluorochrome
chlormethiazole Chlormethiazole: A sedative and anticonvulsant often used in the treatment of alcohol withdrawal. Chlormethiazole has also been proposed as a neuroprotective agent. The mechanism of its therapeutic activity is not entirely clear, but it does potentiate GAMMA-AMINOBUTYRIC ACID receptors response and it may also affect glycine receptors.	2.05	1	0	thiazoles
tropolone Tropolone: A seven-membered aromatic ring compound. It is structurally related to a number of naturally occurring antifungal compounds (ANTIFUNGAL AGENTS).. tropolone : A cyclic ketone that is cyclohepta-2,4,6-trien-1-one substituted by a hydroxy group at position 2. It is a toxin produced by the agricultural pathogen Burkholderia plantarii.	2.02	1	0	alpha-hydroxy ketone; cyclic ketone; enol	bacterial metabolite; fungicide; toxin
pyrithiamine Pyrithiamine: A thiamine antagonist due to its inhibition of thiamine pyrophosphorylation. It is used to produce thiamine deficiency.. pyrithiamine : A pyridinium ion that is 3-(2-hydroxyethyl)-2-methylpyridine substituted at position 1 by a (4-amino-2-methylpyrimidin-5-yl)methyl group.	2.33	2	0
methamphetamine Methamphetamine: A central nervous system stimulant and sympathomimetic with actions and uses similar to DEXTROAMPHETAMINE. The smokable form is a drug of abuse and is referred to as crank, crystal, crystal meth, ice, and speed.. methamphetamine : A member of the class of amphetamines in which the amino group of (S)-amphetamine carries a methyl substituent.	2.41	2	0	amphetamines; secondary amine	central nervous system stimulant; environmental contaminant; neurotoxin; psychotropic drug; xenobiotic
dicyclohexylcarbodiimide 1,3-dicyclohexylcarbodiimide : A carbodiimide compound having a cyclohexyl substituent on both nitrogen atoms.	2.37	2	0	carbodiimide	ATP synthase inhibitor; cross-linking reagent; peptide coupling reagent
levocarnitine (R)-carnitine : The (R)-enantiomer of carnitine.	2.46	2	0	carnitine	antilipemic drug; nootropic agent; nutraceutical; Saccharomyces cerevisiae metabolite; water-soluble vitamin (role)
decamethonium dibromide [no description available]	2.04	1	0
malondialdehyde Malondialdehyde: The dialdehyde of malonic acid.. malonaldehyde : A dialdehyde that is propane substituted by two oxo groups at the terminal carbon atoms respectively. A biomarker of oxidative damage to lipids caused by smoking, it exists in vivo mainly in the enol form.	1.98	1	0	dialdehyde	biomarker
sulfanilylurea sulfanilylurea: antimicrobial agent; structure	2.37	2	0	benzenes; sulfonamide
gentian violet Gentian Violet: A dye that is a mixture of violet rosanilinis with antibacterial, antifungal, and anthelmintic properties.. crystal violet : An organic chloride salt that is the monochloride salt of crystal violet cation. It has been used in creams for the topical treatment of bacterial and fungal infections, being effective against some Gram-positive bacteria (notably Staphylococcus species) and some pathogenic fungi (including Candida species) but use declined following reports of animal carcinogenicity. It has also been used for dying wood, silk, and paper, as well as a histological stain.	4.85	11	0	organic chloride salt	anthelminthic drug; antibacterial agent; antifungal agent; antiseptic drug; histological dye
thiphenamil thiphenamil: RN given refers to parent cpd; structure	2.04	1	0	diarylmethane
1-naphthylisothiocyanate 1-Naphthylisothiocyanate: A tool for the study of liver damage which causes bile stasis and hyperbilirubinemia acutely and bile duct hyperplasia and biliary cirrhosis chronically, with changes in hepatocyte function. It may cause skin and kidney damage.	2.4	2	0	isothiocyanate	insecticide
aminopenicillanic acid aminopenicillanic acid: RN given refers to parent cpd; structure. 6-aminopenicillanic acid : A penicillanic acid compound having a (6R)-amino substituent. The active nucleus common to all penicillins, it may be substituted at the 6-amino position to form the semisynthetic penicillins, resulting in a variety of antibacterial and pharmacologic characteristics.	1.93	1	0	amino acid zwitterion; penicillanic acids	allergen
hematoporphyrin Hematoporphyrins: Iron-free derivatives of heme with 4 methyl groups, 2 hydroxyethyl groups and 2 propionic acid groups attached to the pyrrole rings. Some of these PHOTOSENSITIZING AGENTS are used in the PHOTOTHERAPY of malignant NEOPLASMS.. hematoporphyrin : A dicarboxylic acid that is protoporphyrin in which the vinyl groups at positions 7 and 12 are replaced by 1-hydroxyethyl groups.	2.05	1	0
neutral red Neutral Red: A vital dye used as an indicator and biological stain. Various adverse effects have been observed in biological systems.. neutral red : A hydrochloride obtained by combining the free base of neutral red with one equivalent of hydrochloric acid. Neutral red acts as a pH indicator, changing from red to yellow between pH 6.8 and 8.0.	1.97	1	0	hydrochloride	acid-base indicator; dye; two-colour indicator
lithium carbonate Lithium Carbonate: A lithium salt, classified as a mood-stabilizing agent. Lithium ion alters the metabolism of BIOGENIC MONOAMINES in the CENTRAL NERVOUS SYSTEM, and affects multiple neurotransmission systems.	2.02	1	0	carbonate salt; lithium salt	antimanic drug
methanesulfonyl fluoride methanesulfonyl fluoride: structure	1.97	1	0
metahexamide metahexamide: major descriptor (64-83); on-line search SULFONYLUREA COMPOUNDS (64-83); Index Medicus search METAHEXAMIDE (64-83); RN given refers to parent cpd; structure	2.04	1	0	benzenes; sulfonamide
phenindamine phenindamine: RN given refers to parent cpd; structure	2.04	1	0	indene
malachite green malachite green: RN given refers to parent cpd; structure. malachite green : An organic chloride salt that is the monochloride salt of malachite green cation. Used as a green-coloured dye, as a counter-stain in histology, and for its anti-fungal properties in aquaculture.	2.02	1	0	organic chloride salt	antibacterial agent; antifungal drug; carcinogenic agent; environmental contaminant; fluorochrome; histological dye; teratogenic agent
congo red Congo Red: An acid dye used in testing for hydrochloric acid in gastric contents. It is also used histologically to test for AMYLOIDOSIS.. Congo Red : An indicator dye that is blue-violet at pH 3.0 and red at pH 5.0.	2.41	1	0	bis(azo) compound
lactulose [no description available]	2.97	4	0	glycosylfructose	gastrointestinal drug; laxative
1,2-Dihydroquinolin-2-imine [no description available]	2.05	1	0	aminoquinoline
isovalerylaldehyde isovalerylaldehyde: structure in Merck Index, 9th ed, #5093. 3-methylbutanal : A methylbutanal that is butanal substituted by a methyl group at position 3. It occurs as a volatile constituent in olives.	2.36	2	0	methylbutanal	flavouring agent; plant metabolite; Saccharomyces cerevisiae metabolite; volatile oil component
megestrol acetate [no description available]	2.05	1	0	20-oxo steroid; 3-oxo-Delta(4) steroid; acetate ester; steroid ester	antineoplastic agent; appetite enhancer; contraceptive drug; progestin; synthetic oral contraceptive
glycopyrrolate Glycopyrrolate: A muscarinic antagonist used as an antispasmodic, in some disorders of the gastrointestinal tract, and to reduce salivation with some anesthetics.. glycopyrronium bromide : A quaternary ammonium salt composed of 3-{[cyclopentyl(hydroxy)phenylacetyl]oxy}-1,1-dimethylpyrrolidin-1-ium and bromide ions in a 1:1 ratio.	1.99	1	0	organic bromide salt; quaternary ammonium salt
2-amino-2-methyl-1-propanol 2-amino-2-methyl-1-propanol: RN given refers to parent cpd	2.04	1	0
dibrompropamidine [no description available]	1.97	1	0	aromatic ether
acetylcysteine N-acetyl-L-cysteine : An N-acetyl-L-amino acid that is the N-acetylated derivative of the natural amino acid L-cysteine.	3.59	9	0	acetylcysteine; L-cysteine derivative; N-acetyl-L-amino acid	antidote to paracetamol poisoning; antiinfective agent; antioxidant; antiviral drug; ferroptosis inhibitor; geroprotector; human metabolite; mucolytic; radical scavenger; vulnerary
amyl acetate amyl acetate: sources do not specify n-isomer. pentyl acetate : An acetate ester of pentanol.	2.02	1	0	acetate ester	metabolite
c.i. 42510 Rosaniline Dyes: Compounds that contain the triphenylmethane aniline structure found in rosaniline. Many of them have a characteristic magenta color and are used as COLORING AGENTS.. basic fuchsin : A four-component mixture of chemically related dyes comprising pararosanilin, rosanilin, magenta II and new fuchsin in varying amounts. rosanilin : A hydrochloride that is the monohydrochloride of 4-[(4-aminophenyl)(4-iminocyclohexa-2,5-dien-1-ylidene)methyl]-2-methylaniline. One of the major constituents of Basic fuchsin, together with pararosanilin, magenta II and new fuchsin.	3.58	3	0
phendimetrazine phendimetrazine: minor descriptor (66-86); file maintained to MORPHOLINES (66-86); on-line & INDEX MEDICUS search MORPHOLINES (66-86); RN given refers to parent cpd without isomeric designation	2.04	1	0
trimetozine [no description available]	2.04	1	0	morpholines
benzydamine Benzydamine: A benzyl-indazole having analgesic, antipyretic, and anti-inflammatory effects. It is used to reduce post-surgical and post-traumatic pain and edema and to promote healing. It is also used topically in treatment of RHEUMATIC DISEASES and INFLAMMATION of the mouth and throat.. benzydamine : A member of the class of indazoles carrying benzyl and 3-(dimethylamino)propyl groups at positions 1 and 3 respectively. A locally-acting nonsteroidal anti-inflammatory drug that also exhibits local anaesthetic and analgesic properties.	2.06	1	0	aromatic ether; indazoles; tertiary amino compound	analgesic; central nervous system stimulant; hallucinogen; local anaesthetic; non-steroidal anti-inflammatory drug
erythromycin stearate [no description available]	2.05	1	0	aminoglycoside
erythromycin Erythromycin: A bacteriostatic antibiotic macrolide produced by Streptomyces erythreus. Erythromycin A is considered its major active component. In sensitive organisms, it inhibits protein synthesis by binding to 50S ribosomal subunits. This binding process inhibits peptidyl transferase activity and interferes with translocation of amino acids during translation and assembly of proteins.. erythromycin : Any of several wide-spectrum macrolide antibiotics obtained from actinomycete Saccharopolyspora erythraea (formerly known as Streptomyces erythraeus).. erythromycin A : An erythromycin that consists of erythronolide A having 2,6-dideoxy-3-C-methyl-3-O-methyl-alpha-L-ribo-hexopyranosyl and 3,4,6-trideoxy-3-(dimethylamino)-beta-D-xylo-hexopyranosyl residues attahced at positions 4 and 6 respectively.	17.68	409	35	cyclic ketone; erythromycin
formal glycol [no description available]	1.99	1	0	cyclic acetal; dioxolane
isosorbide Isosorbide: 1,4:3,6-Dianhydro D-glucitol. Chemically inert osmotic diuretic used mainly to treat hydrocephalus; also used in glaucoma.	2.06	1	0	organic molecular entity
butaperazine butaperazine: was heading 1964-94 (Prov 1964-73); use PHENOTHIAZINES to search BUTAPERAZINE 1966-94	2.04	1	0	phenothiazines
nitrosoguanidines Nitrosoguanidines: Nitrosylated derivatives of guanidine. They are used as MUTAGENS in MOLECULAR BIOLOGY research.	2.86	4	0
2-piperidone 2-piperidone: structure given in first source. piperidin-2-one : A delta-lactam that is piperidine which is substituted by an oxo group at position 2.	2.36	2	0	delta-lactam; piperidones	EC 1.2.1.88 (L-glutamate gamma-semialdehyde dehydrogenase) inhibitor
diphenyliodonium diphenyliodonium: RN given refers to the parent coumpound; inhibitor of neutrophil superoxide generating oxidase; structure has been determined	1.96	1	0
levonorgestrel Levonorgestrel: A synthetic progestational hormone with actions similar to those of PROGESTERONE and about twice as potent as its racemic or (+-)-isomer (NORGESTREL). It is used for contraception, control of menstrual disorders, and treatment of endometriosis.	5.01	2	1	17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; terminal acetylenic compound	contraceptive drug; female contraceptive drug; progestin; synthetic oral contraceptive
lormetazepam lormetazepam: RN given refers to cpd with specified locant for methyl group; structure given in first source. lormetazepam : A 1,4-benzodiazepinone compound having a methyl substituent at the 1-position, a hydroxy substituent at the 3-position, a 2-chlorophenyl group at the 5-position and a chloro substituent at the 7-position.	2.05	1	0	1,4-benzodiazepinone; organochlorine compound	sedative
vinblastine [no description available]	2.45	2	0
amaranth dye Amaranth Dye: A sulfonic acid-based naphthylazo dye used as a coloring agent for foodstuffs and medicines and as a dye and chemical indicator. It was banned by the FDA in 1976 for use in foods, drugs, and cosmetics. (From Merck Index, 11th ed)	2.15	1	0
oxolamine oxolamine: RN given refers to parent cpd; structure	2.04	1	0	oxadiazole; ring assembly
ethylestrenol Ethylestrenol: An anabolic steroid with some progestational activity and little androgenic effect.. ethylestrenol : A 17beta-hydroxy steroid that is estrane containing a double bond between positions 4 and 5 and substituted by an ethyl group and a hydroxy group at the 17alpha and 17beta positions, respectively. It is an anabolic steroid that has little androgenic effect and only slight progestational activity. It has been used to promote growth in boys with delayed bone growth.	2.04	1	0	17beta-hydroxy steroid; tertiary alcohol	anabolic agent
canrenone Canrenone: A synthetic pregnadiene compound with anti-aldosterone activity.	3.34	1	1	steroid lactone
estradiol valerate [no description available]	2.05	1	0	steroid ester
rhodamine 6g rhodamine 6G: RN given refers to HCl	2.11	1	0
deoxycytidine monophosphate Deoxycytidine Monophosphate: Deoxycytidine (dihydrogen phosphate). A deoxycytosine nucleotide containing one phosphate group esterified to the deoxyribose moiety in the 2'-,3'- or 5- positions.. 2'-deoxycytosine 5'-monophosphate : A pyrimidine 2'-deoxyribonucleoside 5'-monophosphate having cytosine as the nucleobase.	1.98	1	0	2'-deoxycytidine phosphate; pyrimidine 2'-deoxyribonucleoside 5'-monophosphate	Escherichia coli metabolite; mouse metabolite
ethambutol Ethambutol: An antitubercular agent that inhibits the transfer of mycolic acids into the cell wall of the tubercle bacillus. It may also inhibit the synthesis of spermidine in mycobacteria. The action is usually bactericidal, and the drug can penetrate human cell membranes to exert its lethal effect. (From Smith and Reynard, Textbook of Pharmacology, 1992, p863). ethambutol : An ethylenediamine derivative that is ethane-1,2-diamine in which one hydrogen attached to each of the nitrogens is sutstituted by a 1-hydroxybutan-2-yl group (S,S-configuration). It is a bacteriostatic antimycobacterial drug, effective against Mycobacterium tuberculosis and some other mycobacteria. It is used (as the dihydrochloride salt) in combination with other antituberculous drugs in the treatment of pulmonary and extrapulmonary tuberculosis; resistant strains of M. tuberculosis are readily produced if ethambutol is used alone.	3.68	10	0	ethanolamines; ethylenediamine derivative	antitubercular agent; environmental contaminant; xenobiotic
phenazocine Phenazocine: An opioid analgesic with actions and uses similar to MORPHINE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1095)	1.94	1	0
dehydroepiandrosterone acetate 3beta-acetoxyandrost-5-en-17-one: structure in first source	2.04	1	0	steroid ester
ethidium bromide [no description available]	2.46	2	0	organic bromide salt	geroprotector; intercalator; trypanocidal drug
calcium peroxide [no description available]	4.8	1	1	calcium oxides
cadmium sulfide [no description available]	2.5	2	0	cadmium molecular entity
manganese dioxide [no description available]	4.8	1	1	manganese molecular entity; metal oxide
zinc oxide Zinc Oxide: A mild astringent and topical protectant with some antiseptic action. It is also used in bandages, pastes, ointments, dental cements, and as a sunblock.	4.8	1	1	zinc molecular entity
thorium dioxide Thorium Dioxide: Thorium oxide (ThO2). A radiographic contrast agent that was used in the early 1930s through about 1954. High rates of mortality have been linked to its use and it has been shown to cause liver cancer.	2.34	2	0	thorium molecular entity
arsenic trioxide Arsenic Trioxide: An inorganic compound with the chemical formula As2O3 that is used for the treatment of ACUTE PROMYELOCYTIC LEUKEMIA in patients who have relapsed from, or are resistant to, conventional drug therapy.	2.05	1	0
antimycin a [no description available]	2.05	1	0	benzamides; formamides; macrodiolide; phenols	antifungal agent; mitochondrial respiratory-chain inhibitor; piscicide
vancomycin Vancomycin: Antibacterial obtained from Streptomyces orientalis. It is a glycopeptide related to RISTOCETIN that inhibits bacterial cell wall assembly and is toxic to kidneys and the inner ear.. vancomycin : A complex glycopeptide from Streptomyces orientalis. It inhibits a specific step in the synthesis of the peptidoglycan layer in the Gram-positive bacteria Staphylococcus aureus and Clostridium difficile.	11.29	87	2	glycopeptide	antibacterial drug; antimicrobial agent; bacterial metabolite
d-alpha tocopherol Vitamin E: A generic descriptor for all TOCOPHEROLS and TOCOTRIENOLS that exhibit ALPHA-TOCOPHEROL activity. By virtue of the phenolic hydrogen on the 2H-1-benzopyran-6-ol nucleus, these compounds exhibit varying degree of antioxidant activity, depending on the site and number of methyl groups and the type of ISOPRENOIDS.. tocopherol : A collective name for a group of closely related lipids that contain a chroman-6-ol nucleus substituted at position 2 by a methyl group and by a saturated hydrocarbon chain consisting of three isoprenoid units. They are designated as alpha-, beta-, gamma-, and delta-tocopherol depending on the number and position of additional methyl substituents on the aromatic ring. Tocopherols occur in vegetable oils and vegetable oil products, almost exclusively with R,R,R configuration. Tocotrienols differ from tocopherols only in having three double bonds in the hydrocarbon chain.. vitamin E : Any member of a group of fat-soluble chromanols that exhibit biological activity against vitamin E deficiency. The vitamers in this class consists of a chroman-6-ol core which is substituted at position 2 by a methyl group and (also at position 2) either a saturated or a triply-unsaturated hydrocarbon chain consisting of three isoprenoid units. The major function of vitamin E is to act as a natural antioxidant by scavenging free radicals and molecular oxygen.. (R,R,R)-alpha-tocopherol : An alpha-tocopherol that has R,R,R configuration. The naturally occurring stereoisomer of alpha-tocopherol, it is found particularly in sunflower and olive oils.	6.16	10	1	alpha-tocopherol	algal metabolite; antiatherogenic agent; anticoagulant; antioxidant; antiviral agent; EC 2.7.11.13 (protein kinase C) inhibitor; immunomodulator; micronutrient; nutraceutical; plant metabolite
pseudouridine [no description available]	2.21	1	0	pseudouridines	fundamental metabolite
flurandrenolone Flurandrenolone: A corticosteroid used topically in the treatment of various skin disorders. It is usually employed as a cream or an ointment, and is also used as a polyethylene tape with an adhesive. (From Martindale, The Extra Pharmacopoeia, 30th ed, p733)	3.19	6	0	21-hydroxy steroid
ibufenac ibufenac: used in the treatment of rheumatism; also possesses antipyretic properties; minor descriptor (75-84); on-line & Index Medicus search PHENYLACETATES (75-84); RN given refers to parent cpd. ibufenac : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens is replaced by a 4-isobutylphenyl group. Although it was shown to be effective in treatment of rheumatoid arthritis, the clinical use of ibufenac was discontinued due to hepatotoxic side-effects.	2.06	1	0	monocarboxylic acid	EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; hepatotoxic agent; non-narcotic analgesic; non-steroidal anti-inflammatory drug
1-aminopyrene [no description available]	2.05	1	0
metaxalone [no description available]	2.04	1	0	aromatic ether
spectinomycin Spectinomycin: An antibiotic produced by Streptomyces spectabilis. It is active against gram-negative bacteria and used for the treatment of GONORRHEA.. spectinomycin dihydrochloride : A hydrochloride obtained by combining spectinomycin with two molar equivalents of hydrochloric acid. An antibiotic that is active against gram-negative bacteria and used (as its pentahydrate) to treat gonorrhea.. spectinomycin : A pyranobenzodioxin and antibiotic that is active against gram-negative bacteria and used (as its dihydrochloride pentahydrate) to treat gonorrhea. It is produced by the bacterium Streptomyces spectabilis.	6.2	45	0	cyclic acetal; cyclic hemiketal; cyclic ketone; pyranobenzodioxin; secondary alcohol; secondary amino compound	antibacterial drug; antimicrobial agent; bacterial metabolite
paraquat Paraquat: A poisonous dipyridilium compound used as contact herbicide. Contact with concentrated solutions causes irritation of the skin, cracking and shedding of the nails, and delayed healing of cuts and wounds.. paraquat : An organic cation that consists of 4,4'-bipyridine bearing two N-methyl substituents loctated at the 1- and 1'-positions.	2.42	2	0	organic cation	geroprotector; herbicide
tetrabutylammonium tetrabutylammonium: lipophilic probe; RN given refers to parent cpd	2.05	1	0	quaternary ammonium ion
dronabinol Dronabinol: A psychoactive compound extracted from the resin of Cannabis sativa (marihuana, hashish). The isomer delta-9-tetrahydrocannabinol (THC) is considered the most active form, producing characteristic mood and perceptual changes associated with this compound.. Delta(9)-tetrahydrocannabinol : A diterpenoid that is 6a,7,8,10a-tetrahydro-6H-benzo[c]chromene substituted at position 1 by a hydroxy group, positions 6, 6 and 9 by methyl groups and at position 3 by a pentyl group. The principal psychoactive constituent of the cannabis plant, it is used for treatment of anorexia associated with AIDS as well as nausea and vomiting associated with cancer chemotherapy.	2.05	1	0	benzochromene; diterpenoid; phytocannabinoid; polyketide	cannabinoid receptor agonist; epitope; hallucinogen; metabolite; non-narcotic analgesic
amiloride Amiloride: A pyrazine compound inhibiting SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS. This inhibition creates a negative potential in the luminal membranes of principal cells, located in the distal convoluted tubule and collecting duct. Negative potential reduces secretion of potassium and hydrogen ions. Amiloride is used in conjunction with DIURETICS to spare POTASSIUM loss. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p705). amiloride : A member of the class of pyrazines resulting from the formal monoacylation of guanidine with the carboxy group of 3,5-diamino-6-chloropyrazine-2-carboxylic acid.	3.87	12	0	aromatic amine; guanidines; organochlorine compound; pyrazines	diuretic; sodium channel blocker
clothiapine clothiapine: was heading 1975-94 (was see under DIBENZOTHIAZEPINES 1975-90); CLOTIAPINE was see CLOTHIAPINE 1978-94; use DIBENZOTHIAZEPINES to search CLOTHIAPINE 1975-94; antipsychotic similar to clozapine	2.04	1	0	dibenzothiazepine
pimozide Pimozide: A diphenylbutylpiperidine that is effective as an antipsychotic agent and as an alternative to HALOPERIDOL for the suppression of vocal and motor tics in patients with Tourette syndrome. Although the precise mechanism of action is unknown, blockade of postsynaptic dopamine receptors has been postulated. (From AMA Drug Evaluations Annual, 1994, p403). pimozide : A member of the class of benzimidazoles that is 1,3-dihydro-2H-benzimidazol-2-one in which one of the nitrogens is substituted by a piperidin-4-yl group, which in turn is substituted on the nitrogen by a 4,4-bis(p-fluorophenyl)butyl group.	2.46	2	0	benzimidazoles; heteroarylpiperidine; organofluorine compound	antidyskinesia agent; dopaminergic antagonist; first generation antipsychotic; H1-receptor antagonist; serotonergic antagonist
flumethasone Flumethasone: An anti-inflammatory glucocorticoid used in veterinary practice.	4.83	8	1	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; fluorinated steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	anti-inflammatory drug
betamethasone valerate Betamethasone Valerate: The 17-valerate derivative of BETAMETHASONE. It has substantial topical anti-inflammatory activity and relatively low systemic anti-inflammatory activity.. betamethasone valerate : A steroid ester that is betamethasone in which the hydroxy group at the 17alpha position has been converted to the corresponding pentanoate ester.	5.91	7	4	11beta-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; fluorinated steroid; primary alpha-hydroxy ketone; steroid ester	anti-inflammatory drug
guanoxan guanoxan: was MH 1976-92 (see under GUANIDINES 1976-90); use GUANIDINES to search GUANOXAN 1976-92; antihypertensive agent similar in its mechanism of action to guanethidine; may cause liver damage	2.46	2	0	benzodioxine
azaribine azaribine: pyrimidine analogue; anti-metabolite used in psoriasis & mycosis fungoides;. azaribine : A N-glycosyl-1,2,4-triazine that is 6-azauridine acetylated at positions 2', 3' and 5' on the sugar ring. It is a prodrug for 6-azauridine and is used for treatment of psoriasis.	2.04	1	0	acetate ester; N-glycosyl-1,2,4-triazine	antipsoriatic; prodrug
dexamethasone isonicotinate Dexamethasone Isonicotinate: An anti-inflammatory, anti-allergic glucocorticoid that can be administered orally, by inhalation, locally, and parenterally. It may cause water and salt retention.	1.95	1	0	corticosteroid hormone
fluorescein Fluorescein: A phthalic indicator dye that appears yellow-green in normal tear film and bright green in a more alkaline medium such as the aqueous humor.. fluorescein (lactone form) : A xanthene dye that is highly fluorescent, detectable even when present in minute quantities. Used forensically to detect traces of blood, in analytical chemistry as an indicator in silver nitrate titrations and in microscopy.	2.75	3	0	2-benzofurans; gamma-lactone; organic heteropentacyclic compound; oxaspiro compound; polyphenol; xanthene dye	fluorescent dye; radioopaque medium
methylprednisolone hemisuccinate Methylprednisolone Hemisuccinate: A water-soluble ester of METHYLPREDNISOLONE used for cardiac, allergic, and hypoxic emergencies.	2.43	2	0	corticosteroid hormone; hemisuccinate
fucose Fucose: A six-member ring deoxysugar with the chemical formula C6H12O5. It lacks a hydroxyl group on the carbon at position 6 of the molecule.. L-fucopyranose : The pyranose form of L-fucose.. fucose : Any deoxygalactose that is deoxygenated at the 6-position.	1.94	1	0	fucopyranose; L-fucose	Escherichia coli metabolite; mouse metabolite
sulfadoxine Sulfadoxine: A long acting sulfonamide that is used, usually in combination with other drugs, for respiratory, urinary tract, and malarial infections.. sulfadoxine : A sulfonamide consisting of pyrimidine having methoxy substituents at the 5- and 6-positions and a 4-aminobenzenesulfonamido group at the 4-position. In combination with the antiprotozoal pyrimethamine (CHEBI:8673) it is used as an antimalarial.	2.7	3	0	pyrimidines; sulfonamide	antibacterial drug; antimalarial
c.i. direct blue 1 [no description available]	2.01	1	0
acadesine [no description available]	2.05	1	0	1-ribosylimidazolecarboxamide; aminoimidazole; nucleoside analogue	antineoplastic agent; platelet aggregation inhibitor
acetophenazine acetophenazine: major descriptor (73-85); minor descriptor (64-72); on-line search PHENOTHIAZINES (64-85); Index Medicus search PHENOTHIAZINES (64-72); ACETOPHENAZINE (73-85); RN given refers to parent cpd. acetophenazine : A member of the class of phenothiazines that is 10H-phenothiazine substituted by a 3-[4-(2-hydroxyethyl)piperazin-1-yl]propyl group at the nitogen atom and an acetyl group at position 2.	2.04	1	0	N-(2-hydroxyethyl)piperazine; N-alkylpiperazine; phenothiazines	phenothiazine antipsychotic drug
stavudine Stavudine: A dideoxynucleoside analog that inhibits reverse transcriptase and has in vitro activity against HIV.. stavudine : A nucleoside analogue obtained by formal dehydration across positions 2 and 3 of thymidine. An inhibitor of HIV-1 reverse transcriptase	2.75	3	0	dihydrofuran; nucleoside analogue; organic molecular entity	antimetabolite; antiviral agent; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor
doxifluridine doxifluridine : A pyrimidine 5'-deoxyribonucleoside that is 5-fluorouridine in which the hydroxy group at the 5' position is replaced by a hydrogen. It is an oral prodrug of the antineoplastic agent 5-fluorouracil. Designed to circumvent the rapid degradation of 5-fluorouracil by dihydropyrimidine dehydrogenase in the gut wall, it is converted into 5-fluorouracil in the presence of pyrimidine nucleoside phosphorylase.	2.05	1	0	organofluorine compound; pyrimidine 5'-deoxyribonucleoside	antimetabolite; antineoplastic agent; prodrug
dicloxacillin Dicloxacillin: One of the PENICILLINS which is resistant to PENICILLINASE.. dicloxacillin : A penicillin that is 6-aminopenicillanic acid in which one of the amino hydrogens is replaced by a 3-(2,6-dichlorophenyl)-5-methyl-1,2-oxazol-4-yl]formyl group.	3.05	5	0	dichlorobenzene; penicillin	antibacterial drug
ornithylaspartate ornithylaspartate: used therapeutically in hepatic coma	5.1	5	0
fluorescein-5-isothiocyanate Fluorescein-5-isothiocyanate: Fluorescent probe capable of being conjugated to tissue and proteins. It is used as a label in fluorescent antibody staining procedures as well as protein- and amino acid-binding techniques.. fluorescein 5-isothiocyanate : The 5-isomer of fluorescein isothiocyanate. Acts as a fluorescent probe capable of being conjugated to tissue and proteins; used as a label in fluorescent antibody staining procedures as well as protein- and amino acid-binding techniques.	2.92	4	0	fluorescein isothiocyanate
sabinene sabinene: RN given refers to cpd without isomeric designation. sabinene : A thujene that is a bicyclic monoterpene isolated from the essential oils of various plant species.	2.38	2	0	thujene	plant metabolite
mannose mannopyranose : The pyranose form of mannose.	2.36	2	0	D-aldohexose; D-mannose; mannopyranose	metabolite
iproclozide iproclozide: structure	2.05	1	0	aromatic ether
cephaloglycin Cephaloglycin: A cephalorsporin antibiotic.. cefaloglycin : A cephalosporin antibiotic containing at the 7beta-position of the cephem skeleton an (R)-amino(phenyl)acetamido group.	3.21	6	0	beta-lactam antibiotic allergen; cephalosporin	antimicrobial agent
tranylcypromine Tranylcypromine: A propylamine formed from the cyclization of the side chain of amphetamine. This monoamine oxidase inhibitor is effective in the treatment of major depression, dysthymic disorder, and atypical depression. It also is useful in panic and phobic disorders. (From AMA Drug Evaluations Annual, 1994, p311). tranylcypromine : A racemate comprising equal amounts of (1R,2S)- and (1S,2R)-2-phenylcyclopropan-1-amine. An irreversible monoamine oxidase inhibitor that is used as an antidepressant (INN tranylcypromine).. (1R,2S)-tranylcypromine : A 2-phenylcyclopropan-1-amine that is the (1R,2S)-enantiomer of tranylcypromine.	1.96	1	0	2-phenylcyclopropan-1-amine
nafenopin Nafenopin: A peroxisome proliferator that is used experimentally to promote liver tumors. It has been used as an antihyperlipoproteinemic agent.. nafenopin : A racemate comprising equimolar amounts of (R)- and (S)-nafenopin. It is a peroxisome proliferator that is used experimentally to promote liver tumors. It has been used as an hypolipidemic agent.. 2-methyl-2-[4-(1,2,3,4-tetrahydronaphthalen-1-yl)phenoxy]propanoic acid : A monocarboxylic acid that is 2-hydroxy-2-methylpropanoic acid in which ther tertiary hydroxy group has been converted into the corresponding p-(1,2,3,4-tetrahydronaphthalen-1-yl)phenyl ether.	3.04	1	0	aromatic ether; monocarboxylic acid
streptomycin [no description available]	15.9	939	7	antibiotic antifungal drug; antibiotic fungicide; streptomycins	antibacterial drug; antifungal agrochemical; antimicrobial agent; antimicrobial drug; bacterial metabolite; protein synthesis inhibitor
carbonates Carbonates: Salts or ions of the theoretical carbonic acid, containing the radical CO2(3-). Carbonates are readily decomposed by acids. The carbonates of the alkali metals are water-soluble; all others are insoluble. (From Grant & Hackh's Chemical Dictionary, 5th ed). carbonates : Organooxygen compounds that are salts or esters of carbonic acid, H2CO3.	2.35	2	0	carbon oxoanion
dideoxyadenosine Dideoxyadenosine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by a hydrogen. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is an inhibitor of HIV replication, acting as a chain-terminator of viral DNA by binding to reverse transcriptase. Its principal side effect is nephrotoxicity. In vivo, dideoxyadenosine is rapidly metabolized to DIDANOSINE (ddI) by enzymatic deamination; ddI is then converted to dideoxyinosine monophosphate and ultimately to dideoxyadenosine triphosphate, the putative active metabolite.	2.41	2	0	adenosines; purine 2',3'-dideoxyribonucleoside	EC 3.5.4.4 (adenosine deaminase) inhibitor; EC 4.6.1.1 (adenylate cyclase) inhibitor
cladribine [no description available]	2.05	1	0	organochlorine compound; purine 2'-deoxyribonucleoside	antineoplastic agent; immunosuppressive agent
carbenicillin Carbenicillin: Broad-spectrum semisynthetic penicillin derivative used parenterally. It is susceptible to gastric juice and penicillinase and may damage platelet function.. carbenicillin : A penicillin antibiotic having a 6beta-2-carboxy-2-phenylacetamido side-chain.	11.48	36	0	penicillin allergen; penicillin	antibacterial drug
carbenicillin disodium [no description available]	2.05	1	0	organic sodium salt
vantocil polihexanide: RN given refers to parent cpd	5.12	8	0
dehydroemetine dehydroemetine: was MH 1991-94 (see under EMETINE 1976-90); use EMETINE to search DEHYDROEMETINE 1976-94; amebicide, derivative of emetine. dehydroemetine : A pyridoisoquinoline which was developed in response to the cardiovascular toxicity associated with emetine and results from the dehydrogenation of the heterotricylic ring of emetine. It is an antiprotozoal agent and displays antimalarial, antiamoebic, and antileishmanial properties.	2.05	1	0	aromatic ether; isoquinolines; pyridoisoquinoline	antileishmanial agent; antimalarial; antiprotozoal drug
nifuratel Nifuratel: Local antiprotozoal and antifungal agent that may also be given orally.	1.95	1	0
noxiptilin noxiptilin: proposed tricyclic antidepressent; minor descriptor (75-86); on line & INDEX MEDICUS search DIBENZOCYCLOHEPTENES (75-86); RN given refers to parent cpd	2.04	1	0	organic tricyclic compound
benorilate benorilate: was heading 1980-94 (see under SALICYLATES 1980-90); was BENORYLATE see under SALICYLATES 1975-79; BENORYLATE was see BENORILATE 1980-94; use SALICYLATES to search BENORILATE 1980-90 & BENORYLATE 1975-79; an ester of aspirin and paracetamol with analgesic, antipyretic, and anti-inflammatory activity used in the treatment of rheumatoid diseases; it has less severe side effects than aspirin	2.45	2	0	carbonyl compound
trimetazidine Trimetazidine: A vasodilator used in angina of effort or ischemic heart disease.	2.05	1	0	aromatic amine
metocurine metocurine: from Chinese herb Cyclea hainanensis Mrr	2.45	2	0	isoquinolines
floxacillin Floxacillin: Antibiotic analog of CLOXACILLIN.. flucloxacillin : A penicillin compound having a 6beta-[3-(2-chloro-6-fluorophenyl)-5-methyl-1,2-oxazole-4-carboxamido] side-chain.	2.95	4	0	penicillin allergen; penicillin	antibacterial drug
clomacran clomacran: RN given refers to parent cpd; structure	2.46	2	0	acridines
dihydrostreptomycin sulfate Dihydrostreptomycin Sulfate: A semi-synthetic aminoglycoside antibiotic that is used in the treatment of TUBERCULOSIS.	8.13	107	0
vidarabine adenine arabinoside : A purine nucleoside in which adenine is attached to arabinofuranose via a beta-N(9)-glycosidic bond.	2.05	1	0	beta-D-arabinoside; purine nucleoside	antineoplastic agent; bacterial metabolite; nucleoside antibiotic
iprindole Iprindole: A tricyclic antidepressant that has actions and uses similar to those of AMITRIPTYLINE, but has only weak antimuscarinic and sedative effects. (From Martindale, The Extra Pharmacopoeia, 30th ed, p257)	2.04	1	0	indoles
dimethindene Dimethindene: A histamine H1 antagonist. It is used in hypersensitivity reactions, in rhinitis, for pruritus, and in some common cold remedies.	3.55	9	0	indene
isometheptene isometheptene: RN given refers to cpd without isomeric designation; structure in Merck Index, 9th ed, #5040	2.04	1	0	secondary amino compound
olsalazine olsalazine: cpd with 2 salicylate molecules linked together by an azo bond. olsalazine : An azobenzene that consists of two molecules of 4-aminosalicylic acid joined by an azo linkage. A prodrug for mesalazine, an anti-inflammatory drug, it is used (as the disodium salt) in the treatment of inflammatory bowel disease.	2.74	3	0	azobenzenes; dicarboxylic acid	non-steroidal anti-inflammatory drug; prodrug
n-methylaspartate N-Methylaspartate: An amino acid that, as the D-isomer, is the defining agonist for the NMDA receptor subtype of glutamate receptors (RECEPTORS, NMDA).. N-methyl-D-aspartic acid : An aspartic acid derivative having an N-methyl substituent and D-configuration.	2.69	3	0	amino dicarboxylic acid; D-alpha-amino acid; D-aspartic acid derivative; secondary amino compound	neurotransmitter agent
enbucrilate Enbucrilate: A tissue adhesive that is applied as a monomer to moist tissue and polymerizes to form a bond. It is slowly biodegradable and used in all kinds of surgery, including dental.	3.35	1	0	alpha,beta-unsaturated monocarboxylic acid; nitrile
tiadenol tiadenol: structure	2.05	1	0	aliphatic sulfide
molindone Molindone: An indole derivative effective in schizophrenia and other psychoses and possibly useful in the treatment of the aggressive type of undersocialized conduct disorder. Molindone has much lower affinity for D2 receptors than most antipsychotic agents and has a relatively low affinity for D1 receptors. It has only low to moderate affinity for cholinergic and alpha-adrenergic receptors. Some electrophysiologic data from animals indicate that molindone has certain characteristics that resemble those of CLOZAPINE. (From AMA Drug Evaluations Annual, 1994, p283)	2.04	1	0	indoles
lanthanum [no description available]	4.07	15	0	f-block element atom; lanthanoid atom; scandium group element atom
manganese Manganese: A trace element with atomic symbol Mn, atomic number 25, and atomic weight 54.94. It is concentrated in cell mitochondria, mostly in the pituitary gland, liver, pancreas, kidney, and bone, influences the synthesis of mucopolysaccharides, stimulates hepatic synthesis of cholesterol and fatty acids, and is a cofactor in many enzymes, including arginase and alkaline phosphatase in the liver. (From AMA Drug Evaluations Annual 1992, p2035). manganese(4+) : A manganese cation that is monoatomic and has a formal charge of +4.	7.48	13	2	elemental manganese; manganese group element atom	Escherichia coli metabolite; micronutrient
mercury Mercury: A silver metallic element that exists as a liquid at room temperature. It has the atomic symbol Hg (from hydrargyrum, liquid silver), atomic number 80, and atomic weight 200.59. Mercury is used in many industrial applications and its salts have been employed therapeutically as purgatives, antisyphilitics, disinfectants, and astringents. It can be absorbed through the skin and mucous membranes which leads to MERCURY POISONING. Because of its toxicity, the clinical use of mercury and mercurials is diminishing.. mercury(0) : Elemental mercury of oxidation state zero.	7.2	18	1	elemental mercury; zinc group element atom	neurotoxin
molybdenum Molybdenum: A metallic element with the atomic symbol Mo, atomic number 42, and atomic weight 95.95. It is an essential trace element, being a component of the enzymes xanthine oxidase, aldehyde oxidase, and nitrate reductase.	5.17	3	1	chromium group element atom	micronutrient
palladium Palladium: A chemical element having an atomic weight of 106.4, atomic number of 46, and the symbol Pd. It is a white, ductile metal resembling platinum, and following it in abundance and importance of applications. It is used in dentistry in the form of gold, silver, and copper alloys.. palladium : Chemical element (nickel group element atom) with atomic number 46.	2.06	1	0	metal allergen; nickel group element atom; platinum group metal atom
ruthenium Ruthenium: A hard, brittle, grayish-white rare earth metal with an atomic symbol Ru, atomic number 44, and atomic weight 101.07. It is used as a catalyst and hardener for PLATINUM and PALLADIUM.	2.89	4	0	iron group element atom; platinum group metal atom
silver Silver: An element with the atomic symbol Ag, atomic number 47, and atomic weight 107.87. It is a soft metal that is used medically in surgical instruments, dental prostheses, and alloys. Long-continued use of silver salts can lead to a form of poisoning known as ARGYRIA.	7.26	12	1	copper group element atom; elemental silver	Escherichia coli metabolite
technetium Technetium: The first artificially produced element and a radioactive fission product of URANIUM. Technetium has the atomic symbol Tc, and atomic number 43. All technetium isotopes are radioactive. Technetium 99m (m=metastable) which is the decay product of Molybdenum 99, has a half-life of about 6 hours and is used diagnostically as a radioactive imaging agent. Technetium 99 which is a decay product of technetium 99m, has a half-life of 210,000 years.	1.94	1	0	manganese group element atom
thorium Thorium: A radioactive element of the actinide series of metals. It has an atomic symbol Th, atomic number 90, and atomic weight 232.04. It is used as fuel in nuclear reactors to produce fissionable uranium isotopes. Because of its radioopacity, various thorium compounds are used to facilitate visualization in roentgenography.	2.34	2	0	actinoid atom; f-block element atom
titanium Titanium: A dark-gray, metallic element of widespread distribution but occurring in small amounts with atomic number, 22, atomic weight, 47.867 and symbol, Ti; specific gravity, 4.5; used for fixation of fractures.	6.07	3	1	titanium group element atom
cadmium Cadmium: An element with atomic symbol Cd, atomic number 48, and atomic weight 112.41. It is a metal and ingestion will lead to CADMIUM POISONING.. elemental cadmium : An element in the zinc group of the periodic table with atomic number 48, atomic mass 112, M.P. 321degreeC, and B.P. 765degreeC). An odourless, tasteless, and highly poisonous soft, ductile, lustrous metal with electropositive properties. It has eight stable isotopes: (106)Cd, (108)Cd,(110)Cd, (111)Cd, (112)Cd, (113)Cd, (114)Cd and (116)Cd, with (112)Cd and (114)Cd being the most common.	3.92	13	0	cadmium molecular entity; zinc group element atom
chromium Chromium: A trace element that plays a role in glucose metabolism. It has the atomic symbol Cr, atomic number 24, and atomic weight 52. According to the Fourth Annual Report on Carcinogens (NTP85-002,1985), chromium and some of its compounds have been listed as known carcinogens.. chromium ion : An chromium atom having a net electric charge.. chromium atom : A chromium group element atom that has atomic number 24.	4.43	7	0	chromium group element atom; metal allergen	micronutrient
gadolinium Gadolinium: An element of the rare earth family of metals. It has the atomic symbol Gd, atomic number 64, and atomic weight 157.25. Its oxide is used in the control rods of some nuclear reactors.	4.41	21	0	f-block element atom; lanthanoid atom
gold Gold: A yellow metallic element with the atomic symbol Au, atomic number 79, and atomic weight 197. It is used in jewelry, goldplating of other metals, as currency, and in dental restoration. Many of its clinical applications, such as ANTIRHEUMATIC AGENTS, are in the form of its salts.	6.73	17	1	copper group element atom; elemental gold
helium Helium: A noble gas with the atomic symbol He, atomic number 2, and atomic weight 4.003. It is a colorless, odorless, tasteless gas that is not combustible and does not support combustion. It was first detected in the sun and is now obtained from natural gas. Medically it is used as a diluent for other gases, being especially useful with oxygen in the treatment of certain cases of respiratory obstruction, and as a vehicle for general anesthetics.	1.95	1	0	monoatomic helium; noble gas atom; s-block element atom	food packaging gas
uranium Uranium: A radioactive element of the actinide series of metals. It has an atomic symbol U, atomic number 92, and atomic weight 238.03. U-235 is used as the fissionable fuel in nuclear weapons and as fuel in nuclear power reactors.	2.64	3	0	actinoid atom; f-block element atom; monoatomic uranium
aluminum chloride Aluminum Chloride: A compound with the chemical formula AlCl3; the anhydrous salt is used as a catalyst in organic chemical synthesis, and hydrated salts are used topically as antiperspirants, and for the management of HYPERHYDROSIS.	2.39	2	0	aluminium coordination entity	Lewis acid
zalcitabine Zalcitabine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by a hydrogen. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication at low concentrations, acting as a chain-terminator of viral DNA by binding to reverse transcriptase. Its principal toxic side effect is axonal degeneration resulting in peripheral neuropathy.. zalcitabine : A pyrimidine 2',3'-dideoxyribonucleoside compound having cytosine as the nucleobase.	2.75	3	0	pyrimidine 2',3'-dideoxyribonucleoside	antimetabolite; antiviral drug; HIV-1 reverse transcriptase inhibitor
magnesium sulfate Magnesium Sulfate: A small colorless crystal used as an anticonvulsant, a cathartic, and an electrolyte replenisher in the treatment of pre-eclampsia and eclampsia. It causes direct inhibition of action potentials in myometrial muscle cells. Excitation and contraction are uncoupled, which decreases the frequency and force of contractions. (From AMA Drug Evaluations Annual, 1992, p1083). magnesium sulfate : A magnesium salt having sulfate as the counterion.	5.35	4	1	magnesium salt; metal sulfate; organic magnesium salt	anaesthetic; analgesic; anti-arrhythmia drug; anticonvulsant; calcium channel blocker; cardiovascular drug; fertilizer; tocolytic agent
mercuric chloride Mercuric Chloride: Mercury chloride (HgCl2). A highly toxic compound that volatizes slightly at ordinary temperature and appreciably at 100 degrees C. It is corrosive to mucous membranes and used as a topical antiseptic and disinfectant.. mercury dichloride : A mercury coordination entity made up of linear triatomic molecules in which a mercury atom is bonded to two chlorines. Water-soluble, it is highly toxic. Once used in a wide variety of applications, including preserving wood and anatomical specimens, embalming and disinfecting, as an intensifier in photography, as a mordant for rabbit and beaver furs, and freeing gold from lead, its use has markedly declined as less toxic alternatives have been developed.	3.07	5	0	mercury coordination entity	sensitiser
acetylglucosamine Acetylglucosamine: The N-acetyl derivative of glucosamine.. N-acetyl-beta-D-glucosamine : An N-acetyl-D-glucosamine having beta-configuration at the anomeric centre.	2.46	2	0	N-acetyl-D-glucosamine	epitope
meladrazine nitrosoproline: RN given refers to 1-nitroso-L-proline	1.96	1	0
galactosamine 2-amino-2-deoxy-D-galactopyranose : The pyranose form of D-galactosamine.. D-galactosamine : The D-stereoisomer of galactosamine.	5.88	7	1	D-galactosamine; primary amino compound	toxin
hexocyclium hexocyclium: RN given refers to parent cpd; structure	2.04	1	0	amine
sodium nitrate sodium nitrate : The inorganic nitrate salt of sodium.	1.96	1	0	inorganic nitrate salt; inorganic sodium salt	fertilizer; NMR chemical shift reference compound
hypochlorous acid Hypochlorous Acid: An oxyacid of chlorine (HClO) containing monovalent chlorine that acts as an oxidizing or reducing agent.. hypochlorous acid : A chlorine oxoacid with formula HOCl; a weak, unstable acid, it is the active form of chlorine in water.	1.99	1	0	chlorine oxoacid; reactive oxygen species	EC 2.5.1.18 (glutathione transferase) inhibitor; EC 3.1.1.7 (acetylcholinesterase) inhibitor; human metabolite
camptothecin NSC 100880: carboxylate (opened lactone) form of camptothecin; RN refers to (S)-isomer; structure given in first source	5.35	7	2	delta-lactone; pyranoindolizinoquinoline; quinoline alkaloid; tertiary alcohol	antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor; genotoxin; plant metabolite
nickel chloride nickel chloride: RN given refers to cpd with MF of Ni-Cl2. nickel dichloride : A compound of nickel and chloride in which the ratio of nickel (in the +2 oxidation state) to chloride is 1:2.	2.38	2	0	nickel coordination entity	calcium channel blocker; hapten
bromine Bromine: A halogen with the atomic symbol Br, atomic number 35, and atomic weight 79.904. It is a volatile reddish-brown liquid that gives off suffocating vapors, is corrosive to the skin, and may cause severe gastroenteritis if ingested.	3.33	1	1	diatomic bromine
barium sulfate Barium Sulfate: A compound used as an x-ray contrast medium that occurs in nature as the mineral barite. It is also used in various manufacturing applications and mixed into heavy concrete to serve as a radiation shield.. barium sulfate : A metal sulfate with formula BaO4S. Virtually insoluble in water at room temperature, it is mostly used as a component in oil well drilling fluid it occurs naturally as the mineral barite.	1.98	1	0	barium salt; inorganic barium salt; metal sulfate	radioopaque medium
zinc sulfate Zinc Sulfate: A compound given in the treatment of conditions associated with zinc deficiency such as acrodermatitis enteropathica. Externally, zinc sulfate is used as an astringent in lotions and eye drops. (Reynolds JEF(Ed): Martindale: The Extra Pharmacopoeia (electronic version). Micromedex, Inc, Englewood, CO, 1995). zinc sulfate : A metal sulfate compound having zinc(2+) as the counterion.	5.24	3	1	metal sulfate; zinc molecular entity	fertilizer
sodium sulfate [no description available]	2	1	0	inorganic sodium salt
calcium phosphate, dibasic, anhydrous calcium phosphate, dibasic, anhydrous: molecular formula CaHPO(4), DCPA=dicalcium phosphate anhydrous; don't confuse with dichloropropionanilide which also is called DCPA; MW=136.06; has greater surface area and lower pH than DCPD (dicalcium phosphate dihydrate); occurs in nature as monetite; an intermediate in preparing hydroxyapatite	2.68	3	0	calcium phosphate
calcium phosphate, monobasic, anhydrous calcium phosphate, monobasic: MW 234.05	2.68	3	0	calcium phosphate	fertilizer
tricalcium phosphate tricalcium phosphate: a form of tricalcium phosphate used as bioceramic bone replacement material; see also records for alpha-tricalcium phosphate, beta-tricalcium phosphate, calcium phosphate; apatitic tricalcium phosphate Ca9(HPO4)(PO4)5(OH) is the calcium orthophosphate leading to beta tricalcium phosphate Ca3(PO4)2 (b-TCP). calcium phosphate : A calcium salt composed of calcium and phosphate/diphosphate ions; present in milk and used for the mineralisation of calcified tissues.	5.71	6	1	calcium phosphate
chromates Chromates: Salts of chromic acid containing the CrO(2-)4 radical.. chromate(2-) : A chromium oxoanion resulting from the removal of two protons from chromic acid.	3.55	9	0	chromium oxoanion; divalent inorganic anion	oxidising agent
copper sulfate Copper Sulfate: A sulfate salt of copper. It is a potent emetic and is used as an antidote for poisoning by phosphorus. It also can be used to prevent the growth of algae.. copper(II) sulfate : A metal sulfate compound having copper(2+) as the metal ion.	2.07	1	0	metal sulfate	emetic; fertilizer; sensitiser
silver nitrate Silver Nitrate: A silver salt with powerful germicidal activity. It has been used topically to prevent OPHTHALMIA NEONATORUM.	9.36	18	4	inorganic nitrate salt; silver salt	astringent
potassium dichromate Potassium Dichromate: Chromic acid (H2Cr2O7), dipotassium salt. A compound having bright orange-red crystals and used in dyeing, staining, tanning leather, as bleach, oxidizer, depolarizer for dry cells, etc. Medically it has been used externally as an astringent, antiseptic, and caustic. When taken internally, it is a corrosive poison.. potassium dichromate : A potassium salt that is the dipotassium salt of dichromic acid.	4.78	10	0	potassium salt	allergen; oxidising agent; sensitiser
deuterium Deuterium: The stable isotope of hydrogen. It has one neutron and one proton in the nucleus.	2.38	2	0	dihydrogen
fluorine Fluorine: A nonmetallic, diatomic gas that is a trace element and member of the halogen family. It is used in dentistry as fluoride (FLUORIDES) to prevent dental caries.	4.27	7	0	diatomic fluorine; gas molecular entity	NMR chemical shift reference compound
chlorine Chlorine: An element with atomic symbol Cl, atomic number 17, and atomic weight 35, and member of the halogen family.	6.3	12	1	diatomic chlorine; gas molecular entity	bleaching agent
nickel sulfate nickel sulfate: RN given refers to cpd with MF of Ni(2+)-H2SO4. nickel sulfate : A metal sulfate having nickel(2+) as the metal ion.	3.49	8	0	metal sulfate	allergen
beryllium fluoride beryllium difluoride : The fluoride salt of beryllium (+2 oxidation state). In the solid state it exists as a glass, with four-coordinate Be(2+) tetrahedral centres and two-coordinate fluoride centres. As a gas it adopts a linear triatomic structure and in the liquid state a fluctuating tetrahedral structure. In protein crystallography it is used as a mimic of phosphate.	2.4	2	0	beryllium molecular entity; fluoride salt
deuterium oxide Deuterium Oxide: The isotopic compound of hydrogen of mass 2 (deuterium) with oxygen. (From Grant & Hackh's Chemical Dictionary, 5th ed) It is used to study mechanisms and rates of chemical or nuclear reactions, as well as biological processes.	2.04	1	0	deuterated compound; water	NMR solvent
galactose aldohexose : A hexose with a (potential) aldehyde group at one end.	2.63	3	0
poloxalene Poloxalene: A copolymer of polyethylene and polypropylene ether glycol. It is a non-ionic polyol surface-active agent used medically as a fecal softener and in cattle for prevention of bloat.. pluronic : A triblock copolymer composed of a central hydrophobic chain of poly(propylene oxide) flanked by two hydrophilic chains of poly(ethylene oxide).	1.95	1	0	epoxide
hexadimethrine bromide Hexadimethrine Bromide: A synthetic polymer which agglutinates red blood cells. It is used as a heparin antagonist.	1.96	1	0
chlorine dioxide chlorine dioxide: equal or superior to chlorine when used as wastewater disinfectant	1.96	1	0	chlorine dioxide
sodium selenite disodium selenite : An inorganic sodium salt composed of sodium and selenite ions in a 2:1 ratio.	2.13	1	0	inorganic sodium salt; selenite salt	nutraceutical
cadmium chloride Cadmium Chloride: A cadmium halide in the form of colorless crystals, soluble in water, methanol, and ethanol. It is used in photography, in dyeing, and calico printing, and as a solution to precipitate sulfides. (McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed). cadmium dichloride : A cadmium coordination entity in which cadmium(2+) and Cl(-) ions are present in the ratio 2:1. Although considered to be ionic, it has considerable covalent character to its bonding.	2.05	1	0	cadmium coordination entity
4-chloro-7-nitrobenzofurazan 4-Chloro-7-nitrobenzofurazan: A benzofuran derivative used as a protein reagent since the terminal N-NBD-protein conjugate possesses interesting fluorescence and spectral properties. It has also been used as a covalent inhibitor of both beef heart mitochondrial ATPase and bacterial ATPase.. 4-chloro-7-nitrobenzofurazan : A benzoxadiazole that is 2,1,3-benzoxadiazole which is substituted at position 4 by chlorine and at position 7 by a nitro group.	1.98	1	0	benzoxadiazole; C-nitro compound; organochlorine compound	EC 1.4.3.4 (monoamine oxidase) inhibitor; EC 3.6.1.3 (adenosinetriphosphatase) inhibitor; fluorescent probe; fluorochrome
ancitabine Ancitabine: Congener of CYTARABINE that is metabolized to cytarabine and thereby maintains a more constant antineoplastic action.. ancitabine : An organic heterotricyclic compound resulting from the formal condensation of the oxo group of cytidine to the 2' position with loss of water to give the corresponding cyclic ether. A prodrug, it is metabolised to the antineoplastic agent cytarabine, so is used to maintain a more constant antineoplastic action.	2.04	1	0	diol; organic heterotricyclic compound	antimetabolite; antineoplastic agent; prodrug
chlormerodrin Chlormerodrin: A mercurial compound that has been used as a diuretic but is now superseded by more potent and less toxic drugs. The radiolabeled form has been used as a diagnostic and research tool.. chlormerodrin : Urea in which one of the hydrogens is substituted by a 3-chloromercury-2-methoxyprop-1-yl group. It was formerly used as a diuretic, but more potent and less toxic drugs are now available. Its radiolabelled ((197)Hg, (203)Hg) forms were used in diagnostic aids in renal imaging and brain scans.	1.94	1	0	organomercury compound; ureas	diagnostic agent; diuretic
trolamine salicylate Arthritis: Acute or chronic inflammation of JOINTS.	4.02	3	1
clortermine [no description available]	2.04	1	0	amphetamines
stanozolol Stanozolol: A synthetic steroid that has anabolic and androgenic properties. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1194). stanozolol : An organic heteropentacyclic compound resulting from the formal condensation of the 3-keto-aldehyde moiety of oxymetholone with hydrazine. Like oxymetholone, it is a synthetic anabolic steroid. It has both anabolic and androgenic properties, and has been used to treat hereditary angioedema and various vascular disorders. It has also been widely abused by professional athletes.	3.5	2	0	17beta-hydroxy steroid; anabolic androgenic steroid; organic heteropentacyclic compound; tertiary alcohol	anabolic agent; androgen
clodronic acid Clodronic Acid: A diphosphonate which affects calcium metabolism. It inhibits bone resorption and soft tissue calcification.. clodronic acid : An organochlorine compound that is methylene chloride in which both hydrogens are replaced by phosphonic acid groups. It inhibits bone resorption and soft tissue calcification, and is used (often as the disodium salt tetrahydrate) as an adjunct in the treatment of severe hypercalcaemia associated with malignancy, and in the management of osteolytic lesions and bone pain associated with skeletal metastases.	2.05	1	0	1,1-bis(phosphonic acid); one-carbon compound; organochlorine compound	antineoplastic agent; bone density conservation agent
coformycin [no description available]	3.41	1	0	coformycins	EC 3.5.4.4 (adenosine deaminase) inhibitor
nicofuranose nicofuranose: derivative of nicotinic acid that produces fewer side effects than pure nicotinic acid; used in peripheral vascular disease; also proposed as anticholesteremic; minor descriptor (75-84); on-line search NIACIN/AA (75-84); Index Medicus search NIACIN/AA (83-84), NICOTINIC ACIDS (75-82)	2.04	1	0	organooxygen compound
ammonium chloride Ammonium Chloride: An acidifying agent that has expectorant and diuretic effects. Also used in etching and batteries and as a flux in electroplating.. ammonium chloride : An inorganic chloride having ammonium as the counterion.	4.71	7	1	ammonium salt; inorganic chloride	ferroptosis inhibitor
reproterol reproterol: RN given refers to cpd without isomeric designation; structure	2.46	2	0	oxopurine
titanium dioxide titanium dioxide: used medically as protectant against externally caused irritation & sunlight; high concentrations of dust may cause irritation to respiratory tract; RN given refers to titanium oxide (TiO2); structure. titanium dioxide : A titanium oxide with the formula TiO2. A naturally occurring oxide sourced from ilmenite, rutile and anatase, it has a wide range of applications.	4.8	1	1	titanium oxides	food colouring
apazone Apazone: An anti-inflammatory agent used in the treatment of rheumatoid arthritis. It also has uricosuric properties and has been used to treat gout.. apazone : A member of the class of benzotriazines that is 1,2-dihydro-1,2,4-benzotriazine bearing a dimethylamino substitutent at position 3 and a methyl substituent at position 7 and in which the nitrogens at positions 1 and 2 are both acylated by a carboxy group of propylmalonic acid.	2.04	1	0	benzotriazines	non-steroidal anti-inflammatory drug; uricosuric drug
hydrocortisone-17-butyrate cortisol 17-butyrate : Cortisol esterified with butyric acid at the 17-hydroxy group.	1.99	1	0	butyrate ester; cortisol ester; primary alpha-hydroxy ketone	dermatologic drug; drug allergen
tiletamine hydrochloride Cyclohexanones: Cyclohexane ring substituted by one or more ketones in any position.. cyclohexanones : Any alicyclic ketone based on a cyclohexane skeleton and its substituted derivatives thereof.	2.67	3	0
cloforex cloforex: carbamic ethyl ester of chlorphentermine; structure in Negwer, 5th ed, #2275	2.04	1	0	amphetamines
xipamide Xipamide: A sulfamoylbenzamide analog of CLOPAMIDE. It is diuretic and saluretic with antihypertensive activity. It is bound to PLASMA PROTEINS, thus has a delayed onset and prolonged action.	2.05	1	0	benzamides
selegiline Selegiline: A selective, irreversible inhibitor of Type B monoamine oxidase that is used for the treatment of newly diagnosed patients with PARKINSON DISEASE, and for the treatment of depressive disorders. The compound without isomeric designation is Deprenyl.	2.96	4	0	selegiline; terminal acetylenic compound	geroprotector
selegiline hydrochloride, (r)-isomer [no description available]	2.05	1	0	hydrochloride; terminal acetylenic compound	antiparkinson drug; dopaminergic agent; EC 1.4.3.4 (monoamine oxidase) inhibitor
levamisole Levamisole: An antihelminthic drug that has been tried experimentally in rheumatic disorders where it apparently restores the immune response by increasing macrophage chemotaxis and T-lymphocyte function. Paradoxically, this immune enhancement appears to be beneficial in rheumatoid arthritis where dermatitis, leukopenia, and thrombocytopenia, and nausea and vomiting have been reported as side effects. (From Smith and Reynard, Textbook of Pharmacology, 1991, p435-6). levamisole : A 6-phenyl-2,3,5,6-tetrahydroimidazo[2,1-b][1,3]thiazole that has S configuration. It is used (generally as the monohydrochloride salt) to treat parasitic worm infections in pigs, sheep and cattle and was formerly used in humans as an adjuvant to chemotherapy for the treatment of various cancers. It is also widely used as an adulterant to coccaine.	2.45	2	0	6-phenyl-2,3,5,6-tetrahydroimidazo[2,1-b][1,3]thiazole	antinematodal drug; antirheumatic drug; EC 3.1.3.1 (alkaline phosphatase) inhibitor; immunological adjuvant; immunomodulator
clobutinol clobutinol: was minor as SILOMAT mapped to AMINO ALCOHOLS (63-79)	2.04	1	0	benzenes; organic amino compound
clemastine Clemastine: A histamine H1 antagonist used as the hydrogen fumarate in hay fever, rhinitis, allergic skin conditions, and pruritus. It causes drowsiness.. clemastine : 2-[(2R)-1-Methylpyrrolidin-2-yl]ethanol in which the hydrogen of the hydroxy group is substituted by a 1-(4-chlorophenyl)-1-phenylethyl group (R configuration). An antihistamine with antimuscarinic and moderate sedative properties, it is used as its fumarate salt for the symptomatic relief of allergic conditions such as rhinitis, urticaria, conjunctivitis and in pruritic (severe itching) skin conditions.	2.06	1	0	monochlorobenzenes; N-alkylpyrrolidine	anti-allergic agent; antipruritic drug; H1-receptor antagonist; muscarinic antagonist
thiamphenicol [no description available]	3.58	9	0	monocarboxylic acid amide; sulfone	antimicrobial agent; immunosuppressive agent
pizotyline Pizotyline: Serotonin antagonist used against MIGRAINE DISORDERS and vascular headaches.. pizotifen : A benzocycloheptathiophene that is 9,10-dihydro-4H-benzo[4,5]cyclohepta[1,2-b]thiophene 4-ylidene)-1-methylpiperidine which is joined from the 4 position to the 4 position of an N-methylpiperidine moiety by a double bond. It is a sedating antihistamine, with strong serotonin antagonist and weak antimuscarinic activity. It is generally used as the malate salt for the treatment of migraine and the prevention of headache attacks during cluster periods.	2.05	1	0	benzocycloheptathiophene	histamine antagonist; muscarinic antagonist; serotonergic antagonist
cephalexin Cephalexin: A semisynthetic cephalosporin antibiotic with antimicrobial activity similar to that of CEPHALORIDINE or CEPHALOTHIN, but somewhat less potent. It is effective against both gram-positive and gram-negative organisms.. cephalexin : A semisynthetic first-generation cephalosporin antibiotic having methyl and beta-(2R)-2-amino-2-phenylacetamido groups at the 3- and 7- of the cephem skeleton, respectively. It is effective against both Gram-negative and Gram-positive organisms, and is used for treatment of infections of the skin, respiratory tract and urinary tract.	4.68	9	0	beta-lactam antibiotic allergen; cephalosporin; semisynthetic derivative	antibacterial drug
cromolyn sodium Cromolyn Sodium: A chromone complex that acts by inhibiting the release of chemical mediators from sensitized MAST CELLS. It is used in the prophylactic treatment of both allergic and exercise-induced asthma, but does not affect an established asthmatic attack.. disodium cromoglycate : An organic sodium salt that is the disodium salt of cromoglycic acid.	2.71	3	0	organic sodium salt	anti-asthmatic drug; drug allergen
isosorbide-5-mononitrate isosorbide-5-mononitrate: for prevention of angina pectoris; structure given in first source; a Russian drug	2.45	2	0	glucitol derivative; nitrate ester	nitric oxide donor; vasodilator agent
tetradecanoylphorbol acetate Tetradecanoylphorbol Acetate: A phorbol ester found in CROTON OIL with very effective tumor promoting activity. It stimulates the synthesis of both DNA and RNA.. phorbol ester : Esters of phorbol, originally found in croton oil (from Croton tiglium, of the family Euphorbiaceae). A number of phorbol esters possess activity as tumour promoters and activate the mechanisms associated with cell growth. Some of these are used in experiments as activators of protein kinase C.. phorbol 13-acetate 12-myristate : A phorbol ester that is phorbol in which the hydroxy groups at the cyclopropane ring juction (position 13) and the adjacent carbon (position 12) have been converted into the corresponding acetate and myristate esters. It is a major active constituent of the seed oil of Croton tiglium. It has been used as a tumour promoting agent for skin carcinogenesis in rodents and is associated with increased cell proliferation of malignant cells. However its function is controversial since a decrease in cell proliferation has also been observed in several cancer cell types.	6.14	50	0	acetate ester; diester; phorbol ester; tertiary alpha-hydroxy ketone; tetradecanoate ester	antineoplastic agent; apoptosis inducer; carcinogenic agent; mitogen; plant metabolite; protein kinase C agonist; reactive oxygen species generator
fluorides [no description available]	3.58	9	0	halide anion; monoatomic fluorine
danazol Danazol: A synthetic steroid with antigonadotropic and anti-estrogenic activities that acts as an anterior pituitary suppressant by inhibiting the pituitary output of gonadotropins. It possesses some androgenic properties. Danazol has been used in the treatment of endometriosis and some benign breast disorders.	2.46	2	0	17beta-hydroxy steroid; terminal acetylenic compound	anti-estrogen; estrogen antagonist; geroprotector
fenclozic acid fenclozic acid: an analgesic & antipyretic with anti-inflammatory properties; minor descriptor (75-86); on-line & INDEX MEDICUS search THIAZOLES (75-86); RN given refers to parent cpd	2.06	1	0
laxagetten 4,4'-diacetoxydiphenylpyridylemethane [no description available]	2.06	1	0
oryzalin oryzalin: a dinitroaniline; preemergence herbicide; structure. oryzalin : A sulfonamide that is benzenesulfonamide substituted at positions 3 and 5 by nitro groups and at position 4 by a dipropylamino group.	2.06	1	0	aromatic amine; C-nitro compound; sulfonamide; tertiary amino compound	agrochemical; antimitotic; herbicide
taurolidine [no description available]	2.66	3	0	thiadiazinane
iodine [no description available]	2.63	3	0	halide anion; monoatomic iodine	human metabolite
daunorubicin Daunorubicin: A very toxic anthracycline aminoglycoside antineoplastic isolated from Streptomyces peucetius and others, used in treatment of LEUKEMIA and other NEOPLASMS.. anthracycline : Anthracyclines are polyketides that have a tetrahydronaphthacenedione ring structure attached by a glycosidic linkage to the amino sugar daunosamine.. daunorubicin : A natural product found in Actinomadura roseola.	4	4	0	aminoglycoside antibiotic; anthracycline; p-quinones; tetracenequinones	antineoplastic agent; bacterial metabolite
razoxane Razoxane: An antimitotic agent with immunosuppressive properties.	2.04	1	0	N-alkylpiperazine
cephapirin Cephapirin: Cephalosporin antibiotic, partly plasma-bound, that is effective against gram-negative and gram-positive organisms.. cephapirin : A cephalosporin with acetoxymethyl and 2(pyridin-4-ylsulfanyl)acetamido substituents at positions 3 and 7, respectively, of the cephem skeleton. It is used (as its sodium salt) as an antibiotic, being effective against gram-negative and gram-positive organisms.	1.95	1	0	cephalosporin	antibacterial drug
fludarabine phosphate fludarabine phosphate: structure given in first source. fludarabine phosphate : A purine arabinonucleoside monophosphate having 2-fluoroadenine as the nucleobase. A prodrug, it is rapidly dephosphorylated to 2-fluoro-ara-A and then phosphorylated intracellularly by deoxycytidine kinase to the active triphosphate, 2-fluoro-ara-ATP. Once incorporated into DNA, 2-fluoro-ara-ATP functions as a DNA chain terminator. It is used for the treatment of adult patients with B-cell chronic lymphocytic leukemia (CLL) who have not responded to, or whose disease has progressed during, treatment with at least one standard alkylating-agent containing regimenas.	2.04	1	0	nucleoside analogue; organofluorine compound; purine arabinonucleoside monophosphate	antimetabolite; antineoplastic agent; antiviral agent; DNA synthesis inhibitor; immunosuppressive agent; prodrug
alclofenac alclofenac: was heading 1975-94 (was see under PHENYLACETATES 1975-90); use PHENYLACETATES to search ALCLOFENAC 1975-94; an anti-inflammatory agent used in the treatment of rheumatoid arthritis; acts also as an analgesic and an antipyretic. alclofenac : An aromatic ether in which the ether oxygen links an allyl group to the 4-position of (3-chlorophenyl)acetic acid.A non-steroidal anti-inflammatory drug, it was withdrawn from the UK market in 1979 due to concerns with its association with vasculitis and rash.	2.06	1	0	aromatic ether; monocarboxylic acid; monochlorobenzenes	drug allergen; non-narcotic analgesic; non-steroidal anti-inflammatory drug
carbimazole Carbimazole: An imidazole antithyroid agent. Carbimazole is metabolized to METHIMAZOLE, which is responsible for the antithyroid activity.. carbimazole : A member of the class of imidazoles that is methimazole in which the nitrogen bearing a hydrogen is converted into its ethoxycarbonyl derivative. A prodrug for methimazol, carbimazole is used for the treatment of hyperthyroidism.	2.05	1	0	1,3-dihydroimidazole-2-thiones; carbamate ester	antithyroid drug; prodrug
bromocriptine Bromocriptine: A semisynthetic ergotamine alkaloid that is a dopamine D2 agonist. It suppresses prolactin secretion.	7.48	9	2	indole alkaloid	antidyskinesia agent; antiparkinson drug; dopamine agonist; hormone antagonist
cetalkonium chloride cetalkonium chloride: Note: Bonjela is a multimeaning drug name.	2.06	1	0
phenyl acetate phenyl acetate: The ester formed between phenol and acetic acid. Don't confuse with phenylacetic acid derivatives listed under PHENYLACETATES.. phenyl acetate : An acetate ester obtained by the formal condensation of phenol with acetic acid.	7.25	39	3	benzenes; phenyl acetates
phenoxyethanol phenoxyethanol: structure. 2-phenoxyethanol : An aromatic ether that is phenol substituted on oxygen by a 2-hydroxyethyl group.	3.12	1	0	aromatic ether; glycol ether; primary alcohol	antiinfective agent; central nervous system depressant
triamcinolone Triamcinolone: A glucocorticoid given, as the free alcohol or in esterified form, orally, intramuscularly, by local injection, by inhalation, or applied topically in the management of various disorders in which corticosteroids are indicated. (From Martindale, The Extra Pharmacopoeia, 30th ed, p739). triamcinolone : A C21-steroid hormone that is 1,4-pregnadiene-3,20-dione carrying four hydroxy substituents at positions 11beta, 16alpha, 17alpha and 21 as well as a fluoro substituent at position 9. Used in the form of its 16,17-acetonide to treat various skin infections.	8.14	27	2	11beta-hydroxy steroid; 16alpha-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid hormone; fluorinated steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	anti-allergic agent; anti-inflammatory drug
oxyphenisatin [no description available]	2.46	2	0	indoles
methiodal methiodal: major descriptor (66-86); on-line search METHANESULFONATES (74-86), ALKYL SULFONATES (73), SULFONIC ACIDS (66-72); INDEX MEDICUS search METHIODAL (66-86)	1.93	1	0	organosulfonic acid
tetrachloroethylene Tetrachloroethylene: A chlorinated hydrocarbon used as an industrial solvent and cooling liquid in electrical transformers. It is a potential carcinogen.	2.05	1	0	chlorocarbon; chloroethenes	nephrotoxic agent
fludrocortisone Fludrocortisone: A synthetic mineralocorticoid with anti-inflammatory activity.	3.65	10	0	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid; fluorinated steroid; mineralocorticoid	adrenergic agent; anti-inflammatory drug
ursodeoxycholic acid Ursodeoxycholic Acid: An epimer of chenodeoxycholic acid. It is a mammalian bile acid found first in the bear and is apparently either a precursor or a product of chenodeoxycholate. Its administration changes the composition of bile and may dissolve gallstones. It is used as a cholagogue and choleretic.. ursodeoxycholic acid : A bile acid found in the bile of bears (Ursidae) as a conjugate with taurine. Used therapeutically, it prevents the synthesis and absorption of cholesterol and can lead to the dissolution of gallstones.. ursodeoxycholate : A bile acid anion that is the conjugate base of ursodeoxycholic acid, obtained by deprotonation of the carboxy group; major species at pH 7.3.	2.7	3	0	bile acid; C24-steroid; dihydroxy-5beta-cholanic acid	human metabolite; mouse metabolite
pyrene pyrene: structure in Merck Index, 9th ed, #7746. pyrene : An ortho- and peri-fused polycyclic arene consisting of four fused benzene rings, resulting in a flat aromatic system.	2.73	3	0	ortho- and peri-fused polycyclic arene	fluorescent probe; persistent organic pollutant
proquazone proquazone: nonsteroid anti-inflammatory agent; structure	2.04	1	0	pyrimidines
benzonidazole benzonidazole: used in treatment of Chagas' disease. benznidazole : A monocarboxylic acid amide obtained by formal condensation of the carboxy group of (2-nitroimidazol-1-yl)acetic acid with the aromatic amino group of benzylamine. Used for treatment of Chagas disease.	1.96	1	0	C-nitro compound; imidazoles; monocarboxylic acid amide	antiprotozoal drug
halazepam halazepam: structure	2.04	1	0	organic molecular entity
butachlor butachlor : An aromatic amide that is 2-choro-N-(2,6-diethylphenyl)acetamide in which the amide nitrogen has been replaced by a butoxymethyl group.	2.05	1	0	aromatic amide; organochlorine compound; tertiary carboxamide	environmental contaminant; herbicide; xenobiotic
4-methoxyamphetamine 4-methoxyamphetamine: para-methoxy derivative to amphetamine with hallucinogenic properties; minor descriptor (75-86); on line & INDEX MEDICUS search AMPHETAMINES (75-86); RN given refers to parent compound without isomeric designation	1.95	1	0
megalomicin a megalomicin A: RN given refers to parent cpd; structure	3.05	1	0	amino oligosaccharide
bisbenzimidazole trihydrochloride [no description available]	2.57	2	0
8-bromo cyclic adenosine monophosphate 8-Bromo Cyclic Adenosine Monophosphate: A long-acting derivative of cyclic AMP. It is an activator of cyclic AMP-dependent protein kinase, but resistant to degradation by cyclic AMP phosphodiesterase.. 8-Br-cAMP : A 3',5'-cyclic purine nucleotide that is 3',5'-cyclic AMP bearing an additional bromo substituent at position 8 on the adenine ring. An activator of cyclic AMP-dependent protein kinase, but resistant to degradation by cyclic AMP phosphodiesterase.	1.99	1	0	3',5'-cyclic purine nucleotide; adenyl ribonucleotide; organobromine compound	antidepressant; protein kinase agonist
transferrin Transferrin: An iron-binding beta1-globulin that is synthesized in the LIVER and secreted into the blood. It plays a central role in the transport of IRON throughout the circulation. A variety of transferrin isoforms exist in humans, including some that are considered markers for specific disease states.	2.37	2	0
rose bengal b disodium salt [no description available]	2.05	1	0
glutamic acid Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.. glutamic acid : An alpha-amino acid that is glutaric acid bearing a single amino substituent at position 2.	3.61	9	0	glutamic acid; glutamine family amino acid; L-alpha-amino acid; proteinogenic amino acid	Escherichia coli metabolite; ferroptosis inducer; micronutrient; mouse metabolite; neurotransmitter; nutraceutical
glucaric acid Glucaric Acid: A sugar acid derived from D-glucose in which both the aldehydic carbon atom and the carbon atom bearing the primary hydroxyl group are oxidized to carboxylic acid groups.. D-glucaric acid : The D-enantiomer of glucaric acid.. glucaric acid : A hexaric acid derived by oxidation of sugar such as glucose with nitric acid.	1.95	1	0	glucaric acid	antineoplastic agent
ribostamycin Ribostamycin: A broad-spectrum antimicrobial isolated from Streptomyces ribosifidicus.. ribostamycin : An amino cyclitol glycoside that is 4,6-diaminocyclohexane-1,2,3-triol having a 2,6-diamino-2,6-dideoxy-alpha-D-glucosyl residue attached at position 1 and a beta-D-ribosyl residue attached at position 2. It is an antibiotic produced by Streptomyces ribosidificus (formerly S. thermoflavus).	5.96	34	0	amino cyclitol glycoside; aminoglycoside antibiotic	antibacterial drug; antimicrobial agent; metabolite
adenylyl imidodiphosphate Adenylyl Imidodiphosphate: 5'-Adenylic acid, monoanhydride with imidodiphosphoric acid. An analog of ATP, in which the oxygen atom bridging the beta to the gamma phosphate is replaced by a nitrogen atom. It is a potent competitive inhibitor of soluble and membrane-bound mitochondrial ATPase and also inhibits ATP-dependent reactions of oxidative phosphorylation.	2.41	2	0	adenosine 5'-phosphate
clometacin clometacin: structure	2.06	1	0	N-acylindole
azoxymethane Azoxymethane: A potent carcinogen and neurotoxic compound. It is particularly effective in inducing colon carcinomas.	1.96	1	0
cefazolin Cefazolin: A semisynthetic cephalosporin analog with broad-spectrum antibiotic action due to inhibition of bacterial cell wall synthesis. It attains high serum levels and is excreted quickly via the urine.. cefazolin : A first-generation cephalosporin compound having [(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]methyl and (1H-tetrazol-1-ylacetyl)amino side-groups at positions 3 and 7 respectively.	7.7	18	4	beta-lactam antibiotic allergen; cephalosporin; tetrazoles; thiadiazoles	antibacterial drug
ripazepam [no description available]	2.04	1	0	benzenes
sodium azide Sodium Azide: A cytochrome oxidase inhibitor which is a nitridizing agent and an inhibitor of terminal oxidation. (From Merck Index, 12th ed). sodium azide : The sodium salt of hydrogen azide (hydrazoic acid).	2.03	1	0	inorganic sodium salt	antibacterial agent; explosive; mitochondrial respiratory-chain inhibitor; mutagen
azides Azides: Organic or inorganic compounds that contain the -N3 group.. azide : Any nitrogen molecular entity containing the group -N3.	3.11	5	0	pseudohalide anion	mitochondrial respiratory-chain inhibitor
adenosine diphosphate ribose Adenosine Diphosphate Ribose: An ester formed between the aldehydic carbon of RIBOSE and the terminal phosphate of ADENOSINE DIPHOSPHATE. It is produced by the hydrolysis of nicotinamide-adenine dinucleotide (NAD) by a variety of enzymes, some of which transfer an ADP-ribosyl group to target proteins.	2.67	3	0	ADP-sugar	Escherichia coli metabolite; mouse metabolite
halofenate Halofenate: An antihyperlipoproteinemic agent and uricosuric agent.	3.45	2	0
amoxicillin Amoxicillin: A broad-spectrum semisynthetic antibiotic similar to AMPICILLIN except that its resistance to gastric acid permits higher serum levels with oral administration.. amoxicillin : A penicillin in which the substituent at position 6 of the penam ring is a 2-amino-2-(4-hydroxyphenyl)acetamido group.	5.2	15	0	penicillin allergen; penicillin	antibacterial drug
timolol (S)-timolol (anhydrous) : The (S)-(-) (more active) enantiomer of timolol. A beta-adrenergic antagonist, both the hemihydrate and the maleate salt are used in the mangement of glaucoma, hypertension, angina pectoris and myocardial infarction, and for the prevention of migraine.	3.43	7	0	timolol	anti-arrhythmia drug; antiglaucoma drug; antihypertensive agent; beta-adrenergic antagonist
indoramin Indoramin: An alpha-1 adrenergic antagonist that is commonly used as an antihypertensive agent.	2.45	2	0	tryptamines
2-bromoethanesulfonic acid 2-bromoethanesulfonic acid: RN given refers to parent cpd; a methanogenic inhibitor	2.02	1	0
carfecillin Carfecillin: The phenyl ester of CARBENICILLIN that, upon oral administration, is broken down in the intestinal mucosa to the active antibacterial. It is used for urinary tract infections.	2.05	1	0	penicillin
almitrine Almitrine: A respiratory stimulant that enhances respiration by acting as an agonist of peripheral chemoreceptors located on the carotid bodies. The drug increases arterial oxygen tension while decreasing arterial carbon dioxide tension in patients with chronic obstructive pulmonary disease. It may also prove useful in the treatment of nocturnal oxygen desaturation without impairing the quality of sleep.. almitrine : A triamino-1,3,5-triazine compound having allylamino substituents at the 2- and 4-positions and a 4-(bis(p-fluorophenyl)methyl)-1-piperazinyl group at the 6-position.	2.06	1	0	piperazines; triamino-1,3,5-triazine	central nervous system stimulant
nicergoline Nicergoline: An ergot derivative that has been used as a cerebral vasodilator and in peripheral vascular disease. It may ameliorate cognitive deficits in CEREBROVASCULAR DISORDERS.	2.05	1	0	organic heterotetracyclic compound; organonitrogen heterocyclic compound
oxcarbazepine Oxcarbazepine: A carbamazepine derivative that acts as a voltage-gated sodium channel blocker. It is used for the treatment of PARTIAL SEIZURES with or without secondary generalization. It is also an inducer of CYTOCHROME P-450 CYP3A4.. oxcarbazepine : A dibenzoazepine derivative, having a carbamoyl group at the ring nitrogen, substituted with an oxo group at C-4 of the azepeine ring which is also hydrogenated at C-4 and C-5. It is a anticholinergic anticonvulsant and mood stabilizing drug, used primarily in the treatment of epilepsy.	2.05	1	0	cyclic ketone; dibenzoazepine	anticonvulsant; drug allergen
4-ethynylbiphenyl 4-ethynylbiphenyl: structure given in first source	1.95	1	0
moricizine Moricizine: An antiarrhythmia agent used primarily for ventricular rhythm disturbances.. moricizine : A phenothiazine substituted on the nitrogen by a 3-(morpholin-4-yl)propanoyl group, and at position 2 by an (ethoxycarbonyl)amino group.	2.46	2	0	carbamate ester; morpholines; phenothiazines	anti-arrhythmia drug
amineptin amineptin: used in treatment of neuroses with psychoasthenic, anxio-phobic & depressive manifestations; synonym S 1694 refers to HCl; structure. amineptine : A carbocyclic fatty acid that is 5-aminoheptanoic acid in which one of the hydrogens attached to the nitrogen is replaced by a 10,11-dihydro-5H-dibenzo[a,d][7]annulen-5-yl group. A tricyclic antidepressant, it was never approved in the US and was withdrawn from the French market in 1999 due to concerns over abuse, dependence and severe acne.	2.46	2	0	amino acid; carbocyclic fatty acid; carbotricyclic compound; secondary amino compound	antidepressant; dopamine uptake inhibitor
zidovudine Zidovudine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by an azido group. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA during reverse transcription. It improves immunologic function, partially reverses the HIV-induced neurological dysfunction, and improves certain other clinical abnormalities associated with AIDS. Its principal toxic effect is dose-dependent suppression of bone marrow, resulting in anemia and leukopenia.. zidovudine : A pyrimidine 2',3'-dideoxyribonucleoside compound having a 3'-azido substituent and thymine as the nucleobase.	3.43	7	0	azide; pyrimidine 2',3'-dideoxyribonucleoside	antimetabolite; antiviral drug; HIV-1 reverse transcriptase inhibitor
feprazone Feprazone: A pyrazole that has analgesic, anti-inflammatory, and antipyretic properties. It has been used in mild to moderate pain, fever, and inflammation associated with musculoskeletal and joint disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p15)	2.04	1	0	organic molecular entity
flubendazole flubendazole: the p-fluoro analog of mebendazole. flubendazole : A member of the class of mebendazole in which the benzoyl group is replaced by a p-fluorobenzoyl group. A broad-spectrum anthelmintic, it is used, particularly in veterinary medicine, for the treatment of nematodal infections.	2.07	1	0	aromatic ketone; benzimidazoles; carbamate ester; organofluorine compound	antinematodal drug; teratogenic agent
pirprofen pirprofen: anti-inflammatory agent used in therapy of rheumatoid arthritis; prostaglandin synthetase inhibitor; more potent than indomethacin; structure	2.46	2	0	pyrroline
sisomicin Sisomicin: Antibiotic produced by Micromonospora inyoensis. It is closely related to gentamicin C1A, one of the components of the gentamicin complex (GENTAMICINS).	6.36	22	0	amino cyclitol glycoside; aminoglycoside antibiotic; beta-L-arabinoside; monosaccharide derivative
amdinocillin Amdinocillin: An amidinopenicillanic acid derivative with broad spectrum antibacterial action.. mecillinam : A penicillin in which the 6beta substituent is [(azepan-1-yl)methylidene]amino; an extended-spectrum penicillin antibiotic that binds specifically to penicillin binding protein 2 (PBP2), and is only considered to be active against Gram-negative bacteria.	1.96	1	0	penicillin	antibacterial drug; antiinfective agent
tobramycin Tobramycin: An aminoglycoside, broad-spectrum antibiotic produced by Streptomyces tenebrarius. It is effective against gram-negative bacteria, especially the PSEUDOMONAS species. It is a 10% component of the antibiotic complex, NEBRAMYCIN, produced by the same species.. tobramycin : A amino cyclitol glycoside that is kanamycin B lacking the 3-hydroxy substituent from the 2,6-diaminoglucose ring.	11.12	116	2	amino cyclitol glycoside	antibacterial agent; antimicrobial agent; toxin
paclitaxel Taxus: Genus of coniferous yew trees or shrubs, several species of which have medicinal uses. Notable is the Pacific yew, Taxus brevifolia, which is used to make the anti-neoplastic drug taxol (PACLITAXEL).	3.13	5	0	taxane diterpenoid; tetracyclic diterpenoid	antineoplastic agent; human metabolite; metabolite; microtubule-stabilising agent
etoposide [no description available]	5.81	8	3	beta-D-glucoside; furonaphthodioxole; organic heterotetracyclic compound	antineoplastic agent; DNA synthesis inhibitor
substance p [no description available]	3.14	5	0	peptide	neurokinin-1 receptor agonist; neurotransmitter; vasodilator agent
dobutamine Dobutamine: A catecholamine derivative with specificity for BETA-1 ADRENERGIC RECEPTORS. It is commonly used as a cardiotonic agent after CARDIAC SURGERY and during DOBUTAMINE STRESS ECHOCARDIOGRAPHY.. dobutamine : A catecholamine that is 4-(3-aminobutyl)phenol in which one of the hydrogens attached to the nitrogen is substituted by a 2-(3,4-dihydroxyphenyl)ethyl group. A beta1-adrenergic receptor agonist that has cardiac stimulant action without evoking vasoconstriction or tachycardia, it is used as the hydrochloride to increase the contractility of the heart in the management of acute heart failure.	2.46	2	0	catecholamine; secondary amine	beta-adrenergic agonist; cardiotonic drug; sympathomimetic agent
ticarcillin Ticarcillin: An antibiotic derived from penicillin similar to CARBENICILLIN in action.. ticarcillin : A penicillin compound having a 6beta-[(2R)-2-carboxy-2-thiophen-3-ylacetyl]amino side-group.	3.78	2	1	penicillin allergen; penicillin	antibacterial drug
halofantrine halofantrine: used in treatment of mild to moderate acute malaria	2.04	1	0	phenanthrenes
butaclamol [no description available]	2.45	2	0	amino alcohol; organic heteropentacyclic compound; tertiary alcohol; tertiary amino compound	dopaminergic antagonist
penbutolol Penbutolol: A nonselective beta-blocker used as an antihypertensive and an antianginal agent.	2.06	1	0	ethanolamines
etidocaine Etidocaine: A local anesthetic with rapid onset and long action, similar to BUPIVACAINE.. etidocaine : An amino acid amide in which 2-[ethyl(propyl)amino]butanoic acid and 2,6-dimethylaniline have combined to form the amide bond. Used as a local anaesthetic (amide caine), it has rapid onset and long action properties, similar to bupivacaine, and is given by injection during surgical procedures and during labour and delivery.	2.04	1	0	amino acid amide	local anaesthetic
ribavirin Rebetron: Rebetron is tradename	2.97	4	0	1-ribosyltriazole; aromatic amide; monocarboxylic acid amide; primary carboxamide	anticoronaviral agent; antiinfective agent; antimetabolite; antiviral agent; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor
amikacin Amikacin: A broad-spectrum antibiotic derived from KANAMYCIN. It is reno- and oto-toxic like the other aminoglycoside antibiotics.. amikacin : An amino cyclitol glycoside that is kanamycin A acylated at the N-1 position by a 4-amino-2-hydroxybutyryl group.	6.48	58	0	alpha-D-glucoside; amino cyclitol glycoside; aminoglycoside; carboxamide	antibacterial drug; antimicrobial agent; nephrotoxin
phorbol 12,13-dibutyrate Phorbol 12,13-Dibutyrate: A phorbol ester found in CROTON OIL which, in addition to being a potent skin tumor promoter, is also an effective activator of calcium-activated, phospholipid-dependent protein kinase (protein kinase C). Due to its activation of this enzyme, phorbol 12,13-dibutyrate profoundly affects many different biological systems.	2.9	4	0	butyrate ester; phorbol ester; tertiary alpha-hydroxy ketone
fluorescamine Fluorescamine: A nonfluorescent reagent for the detection of primary amines, peptides and proteins. The reaction products are highly fluorescent.	1.95	1	0
carbidopa [no description available]	2.06	1	0	catechols; hydrate; hydrazines; monocarboxylic acid	antidyskinesia agent; antiparkinson drug; dopaminergic agent; EC 4.1.1.28 (aromatic-L-amino-acid decarboxylase) inhibitor
cephradine Cephradine: A semi-synthetic cephalosporin antibiotic.. cephradine : A first-generation cephalosporin antibiotic with a methyl substituent at position 3, and a (2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetamido substituent at position 7, of the cephem skeleton.	3.46	2	0	beta-lactam antibiotic allergen; cephalosporin	antibacterial drug
imidazolidinyl urea imidazolidinyl urea: RN given refers to parent cpd	3.05	1	0	ureas	antimicrobial agent
ticrynafen Ticrynafen: A novel diuretic with uricosuric action. It has been proposed as an antihypertensive agent.. tienilic acid : An aromatic ketone that is 2,3-dichlorophenoxyacetic acid in which the hydrogen at position 4 on the benzene ring is replaced by a thiophenecarbonyl group. A loop diuretic used to treat hypertension, it was withdrawn from the market in 1982 due to links with hepatitis.	2.46	2	0	aromatic ether; aromatic ketone; dichlorobenzene; monocarboxylic acid; thiophenes	antihypertensive agent; hepatotoxic agent; loop diuretic
methyldopa Methyldopa: An alpha-2 adrenergic agonist that has both central and peripheral nervous system effects. Its primary clinical use is as an antihypertensive agent.. alpha-methyl-L-dopa : A derivative of L-tyrosine having a methyl group at the alpha-position and an additional hydroxy group at the 3-position on the phenyl ring.	3.28	6	0	L-tyrosine derivative; non-proteinogenic L-alpha-amino acid	alpha-adrenergic agonist; antihypertensive agent; hapten; peripheral nervous system drug; sympatholytic agent
bezafibrate [no description available]	3.77	3	0	aromatic ether; monocarboxylic acid amide; monocarboxylic acid; monochlorobenzenes	antilipemic drug; environmental contaminant; geroprotector; xenobiotic
sq-11725 Nadolol: A non-selective beta-adrenergic antagonist with a long half-life, used in cardiovascular disease to treat arrhythmias, angina pectoris, and hypertension. Nadolol is also used for MIGRAINE DISORDERS and for tremor.. nadolol : Nadolol is a diastereoisomeric mixture consisting of equimolar amounts of the four possible 2,3-cis-isomers of 5-[3-(tert-butylamino)-2-hydroxypropoxy]-1,2,3,4-tetrahydronaphthalene-2,3-diol.	2.93	4	0
diltiazem Diltiazem: A benzothiazepine derivative with vasodilating action due to its antagonism of the actions of CALCIUM ion on membrane functions.. diltiazem : A 5-[2-(dimethylamino)ethyl]-2-(4-methoxyphenyl)-4-oxo-2,3,4,5-tetrahydro-1,5-benzothiazepin-3-yl acetate in which both stereocentres have S configuration. A calcium-channel blocker and vasodilator, it is used as the hydrochloride in the management of angina pectoris and hypertension.	3.71	10	0	5-[2-(dimethylamino)ethyl]-2-(4-methoxyphenyl)-4-oxo-2,3,4,5-tetrahydro-1,5-benzothiazepin-3-yl acetate	antihypertensive agent; calcium channel blocker; vasodilator agent
vecuronium bromide Vecuronium Bromide: Monoquaternary homolog of PANCURONIUM. A non-depolarizing neuromuscular blocking agent with shorter duration of action than pancuronium. Its lack of significant cardiovascular effects and lack of dependence on good kidney function for elimination as well as its short duration of action and easy reversibility provide advantages over, or alternatives to, other established neuromuscular blocking agents.. vecuronium bromide : The organic bromide salt of a 5alpha-androstane compound having 3alpha-acetoxy-, 17beta-acetoxy-, 2beta-piperidinino- and 16beta-N-methylpiperidinium substituents.	1.95	1	0	organic bromide salt; quaternary ammonium salt	muscle relaxant; neuromuscular agent; nicotinic antagonist
ng-nitroarginine methyl ester NG-Nitroarginine Methyl Ester: A non-selective inhibitor of nitric oxide synthase. It has been used experimentally to induce hypertension.	2.7	3	0	alpha-amino acid ester; L-arginine derivative; methyl ester; N-nitro compound	EC 1.14.13.39 (nitric oxide synthase) inhibitor
benoxaprofen benoxaprofen: RN given refers to parent cpd; structure. benoxaprofen : A monocarboxylic acid that is propionic acid substituted at position 2 by a 2-(4-chlorophenyl)-1,3-benzoxazol-5-yl group. It was used as a non-steroidal anti-inflammatory drug until 1982 when it was withdrawn from the market due to adverse side-effects including liver necrosis, photosensitivity, and carcinogenicity in animals.	2.46	2	0	1,3-benzoxazoles; monocarboxylic acid; monochlorobenzenes	antipsoriatic; antipyretic; EC 1.13.11.34 (arachidonate 5-lipoxygenase) inhibitor; hepatotoxic agent; nephrotoxin; non-narcotic analgesic; non-steroidal anti-inflammatory drug; protein kinase C agonist
doxantrazole doxantrazole: structure	2.03	1	0
permethrin hemoglobin Atlanta-Coventry: Leu replaced by Pro at beta75 and Leu deleted at beta141	2.41	2	0	cyclopropanecarboxylate ester; cyclopropanes	agrochemical; ectoparasiticide; pyrethroid ester acaricide; pyrethroid ester insecticide; scabicide
exifone [no description available]	2.06	1	0	benzophenones
pirfenidone pirfenidone : A pyridone that is 2-pyridone substituted at positions 1 and 5 by phenyl and methyl groups respectively. An anti-inflammatory drug used for the treatment of idiopathic pulmonary fibrosis.	2.05	1	0	pyridone	antipyretic; non-narcotic analgesic; non-steroidal anti-inflammatory drug
desogestrel Desogestrel: A synthetic progestational hormone used often as the progestogenic component of combined oral contraceptive agents (ORAL CONTRACEPTIVES, COMBINED).	2.05	1	0	17beta-hydroxy steroid; terminal acetylenic compound	contraceptive drug; progestin; synthetic oral contraceptive
muzolimine Muzolimine: A pyrazole diuretic with long duration and high capacity of action. It was proposed for kidney failure and hypertension but was withdrawn worldwide because of severe neurological effects.	2.05	1	0	dichlorobenzene
nitazoxanide nitazoxanide: a 5-nitrothiazolyl derivative used for a broad range of intestinal parasitic infections including CRYPTOSPORIDIUM and GIARDIA; it is a redox-active nitrothiazolyl-salicylamide prodrug	2.05	1	0	benzamides; carboxylic ester
torsemide Torsemide: A pyridine and sulfonamide derivative that acts as a sodium-potassium chloride symporter inhibitor (loop diuretic). It is used for the treatment of EDEMA associated with CONGESTIVE HEART FAILURE; CHRONIC RENAL INSUFFICIENCY; and LIVER DISEASES. It is also used for the management of HYPERTENSION.. torasemide : An N-sulfonylurea obtained by formal condensation of [(3-methylphenyl)amino]pyridine-3-sulfonic acid with the free amino group of N-isopropylurea. It is a potent loop diuretic used for the treatment of hypertension and edema in patients with congestive heart failure.	2.05	1	0	aminopyridine; N-sulfonylurea; secondary amino compound	antihypertensive agent; loop diuretic
epirubicin Epirubicin: An anthracycline which is the 4'-epi-isomer of doxorubicin. The compound exerts its antitumor effects by interference with the synthesis and function of DNA.	2.45	2	0	aminoglycoside; anthracycline antibiotic; anthracycline; deoxy hexoside; monosaccharide derivative; p-quinones; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	antimicrobial agent; antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor
desflurane Desflurane: A fluorinated ether that is used as a volatile anesthetic for maintenance of general anesthesia.	2.05	1	0	organofluorine compound	inhalation anaesthetic
prenalterol Prenalterol: A partial adrenergic agonist with functional beta 1-receptor specificity and inotropic effect. It is effective in the treatment of acute CARDIAC FAILURE, postmyocardial infarction low-output syndrome, SHOCK, and reducing ORTHOSTATIC HYPOTENSION in the SHY-RAGER SYNDROME.	2.04	1	0	aromatic ether
lorcainide [no description available]	2.45	2	0	acetamides
idarubicin Idarubicin: An orally administered anthracycline antineoplastic. The compound has shown activity against BREAST NEOPLASMS; LYMPHOMA; and LEUKEMIA.	2.04	1	0	anthracycline antibiotic; deoxy hexoside; monosaccharide derivative
propiconazole Orbit: Bony cavity that holds the eyeball and its associated tissues and appendages.	2.35	2	0	conazole fungicide; cyclic ketal; dichlorobenzene; triazole fungicide; triazoles	antifungal agrochemical; EC 1.14.13.70 (sterol 14alpha-demethylase) inhibitor; environmental contaminant; xenobiotic
piperacillin Piperacillin: Semisynthetic, broad-spectrum, AMPICILLIN derived ureidopenicillin antibiotic proposed for PSEUDOMONAS infections. It is also used in combination with other antibiotics.. piperacillin : A penicillin in which the substituent at position 6 of the penam ring is a 2-[(4-ethyl-2,3-dioxopiperazin-1-yl)carboxamido]-2-phenylacetamido group.	2.74	3	0	penicillin allergen; penicillin	antibacterial drug
paroxetine Paroxetine: A serotonin uptake inhibitor that is effective in the treatment of depression.. paroxetine : A benzodioxole that consists of piperidine bearing 1,3-benzodioxol-5-yloxy)methyl and 4-fluorophenyl substituents at positions 3 and 4 respectively; the (3S,4R)-diastereomer. Highly potent and selective 5-HT uptake inhibitor that binds with high affinity to the serotonin transporter (Ki = 0.05 nM). Ki values are 1.1, 350 and 1100 nM for inhibition of [3H]-5-HT, [3H]-l-NA and [3H]-DA uptake respectively. Displays minimal affinity for alpha1-, alpha2- or beta-adrenoceptors, 5-HT2A, 5-HT1A, D2 or H1 receptors at concentrations below 1000 nM, however displays weak affinity for muscarinic ACh receptors (Ki = 42 nM). Antidepressant and anxiolytic in vivo.	2.46	2	0	aromatic ether; benzodioxoles; organofluorine compound; piperidines	antidepressant; anxiolytic drug; hepatotoxic agent; P450 inhibitor; serotonin uptake inhibitor
captopril Captopril: A potent and specific inhibitor of PEPTIDYL-DIPEPTIDASE A. It blocks the conversion of ANGIOTENSIN I to ANGIOTENSIN II, a vasoconstrictor and important regulator of arterial blood pressure. Captopril acts to suppress the RENIN-ANGIOTENSIN SYSTEM and inhibits pressure responses to exogenous angiotensin.. captopril : A L-proline derivative in which L-proline is substituted on nitrogen with a (2S)-2-methyl-3-sulfanylpropanoyl group. It is used as an anti-hypertensive ACE inhibitor drug.	4.56	7	0	alkanethiol; L-proline derivative; N-acylpyrrolidine; pyrrolidinemonocarboxylic acid	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor
cefoperazone Cefoperazone: Semisynthetic broad-spectrum cephalosporin with a tetrazolyl moiety that is resistant to beta-lactamase. It may be used to treat Pseudomonas infections.. cefoperazone : A semi-synthetic parenteral cephalosporin with a tetrazolyl moiety that confers beta-lactamase resistance.	2.05	1	0	cephalosporin	antibacterial drug
staurosporine [no description available]	2.45	2	0	indolocarbazole alkaloid; organic heterooctacyclic compound	apoptosis inducer; bacterial metabolite; EC 2.7.11.13 (protein kinase C) inhibitor; geroprotector
foscarnet sodium trisodium phosphonoformate : The trisodium salt of phosphonoformic acid. It is used as an antiviral agent in the treatment of cytomegalovirus retinitis (CMV retinitis, an inflamation of the retina that can lead to blindness) and as an alternative to ganciclovir for AIDS patients who require concurrent antiretroviral therapy but are unable to tolerate ganciclovir due to haematological toxicity.	2.05	1	0	one-carbon compound; organic sodium salt	antiviral drug
atracurium Atracurium: A non-depolarizing neuromuscular blocking agent with short duration of action. Its lack of significant cardiovascular effects and its lack of dependence on good kidney function for elimination provide clinical advantage over alternate non-depolarizing neuromuscular blocking agents.. atracurium : A diester compound consisting of pentane-1,5-diol with both hydroxyls bearing 3-[1-(3,4-dimethoxybenzyl)-6,7-dimethoxy-2-methyl-3,4-dihydroisoquinolinium-2(1H)-yl]propanoyl groups.	2.46	2	0	diester; quaternary ammonium ion	muscle relaxant; nicotinic antagonist
moxalactam Moxalactam: Broad- spectrum beta-lactam antibiotic similar in structure to the CEPHALOSPORINS except for the substitution of an oxaazabicyclo moiety for the thiaazabicyclo moiety of certain CEPHALOSPORINS. It has been proposed especially for the meningitides because it passes the blood-brain barrier and for anaerobic infections.. moxalactam : A broad-spectrum oxacephem antibiotic in which the oxazine ring is substituted with a tetrazolylthiomethyl group and the azetidinone ring carries methoxy and 2-carboxy-2-(4-hydroxyphenyl)acetamido substituents.	3.79	2	1	cephalosporin; oxacephem	antibacterial drug
nicorandil Nicorandil: A derivative of the NIACINAMIDE that is structurally combined with an organic nitrate. It is a potassium-channel opener that causes vasodilatation of arterioles and large coronary arteries. Its nitrate-like properties produce venous vasodilation through stimulation of guanylate cyclase.. nicorandil : A pyrimidinecarboxamide that is nicotinamide in which one of the hydrogens attached to the carboxamide nitrogen is replaced by a 2-(nitrooxy)ethyl group. It has both nitrate-like and ATP-sensitive potassium channel activator properties, and is used for the prevention and treatment of angina pectoris.	2.05	1	0	nitrate ester; pyridinecarboxamide	potassium channel opener; vasodilator agent
bw-755c 4,5-Dihydro-1-(3-(trifluoromethyl)phenyl)-1H-pyrazol-3-amine: A dual inhibitor of both cyclooxygenase and lipoxygenase pathways. It exerts an anti-inflammatory effect by inhibiting the formation of prostaglandins and leukotrienes. The drug also enhances pulmonary hypoxic vasoconstriction and has a protective effect after myocardial ischemia.	1.97	1	0
pergolide Pergolide: A long-acting dopamine agonist which has been used to treat PARKINSON DISEASE and HYPERPROLACTINEMIA but withdrawn from some markets due to potential for HEART VALVE DISEASES.. pergolide : A diamine that is ergoline in which the beta-hydrogen at position 8 is replaced by a (methylthio)methyl group and the hydrogen attached to the piperidine nitrogen (position 6) is replaced by a propyl group. A dopamine D2 receptor agonist which also has D1 and D2 agonist properties, it is used as the mesylate salt in the management of Parkinson's disease, although it was withdrawn from the U.S. and Canadian markets in 2007 due to an increased risk of cardiac valve dysfunction.	2.04	1	0	diamine; methyl sulfide; organic heterotetracyclic compound	antiparkinson drug; dopamine agonist
colforsin Colforsin: Potent activator of the adenylate cyclase system and the biosynthesis of cyclic AMP. From the plant COLEUS FORSKOHLII. Has antihypertensive, positive inotropic, platelet aggregation inhibitory, and smooth muscle relaxant activities; also lowers intraocular pressure and promotes release of hormones from the pituitary gland.	3.79	11	0	acetate ester; cyclic ketone; labdane diterpenoid; organic heterotricyclic compound; tertiary alpha-hydroxy ketone; triol	adenylate cyclase agonist; anti-HIV agent; antihypertensive agent; plant metabolite; platelet aggregation inhibitor; protein kinase A agonist
cefadroxil anhydrous Cefadroxil: Long-acting, broad-spectrum, water-soluble, CEPHALEXIN derivative.. cefadroxil : A cephalosporin bearing methyl and (2R)-2-amino-2-(4-hydroxyphenyl)acetamido groups at positions 3 and 7, respectively, of the cephem skeleton.	2.46	2	0	cephalosporin	antibacterial drug
encainide Encainide: One of the ANTI-ARRHYTHMIA AGENTS, it blocks VOLTAGE-GATED SODIUM CHANNELS and slows conduction within the His-Purkinje system and MYOCARDIUM.. encainide : 4-Methoxy-N-phenylbenzamide in which the hydrogen at the 2 position of the phenyl group is substituted by a 2-(1-methylpiperidin-2-yl)ethyl group. A class Ic antiarrhythmic, the hydrochloride was used for the treatment of severe or life-threatening ventricular arrhythmias, but it was associated with increased death rates in patients who had asymptomatic heart rhythm abnormalities after a recent heart attack and was withdrawn from the market.	2.05	1	0	benzamides; piperidines	anti-arrhythmia drug; sodium channel blocker
nedocromil Nedocromil: A pyranoquinolone derivative that inhibits activation of inflammatory cells which are associated with ASTHMA, including EOSINOPHILS; NEUTROPHILS; MACROPHAGES; MAST CELLS; MONOCYTES; AND PLATELETS.	2.06	1	0	dicarboxylic acid; organic heterotricyclic compound	anti-allergic agent; anti-asthmatic drug; non-steroidal anti-inflammatory drug
fialuridine [no description available]	2.06	1	0
doxofylline doxofylline : An oxopurine that is a derivative of xanthine, methylated at N-1 and N-3 and carrying a 1,3-dioxolan-2-ylmethyl group at N-7, used in the treatment of asthma.	2.04	1	0	oxopurine	anti-asthmatic drug; antitussive; bronchodilator agent
cefaclor anhydrous Cefaclor: Semisynthetic, broad-spectrum antibiotic derivative of CEPHALEXIN.. cefaclor : A cephalosporin bearing chloro and (R)-2-amino-2-phenylacetamido groups at positions 3 and 7, respectively, of the cephem skeleton.	2.39	2	0	cephalosporin	antibacterial drug; drug allergen
pefloxacin Pefloxacin: A synthetic broad-spectrum fluoroquinolone antibacterial agent active against most gram-negative and gram-positive bacteria.. pefloxacin : A quinolone that is 4-oxo-1,4-dihydroquinoline which is substituted at positions 1, 3, 6 and 7 by ethyl, carboxy, fluorine, and 4-methylpiperazin-1-yl groups, respectively.	2.46	2	0	fluoroquinolone antibiotic; monocarboxylic acid; N-alkylpiperazine; N-arylpiperazine; quinolone antibiotic; quinolone	antibacterial drug; antiinfective agent; DNA synthesis inhibitor
octenidine [no description available]	2.41	1	0	dihydropyridine
alfentanil Alfentanil: A short-acting opioid anesthetic and analgesic derivative of FENTANYL. It produces an early peak analgesic effect and fast recovery of consciousness. Alfentanil is effective as an anesthetic during surgery, for supplementation of analgesia during surgical procedures, and as an analgesic for critically ill patients.. alfentanil : A member of the class of piperidines that is piperidine having a 2-(4-ethyl-5-oxo-4,5-dihydro-1H-tetrazol-1-yl)ethyl group at the 1-position as well as N-phenylpropanamido- and methoxymethyl groups at the 4-position.	2.45	2	0	monocarboxylic acid amide; piperidines	central nervous system depressant; intravenous anaesthetic; mu-opioid receptor agonist; opioid analgesic; peripheral nervous system drug
fomesafen fomesafen: a protoporphyrinogen oxidase-inhibiting herbicide. fomesafen : An N-sulfonylcarboxamide that is N-(methylsulfonyl)benzamide in which the phenyl ring is substituted by a nitro group at position 2 and a 2-chloro-4-(trifluoromethyl)phenoxy group at position 5. A protoporphyrinogen oxidase inhibitor, it was specially developed for use (generally as the corresponding sodium salt, fomesafen-sodium) for post-emergence control of broad-leaf weeds in soya.	3.34	7	0	aromatic ether; C-nitro compound; monochlorobenzenes; N-sulfonylcarboxamide; organofluorine compound; phenols	agrochemical; EC 1.3.3.4 (protoporphyrinogen oxidase) inhibitor; herbicide
miglustat miglustat: a glucosylceramide synthase inhibitor. miglustat : A hydroxypiperidine that is deoxynojirimycin in which the amino hydrogen is replaced by a butyl group.	2.05	1	0	piperidines; tertiary amino compound	anti-HIV agent; EC 2.4.1.80 (ceramide glucosyltransferase) inhibitor
cefotetan Cefotetan: A semisynthetic cephamycin antibiotic that is administered intravenously or intramuscularly. The drug is highly resistant to a broad spectrum of beta-lactamases and is active against a wide range of both aerobic and anaerobic gram-positive and gram-negative microorganisms.. cefotetan : A semi-synthetic second-generation cephamycin antibiotic with [(1-methyl-1H-tetrazol-5-yl)sulfanyl]methyl, methoxy and {[4-(2-amino-1-carboxy-2-oxoethylidene)-1,3-dithietan-2-yl]carbonyl}amino groups at the 3, 7alpha, and 7beta positions, respectively, of the cephem skeleton. It is resistant to a wide range of beta-lactamases and is active against a broad spectrum of aerobic and anaerobic Gram-positive and Gram-negative microorganisms.	3.11	5	0
recainam recainam: structure given in first source	2.46	2	0
lovastatin Lovastatin: A fungal metabolite isolated from cultures of Aspergillus terreus. The compound is a potent anticholesteremic agent. It inhibits 3-hydroxy-3-methylglutaryl coenzyme A reductase (HYDROXYMETHYLGLUTARYL COA REDUCTASES), which is the rate-limiting enzyme in cholesterol biosynthesis. It also stimulates the production of low-density lipoprotein receptors in the liver.. lovastatin : A fatty acid ester that is mevastatin carrying an additional methyl group on the carbobicyclic skeleton. It is used in as an anticholesteremic drug and has been found in fungal species such as Aspergillus terreus and Pleurotus ostreatus (oyster mushroom).	6.74	10	2	delta-lactone; fatty acid ester; hexahydronaphthalenes; polyketide; statin (naturally occurring)	anticholesteremic drug; antineoplastic agent; Aspergillus metabolite; prodrug
flupirtine flupirtine: RN given refers to parent cpd without isomeric designation	2.05	1	0	aminopyridine
tolrestat tolrestat: RN & structure given in first source	2.47	2	0	naphthalenes	EC 1.1.1.21 (aldehyde reductase) inhibitor
enoximone Enoximone: A selective phosphodiesterase inhibitor with vasodilating and positive inotropic activity that does not cause changes in myocardial oxygen consumption. It is used in patients with CONGESTIVE HEART FAILURE.	2.05	1	0	aromatic ketone
piritrexim piritrexim: RN given refers to parent cpd; structure given in first source	2.05	1	0
simvastatin Simvastatin: A derivative of LOVASTATIN and potent competitive inhibitor of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HYDROXYMETHYLGLUTARYL COA REDUCTASES), which is the rate-limiting enzyme in cholesterol biosynthesis. It may also interfere with steroid hormone production. Due to the induction of hepatic LDL RECEPTORS, it increases breakdown of LDL CHOLESTEROL.. simvastatin : A member of the class of hexahydronaphthalenes that is lovastatin in which the 2-methylbutyrate ester moiety has been replaced by a 2,2-dimethylbutyrate ester group. It is used as a cholesterol-lowering and anti-cardiovascular disease drug.	2.94	4	0	delta-lactone; fatty acid ester; hexahydronaphthalenes; statin (semi-synthetic)	EC 1.1.1.34/EC 1.1.1.88 (hydroxymethylglutaryl-CoA reductase) inhibitor; EC 3.4.24.83 (anthrax lethal factor endopeptidase) inhibitor; ferroptosis inducer; geroprotector; prodrug
idazoxan Idazoxan: A benzodioxane-linked imidazole that has alpha-2 adrenoceptor antagonist activity.. idazoxan : A benzodioxine that is 2,3-dihydro-1,4-benzodioxine in which one of the hydrogens at position 2 has been replaced by a 4,5-dihydro-1H-imidazol-2-yl group.	2.4	2	0	benzodioxine; imidazolines	alpha-adrenergic antagonist
remoxipride Remoxipride: An antipsychotic agent that is specific for dopamine D2 receptors. It has been shown to be effective in the treatment of schizophrenia.	2.05	1	0	dimethoxybenzene
quinpirole Quinpirole: A dopamine D2/D3 receptor agonist.. quinpirole : A pyrazoloquinoline that is (4aR,8aR)-4,4a,5,6,7,8,8a,9-octahydro-1H-pyrazolo[3,4-g]quinoline substituted by a propyl group at position 5. It acts as a dopamine agonist.	2.03	1	0	pyrazoloquinoline	dopamine agonist
pravastatin Pravastatin: An antilipemic fungal metabolite isolated from cultures of Nocardia autotrophica. It acts as a competitive inhibitor of HMG CoA reductase (HYDROXYMETHYLGLUTARYL COA REDUCTASES).. pravastatin : A carboxylic ester resulting from the formal condensation of (S)-2-methylbutyric acid with the hydroxy group adjacent to the ring junction of (3R,5R)-7-[(1S,2S,6S,8S,8aR)-6,8-dihydroxy-2-methyl-1,2,6,7,8,8a-hexahydronaphthalen-1-yl]-3,5-dihydroxyheptanoic acid. Derived from microbial transformation of mevastatin, pravastatin is a reversible inhibitor of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA). The sodium salt is used for lowering cholesterol and preventing cardiovascular disease. It is one of the lower potency statins, but has the advantage of fewer side effects compared with lovastatin and simvastatin.	3.4	7	0	3-hydroxy carboxylic acid; carbobicyclic compound; carboxylic ester; hydroxy monocarboxylic acid; secondary alcohol; statin (semi-synthetic)	anticholesteremic drug; environmental contaminant; metabolite; xenobiotic
atomoxetine hydrochloride Atomoxetine Hydrochloride: A propylamine derivative and selective ADRENERGIC UPTAKE INHIBITOR that is used in the treatment of ATTENTION DEFICIT HYPERACTIVITY DISORDER.. atomoxetine hydrochloride : The hydrochloride salt of atomoxetine.	2.05	1	0	hydrochloride	adrenergic uptake inhibitor; antidepressant
quinapril Quinapril: A tetrahydroisoquinoline derivative and ANGIOTENSIN CONVERTING ENZYME inhibitor that is used in the treatment of HYPERTENSION and HEART FAILURE.. quinapril : A member of the class of isoquinolines that is (3S)-2-L-alanyl-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid in which the alpha-amino group of the alanyl residue has been substituted by a 1-ethoxycarbonyl-4-phenylbutan-2-yl group (the all-S isomer). A prodrug for quinaprilat (by hydrolysis of the ethyl ester to the corresponding carboxylic acid), it is used as an angiotensin-converting enzyme inhibitor (ACE inhibitor) used (generally as the hydrochloride salt) for the treatment of hypertension and congestive heart failure.	2.45	2	0	dicarboxylic acid monoester; ethyl ester; isoquinolines; tertiary carboxamide	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; prodrug
alpidem [no description available]	2.06	1	0	imidazoles
gepirone gepirone: RN given refers to parent cpd; structure given in first source	2.05	1	0	N-arylpiperazine
mifepristone Mifepristone: A progestational and glucocorticoid hormone antagonist. Its inhibition of progesterone induces bleeding during the luteal phase and in early pregnancy by releasing endogenous prostaglandins from the endometrium or decidua. As a glucocorticoid receptor antagonist, the drug has been used to treat hypercortisolism in patients with nonpituitary CUSHING SYNDROME.	2.42	2	0	3-oxo-Delta(4) steroid; acetylenic compound; tertiary amino compound	abortifacient; contraceptive drug; hormone antagonist; synthetic oral contraceptive
piroximone piroximone: structure in first source	2.05	1	0
5-propynylarabinofuranosyluracil 5-propynylarabinofuranosyluracil: potent inhibitor of VZV	2.05	1	0
disoxaril disoxaril: antipicornavirus agent	1.99	1	0	aromatic ether
salmeterol xinafoate Salmeterol Xinafoate: A selective ADRENERGIC BETA-2 RECEPTOR agonist that functions as a BRONCHODILATOR when administered by inhalation. It is used to manage the symptoms of ASTHMA and CHRONIC OBSTRUCTIVE PULMONARY DISEASE.	4.8	1	1	naphthoic acid
fura-2 Fura-2: A fluorescent calcium chelating agent which is used to study intracellular calcium in tissues.	4.19	17	0
finasteride Finasteride: An orally active 3-OXO-5-ALPHA-STEROID 4-DEHYDROGENASE inhibitor. It is used as a surgical alternative for treatment of benign PROSTATIC HYPERPLASIA.. finasteride : An aza-steroid that is a synthetic drug for the treatment of benign prostatic hyperplasia.	2.05	1	0	3-oxo steroid; aza-steroid; delta-lactam	androgen antagonist; antihyperplasia drug; EC 1.3.1.22 [3-oxo-5alpha-steroid 4-dehydrogenase (NADP(+))] inhibitor
esmolol methyl 3-{4-[2-hydroxy-3-(propan-2-ylamino)propoxy]phenyl}propanoate : A methyl ester that is methyl 3-(4-hydroxyphenyl)propanoate in which the hydrogen attached to the phenolic hydroxy group is substituted by a 2-hydroxy-3-(isopropylamino)propyl group.. esmolol : A racemate comprising equimolar amounts of (R)- and (S)-esmolol. A cardioselective and short-acting beta1 receptor blocker with rapid onset but lacking intrinsic sympathomimetic and membrane-stabilising properties, it is used as the hydrochloride salt in the management of supraventricular arrhythmias, and for the control of hypertension and tachycardia during surgery. While the S enantiomer possesses all of the heart rate control, both enantiomers contribute to lowering blood pressure.	2.46	2	0	aromatic ether; ethanolamines; methyl ester; secondary alcohol; secondary amino compound
adefovir adefovir: inhibitor of African swine fever virus. adefovir(1-) : A organophosphonate oxoanion obtained by removal of a proton from the phosphonate group of adefovir, a nucleoside reverse transcriptase inhibitor. It is the major microspecies at pH 7.3 (according to Marvin v 6.2.0.).. adefovir : A member of the class of phosphonic acids that is methylphosphonic acid in which one of the methyl hydrogens has been replaced by a 2-(6-amino-9H-purin-9-yl)ethoxy group. An inhibitor of HIV-1 reverse transcriptase, the bis(t-butoxycarbonyloxymethyl) ester (dipivoxil ester) prodrug is used to treat chronic hepatitis B viral infection.	2.46	2	0	6-aminopurines; ether; phosphonic acids	antiviral drug; DNA synthesis inhibitor; drug metabolite; HIV-1 reverse transcriptase inhibitor; nephrotoxic agent
sparfloxacin [no description available]	2.05	1	0	fluoroquinolone antibiotic; N-arylpiperazine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone
zileuton [no description available]	2.46	2	0	1-benzothiophenes; ureas	anti-asthmatic drug; EC 1.13.11.34 (arachidonate 5-lipoxygenase) inhibitor; ferroptosis inhibitor; leukotriene antagonist; non-steroidal anti-inflammatory drug
clopidogrel Clopidogrel: A ticlopidine analog and platelet purinergic P2Y receptor antagonist that inhibits adenosine diphosphate-mediated PLATELET AGGREGATION. It is used to prevent THROMBOEMBOLISM in patients with ARTERIAL OCCLUSIVE DISEASES; MYOCARDIAL INFARCTION; STROKE; or ATRIAL FIBRILLATION.. clopidogrel : A thienopyridine that is 4,5,6,7-tetrahydrothieno[3,2-c]pyridine in which the hydrogen attached to the nitrogen is replaced by an o-chlorobenzyl group, the methylene hydrogen of which is replaced by a methoxycarbonyl group (the S enantiomer). A P2Y12 receptor antagonist, it is used to inhibit blood clots and prevent heart attacks.	2.05	1	0	methyl ester; monochlorobenzenes; thienopyridine	anticoagulant; P2Y12 receptor antagonist; platelet aggregation inhibitor
cidofovir anhydrous Cidofovir: An acyclic nucleoside phosphonate that acts as a competitive inhibitor of viral DNA polymerases. It is used in the treatment of RETINITIS caused by CYTOMEGALOVIRUS INFECTIONS and may also be useful for treating HERPESVIRUS INFECTIONS.. cidofovir anhydrous : Cytosine substituted at the 1 position by a 3-hydroxy-2-(phosphonomethoxy)propyl group (S configuration). A nucleoside analogue, it is an injectable antiviral used for the treatment of cytomegalovirus (CMV) retinitis in AIDS patients.	2.46	2	0	phosphonic acids; pyrimidone	anti-HIV agent; antineoplastic agent; antiviral drug; photosensitizing agent
tiagabine Tiagabine: A nipecotic acid derivative that acts as a GABA uptake inhibitor and anticonvulsant agent. It is used in the treatment of EPILEPSY, for refractory PARTIAL SEIZURES.. tiagabine : A piperidinemonocarboxylic acid that is (R)-nipecotic acid in which the hydrogen attached to the nitrogen has been replaced by a 1,1-bis(3-methyl-2-thienyl)but-1-en-4-yl group. A GABA reuptake inhibitor, it is used (generally as the hydrochloride salt) for the treatment of epilepsy.	2.45	2	0	beta-amino acid; piperidinemonocarboxylic acid; tertiary amino compound; thiophenes	anticonvulsant; GABA reuptake inhibitor
mibefradil Mibefradil: A benzimidazoyl-substituted tetraline that selectively binds and inhibits CALCIUM CHANNELS, T-TYPE.	2.97	4	0	tetralins	T-type calcium channel blocker
topotecan Topotecan: An antineoplastic agent used to treat ovarian cancer. It works by inhibiting DNA TOPOISOMERASES, TYPE I.. topotecan : A pyranoindolizinoquinoline used as an antineoplastic agent. It is a derivative of camptothecin and works by binding to the topoisomerase I-DNA complex and preventing religation of these 328 single strand breaks.	2.07	1	0	pyranoindolizinoquinoline	antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor
tenidap tenidap: structure given in first source; RN refers to (Z)-isomer	2.46	2	0
bromfenac bromfenac: bromfenac sodium is the active cpd; structure in first source. bromfenac : Amfenac in which the the hydrogen at the 4 position of the benzoyl group is substituted by bromine. It is used for the management of ocular pain and treatment of postoperative inflammation in patients who have undergone cataract extraction. It was withdrawn from the US market in 1998, following concerns over off-label abuse and hepatic failure.	2.46	2	0	aromatic amino acid; benzophenones; organobromine compound; substituted aniline	non-narcotic analgesic; non-steroidal anti-inflammatory drug
atorvastatin [no description available]	2.05	1	0	aromatic amide; dihydroxy monocarboxylic acid; monofluorobenzenes; pyrroles; statin (synthetic)	environmental contaminant; xenobiotic
lamivudine [no description available]	3.31	6	0	monothioacetal; nucleoside analogue; oxacycle; primary alcohol	allergen; anti-HBV agent; antiviral drug; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor; HIV-1 reverse transcriptase inhibitor; prodrug
duloxetine [no description available]	2.05	1	0	duloxetine
irinotecan [no description available]	5.07	5	2	carbamate ester; delta-lactone; N-acylpiperidine; pyranoindolizinoquinoline; ring assembly; tertiary alcohol; tertiary amino compound	antineoplastic agent; apoptosis inducer; EC 5.99.1.2 (DNA topoisomerase) inhibitor; prodrug
valsartan Valsartan: A tetrazole derivative and ANGIOTENSIN II TYPE 1 RECEPTOR BLOCKER that is used to treat HYPERTENSION.. valsartan : A monocarboxylic acid amide consisting of L-valine in which the amino hydrogens have been replaced by a pentanoyl and a [2'-(1H-tetrazol-5-yl)biphenyl]-4-yl]methyl group. It exhibits antihypertensive activity.	2.46	2	0	biphenylyltetrazole; monocarboxylic acid amide; monocarboxylic acid	angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic
ibandronic acid Ibandronic Acid: Aminobisphosphonate that is a potent inhibitor of BONE RESORPTION. It is used in the treatment of HYPERCALCEMIA associated with malignancy, for the prevention of fracture and bone complications in patients with breast cancer and bone metastases, and for the treatment and prevention of POSTMENOPAUSAL OSTEOPOROSIS.	2.03	1	0
ziprasidone ziprasidone: a benzisothiazoylpiperazine derivative; has combined dopamine and serotonin receptor antagonist activity; structurally related to tiospirone. ziprasidone : A piperazine compound having 1,2-benzothiazol-3-yl- and 2-(6-chloro-1,3-dihydro-2-oxindol-5-yl)ethyl substituents attached to the nitrogen atoms.	2.74	3	0	1,2-benzisothiazole; indolones; organochlorine compound; piperazines	antipsychotic agent; dopaminergic antagonist; histamine antagonist; muscarinic antagonist; psychotropic drug; serotonergic antagonist
adefovir dipivoxil bis(pivaloyloxymethyl)-9-(2-phosphonylmethoxyethyl)adenine: structure given in first source. adefovir pivoxil : An organic phosphonate that is the dipivoxil ester of adefovir. A prodrug for adefovir, an HIV-1 reverse transcriptase inhibitor, adefovir pivoxil is used to treat chronic hepatitis B viral infection.	2.05	1	0	6-aminopurines; carbonate ester; ether; organic phosphonate	antiviral drug; DNA synthesis inhibitor; HIV-1 reverse transcriptase inhibitor; nephrotoxic agent; prodrug
mifobate mifobate: has antiatherosclerotic properties	2.05	1	0	trialkyl phosphate
tasosartan tasosartan: angiotensin II antagonist; structure given in first source	2.06	1	0	biphenyls
capecitabine Capecitabine: A deoxycytidine derivative and fluorouracil PRODRUG that is used as an ANTINEOPLASTIC ANTIMETABOLITE in the treatment of COLON CANCER; BREAST CANCER and GASTRIC CANCER.. capecitabine : A carbamate ester that is cytidine in which the hydrogen at position 5 is replaced by fluorine and in which the amino group attached to position 4 is converted into its N-(penyloxy)carbonyl derivative. Capecitabine is a antineoplastic agent used in the treatment of cancers.	2.05	1	0	carbamate ester; cytidines; organofluorine compound	antimetabolite; antineoplastic agent; prodrug
adenosine quinquefolan B: isolated from roots of Panax quinquefolium L.; RN not in Chemline 10/87; RN from Toxlit	6.21	10	1	adenosines; purines D-ribonucleoside	analgesic; anti-arrhythmia drug; fundamental metabolite; human metabolite; vasodilator agent
sodium molybdate(vi) sodium molybdate(VI): RN given refers to molybdic acid, di-Na salt. sodium molybdate (anhydrous) : An inorganic sodium salt having molybdate as the counterion.	2	1	0	inorganic sodium salt	poison
gadolinium chloride gadolinium chloride: a macrophage inhibitor; reduces pulmonary injury and inflammatory mediator production induced by inhaled ozone	2.7	3	0	gadolinium coordination entity	TRP channel blocker
vanadates Vanadates: Oxyvanadium ions in various states of oxidation. They act primarily as ion transport inhibitors due to their inhibition of Na(+)-, K(+)-, and Ca(+)-ATPase transport systems. They also have insulin-like action, positive inotropic action on cardiac ventricular muscle, and other metabolic effects.. vanadate(3-) : A vanadium oxoanion that is a trianion with formula VO4 in which the vanadium is in the +5 oxidation state and is attached to four oxygen atoms.	2.9	4	0	trivalent inorganic anion; vanadium oxoanion	EC 3.1.3.1 (alkaline phosphatase) inhibitor; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; EC 3.1.3.41 (4-nitrophenylphosphatase) inhibitor; EC 3.1.3.48 (protein-tyrosine-phosphatase) inhibitor
dimethylhydrazines Dimethylhydrazines: Hydrazines substituted with two methyl groups in any position.	1.95	1	0
musk xylene musk xylene : A C-nitro compound that is m-xylene bearing three nitro substituents at positions 2, 4 and 6 as well as a tert-butyl group at position 5.	1.99	1	0	C-nitro compound	carcinogenic agent; explosive; fragrance
acridine orange Acridine Orange: A cationic cytochemical stain specific for cell nuclei, especially DNA. It is used as a supravital stain and in fluorescence cytochemistry. It may cause mutations in microorganisms.. acridine orange : Fluorescent dye useful for cell cycle determination. It is cell-permeable, and interacts with DNA and RNA by intercalation or electrostatic attractions respectively.. acridine orange free base : A member of the class of aminoacridines that is acridine carrying two dimethylamino substituents at positions 3 and 6. The hydrochloride salt is the fluorescent dye 'acridine orange', used for cell cycle determination.	2.38	2	0	aminoacridines; aromatic amine; tertiary amino compound	fluorochrome; histological dye
saran Saran: RN given is for Saran 683, a copolymer of vinyl chloride and vinylidene chloride	1.94	1	0
tenocyclidine tenocyclidine : A tertiary amino compound that consists of cyclohexane having piperidin-1-yl and thiophen-2-yl groups attached at position 1. A dissociative anaesthetic drug with halluccinogenic and stimulant effects. Its effects are similar to those of phencyclidine (PCP, an analogue with the thienyl group replaced by phenyl), but it is rather more potent.	1.98	1	0	piperidines; tertiary amino compound; thiophenes	central nervous system stimulant; hallucinogen; neuroprotective agent; NMDA receptor antagonist
colestipol Colestipol: Highly crosslinked and insoluble basic anion exchange resin used as anticholesteremic. It may also may reduce triglyceride levels.. colestipol : A high molecular weight copolymer of diethylenetriamine and epichlorohydrin (hydrochloride), with approximately 1 out of 5 amine nitrogens protonated. Due to the highly cross-linked and insoluble nature of the material, no structural formula has been assigned and no specific molecular weight information is available. A basic anion exchange resin, it is used as its hydrochloride for binding bile acids in the intestine, inhibiting their reabsorption.	8.11	17	1
halofuginone [no description available]	2.05	1	0	quinazolines
trazodone hydrochloride Triticum: A plant genus of the family POACEAE that is the source of EDIBLE GRAIN. A hybrid with rye (SECALE CEREALE) is called TRITICALE. The seed is ground into FLOUR and used to make BREAD, and is the source of WHEAT GERM AGGLUTININS.. trazodone hydrochloride : A hydrochloride salt prepared from equimolar amounts of trazodone and hydrogen chloride.	3.09	5	0	hydrochloride	adrenergic antagonist; antidepressant; H1-receptor antagonist; sedative; serotonin uptake inhibitor
ortho-cept ethinyl estradiol-desogestrel combination: Ethinyl Estradiol and Desogestrell given in fixed proportions; has proved to be an effective & well-tolerated oral contraceptive, which improves cycle control & has a beneficial effect on acne	2.05	1	0
trovafloxacin trovafloxacin: a trifluoronaphthyridone derivative of 7-(3-azabicyclo(3.1.0)hexyl)naphthyridone; has antineoplastic activity. trovafloxacin : A 1,8-naphthyridine derivative that is 4-oxo-1,4-dihydro-1,8-naphthyridine-3-carboxylic acid bearing additional 2,4-difluorophenyl, fluoro and 6-amino-3-azabicyclo[3.1.0]hex-3-yl substituents at positions 1, 6 and 7 respectively. A broad-spectrum antibiotic that was withdrawn from the market due to risk of liver failure.	2.46	2	0
cefprozil [no description available]	2.05	1	0	cephalosporin; semisynthetic derivative	antibacterial drug
dexamethasone dipropionate [no description available]	2.02	1	0	corticosteroid hormone
4-[1-[4-[2-(dimethylamino)ethoxy]phenyl]-2-phenylbut-1-enyl]phenol [no description available]	2.05	1	0	stilbenoid
efavirenz efavirenz: HIV-1 reverse transcriptase inhibitor. efavirenz : 1,4-Dihydro-2H-3,1-benzoxazin-2-one substituted at the 4 position by cyclopropylethynyl and trifluoromethyl groups (S configuration) and at the 6 position by chlorine. A non-nucleoside reverse transcriptase inhibitor with activity against HIV, it is used with other antiretrovirals for combination therapy of HIV infection.	2.05	1	0	acetylenic compound; benzoxazine; cyclopropanes; organochlorine compound; organofluorine compound	antiviral drug; HIV-1 reverse transcriptase inhibitor
nelfinavir Nelfinavir: A potent HIV protease inhibitor. It is used in combination with other antiviral drugs in the treatment of HIV in both adults and children.. nelfinavir : An aryl sulfide that is used (as its mesylate salt) for treatment of HIV and also exhibits some anticancer properties.	2.46	2	0	aryl sulfide; benzamides; organic heterobicyclic compound; phenols; secondary alcohol; tertiary amino compound	antineoplastic agent; HIV protease inhibitor
2,4-diamino-5-adamantyl-6-methylpyrimidine [no description available]	1.98	1	0
doxapram hydrochloride [no description available]	2.05	1	0	hydrochloride	central nervous system stimulant
glucose, (beta-d)-isomer beta-D-glucose : D-Glucopyranose with beta configuration at the anomeric centre.. (1->4)-beta-D-glucan : A beta-D-glucan in which the glucose units are connected by (1->4) linkages.. (1->3)-beta-D-glucan : A beta-D-glucan in which the glucose units are connected by (1->3) linkages.	6.16	10	1	D-glucopyranose	epitope; mouse metabolite
benzathine cloxacillin benzathine cloxacillin: Orbenin D.C. contains 500 mg of benzathine cloxacillin	1.97	1	0	benzathine(2+) salt
mevastatin mevastatin: antifungal metabolite from Penicillium brevicopactum; potent inhibitory activity to sterol synthesis; structure. mevastatin : A carboxylic ester that is pravastatin that is lacking the allylic hydroxy group. A hydroxymethylglutaryl-CoA reductase inhibitor (statin) isolated from Penicillium citrinum and from Penicillium brevicompactum, its clinical use as a lipid-regulating drug ceased following reports of toxicity in animals.	3.06	1	0	2-pyranones; carboxylic ester; hexahydronaphthalenes; polyketide; statin (naturally occurring)	antifungal agent; apoptosis inducer; EC 3.4.24.83 (anthrax lethal factor endopeptidase) inhibitor; fungal metabolite; Penicillium metabolite
lanthanum chloride lanthanum chloride: RN given refers to parent cpd	2.4	2	0
propamidine propamidine: structure given in first source. propamidine : A polyether that is the bis(4-guanidinophenyl) ether of propane-1,3-diol. Used (as its isethionate salt) for the treatment of minor eye or eyelid infections, such as conjunctivitis and blepharitis.	4.34	6	0	aromatic ether; guanidines; polyether	antimicrobial agent; antiseptic drug
1,5-anhydroglucitol 1,5-anhydroglucitol: structure. 1,5-anhydro-D-glucitol : An anhydro sugar of D-glucitol.	2.05	1	0	anhydro sugar	human metabolite
cyclen cyclen: macrocyclic polyamine metal-complexing agent. 1,4,7,10-tetraazacyclododecane : An azacycloalkane that is cyclododecane in which the carbon atoms at positions 1, 4, 7 and 10 are replaced by nitrogen atoms.	2.13	1	0	azacycloalkane; crown amine; saturated organic heteromonocyclic parent
thiazolyl blue thiazolyl blue: RN & II refers to bromide. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide : The bromide salt of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium.	2.04	1	0	organic bromide salt	colorimetric reagent; dye
3-methylhistidine 3-methylhistidine: marker for myofibrillar-protein breakdown; RN given refers to (L)-isomer. 3-methylhistidine : A methylhistidine in which the methyl group is located at N-3.. N(pros)-methyl-L-histidine : A L-histidine derivative that is L-histidine substituted by a methyl group at position 3 on the imidazole ring.	1.97	1	0	L-histidine derivative; non-proteinogenic L-alpha-amino acid; zwitterion	human metabolite; Saccharomyces cerevisiae metabolite
betulinic acid [no description available]	2.05	1	0	hydroxy monocarboxylic acid; pentacyclic triterpenoid	anti-HIV agent; anti-inflammatory agent; antimalarial; antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; plant metabolite
baicalin [no description available]	2.02	1	0	dihydroxyflavone; glucosiduronic acid; glycosyloxyflavone; monosaccharide derivative	antiatherosclerotic agent; antibacterial agent; anticoronaviral agent; antineoplastic agent; antioxidant; cardioprotective agent; EC 2.7.7.48 (RNA-directed RNA polymerase) inhibitor; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; ferroptosis inhibitor; neuroprotective agent; non-steroidal anti-inflammatory drug; plant metabolite; prodrug
plerixafor plerixafor: a bicyclam derivate, highly potent & selective inhibitor of HIV-1 & HIV-2. plerixafor : An azamacrocycle consisting of two cyclam rings connected by a 1,4-phenylenebis(methylene) linker. It is a CXCR4 chemokine receptor antagonist and a hematopoietic stem cell mobilizer. It is used in combination with grulocyte-colony stimulating factor (G-CSF) to mobilize hematopoietic stem cells to the perpheral blood for collection and subsequent autologous transplantation in patients with non-Hodgkin's lymphoma and multiple myeloma.	2.04	1	0	azacycloalkane; azamacrocycle; benzenes; crown amine; secondary amino compound; tertiary amino compound	anti-HIV agent; antineoplastic agent; C-X-C chemokine receptor type 4 antagonist; immunological adjuvant
amprenavir [no description available]	2.46	2	0	carbamate ester; sulfonamide; tetrahydrofuryl ester	antiviral drug; HIV protease inhibitor
oseltamivir Oseltamivir: An acetamido cyclohexene that is a structural homolog of SIALIC ACID and inhibits NEURAMINIDASE.. oseltamivir : A cyclohexenecarboxylate ester that is the ethyl ester of oseltamivir acid. An antiviral prodrug (it is hydrolysed to the active free carboxylic acid in the liver), it is used to slow the spread of influenza.	2.06	1	0	acetamides; amino acid ester; cyclohexenecarboxylate ester; primary amino compound	antiviral drug; EC 3.2.1.18 (exo-alpha-sialidase) inhibitor; environmental contaminant; prodrug; xenobiotic
allicin [no description available]	2.01	1	0	botanical anti-fungal agent; sulfoxide	antibacterial agent
benethamine penicillin [no description available]	8.43	1	1	benethamine salt
epigallocatechin gallate epigallocatechin gallate: a steroid 5alpha-reductase inhibitor and antimutagen in green tea (Camellia sinensis). (-)-epigallocatechin 3-gallate : A gallate ester obtained by the formal condensation of gallic acid with the (3R)-hydroxy group of (-)-epigallocatechin.	3.6	2	0	flavans; gallate ester; polyphenol	antineoplastic agent; antioxidant; apoptosis inducer; geroprotector; Hsp90 inhibitor; neuroprotective agent; plant metabolite
hexamidine hexamidine : A polyether that is the bis(4-guanidinophenyl) ether of hexane-1,6-diol.	2.01	1	0	aromatic ether; guanidines; polyether	antimicrobial agent; antiseptic drug
1,2-distearoyllecithin [no description available]	1.96	1	0
kasugamycin kasugamycin: experimental antimicrobial agent from Streptomyces kausugaensis; used in pseudomonas infections; interfers with protein synthesis in susceptible Escherichia coli. kasugamycin : An amino cyclitol glycoside that is isolated from Streptomyces kasugaensis and exhibits antibiotic and fungicidal properties.	2.4	2	0
metaperiodate Periodic Acid: A strong oxidizing agent.	1.95	1	0	iodine oxoacid
1,2,3,4,6-pentakis-O-galloyl-beta-D-glucose pentagalloylglucose: pentahydroxy gallic acid ester of glucose; a phytogenic antineoplastic agent and antibacterial agent. 1,2,3,4,6-pentakis-O-galloyl-beta-D-glucose : A galloyl-beta-D-glucose compound having five galloyl groups in the 1-, 2-, 3-, 4- and 6-positions.	2.52	2	0	gallate ester; galloyl beta-D-glucose	anti-inflammatory agent; antineoplastic agent; geroprotector; hepatoprotective agent; plant metabolite; radiation protective agent; radical scavenger
glutathione disulfide Glutathione Disulfide: A GLUTATHIONE dimer formed by a disulfide bond between the cysteine sulfhydryl side chains during the course of being oxidized.	2.41	2	0	glutathione derivative; organic disulfide	Escherichia coli metabolite; mouse metabolite
betamethasone sodium phosphate betamethasone sodium phosphate: phosphate ester of betamethasone; RN given refers to the di-Na salt (11beta,16beta)-isomer; structure in Negwer,5th ed, 4975. betamethasone sodium phosphate : An organic sodium salt that is the disodium salt of betamethasone phosphate.	4.14	3	1	organic sodium salt; tertiary alpha-hydroxy ketone
sinefungin [no description available]	2.41	2	0	adenosines; non-proteinogenic alpha-amino acid	antifungal agent; antimicrobial agent
cephalosporin c cephalosporin C: RN given refers to parent cpd; structure in Merck, 9th ed, #1937. cephalosporin C : A cephalosporin antibiotic carrying a 3-acetoxymethyl substituent and a 6-oxo-N(6)-L-lysino group at position 7.	12.08	50	2	cephalosporin	fungal metabolite
tilbroquinol [no description available]	2.06	1	0	organohalogen compound; quinolines
bendamustine [no description available]	2.05	1	0	benzimidazoles
erdosteine [no description available]	2.05	1	0	N-acyl-amino acid
droxicam droxicam: structure given in first source. droxicam : An organic heterotricyclic compound that is 2H,5H-[1,3]oxazino[5,6-c][1,2]benzothiazine-2,4(3H)-dione 6,6-dioxide substituted at positions 3 and 5 by pyridin-2-yl and methyl groups respectively. A prodrug of piroxicam, it is used for the relief of pain and inflammation in musculoskeletal disorders such as rheumatoid arthritis and osteoarthritis.	2.06	1	0	organic heterotricyclic compound; pyridines	cyclooxygenase 1 inhibitor; hepatotoxic agent; non-narcotic analgesic; non-steroidal anti-inflammatory drug; platelet aggregation inhibitor; prodrug
ceftezole ceftezole: RN given refers to (6R-(trans))-isomer; structure. ceftezole : A first-generation cephalosporin antibiotic having (1,3,4-thiadiazol-2-ylsulfanyl)methyl and [2-(1H-tetrazol-1-yl)acetamido side groups located at positions 3 and 7 respectively.	2.04	1	0	cephalosporin; thiadiazoles
ecabet ecabet: structure in first source	2.11	1	0	diterpenoid
bicozamycin bicozamycin : A commercially important azabicyclic antibiotic obtained from Streptomyces sapporonensis. It inhibits the Rho protein of E. coli.	1.96	1	0	azabicycloalkane; bridged compound	antibacterial agent; antidiarrhoeal drug; antiinfective agent
ebrotidine ebrotidine: an H2-receptor antagonist and gastric mucosa protector	2.06	1	0	sulfonamide
web 2086 WEB 2086: structure given in first source; PAF antagonist	1.98	1	0	organonitrogen heterocyclic compound; organosulfur heterocyclic compound
mizolastine [no description available]	2.05	1	0	benzimidazoles
intoplicine intoplicine: structure in first source	2.05	1	0	pyridoindole
telmisartan Telmisartan: A biphenyl compound and benzimidazole derivative that acts as an angiotensin II type 1 receptor antagonist. It is used in the management of HYPERTENSION.. telmisartan : A member of the class of benzimidazoles used widely in the treatment of hypertension.	2.75	3	0	benzimidazoles; biphenyls; carboxybiphenyl	angiotensin receptor antagonist; antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; environmental contaminant; xenobiotic
methacycline [no description available]	2.89	4	0	1,2-diglyceride
hexestrol bis(diethylaminoethyl ether) hexestrol bis(diethylaminoethyl ether): minor descriptor (75-84); on-line & Index Medicus search HEXESTROL/AA (75-84); RN given refers to parent cpd without isomeric designation	2.04	1	0	stilbenoid
dexfenfluramine Dexfenfluramine: The S-isomer of FENFLURAMINE. It is a serotonin agonist and is used as an anorectic. Unlike fenfluramine, it does not possess any catecholamine agonist activity.. (S)-fenfluramine : The S-enantiomer of fenfluramine. It stimulates the release of serotonin and selectively inhibits its reuptake, but unlike fenfluramine it does not possess catecholamine agonist activity. It was formerly given by mouth as the hydrochloride in the treatment of obesity, but, like fenfluramine, was withdrawn wolrdwide following reports of valvular heart defects.	2.05	1	0	fenfluramine	appetite depressant; serotonergic agonist; serotonin uptake inhibitor
2-methoxyestradiol 2-methoxy-17beta-estradiol : A 17beta-hydroxy steroid, being 17beta-estradiol methoxylated at C-2.	2.05	1	0	17beta-hydroxy steroid; 3-hydroxy steroid	angiogenesis modulating agent; antimitotic; antineoplastic agent; human metabolite; metabolite; mouse metabolite
anthraquinone-2,6-disulfonate anthraquinone-2,6-disulfonate: structure in first source. anthraquinone-2,6-disulfonic acid : A member of the class of anthraquinones that is 9,10-anthraquinone substituted at positions 2 and 6 by sulfo groups.	2.02	1	0	anthraquinone; arenesulfonic acid
propamidine isethionate propamidine isethionate : A guanidinium salt obtained by combining propamidine with two molar equivalents of isethionic acid. Used for the treatment of minor eye or eyelid infections, such as conjunctivitis and blepharitis.	4.87	8	1	guanidinium salt; organosulfonate salt	antimicrobial agent; antiseptic drug
1,7-phenanthroline [no description available]	4.6	6	1	phenanthroline
triazoles Triazoles: Heterocyclic compounds containing a five-membered ring with two carbon atoms and three nitrogen atoms with the molecular formula C2H3N3.. triazoles : An azole in which the five-membered heterocyclic aromatic skeleton contains three N atoms and two C atoms.	3.39	7	0	1,2,3-triazole
6-methyladenine 6-methyladenine: structure. 6-methyladenine : A methyladenine that is 9H-purin-6-amine substituted by a methyl group at the amino nitrogen.	1.93	1	0	6-alkylaminopurine; methyladenine	human metabolite
azauracil azauracil: minor descriptor (64-72); major descriptor (73-86); on line search URACIL (66-74); URACIL/AA (75-86); INDEX MEDICUS search URACIL (64-72); AZAURACIL (73-86). 6-azauracil : A 1,2,4-triazine compound having oxo-substituents at the 3- and 5-positions.	2.36	2	0	1,2,4-triazines; nucleobase analogue	antimetabolite
delphinidin Paraffin: A mixture of solid hydrocarbons obtained from petroleum. It has a wide range of uses including as a stiffening agent in ointments, as a lubricant, and as a topical anti-inflammatory. It is also commonly used as an embedding material in histology.. delphinidin chloride : An anthocyanidin chloride that has delphinidin as the cationic counterpart.	4.26	4	1	anthocyanidin chloride
disobutamide [no description available]	2.04	1	0	acetamides
medetomidine Medetomidine: An agonist of RECEPTORS, ADRENERGIC ALPHA-2 that is used in veterinary medicine for its analgesic and sedative properties. It is the racemate of DEXMEDETOMIDINE.	2.05	1	0	imidazoles
fluorodeoxyglucose f18 Fluorodeoxyglucose F18: The compound is given by intravenous injection to do POSITRON-EMISSION TOMOGRAPHY for the assessment of cerebral and myocardial glucose metabolism in various physiological or pathological states including stroke and myocardial ischemia. It is also employed for the detection of malignant tumors including those of the brain, liver, and thyroid gland. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1162)	4.8	1	1	2-deoxy-2-((18)F)fluoro-D-glucose; 2-deoxy-2-fluoro-aldehydo-D-glucose
sertraline Sertraline: A selective serotonin uptake inhibitor that is used in the treatment of depression.. sertraline : A member of the class of tetralins that is tetralin which is substituted at positions 1 and 4 by a methylamino and a 3,4-dichlorophenyl group, respectively (the S,S diastereoisomer). A selective serotonin-reuptake inhibitor (SSRI), it is administered orally as the hydrochloride salt as an antidepressant for the treatment of depression, obsessive-compulsive disorder, panic disorder and post-traumatic stress disorder.	2.74	3	0	dichlorobenzene; secondary amino compound; tetralins	antidepressant; serotonin uptake inhibitor
picosulfate sodium picosulfate sodium: contains two active ingredients, sodium picosulfate and magnesium citrate, which are both laxatives; structure	2.05	1	0	aryl sulfate; pyridines
arbekacin arbekacin: structure given in first source. arbekacin : A kanamycin that is kanamycin B bearing an N-(2S)-4-amino-2-hydroxybutyryl group on the aminocyclitol ring.	3.54	8	0	aminoglycoside; kanamycins	antibacterial agent; antibacterial drug; antimicrobial agent; protein synthesis inhibitor
selfotel selfotel: a N-methyl-D-aspartate (NMDA) antagonist; used to treat stroke-induced impairment	2.05	1	0	non-proteinogenic alpha-amino acid
zoledronic acid Zoledronic Acid: An imidobisphosphonate inhibitor of BONE RESORPTION that is used for the treatment of malignancy-related HYPERCALCEMIA; OSTEITIS DEFORMANS; and OSTEOPOROSIS.. zoledronic acid : An imidazole compound having a 2,2-bis(phosphono)-2-hydroxyethane-1-yl substituent at the 1-position.	2.44	2	0	1,1-bis(phosphonic acid); imidazoles	bone density conservation agent
dienogest [no description available]	2.05	1	0	17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; aliphatic nitrile; steroid hormone	progesterone receptor agonist; progestin; synthetic oral contraceptive
clostebol [no description available]	2.48	2	0	3-hydroxy steroid	androgen
morphazinamide morphazinamide: RN given refers to parent cpd; RN in Chemline for mono-HCL: 1473-73-0; structure in Merck Index	2.05	1	0	morpholines; pyrazines; secondary carboxamide
dipropylacetamide dipropylacetamide: structure. valpromide : A fatty amide derived from valproic acid.	2.67	3	0	fatty amide	geroprotector; metabolite; teratogenic agent
pafenolol pafenolol: structure given in first source	2.46	2	0
nefiracetam [no description available]	1.98	1	0	organonitrogen compound; organooxygen compound
acamprosate Acamprosate: Structural analog of taurine that is used for the prevention of relapse in individuals with ALCOHOLISM.. acamprosate : An organosulfonic acid that is propane-1-sulfonic acid substituted by an acetylamino group at position 3.	2.06	1	0	acetamides; organosulfonic acid	environmental contaminant; neurotransmitter agent; xenobiotic
isaxonine isaxonine: promotes nerve growth	2.06	1	0	aminopyrimidine
enrofloxacin Enrofloxacin: A fluoroquinolone antibacterial and antimycoplasma agent that is used in veterinary practice.. enrofloxacin : A quinolinemonocarboxylic acid that is 1,4-dihydroquinoline-3-carboxylic acid substituted by an oxo group at position 4, a fluoro group at position 6, a cyclopropyl group at position 1 and a 4-ethylpiperazin-1-yl group at position 7. It is a veterinary antibacterial agent used for the treatment of pets.	3.3	6	0	cyclopropanes; N-alkylpiperazine; N-arylpiperazine; organofluorine compound; quinolinemonocarboxylic acid; quinolone	antibacterial agent; antimicrobial agent; antineoplastic agent
nicotinohydroxamic acid [no description available]	3.75	2	1	pyridinecarboxamide
6-amino-1-hydroxyhexane-1,1-diphosphonate 6-amino-1-hydroxyhexane-1,1-diphosphonate: used for therapy of Paget's disease of bone & malignant hypercalcaemia	2.03	1	0	1,1-bis(phosphonic acid)
dexrazoxane Dexrazoxane: The (+)-enantiomorph of razoxane.	2.05	1	0	razoxane	antineoplastic agent; cardiovascular drug; chelator; immunosuppressive agent
clobetasone butyrate [no description available]	4.32	2	2	organic molecular entity
masoprocol Masoprocol: A potent lipoxygenase inhibitor that interferes with arachidonic acid metabolism. The compound also inhibits formyltetrahydrofolate synthetase, carboxylesterase, and cyclooxygenase to a lesser extent. It also serves as an antioxidant in fats and oils.. masoprocol : The meso-form of nordihydroguaiaretic acid. An antioxidant found in the creosote bush, Larrea divaricata, it is a potent lipoxygenase inhibitor that interferes with arachidonic acid metabolism. It also inhibits (though to a lesser extent) formyltetrahydrofolate synthetase, carboxylesterase, and cyclooxygenase.	2.39	2	0	nordihydroguaiaretic acid	antineoplastic agent; hypoglycemic agent; lipoxygenase inhibitor; metabolite
fenoxypropazine [no description available]	2.06	1	0	aromatic ether
voriconazole Voriconazole: A triazole antifungal agent that specifically inhibits STEROL 14-ALPHA-DEMETHYLASE and CYTOCHROME P-450 CYP3A.. voriconazole : A triazole-based antifungal agent used for the treatment of esophageal candidiasis, invasive pulmonary aspergillosis, and serious fungal infections caused by Scedosporium apiospermum and Fusarium spp. It is an inhibitor of cytochrome P450 2C9 (CYP2C9) and CYP3A4.	2.05	1	0	conazole antifungal drug; difluorobenzene; pyrimidines; tertiary alcohol; triazole antifungal drug	P450 inhibitor
betamipron [no description available]	2.05	1	0	organonitrogen compound; organooxygen compound
penethamate hydroiodide penethamate hydroiodide: structure	4.4	2	2
clociguanil clociguanil: RN given refers to parent cpd; structure	2.04	1	0
nitrefazole [no description available]	2.06	1	0	imidazoles
cyclobutyrol cyclobutyrol: RN given refers to parent cpd; structure. cyclobutyrol : A hydroxy monocarboxylic acid in which the hydroxy group is geminal to a 1-carboxypropyl group on a cyclohexane ring.	2.05	1	0	hydroxy monocarboxylic acid	bile therapy drug
terlipressin terlivaz: first FDA approved injection to improve kidney function in adults with hepatorenal syndrome (HRS) with rapid reduction in kidney function.	2.05	1	0	polypeptide
tolmesoxide tolmesoxide: structure	2.05	1	0
isoflavone [no description available]	2.05	1	0	isoflavones
clevudine [no description available]	2.05	1	0
neamine neamine: fragment of NEOMYCIN B; structure in first source. neamine : 2-Deoxy-D-streptamine glycosylated at the 4-oxygen with a 6-amino-alpha-D-glucosaminyl group.	10.08	90	3	2,6-dideoxy-alpha-D-glucoside; aminoglycoside	antibacterial agent
lividomycin [no description available]	5.12	14	0	lividomycins	metabolite
gentamicin c1 [no description available]	3.28	6	0
gentamicin c1a [no description available]	4.22	4	0	gentamycin C
leupeptin [no description available]	2.7	3	0	aldehyde; tripeptide	bacterial metabolite; calpain inhibitor; cathepsin B inhibitor; EC 3.4.21.4 (trypsin) inhibitor; serine protease inhibitor
phleomycins Phleomycins: Water-soluble, copper-containing low molecular weight polypeptides obtained from the culture medium of Streptomyces verticillus. They are specific inhibitors of DNA synthesis in bacteria and have been found to act as antitumor agents. They have also been used against rust fungi of plants.. phleomycin : A mixture of glycopeptide antibiotics originally isolated from the bacterium Streptomyces verticillus whose components all contain a thiazolinylthiazole moiety and can form complexes with redox-active metals such as Co, Cu, and Fe. (Bleomycins are very similar to phleomycins, but have a bithiazole moiety in place of the thiazolinylthiazole moiety).	2.01	1	0
fla 365 FLA 365: RN given refers to parent cpd; structure given in first source	1.98	1	0
1-aminohydantoin 1-aminohydantoin: a metabolite of nitrofurantoin	1.93	1	0	imidazolidine-2,4-dione
2-(4'-methylpiperazino-1-methyl)-1,3-diazafluoranthene 1-oxide 2-(4'-methylpiperazino-1-methyl)-1,3-diazafluoranthene 1-oxide: structure	2.04	1	0
tetrandrine tetrandrine: a bisbenzylisoquinoline that exhibits antifibrogenic activity	2.05	1	0	bisbenzylisoquinoline alkaloid; isoquinolines
calpeptin [no description available]	2.03	1	0	amino acid amide
dehydroleucodine dehydroleucodine: has antimicrobial activity; RN given refers to (3aS-(3aalpha,9aalpha,9bbeta))-isomer	2.13	1	0
oxazolidin-2-one Oxazolidinones: Derivatives of oxazolidin-2-one. They represent an important class of synthetic antibiotic agents.. oxazolidin-2-one : An oxazolidinone that is 1,3-oxazolidine with an oxo substituent at position 2.. oxazolidinone : An oxazolidine containing one or more oxo groups.	2.43	2	0	carbamate ester; oxazolidinone	metabolite
octadecyl palmitate octadecyl palmitate: found in psoriatic nail, but not in normal nails. stearyl palmitate : A palmitate ester resulting from the formal condensation of the carboxy group of palmitic acid with the hydroxy group of stearyl alcohol.	6.45	14	1	hexadecanoate ester; wax ester	coral metabolite; cosmetic
6-carboxyfluorescein 6-carboxyfluorescein: originally sold as 6-carboxyfluorescein, but commercial product is a mixture of two isomers; correct name is 5(6)-carboxyfluorescein	1.97	1	0	monocarboxylic acid
rivastigmine [no description available]	2.06	1	0	carbamate ester; tertiary amino compound	cholinergic drug; EC 3.1.1.8 (cholinesterase) inhibitor; neuroprotective agent
rosiglitazone [no description available]	2.46	2	0	aminopyridine; thiazolidinediones	EC 6.2.1.3 (long-chain-fatty-acid--CoA ligase) inhibitor; ferroptosis inhibitor; insulin-sensitizing drug
ruthenium dioxide ruthenium dioxide: RN given refers to cpd with MF of Ru-O2	1.97	1	0
clarithromycin Clarithromycin: A semisynthetic macrolide antibiotic derived from ERYTHROMYCIN that is active against a variety of microorganisms. It can inhibit PROTEIN SYNTHESIS in BACTERIA by reversibly binding to the 50S ribosomal subunits. This inhibits the translocation of aminoacyl transfer-RNA and prevents peptide chain elongation.. clarithromycin : The 6-O-methyl ether of erythromycin A, clarithromycin is a macrolide antibiotic used in the treatment of respiratory-tract, skin and soft-tissue infections. It is also used to eradicate Helicobacter pylori in the treatment of peptic ulcer disease. It prevents bacteria from growing by interfering with their protein synthesis.	2.74	3	0	macrolide antibiotic	antibacterial drug; environmental contaminant; protein synthesis inhibitor; xenobiotic
primin primin: contact allergen found in the ornamental plant Primula obconica Hance. primin : A 1,4-benzoquinone having a methoxy substituent at the 2-position and a pentyl substituent at the 6-position.	1.98	1	0	1,4-benzoquinones	allergen; antifeedant; antimicrobial agent; hapten; metabolite
metconazole metconazole : A member of the class of cyclopentanols carrying 1,2,4-triazol-1-ylmethyl and 4-chlorobenzyl and geminal dimethyl substituents at positions 1, 2 and 5 respectively. Used to control a range of fungal infections including alternaria, rusts, fusarium and septoria diseases.	2.1	1	0	conazole fungicide; cyclopentanols; monochlorobenzenes; tertiary alcohol; triazole fungicide; triazoles	antifungal agrochemical; EC 1.14.13.70 (sterol 14alpha-demethylase) inhibitor
coenzyme a [no description available]	3.23	6	0	adenosine 3',5'-bisphosphate	coenzyme; Escherichia coli metabolite; mouse metabolite
convicine convicine: structure	1.98	1	0	glycoside
nicotine (S)-nicotine : A 3-(1-methylpyrrolidin-2-yl)pyridine in which the chiral centre has S-configuration. The naturally occurring and most active enantiomer of nicotine, isolated from Nicotiana tabacum.	3.37	7	0	3-(1-methylpyrrolidin-2-yl)pyridine	anxiolytic drug; biomarker; immunomodulator; mitogen; neurotoxin; nicotinic acetylcholine receptor agonist; peripheral nervous system drug; phytogenic insecticide; plant metabolite; psychotropic drug; teratogenic agent; xenobiotic
fibrinogen Fibrinogen: Plasma glycoprotein clotted by thrombin, composed of a dimer of three non-identical pairs of polypeptide chains (alpha, beta, gamma) held together by disulfide bonds. Fibrinogen clotting is a sol-gel change involving complex molecular arrangements: whereas fibrinogen is cleaved by thrombin to form polypeptides A and B, the proteolytic action of other enzymes yields different fibrinogen degradation products.. D-iditol : The D-enantiomer of iditol.	5.15	3	1	iditol	fungal metabolite
moexipril [no description available]	2.46	2	0	peptide
sennoside B sennoside B : A member of the class of sennosides that is (9R,9'S)-9,9',10,10'-tetrahydro-9,9'-bianthracene-2,2'-dicarboxylic acid which is substituted by hydroxy groups at positions 4 and 4', by beta-D-glucopyranosyloxy groups at positions 5 and 5', and by oxo groups at positions 10 and 10'.	2.04	1	0	oxo dicarboxylic acid; sennosides
fluocinolone [no description available]	2.34	2	0	fluorinated steroid
homocysteine Homocysteine: A thiol-containing amino acid formed by a demethylation of METHIONINE.. homocysteine : A sulfur-containing amino acid consisting of a glycine core with a 2-mercaptoethyl side-chain.. L-homocysteine : A homocysteine that has L configuration.	2.36	2	0	amino acid zwitterion; homocysteine; serine family amino acid	fundamental metabolite; mouse metabolite
alpha,beta-methyleneadenosine 5'-triphosphate alpha,beta-methyleneadenosine 5'-triphosphate: do not confuse with beta,gamma-methylene ATP; RN given refers to parent cpd	1.99	1	0	nucleoside triphosphate analogue
lopinavir [no description available]	2.46	2	0	amphetamines; dicarboxylic acid diamide	anticoronaviral agent; antiviral drug; HIV protease inhibitor
beta-hydroxyphenylpropionic acid beta-hydroxyphenylpropionic acid: benzoic acid metabolite in urine. 3-hydroxy-3-phenylpropionic acid : A 3-hydroxy carboxylic acid that is 3-phenylpropionic acid in which one of the hydrogens beta to the carboxy group is replaced by a hydroxy group.	1.98	1	0	3-hydroxy carboxylic acid; monocarboxylic acid
6-deoxyglucose 6-deoxyglucose: RN given refers to (D)-isomer; Main Heading DEOXYGLUCOSE refers to 2-deoxyglucose	1.98	1	0	quinovose
dimethacrine dimethacrine: minor descriptor (75-84); on-line & Index Medicus search ACRIDINES (75-84); RN given refers to parent cpd without isomeric designation	2.04	1	0	acridines
glucuronic acid Glucuronic Acid: A sugar acid formed by the oxidation of the C-6 carbon of GLUCOSE. In addition to being a key intermediate metabolite of the uronic acid pathway, glucuronic acid also plays a role in the detoxification of certain drugs and toxins by conjugating with them to form GLUCURONIDES.. D-glucuronic acid : The D-enantiomer of glucuronic acid.. D-glucopyranuronic acid : A D-glucuronic acid in cyclic pyranose form.	2.88	4	0	D-glucuronic acid	algal metabolite
beta-aspartylglycine beta-aspartylglycine: found in cecum of germ-free & antibiotic-treated mice; RN given refers to (L-beta)-isomer	1.96	1	0	dipeptide
phorbolol myristate acetate [no description available]	2.01	1	0
karanjin karanjin: structure given in first source	2.06	1	0	extended flavonoid
2-hydroxyhydroquinonephthalein [no description available]	1.96	1	0
pregnanetriol Pregnanetriol: A metabolite of 17-ALPHA-HYDROXYPROGESTERONE, normally produced in small quantities by the GONADS and the ADRENAL GLANDS, found in URINE. An elevated urinary pregnanetriol is associated with CONGENITAL ADRENAL HYPERPLASIA with a deficiency of STEROID 21-HYDROXYLASE.	2.35	2	0	corticosteroid hormone
phenglutarimide phenglutarimide: RN given refers to parent cpd; structure	2.05	1	0	piperidines
cobalt Cobalt: A trace element that is a component of vitamin B12. It has the atomic symbol Co, atomic number 27, and atomic weight 58.93. It is used in nuclear weapons, alloys, and pigments. Deficiency in animals leads to anemia; its excess in humans can lead to erythrocytosis.. cobalt(1+) : A monovalent inorganic cation obtained from cobalt.. cobalt atom : A cobalt group element atom that has atomic number 27.	5.36	19	0	cobalt group element atom; metal allergen	micronutrient
p-methoxy-n-methylphenethylamine p-Methoxy-N-methylphenethylamine: A potent mast cell degranulator. It is involved in histamine release.. N,O-dimethyltyramine : A secondary amino compound that is tyramine in which the hydrogen of the phenolic hydroxy group has been replaced by a methyl group.	3.37	7	0	aromatic ether; secondary amino compound	metabolite
fulvestrant Fulvestrant: An estradiol derivative and estrogen receptor antagonist that is used for the treatment of estrogen receptor-positive, locally advanced or metastatic breast cancer.. fulvestrant : A 3-hydroxy steroid that is 17beta-estradiol in which the 7alpha hydrogen has been replaced by a nonyl group in which one of the hydrogens of the terminal methyl has been replaced by a (4,4,5,5,5-pentafluoropentyl)sulfinyl group. An estrogen receptor antagonist, it is used in the treatment of breast cancer.	2.07	1	0	17beta-hydroxy steroid; 3-hydroxy steroid; organofluorine compound; sulfoxide	antineoplastic agent; estrogen antagonist; estrogen receptor antagonist
1,2-bis(2-aminophenoxy)ethane-n,n,n',n'-tetraacetic acid 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid: structure in first source	3.24	6	0	polyamino carboxylic acid; tetracarboxylic acid	chelator
1-amino-1,3-dicarboxycyclopentane 1-amino-1,3-dicarboxycyclopentane: RN given refers to (cis)-isomer	2.9	4	0
u 73122 1-(6-((3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-2,5-dione: structure given in first source. U-73122 : An aza-steroid that is 3-O-methyl-17beta-estradiol in which the 17beta-hydroxy group is replaced by a 6-(maleimid-1-yl)hexylamino group. An inibitor of phospholipase C.	5.21	48	0	aromatic ether; aza-steroid; maleimides	EC 3.1.4.11 (phosphoinositide phospholipase C) inhibitor
1,4-dihydropyridine [no description available]	2.39	2	0
imipenem, anhydrous Imipenem: Semisynthetic thienamycin that has a wide spectrum of antibacterial activity against gram-negative and gram-positive aerobic and anaerobic bacteria, including many multiresistant strains. It is stable to beta-lactamases. Clinical studies have demonstrated high efficacy in the treatment of infections of various body systems. Its effectiveness is enhanced when it is administered in combination with CILASTATIN, a renal dipeptidase inhibitor.. imipenem : A broad-spectrum, intravenous beta-lactam antibiotic of the carbapenem subgroup.	3.16	5	0	beta-lactam antibiotic allergen; carbapenems; zwitterion	antibacterial drug
quin2 Quin2: fluorescent highly selective Ca indicator, binding Ca 1:1; structure given in first source	1.97	1	0
sr141716 [no description available]	2.05	1	0	amidopiperidine; carbohydrazide; dichlorobenzene; monochlorobenzenes; pyrazoles	anti-obesity agent; appetite depressant; CB1 receptor antagonist
bosentan anhydrous Bosentan: A sulfonamide and pyrimidine derivative that acts as a dual endothelin receptor antagonist used to manage PULMONARY HYPERTENSION and SYSTEMIC SCLEROSIS.	2.75	3	0	primary alcohol; pyrimidines; sulfonamide	antihypertensive agent; endothelin receptor antagonist
fluo-3 Fluo-3: fluorescent Ca(2+) indicator; permits continuous monitoring of Ca without interference with use of UV-sensitive caged compounds	2.4	2	0	xanthene dye	fluorochrome
selenomethionine [no description available]	2.05	1	0	amino acid zwitterion; selenomethionine	plant metabolite
fura-2-am fura-2-am: pentaester precursor of fura-2	3.09	5	0
quin2-acetoxymethyl ester Quin2-acetoxymethyl ester: structure given in first source	2	1	0
u 78517f U 78517F: iron-catalyzed lipid peroxidation inhibitor; structure given in first source; RN given is for diHCl	1.99	1	0
inositol-1,3,4,5-tetrakisphosphate inositol-1,3,4,5-tetrakisphosphate: for cpd without numerical locants of phosphate groups, index INOSITOL PHOSPHATES. 1D-myo-inositol 1,3,4,5-tetrakisphosphate : A myo-inositol tetrakisphosphate having the four phosphates placed in the 1-, 3-, 4- and 5-positions.	1.98	1	0	inositol phosphate
methoctramine methoctramine: structure given in first source. methoctramine : A tetramine that is N,N'-bis(6-aminohexyl)octane-1,8-diamine where the primary amino groups both carry 2-methoxybenzyl substituents.. methoctramine tetrahydrochloride : A hydrochloride obtained by combining methoctramine with four molar equivalents of hydrochloric acid.	2.45	2	0	hydrochloride	muscarinic antagonist
dimyristoylphosphatidylglycerol [no description available]	2.11	1	0
perindopril Perindopril: An angiotensin-converting enzyme inhibitor. It is used in patients with hypertension and heart failure.. perindopril : An alpha-amino acid ester that is the ethyl ester of N-{(2S)-1-[(2S,3aS,7aS)-2-carboxyoctahydro-1H-indol-1-yl]-1-oxopropan-2-yl}-L-norvaline	2.45	2	0	alpha-amino acid ester; dicarboxylic acid monoester; ethyl ester; organic heterobicyclic compound	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor
1-nitropyrene-9,10-oxide 1-nitropyrene-9,10-oxide: microsomal metabolite of 1-nitropyrene	1.98	1	0
procyanidin Proanthocyanidins: Dimers and oligomers of flavan-3-ol units (CATECHIN analogs) linked mainly through C4 to C8 bonds to leucoanthocyanidins. They are structurally similar to ANTHOCYANINS but are the result of a different fork in biosynthetic pathways.	2.05	1	0	proanthocyanidin
fingolimod fingolimod : An aminodiol that consists of propane-1,3-diol having amino and 2-(4-octylphenyl)ethyl substituents at the 2-position. It is a sphingosine 1-phosphate receptor modulator used for the treatment of relapsing-remitting multiple sclerosis. A prodrug, fingolimod is phosphorylated by sphingosine kinase to active metabolite fingolimod-phosphate, a structural analogue of sphingosine 1-phosphate.	2.05	1	0	aminodiol; primary amino compound	antineoplastic agent; CB1 receptor antagonist; immunosuppressive agent; prodrug; sphingosine-1-phosphate receptor agonist
triptolide [no description available]	2.15	1	0	diterpenoid; epoxide; gamma-lactam; organic heteroheptacyclic compound	antispermatogenic agent; plant metabolite
n-chlorotaurine N-chlorotaurine: inhibits both inducible nitric oxide synthase and IkappaB kinase	3.4	1	1
proanthocyanidin proanthocyanidin: RN given refers to proanthocyanidin A; Cannabinoid Receptor CB1 antagonist. proanthocyanidin : A flavonoid oligomer obtained by the the condensation of two or more units of hydroxyflavans.	2.05	1	0
sch 28080 Sch 28080: not related structurally to other known anti-ulcer agents; inhibits histamine-stimulated gastric secretion; prevents gastric lesions induced by aspirin, indomethacin & ethanol	2.04	1	0	imidazopyridine
ecteinascidin 743 [no description available]	2.05	1	0	acetate ester; azaspiro compound; bridged compound; hemiaminal; isoquinoline alkaloid; lactone; organic heteropolycyclic compound; organic sulfide; oxaspiro compound; polyphenol; tertiary amino compound	alkylating agent; angiogenesis modulating agent; anti-inflammatory agent; antineoplastic agent; marine metabolite
1-hexadecyl-2-acetyl-glycero-3-phosphocholine Platelet Activating Factor: A phospholipid derivative formed by PLATELETS; BASOPHILS; NEUTROPHILS; MONOCYTES; and MACROPHAGES. It is a potent platelet aggregating agent and inducer of systemic anaphylactic symptoms, including HYPOTENSION; THROMBOCYTOPENIA; NEUTROPENIA; and BRONCHOCONSTRICTION.. 2-O-acetyl-1-O-hexadecyl-sn-glycero-3-phosphocholine : A 2-acetyl-1-alkyl-sn-glycero-3-phosphocholine betaine which has hexadecyl as the alkyl group. PAF is a potent phospholipid activator and mediator of many leukocyte functions, including platelet aggregation, inflammation, and anaphylaxis.	3.23	6	0	2-acetyl-1-alkyl-sn-glycero-3-phosphocholine	antihypertensive agent; beta-adrenergic antagonist; bronchoconstrictor agent; hematologic agent; vasodilator agent
deoxyglucose Deoxyglucose: 2-Deoxy-D-arabino-hexose. An antimetabolite of glucose with antiviral activity.. deoxyglucose : A deoxyhexose comprising glucose having at least one hydroxy group replaced by hydrogen.	2.91	4	0
5-hydroxydopamine 5-hydroxydopamine: RN given refers to parent cpd	2.04	1	0	catecholamine
homoorientin homoorientin: isolated from Swertia japonica; structure given in first source	4.8	1	1	flavone C-glycoside; tetrahydroxyflavone	antineoplastic agent; radical scavenger
valerates Valerates: Derivatives of valeric acid, including its salts and esters.	4.99	5	2	short-chain fatty acid anion; straight-chain saturated fatty acid anion	plant metabolite
florfenicol florfenicol: structure given in first source. florfenicol : A carboxamide that is the N-dichloroacetyl derivative of (1R,2S)-2-amino-3-fluoro-1-[4-(methanesulfonyl)phenyl]propan-1-ol. A synthetic veterinary antibiotic that is used for treatment of bovine respiratory disease and foot rot; also used in aquaculture.	2.03	1	0	organochlorine compound; organofluorine compound; secondary alcohol; secondary carboxamide; sulfone	antimicrobial agent
u 73343 U 73343: an inactive analog of U 73122	2.91	4	0
thromboxanes thromboxane : A class of oxygenated oxane derivatives, originally derived from prostaglandin precursors in platelets, that stimulate aggregation of platelets and constriction of blood vessels.	1.97	1	0
amdinocillin pivoxil Amdinocillin Pivoxil: Pivaloyloxymethyl ester of amdinocillin that is well absorbed orally, but broken down to amdinocillin in the intestinal mucosa. It is active against gram-negative organisms and used as for amdinocillin.. pivmecillinam : A penicillanic acid ester that is the [(2,2-dimethylpropanoyl)oxy]methyl ester and prodrug of mecillinam.	2.02	1	0	penicillanic acid ester; penicillin; pivaloyloxymethyl ester	antibacterial drug; antiinfective agent; prodrug
nitisinone [no description available]	2.05	1	0	(trifluoromethyl)benzenes; C-nitro compound; cyclohexanones; mesotrione	EC 1.13.11.27 (4-hydroxyphenylpyruvate dioxygenase) inhibitor
marimastat marimastat: a matrix metalloproteinase inhibitor active in patients with advanced carcinoma of the pancreas, prostate, or ovary. marimastat : A secondary carboxamide resulting from the foraml condensation of the carboxy group of (2R)-2-[(1S)-1-hydroxy-2-(hydroxyamino)-2-oxoethyl]-4-methylpentanoic acid with the alpha-amino group of N,3-dimethyl-L-valinamide.	2.05	1	0	hydroxamic acid; secondary carboxamide	antineoplastic agent; matrix metalloproteinase inhibitor
clofarabine [no description available]	2.05	1	0	adenosines; organofluorine compound	antimetabolite; antineoplastic agent
arg-3-hyp-7-phe-bradykinin NPC 567: bradykinin receptor antagonist. NPC-567 : A ten-membered oligopeptide comprising D-arginyl, L-arginyl, L-prolyl, (4R)-4-hydroxy-L-prolyl, glycyl, L-phenylalanyl, L-seryl, D-phenylalanyl, L-phenylalanyl and L-arginine residues joined in sequence.	2.04	1	0	oligopeptide	bradykinin receptor antagonist
caprylates Caprylates: Derivatives of caprylic acid. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain a carboxy terminated eight carbon aliphatic structure.. octanoate : A straight-chain saturated fatty acid anion that is the conjugate base of octanoic acid (caprylic acid); believed to block adipogenesis.	2.34	2	0	fatty acid anion 8:0; straight-chain saturated fatty acid anion	human metabolite; Saccharomyces cerevisiae metabolite
ah 6809 6-isopropoxy-9-oxoxanthene-2-carboxylic acid: structure given in UD	2.02	1	0	xanthones
muricholic acid muricholic acid: internal standard in analysis of fecal bile acids; RN given refers to (3 alpha,5 beta)-isomer	2.07	1	0	3alpha-hydroxy steroid; 6-hydroxy steroid; 7-hydroxy steroid; bile acid; C24-steroid; trihydroxy-5beta-cholanic acid
mitiglinide mitiglinide: a rapid and short-acting hypoglycemic agent; acts on sulfonylurea receptor closing KATP channels; considered one of the glinides-an imprecise grouping; structure given in first source	2.05	1	0	benzenes; monocarboxylic acid
phenylalanyl-leucyl-arginyl phenylalaninamide phenylalanyl-leucyl-arginyl phenylalaninamide: RN given refers to all (L)-isomer; RN for cpd without isomeric designation not avail 11/90; involved in transmitter release	2.41	2	0
pn 202-791 PN 202-791: (+)-isomer is calcium channel agonist; (-)-isomer is calcium channel blocker; RN given refers to (S)-isomer	1.97	1	0	benzoxadiazole; isopropyl ester
gadolinium 1,4,7,10-tetraazacyclododecane-n,n',n'',n'''-tetraacetate gadolinium 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetate: RN refers to Na salt	2.17	1	0
luzindole luzindole: melatonin receptor antagonist; structure given in first source. luzindole : A member of the class of indoles that is tryptamine in which one of the amino hydrogens is replaced by an acetyl group while the hydrogen at position 2 is replaced by a benzyl group.	2.05	1	0	acetamides; indoles	melatonin receptor antagonist
arginylphenylalaninamide arginylphenylalaninamide: RN given refers to (L,L)-isomer; fragment of FMRamide; may be used as a neurotransmitter or neuromodulator by optic lobe neurons of different types	2.02	1	0
saccharolactone saccharolactone: used as index for assessing induction of hepatic enzymes by anticonvulsants; RN given refers to cpd without isomeric designation. D-glucaro-1,4-lactone : A delta-lactone that is D-glucono-1,4-lactone in which the hydroxy group at position 6 has been oxidised to the corresponding carboxylic acid.	1.95	1	0	aldarolactone; delta-lactone
carbene carbene: electrically neutral species H2C: and its derivatives, in which the carbon is covalently bonded to two univalent groups of any kind or a divalent group and bears two nonbonding electrons; carbene is the name of the parent hydride :CH2 ; hence, the name dichlorocarbene for :CCl2. However, names for acyclic and cyclic hydrocarbons containing one or more divalent carbon atoms are derived from the name of the corresponding all-4-hydrocarbon using the suffix -ylidene; methylene carbene also available. carbene : The electrically neutral species H2C(2.) and its derivatives, in which the carbon is covalently bonded to two univalent groups of any kind or a divalent group and bears two nonbonding electrons, which may be spin-paired (singlet state) or spin-non-paired (triplet state).	1.94	1	0	carbene; methanediyl
imatinib mesylate imatinib methanesulfonate : A methanesulfonate (mesylate) salt that is the monomesylate salt of imatinib. Used for treatment of chronic myelogenous leukemia and gastrointestinal stromal tumours.	2.05	1	0	methanesulfonate salt	anticoronaviral agent; antineoplastic agent; apoptosis inducer; tyrosine kinase inhibitor
almotriptan almotriptan : An indole compound having a 2-(dimethylamino)ethyl group at the 3-position and a (pyrrolidin-1-ylsulfonyl)methyl group at the 5-position.	2.06	1	0	indoles; sulfonamide; tertiary amine	non-steroidal anti-inflammatory drug; serotonergic agonist; vasoconstrictor agent
mk 0663 [no description available]	2.05	1	0	bipyridines; organochlorine compound; sulfone	cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug
tazobactam Tazobactam: A penicillanic acid and sulfone derivative and potent BETA-LACTAMASE inhibitor that enhances the activity of other anti-bacterial agents against beta-lactamase producing bacteria.. tazobactam : A member of the class of penicillanic acids that is sulbactam in which one of the exocyclic methyl hydrogens is replaced by a 1,2,3-triazol-1-yl group; used (in the form of its sodium salt) in combination with ceftolozane sulfate for treatment of complicated intra-abdominal infections and complicated urinary tract infections.	2.45	2	0	penicillanic acids; triazoles	antiinfective agent; antimicrobial agent; EC 3.5.2.6 (beta-lactamase) inhibitor
gefitinib [no description available]	2.46	2	0	aromatic ether; monochlorobenzenes; monofluorobenzenes; morpholines; quinazolines; secondary amino compound; tertiary amino compound	antineoplastic agent; epidermal growth factor receptor antagonist
n(6)-(3-iodobenzyl)-5'-n-methylcarboxamidoadenosine N(6)-(3-iodobenzyl)-5'-N-methylcarboxamidoadenosine: structure given in first source; a selective A(3) adenosine receptor agonist. 3-iodobenzyl-5'-N-methylcarboxamidoadenosine : A derivative of adenosine in which the 5'-hydroxymethyl group is replaced by N-ethylcarboxamido and one of the hydrogens of the exocyclic amino function is substituted by a 3-iodobenzyl group.	2.45	2	0	adenosines; monocarboxylic acid amide; organoiodine compound	adenosine A3 receptor agonist
1-(1-(2-benzo(b)thienyl)cyclohexyl)piperidine 1-(1-(2-benzo(b)thienyl)cyclohexyl)piperidine: structure given in first source. 1-[1-(1-benzothiophen-2-yl)cyclohexyl]piperidine : A tertiary amino compound that consists of cyclohexane having piperidin-1-yl and benzothiophen-2-yl groups attached at position 1. A potent dopamine re-uptake inhibitor with a behavioral profile different from that of phencyclidine (PCP) and similar to that of cocaine.	2.04	1	0	1-benzothiophenes; piperidines; tertiary amino compound	dopamine uptake inhibitor
adenophostin a adenophostin A: structure given in first source; an inositol-1,4,5-trisphosphate agonist isolated from Penicillium brevicompactum	2.01	1	0	disaccharide phosphate
2-chloro-n(6)cyclopentyladenosine 2-chloro-N(6)cyclopentyladenosine: highly selective agonist at A1 adenosine receptors	2	1	0
antibiotic g 418 antibiotic G 418: from Micromonospora rhodorangea	5.76	28	0
bradykinin, leu(8)-des-arg(9)- bradykinin, Leu(8)-des-Arg(9)-: RN given refers to (L)-isomer	1.99	1	0
1-((3,5-dichloro)-2,6-dihydroxy-4-methoxyphenyl)-1-hexanone 1-((3,5-dichloro)-2,6-dihydroxy-4-methoxyphenyl)-1-hexanone: structure given in first source. 1-(3,5-dichloro-2,6-dihydroxy-4-methoxyphenyl)hexan-1-one : A differentiation-inducing factor that is hexaphenone bearing two chloro substituents at positions 3 and 5, two hydroxy substituents at positions 2 and 6 as well as a single methoxy substituent at position 4. A secreted, chlorinated molecule that controls cell fate during development of Dictyostelium cells.	2.89	4	0	dichlorobenzene; differentiation-inducing factor; monomethoxybenzene; resorcinols	eukaryotic metabolite; signalling molecule
rmi 12330a RMI 12330A: adenyl cyclase inhibitor in rat liver; RN given refers to (cis)-isomer; NM refers to HCl, (cis)-isomer; structure	2.41	2	0
b 4162 B 4162: bradykinin inhibitor	1.99	1	0
desloratadine desloratadine: major metabolite of loratadine. desloratadine : Loratadine in which the ethoxycarbonyl group attached to the piperidine ring is replaced by hydrogen. The major metabolite of loratidine, desloratadine is an antihistamine which is used for the symptomatic relief of allergic conditions including rhinitis and chronic urticaria. It does not readily enter the central nervous system, so does not cause drowsiness.	3.47	1	1	benzocycloheptapyridine	anti-allergic agent; cholinergic antagonist; drug metabolite; H1-receptor antagonist
n-(6-phenylhexyl)-5-chloro-1-naphthalenesulfonamide N-(6-phenylhexyl)-5-chloro-1-naphthalenesulfonamide: protein kinase C activator; RN & structure given in first source	1.97	1	0	naphthalenes; sulfonic acid derivative
glycerophosphoinositol 4,5-bisphosphate glycerophosphoinositol 4,5-bisphosphate: do not confuse with phosphatidylinositols which have fatty acids esterified at the C-1 and C-2 hydroxyl groups of glycerol	5.48	64	0
furamidine furamidine: RN given refers to parent cpd; WR 199385 refers to di-HCl; pafuramidine is a prodrug of this	2.07	1	0
methotrexate [no description available]	4.17	17	0	dicarboxylic acid; monocarboxylic acid amide; pteridines	abortifacient; antimetabolite; antineoplastic agent; antirheumatic drug; dermatologic drug; DNA synthesis inhibitor; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; immunosuppressive agent
ro 32-0432 [no description available]	2	1	0
vb 20b7 2-(1-(4-piperonyl)piperazinyl)benzothiazole: a 5-HT3 receptor antagonist and 5-HT4 receptor agonist; structure in first source	2.01	1	0	N-arylpiperazine
ne 58051 NE 58051: inhibits tumor cell adhesion to extracellular matrices; structure in first source	2.03	1	0
tamsulosin [no description available]	2.06	1	0	5-(2-{[2-(2-ethoxyphenoxy)ethyl]amino}propyl)-2-methoxybenzenesulfonamide	alpha-adrenergic antagonist; antineoplastic agent
antiprimod azaspirane: structure given in first source	2.05	1	0
sulbactam [no description available]	2.46	2	0	penicillanic acids
olmesartan medoxomil Olmesartan Medoxomil: An ANGIOTENSIN II TYPE 1 RECEPTOR BLOCKER that is used to manage HYPERTENSION.	2.05	1	0	biphenyls
ym 529 YM 529: inhibits osteoclastic bone resorption; structure given in first source	2.03	1	0
ilomastat CS 610: matrix metalloproteinase inhibitor; structure in first source. ilomastat : An N-acyl-amino acid obtained by formal condensation of the carboxy group of (2R)-2-[2-(hydroxyamino)-2-oxoethyl]-4-methylpentanoic acid with the amino group of N-methyl-L-tryptophanamide. A cell permeable broad-spectrum matrix metalloproteinase (MMP) inhibitor	2.05	1	0	hydroxamic acid; L-tryptophan derivative; N-acyl-amino acid	anti-inflammatory agent; antibacterial agent; antineoplastic agent; EC 3.4.24.24 (gelatinase A) inhibitor; neuroprotective agent
omega-n-methylarginine omega-N-Methylarginine: A competitive inhibitor of nitric oxide synthetase.. N(omega)-methyl-L-arginine : A L-arginine derivative with a N(omega)-methyl substituent.	2.7	3	0	amino acid zwitterion; arginine derivative; guanidines; L-arginine derivative; non-proteinogenic L-alpha-amino acid
xylose xylopyranose: structure in first source	8.55	20	3	D-xylose
beta-lactams 2-azetidinone: structure in first source. azetidin-2-one : An unsubstituted beta-lactam compound.. beta-lactam : A lactam in which the amide bond is contained within a four-membered ring, which includes the amide nitrogen and the carbonyl carbon.	1.97	1	0	beta-lactam antibiotic allergen; beta-lactam
proline Proline: A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.. proline : An alpha-amino acid that is pyrrolidine bearing a carboxy substituent at position 2.	3.46	8	0	amino acid zwitterion; glutamine family amino acid; L-alpha-amino acid; proline; proteinogenic amino acid	algal metabolite; compatible osmolytes; Escherichia coli metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite
betamethasone-17,21-dipropionate betamethasone-17,21-dipropionate: may also contain chlorocresol (UD 25:22R)	2.35	2	0
docetaxel [no description available]	2.46	2	0	hydrate; secondary alpha-hydroxy ketone	antineoplastic agent
atazanavir atazanavir : A heavily substituted carbohydrazide that is an antiretroviral drug of the protease inhibitor (PI) class used to treat infection of human immunodeficiency virus (HIV).	2.05	1	0	carbohydrazide	antiviral drug; HIV protease inhibitor
levofloxacin Levofloxacin: The L-isomer of Ofloxacin.. levofloxacin : An optically active form of ofloxacin having (S)-configuration; an inhibitor of bacterial topoisomerase IV and DNA gyrase.	3.19	5	0	9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid; fluoroquinolone antibiotic; quinolone antibiotic	antibacterial drug; DNA synthesis inhibitor; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; topoisomerase IV inhibitor
9-(2-hydroxy-3-nonyl)adenine (2R,3S)-EHNA : EHNA of absolute configuration 2R,3S. Selective inhibitor of cGMP-stimulated phosphodiesterase (PDE2) (IC50 = 0.8 - 4 mM). Also a potent inhibitor of adenosine deaminase.	2.04	1	0	EHNA	EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; EC 3.5.4.4 (adenosine deaminase) inhibitor
9-(2-hydroxy-3-nonyl)adenine (2S,3R)-EHNA : EHNA of absolute configuration 2S,3R.	3.41	1	0	EHNA
ezetimibe Ezetimibe: An azetidine derivative and ANTICHOLESTEREMIC AGENT that inhibits intestinal STEROL absorption. It is used to reduce total CHOLESTEROL; LDL CHOLESTEROL, and APOLIPOPROTEINS B in the treatment of HYPERLIPIDEMIAS.. ezetimibe : A beta-lactam that is azetidin-2-one which is substituted at 1, 3, and 4 by p-fluorophenyl, 3-(p-fluorophenyl)-3-hydroxypropyl, and 4-hydroxyphenyl groups, respectively (the 3R,3'S,4S enantiomer).	2.05	1	0	azetidines; beta-lactam; organofluorine compound	anticholesteremic drug; antilipemic drug; antimetabolite
cox 189 lumiracoxib: a COX-2 inhibitor. lumiracoxib : An amino acid that is phenylacetic acid which is substituted at position 2 by the nitrogen of 2-chloro-6-fluoroaniline and at position 5 by a methyl group. A highly selective cyclooxygenase 2 inhibitor, it was briefly used for the treatment of osteoarthritis, but was withdrawn due to concersns of hepatotoxicity.	2.06	1	0	amino acid; monocarboxylic acid; organochlorine compound; organofluorine compound; secondary amino compound	cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug
cilomilast [no description available]	3.41	1	0	methoxybenzenes
cariporide cariporide: a selective sodium-hydrogen exchange subtype 1 inhibitor; structure in first source	2.05	1	0
tezosentan tezosentan: structure in first source	2.05	1	0
moxifloxacin Moxifloxacin: A fluoroquinolone that acts as an inhibitor of DNA TOPOISOMERASE II and is used as a broad-spectrum antibacterial agent.. moxifloxacin : A quinolone that consists of 4-oxo-1,4-dihydroquinoline-3-carboxylic acid bearing a cyclopropyl substituent at position 1, a fluoro substitiuent at position 6, a (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl group at position 7 and a methoxy substituent at position 8. A member of the fluoroquinolone class of antibacterial agents.	3.95	3	0	aromatic ether; cyclopropanes; fluoroquinolone antibiotic; pyrrolidinopiperidine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone	antibacterial drug
pralnacasan pralnacasan: NSAID, ICE inhibitor & metastasis inhibitor; RN & structure in first source	2.06	1	0
jtt 501 JTT 501: an insulin sensitizer; structure in first source	2.05	1	0
phorbols Phorbols: The parent alcohol of the tumor promoting compounds from CROTON OIL (Croton tiglium).	2.38	2	0	diterpene; terpenoid fundamental parent
naproxen Naproxen: An anti-inflammatory agent with analgesic and antipyretic properties. Both the acid and its sodium salt are used in the treatment of rheumatoid arthritis and other rheumatic or musculoskeletal disorders, dysmenorrhea, and acute gout.. naproxen : A methoxynaphthalene that is 2-methoxynaphthalene substituted by a carboxy ethyl group at position 6. Naproxen is a non-steroidal anti-inflammatory drug commonly used for the reduction of pain, fever, inflammation and stiffness caused by conditions such as osteoarthritis, kidney stones, rheumatoid arthritis, psoriatic arthritis, gout, ankylosing spondylitis, menstrual cramps, tendinitis, bursitis, and for the treatment of primary dysmenorrhea. It works by inhibiting both the COX-1 and COX-2 enzymes.	3.46	7	0	methoxynaphthalene; monocarboxylic acid	antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; drug allergen; environmental contaminant; gout suppressant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic
alpha-methylhistamine (R)-alpha-methylhistamine : An aralkylamino compound that is histamine bearing a methyl substituent at the alpha-position (the R-enantiomer).	2.05	1	0	aralkylamino compound; imidazoles	H3-receptor agonist
hydroxyl radical Hydroxyl Radical: The univalent radical OH. Hydroxyl radical is a potent oxidizing agent.	2.94	4	0	oxygen hydride; oxygen radical; reactive oxygen species
lactitol lactitol : A glycosyl alditol consisting of beta-D-galactopyranose and D-glucitol joined by a 1->4 glycosidic bond. It is used as a laxative, as an excipient, and as replacement bulk sweetener in some low-calorie foods.	7.89	7	1	glycosyl alditol	cathartic; excipient; laxative
pirlimycin pirlimycin: RN given refers to (mono-HCl(2S-cis)-isomer)	2.05	1	0
nps-568 N-(2-chlorophenylpropyl)-1-(3-methoxyphenyl)ethylamine: NPS-568 is the ((R), HCl salt)-isomer; calcimimetic compound and calcium-sensing receptor agonist	2.52	2	0
clofibride clofibride: structure	2.04	1	0	monocarboxylic acid
cyc 202 seliciclib : 2,6-Diaminopurine carrying benzylamino, (2R)-1-hydroxybutan-2-yl and isopropyl substituents at C-6, C-2-N and N-9 respectively. It is an experimental drug candidate in the family of pharmacological cyclin-dependent kinase (CDK) inhibitors.	2.05	1	0	2,6-diaminopurines	antiviral drug; EC 2.7.11.22 (cyclin-dependent kinase) inhibitor
carbodiimides Carbodiimides: Compounds with the general formula RN=C=NR, where R is a hydrocarbyl group.. methanediimine : A carbodiimide in which both nitrogens are unsubstituted.	2.7	3	0	carbodiimide
substance p, sar(9)-met(o2)(11)- substance P, Sar(9)-Met(O2)(11)-: a neurokinin-1 receptor agonist	2.05	1	0
antiflammin p1 antiflammin P1: nonapeptide fragment of uteroglobin has no phospholipase A2 inhibitory & anti-inflammatory activity; RN given refers to all (L)-isomer	2.01	1	0
calcium pyrophosphate [no description available]	2.68	3	0
4'-galactooligosaccharide 4'-galactooligosaccharide: structure given in first source. galactooligosaccharide : An oligosaccharide comprised of galactose residues.	2	1	0
paromomycin Paromomycin: An aminoglycoside antibacterial and antiprotozoal agent produced by species of STREPTOMYCES.. paromomycin : An amino cyclitol glycoside that is the 1-O-(2-amino-2-deoxy-alpha-D-glucopyranoside) and the 3-O-(2,6-diamino-2,6-dideoxy-beta-L-idopyranosyl)-beta-D-ribofuranoside of 4,6-diamino-2,3-dihydroxycyclohexane (the 1R,2R,3S,4R,6S diastereoisomer). It is obtained from various Streptomyces species. A broad-spectrum antibiotic, it is used (generally as the sulfate salt) for the treatment of acute and chronic intestinal protozoal infections, but is not effective for extraintestinal protozoal infections. It is also used as a therapeutic against visceral leishmaniasis.	11.39	199	1	amino cyclitol glycoside; aminoglycoside antibiotic	anthelminthic drug; antibacterial drug; antiparasitic agent; antiprotozoal drug
proctosedyl Proctosedyl: drug combination containing the above cpds; used in treatment of second degree hemorrhoids	4.29	4	1
avasimibe [no description available]	2.05	1	0	monoterpenoid
aminopterin Aminopterin: A folic acid derivative used as a rodenticide that has been shown to be teratogenic.	2.88	4	0	dicarboxylic acid	EC 1.5.1.3 (dihydrofolate reductase) inhibitor; mutagen
biotin vitamin B7 : Any member of a group of vitamers that belong to the chemical structural class called biotins that exhibit biological activity against vitamin B7 deficiency. Vitamin B7 deficiency is very rare in individuals who take a normal balanced diet. Foods rich in biotin are egg yolk, liver, cereals, vegetables (spinach, mushrooms) and rice. Symptoms associated with vitamin B7 deficiency include thinning hair, scaly skin rashes around eyes, nose and mouth, and brittle nails. The vitamers include biotin and its ionized and salt forms.	3.26	6	0	biotins; vitamin B7	coenzyme; cofactor; Escherichia coli metabolite; fundamental metabolite; human metabolite; mouse metabolite; nutraceutical; prosthetic group; Saccharomyces cerevisiae metabolite
temocillin temocillin: beta-lactam antibiotic with unusual spectrum of antibacterial activity & exceptional stability to bacterial beta-lactamases; RN given refers to di-Na salt (2S-(2alpha,5alpha,6alpha))-isomer; structure in first source. temocillin : A penicillin compound having a 6alpha-methoxy and 6beta-[2-carboxy(thiophen-3-yl)acetamido side-groups.	1.96	1	0	penicillin
angiotensin ii Giapreza: injectable form of angiotensin II used to increase blood pressure in adult patients with septic or other distributive shock. Ile(5)-angiotensin II : An angiotensin II that acts on the central nervous system (PDB entry: 1N9V).	6.54	15	1	amino acid zwitterion; angiotensin II	human metabolite
fiduxosin fiduxosin: fiduxosin (ABT-980) is the (3aR,9bR)-isomer; structure in first source	2.06	1	0
atropine tropan-3alpha-yl 3-hydroxy-2-phenylpropanoate : A tropane alkaloid that is (1R,5)-8-methyl-8-azabicyclo[3.2.1]octane substituted by a (3-hydroxy-2-phenylpropanoyl)oxy group at position 3.	7.81	32	2
lignin Lignin: The most abundant natural aromatic organic polymer found in all vascular plants. Lignin together with cellulose and hemicellulose are the major cell wall components of the fibers of all wood and grass species. Lignin is composed of coniferyl, p-coumaryl, and sinapyl alcohols in varying ratios in different plant species. (From Merck Index, 11th ed). lignin : A polyphenylpropanoid derived from three monolignol monomers: trans-p-coumaryl alcohol, coniferol and trans-sinapyl alcohol. There is extensive cross-linking and no defined primary structure.	3.45	2	0
sb 203580 [no description available]	2.41	2	0	imidazoles; monofluorobenzenes; pyridines; sulfoxide	EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; geroprotector; Hsp90 inhibitor; neuroprotective agent
organophosphonates hydrogenphosphite : A divalent inorganic anion resulting from the removal of a proton from two of the hydroxy groups of phosphorous acid.	5	2	1	divalent inorganic anion; phosphite ion
l 694,458 DMP 777: structure given in first source	2.04	1	0
5-chloropyrazinamide [no description available]	2.1	1	0
psyllium Psyllium: Dried, ripe seeds of PLANTAGO PSYLLIUM; PLANTAGO INDICA; and PLANTAGO OVATA. Plantain seeds swell in water and are used as demulcents and bulk laxatives.	3.35	1	1	very long-chain fatty acid
3-(piperidine-1-yl)propyl 4-amino-5-chloro-2-methoxybenzoate hydrochloride 3-(piperidine-1-yl)propyl 4-amino-5-chloro-2-methoxybenzoate hydrochloride: structure given in first source; a 5-HT(4) receptor antagonist	2.01	1	0
aflatoxin b1 Aflatoxin B1: A potent hepatotoxic and hepatocarcinogenic mycotoxin produced by the Aspergillus flavus group of fungi. It is also mutagenic, teratogenic, and causes immunosuppression in animals. It is found as a contaminant in peanuts, cottonseed meal, corn, and other grains. The mycotoxin requires epoxidation to aflatoxin B1 2,3-oxide for activation. Microsomal monooxygenases biotransform the toxin to the less toxic metabolites aflatoxin M1 and Q1.. aflatoxin B1 : An aflatoxin having a tetrahydrocyclopenta[c]furo[3',2':4,5]furo[2,3-h]chromene skeleton with oxygen functionality at positions 1, 4 and 11.	2.41	1	0	aflatoxin; aromatic ether; aromatic ketone	carcinogenic agent; human metabolite
5'-deoxy-5'-iodouridine 5'-deoxy-5'-iodouridine: RN given refers to unlabeled cpd; main heading IDOXURIDINE refers to 2'-deoxy-5-iodouridine	2.34	2	0
24-norursodeoxycholic acid 24-norursodeoxycholic acid: structure given in first source	2.06	1	0
carbocysteine Carbocysteine: A compound formed when iodoacetic acid reacts with sulfhydryl groups in proteins. It has been used as an anti-infective nasal spray with mucolytic and expectorant action.. S-carboxymethyl-L-cysteine : An L-cysteine thioether that is L-cysteine in which the hydrogen of the thiol group has been replaced by a carboxymethyl group.	2.04	1	0	L-cysteine thioether; non-proteinogenic L-alpha-amino acid	mucolytic
viccillin s (combination) Viccillin S (combination): RN given refers to combination of above two cpds	3.38	1	1
olpadronic acid [no description available]	2.01	1	0
troleandomycin Troleandomycin: A macrolide antibiotic that is similar to ERYTHROMYCIN.. troleandomycin : A semi-synthetic macrolide antibiotic obtained by acetylation of the three free hydroxy groups of oleandomycin. Troleandomycin is only found in individuals that have taken the drug.	2.87	4	0	acetate ester; epoxide; macrolide antibiotic; monosaccharide derivative; polyketide; semisynthetic derivative	EC 1.14.13.97 (taurochenodeoxycholate 6alpha-hydroxylase) inhibitor; xenobiotic
2-deoxystreptamine 2-deoxystreptamine: RN given refers to parent cpd; structure.. 2-deoxystreptamine : An amino cyclitol consisting of scyllo-inositol with the hydroxy groups at positions 1 and 3 replaced by unsubstituted amino groups and that at position 2 replaced by hydrogen.	5.16	14	0
lapatinib [no description available]	2.46	2	0	furans; organochlorine compound; organofluorine compound; quinazolines	antineoplastic agent; tyrosine kinase inhibitor
deferasirox Deferasirox: A triazole and benzoate derivative that acts as a selective iron chelator. It is used in the management of chronic IRON OVERLOAD due to blood transfusion or non-transfusion dependent THALASSEMIA.. deferasirox : A member of the class of triazoles, deferasirox is 1,2,4-triazole substituted by a 4-carboxyphenyl group at position 1 and by 2-hydroxyphenyl groups at positions 3 and 5. An orally active iron chelator, it is used to manage chronic iron overload in patients receiving long-term blood transfusions.	2.46	2	0	benzoic acids; monocarboxylic acid; phenols; triazoles	iron chelator
bms204352 BMS204352: a calcium-sensitive opener of maxi-K potassium channels; structure in first source	2.05	1	0
tbc-11251 sitaxsentan: endothelin A receptor antagonist; structure in first source	2.05	1	0	benzodioxoles
sorafenib [no description available]	2.05	1	0	(trifluoromethyl)benzenes; aromatic ether; monochlorobenzenes; phenylureas; pyridinecarboxamide	angiogenesis inhibitor; anticoronaviral agent; antineoplastic agent; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; ferroptosis inducer; tyrosine kinase inhibitor
colistimethate sodium [no description available]	1.93	1	0
lenalidomide [no description available]	4.8	1	1	aromatic amine; dicarboximide; isoindoles; piperidones	angiogenesis inhibitor; antineoplastic agent; immunomodulator
cholic acid Cholic Acid: A major primary bile acid produced in the liver and usually conjugated with glycine or taurine. It facilitates fat absorption and cholesterol excretion.. cholic acid : A bile acid that is 5beta-cholan-24-oic acid bearing three alpha-hydroxy substituents at position 3, 7 and 12.	2.67	3	0	12alpha-hydroxy steroid; 3alpha-hydroxy steroid; 7alpha-hydroxy steroid; bile acid; C24-steroid; trihydroxy-5beta-cholanic acid	human metabolite; mouse metabolite
sitosterol, (3beta)-isomer Sobatum: tradename; active fraction of Solanum trilobatum; reduces side-effects of radiation-induced toxicity. sitosterol : A member of the class of phytosterols that is stigmast-5-ene substituted by a beta-hydroxy group at position 3.	2.05	1	0	3beta-hydroxy-Delta(5)-steroid; 3beta-sterol; C29-steroid; phytosterols; stigmastane sterol	anticholesteremic drug; antioxidant; mouse metabolite; plant metabolite; sterol methyltransferase inhibitor
deoxycholic acid Deoxycholic Acid: A bile acid formed by bacterial action from cholate. It is usually conjugated with glycine or taurine. Deoxycholic acid acts as a detergent to solubilize fats for intestinal absorption, is reabsorbed itself, and is used as a choleretic and detergent.. deoxycholic acid : A bile acid that is 5beta-cholan-24-oic acid substituted by hydroxy groups at positions 3 and 12 respectively.	3.35	7	0	bile acid; C24-steroid; dihydroxy-5beta-cholanic acid	human blood serum metabolite
cortisone [no description available]	5.64	26	0	11-oxo steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	human metabolite; mouse metabolite
dromostanolone propionate dromostanolone propionate: RN given refers to (2alpha,5alpha,17beta)-isomer	2.04	1	0	3-oxo-5alpha-steroid; steroid ester	antineoplastic agent
sodium sulfide sodium sulfide: see also record for sodium bisulfide; actisoufre is the sodium sulfide component of sulfur-containing thermal springs which is also found in Saccharomyces cerevisiae	2	1	0
stigmastanol stigmastanol: saturated analog of beta-sitosterol; RN given refers to (3beta,5alpha)-isomer. stigmastanol : A 3-hydroxy steroid that is 5alpha-stigmastane which is substituted at the 3beta position by a hydroxy group.	2.39	2	0	3-hydroxy steroid; phytosterols	anticholesteremic drug; plant metabolite
vincaleukoblastine [no description available]	2.05	1	0	acetate ester; indole alkaloid fundamental parent; methyl ester; organic heteropentacyclic compound; organic heterotetracyclic compound; tertiary alcohol; tertiary amino compound; vinca alkaloid	antineoplastic agent; immunosuppressive agent; microtubule-destabilising agent; plant metabolite
benzofurans Benzofurans: Compounds that contain a BENZENE ring fused to a furan ring.	2.96	4	0
benzarone benzarone: antihemorrhagic agent; structure	2.46	2	0	1-benzofurans
nsc 88915 4-pregnen-21-ol-3,20-dione-21-(4-bromobenzenesufonate): a tyrosyl-DNA phosphodiesterase inhibitor; structure in first source	2.07	1	0
estramustine Estramustine: A nitrogen mustard linked to estradiol, usually as phosphate; used to treat prostatic neoplasms; also has radiation protective properties.. estramustine : A carbamate ester obtained by the formal condensation of the hydroxy group of 17beta-estradiol with the carboxy group of bis(2-chloroethyl)carbamic acid.	2.05	1	0	17beta-hydroxy steroid; carbamate ester; organochlorine compound	alkylating agent; antineoplastic agent; radiation protective agent
lupeol [no description available]	2.06	1	0	pentacyclic triterpenoid; secondary alcohol	anti-inflammatory drug; plant metabolite
phenethicillin phenethicillin: minor descriptor (85); major descriptor (63-84); on-line search PENICILLIN, PHENOXYMETHYL/AA (66-85); Index Medicus search PHENETHICILLIN (63-84); RN given refers to (2S-(2alpha,5alpha,6beta))-isomer. phenethicillin : A penicillin in which the substituent at position 6 of the penam ring is a 2-phenoxypropanamido group.	2.37	2	0	penicillin allergen; penicillin
noscapine Noscapine: A naturally occurring opium alkaloid that is a centrally acting antitussive agent.. (-)-noscapine : A benzylisoquinoline alkaloid that is 1,2,3,4-tetrahydroisoquinoline which is substituted by a 4,5-dimethoxy-3-oxo-1,3-dihydro-2-benzofuran-1-yl group at position 1, a methylenedioxy group at positions 6-7 and a methoxy group at position 8. Obtained from plants of the Papaveraceae family, it lacks significant painkilling properties and is primarily used for its antitussive (cough-suppressing) effects.	2.05	1	0	aromatic ether; benzylisoquinoline alkaloid; cyclic acetal; isobenzofuranone; organic heterobicyclic compound; organic heterotricyclic compound; tertiary amino compound	antineoplastic agent; antitussive; apoptosis inducer; plant metabolite
homoharringtonine Homoharringtonine: Semisynthetic derivative of harringtonine that acts as a protein synthesis inhibitor and induces APOPTOSIS in tumor cells. It is used in the treatment of MYELOID LEUKEMIA, CHRONIC.. omacetaxine mepesuccinate : A cephalotaxine-derived alkaloid ester obtained from Cephalotaxus harringtonia; used for the treatment of chronic or accelerated phase chronic myeloid leukaemia.	2.05	1	0	alkaloid ester; enol ether; organic heteropentacyclic compound; tertiary alcohol	anticoronaviral agent; antineoplastic agent; apoptosis inducer; protein synthesis inhibitor
hafnia Hafnia: A genus of straight, gram-negative bacterial rods which are facultatively anaerobic and motile by peritrichous flagella. This genus is found in human and animal feces, soil, water, and dairy products. It is an opportunistic pathogen in humans. (From Bergey's Manual of Determinative Bacteriology, 9th ed)	2.13	1	0
acivicin [no description available]	1.97	1	0	isoxazoles; non-proteinogenic L-alpha-amino acid; organochlorine compound	antileishmanial agent; antimetabolite; antimicrobial agent; antineoplastic agent; EC 2.3.2.2 (gamma-glutamyltransferase) inhibitor; glutamine antagonist; metabolite
wortmannin [no description available]	3.62	9	0	acetate ester; cyclic ketone; delta-lactone; organic heteropentacyclic compound	anticoronaviral agent; antineoplastic agent; autophagy inhibitor; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; geroprotector; Penicillium metabolite; radiosensitizing agent
2-oxindole 2-oxindole: RN given refers to parent cpd; structure. indolin-2-one : An indolinone carrying an oxo group at position 2.	1.99	1	0	gamma-lactam; indolinone
trimethoprim, sulfamethoxazole drug combination Trimethoprim, Sulfamethoxazole Drug Combination: A drug combination with broad-spectrum antibacterial activity against both gram-positive and gram-negative organisms. It is effective in the treatment of many infections, including PNEUMOCYSTIS PNEUMONIA in AIDS.. co-trimoxazole : A two-component mixture comprising trimethoprim and sulfamethoxazole.	7	15	6
o-(chloroacetylcarbamoyl)fumagillol O-(Chloroacetylcarbamoyl)fumagillol: Semisynthetic analog of fumagillin (a cyclohexane-sesquiterpene antibiotic isolated from ASPERGILLUS FUMIGATUS) that inhibits angiogenesis.. O-(chloroacetylcarbamoyl)fumagillol : A carbamate ester that is fumagillol in which the hydroxy group has been converted to the corresponding N-(chloroacetyl)carbamate derivative.	2.05	1	0	carbamate ester; organochlorine compound; semisynthetic derivative; sesquiterpenoid; spiro-epoxide	angiogenesis inhibitor; antineoplastic agent; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; methionine aminopeptidase 2 inhibitor; retinoic acid receptor alpha antagonist
taurochenodeoxycholic acid Taurochenodeoxycholic Acid: A bile salt formed in the liver by conjugation of chenodeoxycholate with taurine, usually as the sodium salt. It acts as detergent to solubilize fats in the small intestine and is itself absorbed. It is used as a cholagogue and choleretic.. taurochenodeoxycholate : An organosulfonate oxoanion that is the conjugate base of taurochenodeoxycholic acid arising from deprotonation of the sulfonate OH group; major species at pH 7.3.. taurochenodeoxycholic acid : A bile acid taurine conjugate of chenodeoxycholic acid.	2.11	1	0	bile acid taurine conjugate	human metabolite; mouse metabolite
bortezomib [no description available]	5.01	2	1	amino acid amide; L-phenylalanine derivative; pyrazines	antineoplastic agent; antiprotozoal drug; protease inhibitor; proteasome inhibitor
ritonavir Ritonavir: An HIV protease inhibitor that works by interfering with the reproductive cycle of HIV. It also inhibits CYTOCHROME P-450 CYP3A.. ritonavir : An L-valine derivative that is L-valinamide in which alpha-amino group has been acylated by a [(2-isopropyl-1,3-thiazol-4-yl)methyl]methylcarbamoyl group and in which a hydrogen of the carboxamide amino group has been replaced by a (2R,4S,5S)-4-hydroxy-1,6-diphenyl-5-{[(1,3-thiazol-5-ylmethoxy)carbonyl]amino}hexan-2-yl group. A CYP3A inhibitor and antiretroviral drug from the protease inhibitor class used to treat HIV infection and AIDS, it is often used as a fixed-dose combination with another protease inhibitor, lopinavir. Also used in combination with dasabuvir sodium hydrate, ombitasvir and paritaprevir (under the trade name Viekira Pak) for treatment of chronic hepatitis C virus genotype 1 infection as well as cirrhosis of the liver.	2.75	3	0	1,3-thiazoles; carbamate ester; carboxamide; L-valine derivative; ureas	antiviral drug; environmental contaminant; HIV protease inhibitor; xenobiotic
1-hydroxypentane-1,1-bisphosphonate [no description available]	2.03	1	0
cimadronate cimadronate: increases serum 1,25-dihydroxyvitamin D in rats via stimulating renal 1-hydroxylase activity; structure given in first source	2.03	1	0
nexavar [no description available]	2.05	1	0	organosulfonate salt
dihydropyridines Dihydropyridines: Pyridine moieties which are partially saturated by the addition of two hydrogen atoms in any position.	2.67	3	0
methylmercuric chloride methylmercuric chloride: RN given refers to unlabeled cpd	2.21	1	0	chlorine molecular entity; mercury coordination entity; one-carbon compound
povidone-iodine Povidone-Iodine: An iodinated polyvinyl polymer used as topical antiseptic in surgery and for skin and mucous membrane infections, also as aerosol. The iodine may be radiolabeled for research purposes.	10.71	36	5
leupeptins Leupeptins: A group of acylated oligopeptides produced by Actinomycetes that function as protease inhibitors. They have been known to inhibit to varying degrees trypsin, plasmin, KALLIKREINS, papain and the cathepsins.	3.13	5	0
carboplatin [no description available]	4.33	2	2
rimiterol rimiterol: was heading 1977-94 (see under CATECHOLS 1977-90); use CATECHOLS to search RIMITEROL 1977-94; predominantly a beta 2 stimulant, therefore affects the cardiovascular system less than isoproterenol, but its action is of shorter duration than that of albuterol	2.46	2	0	catechols
lithium chloride Lithium Chloride: A salt of lithium that has been used experimentally as an immunomodulator.. lithium chloride : A metal chloride salt with a Li(+) counterion.	3.86	12	0	inorganic chloride; lithium salt	antimanic drug; geroprotector
leptomycin b [no description available]	3.13	1	0
s-adenosylhomocysteine S-Adenosylhomocysteine: 5'-S-(3-Amino-3-carboxypropyl)-5'-thioadenosine. Formed from S-adenosylmethionine after transmethylation reactions.. S-adenosyl-L-homocysteine : An organic sulfide that is the S-adenosyl derivative of L-homocysteine.	1.99	1	0	adenosines; amino acid zwitterion; homocysteine derivative; homocysteines; organic sulfide	cofactor; EC 2.1.1.72 [site-specific DNA-methyltransferase (adenine-specific)] inhibitor; EC 2.1.1.79 (cyclopropane-fatty-acyl-phospholipid synthase) inhibitor; epitope; fundamental metabolite
glycogen glycogen : A polydisperse, highly branched glucan composed of chains of D-glucopyranose residues in alpha(1->4) glycosidic linkage, joined together by alpha(1->6) glycosidic linkages. A small number of alpha(1->3) glycosidic linkages and some cumulative alpha(1->6) links also may occur. The branches in glycogen typically contain 8 to 12 glucose residues.	3.06	5	0
arabinose [no description available]	2.35	2	0	L-arabinose	Escherichia coli metabolite; mouse metabolite
fibrin Fibrin: A protein derived from FIBRINOGEN in the presence of THROMBIN, which forms part of the blood clot.	4.04	3	1	peptide
bradykinin [no description available]	4.29	19	0	oligopeptide	human blood serum metabolite; vasodilator agent
glucosamine D-glucosamine : An amino sugar whose structure comprises D-glucose having an amino substituent at position 2.. 2-amino-2-deoxy-D-glucopyranose : A D-glucosamine whose structure comprises D-glucopyranose having an amino substituent at position 2.	5.01	13	0	D-glucosamine	Escherichia coli metabolite; geroprotector; mouse metabolite
elastin [no description available]	2.99	4	0	oligopeptide
mevalonic acid Mevalonic Acid: A dihydroxy monocarboxylic acid and precursor in the biosynthetic pathway known as the mevalonate pathway, which produces terpenes and steroids that are vital for diverse cellular functions.. mevalonic acid : A racemate composed of equimolar amounts of (R)- and (S)-mevalonic acid.. (R)-mevalonic acid : The (R)-enantiomer of mevalonic acid.	1.96	1	0	3,5-dihydroxy-3-methylpentanoic acid
raffinose Raffinose: A trisaccharide occurring in Australian manna (from Eucalyptus spp, Myrtaceae) and in cottonseed meal.. raffinose : A trisaccharide composed of alpha-D-galactopyranose, alpha-D-glucopyranose and beta-D-fructofuranose joined in sequence by 1->6 and 1<->2 glycosidic linkages, respectively.	2.68	3	0	raffinose family oligosaccharide; trisaccharide	mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
diaminopimelic acid Diaminopimelic Acid: A diamino derivative of heptanedioic acid with amino groups at C-2 and C-6 and the general formula (COOH)CH(NH2)CH2CH2CH2CH(NH2)(COOH).. LL-2,6-diaminopimelic acid : A 2,6-diaminopimelic acid in which both chiral centres have S configuration. It is a component of bacterial cell wall.	2.41	1	0	2,6-diaminopimelic acid; amino acid zwitterion	Escherichia coli metabolite
oxytocin Oxytocin: A nonapeptide hormone released from the neurohypophysis (PITUITARY GLAND, POSTERIOR). It differs from VASOPRESSIN by two amino acids at residues 3 and 8. Oxytocin acts on SMOOTH MUSCLE CELLS, such as causing UTERINE CONTRACTIONS and MILK EJECTION.. oxytocin : A cyclic nonapeptide hormone with amino acid sequence CYIQNCPLG that also acts as a neurotransmitter in the brain; the principal uterine-contracting and milk-ejecting hormone of the posterior pituitary. Together with the neuropeptide vasopressin, it is believed to influence social cognition and behaviour.	1.98	1	0	heterodetic cyclic peptide; peptide hormone	oxytocic; vasodilator agent
bekanamycin bekanamycin: kanendomycin is the sulfate of bekanamycin; RN given refers to parent cpd; structure	4.38	20	0	kanamycins
inositol 1,4,5-trisphosphate Inositol 1,4,5-Trisphosphate: Intracellular messenger formed by the action of phospholipase C on phosphatidylinositol 4,5-bisphosphate, which is one of the phospholipids that make up the cell membrane. Inositol 1,4,5-trisphosphate is released into the cytoplasm where it releases calcium ions from internal stores within the cell's endoplasmic reticulum. These calcium ions stimulate the activity of B kinase or calmodulin.	5.64	76	0	myo-inositol trisphosphate	mouse metabolite
ouabain Ouabain: A cardioactive glycoside consisting of rhamnose and ouabagenin, obtained from the seeds of Strophanthus gratus and other plants of the Apocynaceae; used like DIGITALIS. It is commonly used in cell biological studies as an inhibitor of the NA(+)-K(+)-EXCHANGING ATPASE.. cardiac glycoside : Steroid lactones containing sugar residues that act on the contractile force of the cardiac muscles.. ouabain : A steroid hormone that is a multi-hydroxylated alpha-L-rhamnosyl cardenoloide. It binds to and inhibits the plasma membrane Na(+)/K(+)-ATPase (sodium pump). It has been isolated naturally from Strophanthus gratus.	3.61	9	0	11alpha-hydroxy steroid; 14beta-hydroxy steroid; 5beta-hydroxy steroid; alpha-L-rhamnoside; cardenolide glycoside; steroid hormone	anti-arrhythmia drug; cardiotonic drug; EC 2.3.3.1 [citrate (Si)-synthase] inhibitor; EC 3.1.3.41 (4-nitrophenylphosphatase) inhibitor; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor; EC 3.6.3.9 (Na(+)/K(+)-transporting ATPase) inhibitor; ion transport inhibitor; plant metabolite
puromycin [no description available]	6.38	32	0	puromycins	antiinfective agent; antimicrobial agent; antineoplastic agent; EC 3.4.11.14 (cytosol alanyl aminopeptidase) inhibitor; EC 3.4.14.2 (dipeptidyl-peptidase II) inhibitor; nucleoside antibiotic; protein synthesis inhibitor
paromamine paromamine: RN given refers to (D)-isomer. paromamine : An aminoglycoside that is 4alpha,6alpha-diaminocyclohexane-1beta,2alpha,3beta-triol in which the pro-R hydroxy group has been converted into its 2-amino-alpha-D-glucoside derivative.	3.12	5	0	aminoglycoside; primary amino compound; triamine
streptamine streptamine: RN given refers to parent cpd; structure. streptamine : An amino cyclitol consisting of scyllo-inositol with the hydroxy groups at positions 1 and 3 replaced by unsubstituted amino groups.	2.05	1	0
pentostatin Pentostatin: A potent inhibitor of ADENOSINE DEAMINASE. The drug induces APOPTOSIS of LYMPHOCYTES, and is used in the treatment of many lymphoproliferative malignancies, particularly HAIRY CELL LEUKEMIA. It is also synergistic with some other antineoplastic agents and has immunosuppressive activity.. pentostatin : A member of the class of coformycins that is coformycin in which the hydroxy group at position 2' is replaced with a hydrogen. It is a drug used for the treatment of hairy cell leukaemia.	3.41	1	0	coformycins	antimetabolite; antineoplastic agent; Aspergillus metabolite; bacterial metabolite; EC 3.5.4.4 (adenosine deaminase) inhibitor
monoiodotyrosine Monoiodotyrosine: A product from the iodination of tyrosine. In the biosynthesis of thyroid hormones (THYROXINE and TRIIODOTHYRONINE), tyrosine is first iodized to monoiodotyrosine.. iodotyrosine : A tyrosine derivative which has at least one iodo-substituent on the benzyl moiety.. monoiodotyrosine : An iodotyrosine carrying a single iodo substituent.. 3-iodo-L-tyrosine : The monoiodotyrosine that is L-tyrosine carrying an iodo-substituent at position C-3 of the benzyl group.	2.45	2	0	amino acid zwitterion; L-tyrosine derivative; monoiodotyrosine; non-proteinogenic L-alpha-amino acid	EC 1.14.16.2 (tyrosine 3-monooxygenase) inhibitor; human metabolite; mouse metabolite
taurolithocholic acid Taurolithocholic Acid: A bile salt formed in the liver from lithocholic acid conjugation with taurine, usually as the sodium salt. It solubilizes fats for absorption and is itself absorbed. It is a cholagogue and choleretic.. taurolithocholic acid : The bile acid taurine conjugate of lithocholic acid.	1.97	1	0	bile acid taurine conjugate; monocarboxylic acid amide	human metabolite
nitroarginine Nitroarginine: An inhibitor of nitric oxide synthetase which has been shown to prevent glutamate toxicity. Nitroarginine has been experimentally tested for its ability to prevent ammonia toxicity and ammonia-induced alterations in brain energy and ammonia metabolites. (Neurochem Res 1995:200(4):451-6). N(gamma)-nitro-L-arginine : An L-arginine derivative that is L-arginine in which the terminal nitrogen of the guanidyl group is replaced by a nitro group.	2.39	2	0	guanidines; L-arginine derivative; N-nitro compound; non-proteinogenic L-alpha-amino acid
inositol 4-phosphate inositol 4-phosphate: RN given refers to (DL-myo)-isomer	1.97	1	0	inositol phosphate
adenosine 5'-o-(3-thiotriphosphate) adenosine 5'-O-(3-thiotriphosphate): RN given refers to cpd with unspecified locant for thio group; see also records for 1-thio & 2-thio-isomers. adenosine 5'-[gamma-thio]triphosphate : A nucleoside triphosphate analogue that is ATP in which one of the oxygens attached to 3-phosphate group is replaced by sulfur.	2.39	2	0	nucleoside triphosphate analogue
strychnine Strychnine: An alkaloid found in the seeds of STRYCHNOS NUX-VOMICA. It is a competitive antagonist at glycine receptors and thus a convulsant. It has been used as an analeptic, in the treatment of nonketotic hyperglycinemia and sleep apnea, and as a rat poison.. strychnine : A monoterpenoid indole alkaloid that is strychnidine bearing a keto substituent at the 10-position.	2.88	4	0	monoterpenoid indole alkaloid; organic heteroheptacyclic compound	avicide; cholinergic antagonist; glycine receptor antagonist; neurotransmitter agent; rodenticide
quinidine Quinidine: An optical isomer of quinine, extracted from the bark of the CHINCHONA tree and similar plant species. This alkaloid dampens the excitability of cardiac and skeletal muscles by blocking sodium and potassium currents across cellular membranes. It prolongs cellular ACTION POTENTIALS, and decreases automaticity. Quinidine also blocks muscarinic and alpha-adrenergic neurotransmission.. quinidine : A cinchona alkaloid consisting of cinchonine with the hydrogen at the 6-position of the quinoline ring substituted by methoxy.	4.68	9	0	cinchona alkaloid	alpha-adrenergic antagonist; anti-arrhythmia drug; antimalarial; drug allergen; EC 1.14.13.181 (13-deoxydaunorubicin hydroxylase) inhibitor; EC 3.6.3.44 (xenobiotic-transporting ATPase) inhibitor; muscarinic antagonist; P450 inhibitor; potassium channel blocker; sodium channel blocker
meropenem Meropenem: A thienamycin derivative antibacterial agent that is more stable to renal dehydropeptidase I than IMIPENEM, but does not need to be given with an enzyme inhibitor such as CILASTATIN. It is used in the treatment of bacterial infections, including infections in immunocompromised patients.. meropenem : A carbapenemcarboxylic acid in which the azetidine and pyrroline rings carry 1-hydroxymethyl and in which the azetidine and pyrroline rings carry 1-hydroxymethyl and 5-(dimethylcarbamoyl)pyrrolidin-3-ylthio substituents respectively.	2.96	4	0	alpha,beta-unsaturated monocarboxylic acid; carbapenemcarboxylic acid; organic sulfide; pyrrolidinecarboxamide	antibacterial agent; antibacterial drug; drug allergen
griseofulvin Griseofulvin: An antifungal agent used in the treatment of TINEA infections.. griseofulvin : An oxaspiro compound produced by Penicillium griseofulvum. It is used by mouth as an antifungal drug for infections involving the scalp, hair, nails and skin that do not respond to topical treatment.	5.18	9	0	1-benzofurans; antibiotic antifungal drug; benzofuran antifungal drug; organochlorine compound; oxaspiro compound	antibacterial agent; Penicillium metabolite
monensin Monensin: An antiprotozoal agent produced by Streptomyces cinnamonensis. It exerts its effect during the development of first-generation trophozoites into first-generation schizonts within the intestinal epithelial cells. It does not interfere with hosts' development of acquired immunity to the majority of coccidial species. Monensin is a sodium and proton selective ionophore and is widely used as such in biochemical studies.. monensin A : A spiroketal, monensin A is the major component of monensin, a mixture of antibiotic substances produced by Streptomyces cinnamonensis. An antiprotozoal, it is used as the sodium salt as a feed additive for the prevention of coccidiosis in poultry and as a growth promoter in cattle.	2.39	2	0	cyclic hemiketal; monocarboxylic acid; polyether antibiotic; spiroketal	antifungal agent; coccidiostat; ionophore
cefoxitin Cefoxitin: A semisynthetic cephamycin antibiotic resistant to beta-lactamase.. cefoxitin : A semisynthetic cephamycin antibiotic which, in addition to the methoxy group at the 7alpha position, has 2-thienylacetamido and carbamoyloxymethyl side-groups. It is resistant to beta-lactamase.	5.92	7	4	beta-lactam antibiotic allergen; cephalosporin; cephamycin; semisynthetic derivative	antibacterial drug
digitoxin Digitoxin: A cardiac glycoside sometimes used in place of DIGOXIN. It has a longer half-life than digoxin; toxic effects, which are similar to those of digoxin, are longer lasting. (From Martindale, The Extra Pharmacopoeia, 30th ed, p665). digitoxin : A cardenolide glycoside in which the 3beta-hydroxy group of digitoxigenin carries a 2,6-dideoxy-beta-D-ribo-hexopyranosyl-(1->4)-2,6-dideoxy-beta-D-ribo-hexopyranosyl-(1->4)-2,6-dideoxy-beta-D-ribo-hexopyranosyl trisaccharide chain.	3.76	3	0	cardenolide glycoside	EC 3.6.3.9 (Na(+)/K(+)-transporting ATPase) inhibitor
saquinavir Saquinavir: An HIV protease inhibitor which acts as an analog of an HIV protease cleavage site. It is a highly specific inhibitor of HIV-1 and HIV-2 proteases, and also inhibits CYTOCHROME P-450 CYP3A.. saquinavir : An aspartic acid derivative obtained by formal condensation of the primary amino group of (2S,3R)-4-[(3S,4aS,8aS)-3-(tert-butylcarbamoyl)octahydroisoquinolin-2(1H)-yl]-3-hydroxy-1-phenylbutan-2-ylamine with the carboxy group of N(2)(-quinolin-2-ylcarbonyl)-L-asparagine. An inhibitor of HIV-1 protease.	2.75	3	0	L-asparagine derivative; quinolines	antiviral drug; HIV protease inhibitor
pancuronium Pancuronium: A bis-quaternary steroid that is a competitive nicotinic antagonist. As a neuromuscular blocking agent it is more potent than CURARE but has less effect on the circulatory system and on histamine release.. pancuronium : A steroid ester in which a 5alpha-androstane skeleton is C-3alpha- and C-17beta-disubstituted with acetoxy groups and 2beta- and 16beta-disubstituted with 1-methylpiperidinium-1-yl groups. It is a non-depolarizing curare-mimetic muscle relaxant.	2.65	3	0	acetate ester; steroid ester	cholinergic antagonist; muscle relaxant; nicotinic antagonist
rocuronium Rocuronium: An androstanol non-depolarizing neuromuscular blocking agent. It has a mono-quaternary structure and is a weaker nicotinic antagonist than PANCURONIUM.. rocuronium : A 5alpha-androstane compound having 3alpha-hydroxy-, 17beta-acetoxy-, 2beta-morpholino- and 16beta-N-allyllyrrolidinium substituents.	1.99	1	0	3alpha-hydroxy steroid; acetate ester; androstane; morpholines; quaternary ammonium ion; tertiary amino compound	drug allergen; muscle relaxant; neuromuscular agent
abacavir abacavir: a carbocyclic nucleoside with potent selective anti-HIV activity. abacavir : A 2,6-diaminopurine that is (1S)-cyclopent-2-en-1-ylmethanol in which the pro-R hydrogen at the 4-position is substituted by a 2-amino-6-(cyclopropylamino)-9H-purin-9-yl group. A nucleoside analogue reverse transcriptase inhibitor (NRTI) with antiretroviral activity against HIV, it is used (particularly as the sulfate) with other antiretrovirals in combination therapy of HIV infection.	2.06	1	0	2,6-diaminopurines	antiviral drug; drug allergen; HIV-1 reverse transcriptase inhibitor
netilmicin Netilmicin: Semisynthetic 1-N-ethyl derivative of SISOMYCIN, an aminoglycoside antibiotic with action similar to gentamicin, but less ear and kidney toxicity.	5.49	21	0
trimethaphan camsylate trimethaphan camsylate : The (S)-camphorsulfonate salt of trimethaphan.	2.05	1	0
metyrosine alpha-methyl-L-tyrosine : An L-tyrosine derivative that consists of L-tyrosine bearing an additional methyl substituent at position 2. An inhibitor of the enzyme tyrosine 3-monooxygenase, and consequently of the synthesis of catecholamines. It is used to control the symptoms of excessive sympathetic stimulation in patients with pheochromocytoma.	2.06	1	0	L-tyrosine derivative; non-proteinogenic L-alpha-amino acid	antihypertensive agent; EC 1.14.16.2 (tyrosine 3-monooxygenase) inhibitor
erythromycin estolate Erythromycin Estolate: A macrolide antibiotic, produced by Streptomyces erythreus. It is the lauryl sulfate salt of the propionic ester of erythromycin. This erythromycin salt acts primarily as a bacteriostatic agent. In sensitive organisms, it inhibits protein synthesis by binding to 50S ribosomal subunits. This binding process inhibits peptidyl transferase activity and interferes with translocation of amino acids during translation and assembly of proteins.	2.46	2	0	aminoglycoside sulfate salt; erythromycin derivative	enzyme inhibitor
terconazole terconazole: structure & RN for (cis)-isomer from first source. terconazole : A racemate consisting of equimolar amounts of (2R,4S)- and (2S,4R)-terconazole. It has broad-spectrum antifungal activitiy and is used for the treatment of vaginal yeast infections (Candida).. (2R,4S)-terconazole : A 1-(4-{[2-(2,4-dichlorophenyl)-2-(1H-1,2,4-triazol-1-ylmethyl)-1,3-dioxolan-4-yl]methoxy}phenyl)-4-isopropylpiperazine in which positions 2 and 4 of the 1,3-dioxolane moiety have R and S configuration, respectively.	1.93	1	0	1-(4-{[2-(2,4-dichlorophenyl)-2-(1H-1,2,4-triazol-1-ylmethyl)-1,3-dioxolan-4-yl]methoxy}phenyl)-4-isopropylpiperazine
linezolid [no description available]	4.26	5	0	acetamides; morpholines; organofluorine compound; oxazolidinone	antibacterial drug; protein synthesis inhibitor
phalloidine Phalloidine: Very toxic polypeptide isolated mainly from AMANITA phalloides (Agaricaceae) or death cup; causes fatal liver, kidney and CNS damage in mushroom poisoning; used in the study of liver damage.. phalloidin : A homodetic bicyclic heptapeptide having a sulfide bridge.	2.92	4	0	homodetic cyclic peptide
indican [no description available]	3.33	7	0	beta-D-glucoside; exopolysaccharide; indolyl carbohydrate
ryanodine Ryanodine: A methylpyrrole-carboxylate from RYANIA that disrupts the RYANODINE RECEPTOR CALCIUM RELEASE CHANNEL to modify CALCIUM release from SARCOPLASMIC RETICULUM resulting in alteration of MUSCLE CONTRACTION. It was previously used in INSECTICIDES. It is used experimentally in conjunction with THAPSIGARGIN and other inhibitors of CALCIUM ATPASE uptake of calcium into SARCOPLASMIC RETICULUM.. ryanodine : An insecticide alkaloid isolated from South American plant Ryania speciosa.	4.35	20	0
phorbol phorbol: RN given refers to (1aR-(1a alpha,1b beta,4a beta,7a alpha,7b alpha,8 alpha,9 beta,9b beta))-isomer; synonym isophorbol refers to (4a alpha)-isomer; structure in Merck Index, 9th ed, #7143. phorbol : A diterpenoid with the structure of tigliane hydroxylated at C-4, -9, -12(beta), -13 and -20, with an oxo group at C-3 and unsaturation at the 1- and 6-positions.	2.38	2	0	cyclic ketone; enone; tertiary alcohol; tertiary alpha-hydroxy ketone; tetracyclic diterpenoid
picrotoxinin [no description available]	2.45	2	0	epoxide; gamma-lactone; organic heteropentacyclic compound; picrotoxane sesquiterpenoid; tertiary alcohol	GABA antagonist; plant metabolite; serotonergic antagonist
naringin [no description available]	2.31	1	0	(2S)-flavan-4-one; 4'-hydroxyflavanones; dihydroxyflavanone; disaccharide derivative; neohesperidoside	anti-inflammatory agent; antineoplastic agent; metabolite
ochratoxin a ochratoxin A: structure in first source & in Merck, 9th ed, #6549. ochratoxin A : A phenylalanine derivative resulting from the formal condensation of the amino group of L-phenylalanine with the carboxy group of (3R)-5-chloro-8-hydroxy-3-methyl-1-oxo-3,4-dihydro-1H-2-benzopyran-7-carboxylic acid (ochratoxin alpha). It is among the most widely occurring food-contaminating mycotoxins, produced by Aspergillus ochraceus, Aspergillus carbonarius and Penicillium verrucosum.	2.05	1	0	isochromanes; monocarboxylic acid amide; N-acyl-L-phenylalanine; organochlorine compound; phenylalanine derivative	Aspergillus metabolite; calcium channel blocker; carcinogenic agent; mycotoxin; nephrotoxin; Penicillium metabolite; teratogenic agent
cyclopamine [no description available]	2.05	1	0	piperidines	glioma-associated oncogene inhibitor
acriflavine Acriflavine: 3,6-Diamino-10-methylacridinium chloride mixt. with 3,6-acridinediamine. Fluorescent dye used as a local antiseptic and also as a biological stain. It intercalates into nucleic acids thereby inhibiting bacterial and viral replication.	2.36	2	0
bq 123 cyclo(Trp-Asp-Pro-Val-Leu): derived from the modification of a natural lead of BE-18257B, an endothelin A receptor antagonist; has neuroprotective activity; amino acid sequence given in first source	2.9	4	0	cyclic peptide
n-formylmethionine leucyl-phenylalanine N-Formylmethionine Leucyl-Phenylalanine: A formylated tripeptide originally isolated from bacterial filtrates that is positively chemotactic to polymorphonuclear leucocytes, and causes them to release lysosomal enzymes and become metabolically activated.. N-formyl-L-methionyl-L-leucyl-L-phenylalanine : A tripeptide composed of L-Met, L-Leu and L-Phe in a linear sequence with a formyl group at the amino terminus. It acts as a potent inducer of leucocyte chemotaxis and macrophage activator as well as a ligand for the FPR receptor.	2.89	4	0	tripeptide
devazepide Devazepide: A derivative of benzodiazepine that acts on the cholecystokinin A (CCKA) receptor to antagonize CCK-8's (SINCALIDE) physiological and behavioral effects, such as pancreatic stimulation and inhibition of feeding.. devazepide : An indolecarboxamide obtained by formal condensation of the carboxy group of indole-2-carboxylic acid with the exocyclic amino group of (3S)-3-amino-1-methyl-5-phenyl-1,3-dihydro-1,4-benzodiazepin-2-one. A cholecystokinin antagonist used for treatment of gastrointestinal disorders.	2.45	2	0	1,4-benzodiazepinone; indolecarboxamide	antineoplastic agent; apoptosis inducer; cholecystokinin antagonist; gastrointestinal drug
hetacillin [no description available]	2.04	1	0	penicillin	antibacterial drug
tolterodine [no description available]	2.05	1	0	tertiary amine	antispasmodic drug; muscarinic antagonist; muscle relaxant
doxorubicin hydrochloride [no description available]	2.05	1	0	anthracycline
halcinonide Halcinonide: A glucocorticoid used topically in the treatment of DERMATITIS; ECZEMA; or PSORIASIS. It may cause skin irritation.	4.31	2	2	organic molecular entity	SMO receptor agonist
medigoxin Medigoxin: A semisynthetic digitalis glycoside with the general properties of DIGOXIN but more rapid onset of action. Its cardiotonic action is prolonged by its demethylation to DIGOXIN in the liver. It has been used in the treatment of congestive heart failure (HEART FAILURE).	2.04	1	0	cardenolide glycoside
erythromycin ethylsuccinate Erythromycin Ethylsuccinate: A macrolide antibiotic, produced by Streptomyces erythreus. This compound is an ester of erythromycin base and succinic acid. It acts primarily as a bacteriostatic agent. In sensitive organisms, it inhibits protein synthesis by binding to 50S ribosomal subunits. This binding process inhibits peptidyl transferase activity and interferes with translocation of amino acids during translation and assembly of proteins.. erythromycin ethylsuccinate : A erythromycin derivative that is erythromycin A in which the hydroxy group at position 3R is substituted by a (4-ethoxy-4-oxobutanoyl)oxy group. It is used for the treatment of a wide variety of bacterial infections.	8.57	125	1	cyclic ketone; erythromycin derivative; ethyl ester; succinate ester
betamethasone acetate [no description available]	2.04	1	0	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(1),Delta(4)-steroid; acetate ester; fluorinated steroid; steroid ester; tertiary alpha-hydroxy ketone
ao 128 AO 128: alpha-glucosidase inhibitor; structure given in first source	2.05	1	0	organic molecular entity
acarbose [no description available]	2.75	3	0	amino cyclitol; glycoside
7-ketolithocholic acid 7-ketolithocholic acid: RN given refers to (3alpha,5beta)-isomer. 7-oxolithocholic acid : A bile acid that is lithocholic acid carrying an additional oxo substituent at position 7.	1.96	1	0	3alpha-hydroxy steroid; bile acid; monohydroxy-5beta-cholanic acid; oxo-5beta-cholanic acid	human metabolite
maleic acid maleic acid: RN given refers to parent cpd(Z)-isomer which is maleic acid; all RR's given refer to (Z)-isomer; (E)-isomer is fumaric acid. maleic acid : A butenedioic acid in which the double bond has cis- (Z)-configuration.	2.08	1	0	butenedioic acid	algal metabolite; mouse metabolite; plant metabolite
acetyl coenzyme a Acetyl Coenzyme A: Acetyl CoA participates in the biosynthesis of fatty acids and sterols, in the oxidation of fatty acids and in the metabolism of many amino acids. It also acts as a biological acetylating agent.	2.88	4	0	acyl-CoA	acyl donor; coenzyme; effector; fundamental metabolite
ergosterol [no description available]	2.42	2	0	3beta-hydroxy-Delta(5)-steroid; 3beta-sterol; ergostanoid; phytosterols	fungal metabolite; Saccharomyces cerevisiae metabolite
tretinoin Tretinoin: An important regulator of GENE EXPRESSION during growth and development, and in NEOPLASMS. Tretinoin, also known as retinoic acid and derived from maternal VITAMIN A, is essential for normal GROWTH; and EMBRYONIC DEVELOPMENT. An excess of tretinoin can be teratogenic. It is used in the treatment of PSORIASIS; ACNE VULGARIS; and several other SKIN DISEASES. It has also been approved for use in promyelocytic leukemia (LEUKEMIA, PROMYELOCYTIC, ACUTE).. retinoic acid : A retinoid consisting of 3,7-dimethylnona-2,4,6,8-tetraenoic acid substituted at position 9 by a 2,6,6-trimethylcyclohex-1-en-1-yl group (geometry of the four exocyclic double bonds is not specified).. all-trans-retinoic acid : A retinoic acid in which all four exocyclic double bonds have E- (trans-) geometry.	3.49	8	0	retinoic acid; vitamin A	anti-inflammatory agent; antineoplastic agent; antioxidant; AP-1 antagonist; human metabolite; keratolytic drug; retinoic acid receptor agonist; retinoid X receptor agonist; signalling molecule
arachidonic acid icosa-5,8,11,14-tetraenoic acid : Any icosatetraenoic acid with the double bonds at positions 5, 8, 11 and 14.. arachidonate : A long-chain fatty acid anion resulting from the removal of a proton from the carboxy group of arachidonic acid.	4.58	26	0	icosa-5,8,11,14-tetraenoic acid; long-chain fatty acid; omega-6 fatty acid	Daphnia galeata metabolite; EC 3.1.1.1 (carboxylesterase) inhibitor; human metabolite; mouse metabolite
phosphoramidon phosphoramidon: a membrane metallo-endopeptidase & endothelin-converting enzyme inhibitor; thermolysin inhibitor from culture filtrate of Streptomyces tanashiensis; structure. phosphoramidon : A dipeptide isolated from the cultures of Streptomyces tanashiensis.	2.04	1	0	deoxyaldohexose phosphate; dipeptide	bacterial metabolite; EC 3.4.24.11 (neprilysin) inhibitor; EC 3.4.24.71 (endothelin-converting enzyme 1) inhibitor
retinol Vitamin A: Retinol and derivatives of retinol that play an essential role in metabolic functioning of the retina, the growth of and differentiation of epithelial tissue, the growth of bone, reproduction, and the immune response. Dietary vitamin A is derived from a variety of CAROTENOIDS found in plants. It is enriched in the liver, egg yolks, and the fat component of dairy products.. vitamin A : Any member of a group of fat-soluble retinoids produced via metabolism of provitamin A carotenoids that exhibit biological activity against vitamin A deficiency. Vitamin A is involved in immune function, vision, reproduction, and cellular communication.. all-trans-retinol : A retinol in which all four exocyclic double bonds have E- (trans-) geometry.. retinol : A retinoid consisting of 3,7-dimethylnona-2,4,6,8-tetraen-1-ol substituted at position 9 by a 2,6,6-trimethylcyclohex-1-en-1-yl group (geometry of the four exocyclic double bonds is not specified).	6.14	18	2	retinol; vitamin A	human metabolite; mouse metabolite; plant metabolite
alpha-D-fructofuranose 1,6-bisphosphate alpha-D-fructofuranose 1,6-bisphosphate : A D-fructofuranose 1,6-bisphosphate with an alpha-configuration at the anomeric position.	2.05	1	0	D-fructofuranose 1,6-bisphosphate
docosahexaenoate efalex: a mixture of fish oil and primrose oil; used as a high-docosahexaenoic acid fatty acid supplement. docosahexaenoic acid : Any C22 polyunsaturated fatty acid containing six double bonds.. docosahexaenoate : A polyunsaturated fatty acid anion that is the conjugate base of docosahexaenoic acid, obtained by deprotonation of the carboxy group; major species at pH 7.3.. all-cis-docosa-4,7,10,13,16,19-hexaenoic acid : A docosahexaenoic acid having six cis-double bonds at positions 4, 7, 10, 13, 16 and 19.	2.05	1	0	docosahexaenoic acid; omega-3 fatty acid	algal metabolite; antineoplastic agent; Daphnia tenebrosa metabolite; human metabolite; mouse metabolite; nutraceutical
oleic acid Oleic Acid: An unsaturated fatty acid that is the most widely distributed and abundant fatty acid in nature. It is used commercially in the preparation of oleates and lotions, and as a pharmaceutical solvent. (Stedman, 26th ed). oleic acid : An octadec-9-enoic acid in which the double bond at C-9 has Z (cis) stereochemistry.	2.87	4	0	octadec-9-enoic acid	antioxidant; Daphnia galeata metabolite; EC 3.1.1.1 (carboxylesterase) inhibitor; Escherichia coli metabolite; mouse metabolite; plant metabolite; solvent
tacrolimus Tacrolimus: A macrolide isolated from the culture broth of a strain of Streptomyces tsukubaensis that has strong immunosuppressive activity in vivo and prevents the activation of T-lymphocytes in response to antigenic or mitogenic stimulation in vitro.. tacrolimus (anhydrous) : A macrolide lactam containing a 23-membered lactone ring, originally isolated from the fermentation broth of a Japanese soil sample that contained the bacteria Streptomyces tsukubaensis.	2.71	3	0	macrolide lactam	bacterial metabolite; immunosuppressive agent
ferulic acid ferulate : A monocarboxylic acid anion obtained by the deprotonation of the carboxy group of ferulic acid.	2.6	1	0	ferulic acids	anti-inflammatory agent; antioxidant; apoptosis inhibitor; cardioprotective agent; MALDI matrix material; plant metabolite
pectins Pectins: High molecular weight polysaccharides present in the cell walls of all plants. Pectins cement cell walls together. They are used as emulsifiers and stabilizers in the food industry. They have been tried for a variety of therapeutic uses including as antidiarrheals, where they are now generally considered ineffective, and in the treatment of hypercholesterolemia.. alpha-D-galacturonic acid : The alpha-anomer of D-galacturonic acid.	4.08	16	0	D-galactopyranuronic acid
cerivastatin cerivastatin: cerivastatin is the ((E)-(+))-isomer; structure given in first source. cerivastatin : (3R,5S)-3,5-dihydroxyhept-6-enoic acid in which the (7E)-hydrogen is substituted by a 4-(4-fluorophenyl)-2,6-diisopropyl-5-(methoxymethyl)pyridin-3-yl group. Formerly used (as its sodium salt) to lower cholesterol and prevent cardiovascular disease, it was withdrawn from the market worldwide in 2001 following reports of a severe form of muscle toxicity.	2.05	1	0	dihydroxy monocarboxylic acid; pyridines; statin (synthetic)
rosuvastatin rosuvastatin : A dihydroxy monocarboxylic acid that is (6E)-7-{4-(4-fluorophenyl)-2-[methyl(methylsulfonyl)amino]-6-(propan-2-yl)pyrimidin-5-yl} hept-6-enoic acid carrying two hydroxy substituents at positions 3 and 5 (the 3R,5S-diastereomer).	2.05	1	0	dihydroxy monocarboxylic acid; monofluorobenzenes; pyrimidines; statin (synthetic); sulfonamide	anti-inflammatory agent; antilipemic drug; cardioprotective agent; CETP inhibitor; environmental contaminant; xenobiotic
cocaine Cocaine: An alkaloid ester extracted from the leaves of plants including coca. It is a local anesthetic and vasoconstrictor and is clinically used for that purpose, particularly in the eye, ear, nose, and throat. It also has powerful central nervous system effects similar to the amphetamines and is a drug of abuse. Cocaine, like amphetamines, acts by multiple mechanisms on brain catecholaminergic neurons; the mechanism of its reinforcing effects is thought to involve inhibition of dopamine uptake.. cocaine : A tropane alkaloid obtained from leaves of the South American shrub Erythroxylon coca.	2.69	3	0	benzoate ester; methyl ester; tertiary amino compound; tropane alkaloid	adrenergic uptake inhibitor; central nervous system stimulant; dopamine uptake inhibitor; environmental contaminant; local anaesthetic; mouse metabolite; plant metabolite; serotonin uptake inhibitor; sodium channel blocker; sympathomimetic agent; vasoconstrictor agent; xenobiotic
eicosapentaenoic acid icosapentaenoic acid : Any straight-chain, C20 polyunsaturated fatty acid having five C=C double bonds.. all-cis-5,8,11,14,17-icosapentaenoic acid : An icosapentaenoic acid having five cis-double bonds at positions 5, 8, 11, 14 and 17.	2.05	1	0	icosapentaenoic acid; omega-3 fatty acid	anticholesteremic drug; antidepressant; antineoplastic agent; Daphnia galeata metabolite; fungal metabolite; micronutrient; mouse metabolite; nutraceutical
thapsigargin Thapsigargin: A sesquiterpene lactone found in roots of THAPSIA. It inhibits SARCOPLASMIC RETICULUM CALCIUM-TRANSPORTING ATPASES.. thapsigargin : An organic heterotricyclic compound that is a hexa-oxygenated 6,7-guaianolide isolated fron the roots of Thapsia garganica L., Apiaceae. A potent skin irritant, it is used in traditional medicine as a counter-irritant. Thapsigargin inhibits Ca(2+)-transporting ATPase mediated uptake of calcium ions into sarcoplasmic reticulum and is used in experimentation examining the impacts of increasing cytosolic calcium concentrations.	4.14	16	0	butyrate ester; organic heterotricyclic compound; sesquiterpene lactone	calcium channel blocker; EC 3.6.3.8 (Ca(2+)-transporting ATPase) inhibitor
mycophenolic acid Mycophenolic Acid: Compound derived from Penicillium stoloniferum and related species. It blocks de novo biosynthesis of purine nucleotides by inhibition of the enzyme inosine monophosphate dehydrogenase (IMP DEHYDROGENASE). Mycophenolic acid exerts selective effects on the immune system in which it prevents the proliferation of T-CELLS, LYMPHOCYTES, and the formation of antibodies from B-CELLS. It may also inhibit recruitment of LEUKOCYTES to sites of INFLAMMATION.. mycophenolate : A monocarboxylic acid anion resulting from the removal of a proton from the carboxy group of mycophenolic acid.. mycophenolic acid : A member of the class of 2-benzofurans that is 2-benzofuran-1(3H)-one which is substituted at positions 4, 5, 6, and 7 by methyl, methoxy, (2E)-5-carboxy-3-methylpent-2-en-1-yl, and hydroxy groups, respectively. It is an antibiotic produced by Penicillium brevi-compactum, P. stoloniferum, P. echinulatum and related species. An immunosuppressant, it is widely used (partiularly as its sodium salt and as the 2-(morpholin-4-yl)ethyl ester prodrug, mycophenolate mofetil) to prevent tissue rejection following organ transplants and for the treatment of certain autoimmune diseases.	2.72	3	0	2-benzofurans; gamma-lactone; monocarboxylic acid; phenols	anticoronaviral agent; antimicrobial agent; antineoplastic agent; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; environmental contaminant; immunosuppressive agent; mycotoxin; Penicillium metabolite; xenobiotic
mupirocin Mupirocin: A topically used antibiotic from a strain of Pseudomonas fluorescens. It has shown excellent activity against gram-positive staphylococci and streptococci. The antibiotic is used primarily for the treatment of primary and secondary skin disorders, nasal infections, and wound healing.. mupirocin : An alpha,beta-unsaturated ester resulting from the formal condensation of the alcoholic hydroxy group of 9-hydroxynonanoic acid with the carboxy group of (2E)-4-[(2S)-tetrahydro-2H-pyran-2-yl]-3-methylbut-2-enoic acid in which the tetrahydropyranyl ring is substituted at positions 3 and 4 by hydroxy groups and at position 5 by a {(2S,3S)-3-[(2S,3S)-3-hydroxybutan-2-yl]oxiran-2-yl}methyl group. Originally isolated from the Gram-negative bacterium Pseudomonas fluorescens, it is used as a topical antibiotic for the treatment of Gram-positive bacterial infections.	6.36	11	4	alpha,beta-unsaturated carboxylic ester; epoxide; monocarboxylic acid; oxanes; secondary alcohol; triol	antibacterial drug; bacterial metabolite; protein synthesis inhibitor
clindamycin Clindamycin: An antibacterial agent that is a semisynthetic analog of LINCOMYCIN.. clindamycin : A carbohydrate-containing antibiotic that is the semisynthetic derivative of lincomycin, a natural antibiotic.	10.47	40	7
brivudine brivudine: anti-herpes agent	2.06	1	0
fosfomycin Fosfomycin: An antibiotic produced by Streptomyces fradiae.. fosfomycin : A phosphonic acid having an (R,S)-1,2-epoxypropyl group attached to phosphorus.	4.51	5	1	epoxide; phosphonic acids	antimicrobial agent; EC 2.5.1.7 (UDP-N-acetylglucosamine 1-carboxyvinyltransferase) inhibitor
zithromax Azithromycin: A semi-synthetic macrolide antibiotic structurally related to ERYTHROMYCIN. It has been used in the treatment of Mycobacterium avium intracellulare infections, toxoplasmosis, and cryptosporidiosis.. azithromycin : A macrolide antibiotic useful for the treatment of bacterial infections.	3.16	5	0	macrolide antibiotic	antibacterial drug; environmental contaminant; xenobiotic
drf 2725 ragaglitazar: a phenoxazine analogue of phenyl propanoic acid; Ragaglitazar is a coligand of PPARalpha and PPARgamma	2.05	1	0
argininamide argininamide: RN given refers to parent cpd without isomeric designation. L-arginine amide : An amino acid amide resulting from the formal condensation of the carboxy group of L-arginine with ammonia.	2.02	1	0	amino acid amide; guanidines; L-arginine derivative
adenosine-5'-(n-ethylcarboxamide) Adenosine-5'-(N-ethylcarboxamide): A stable adenosine A1 and A2 receptor agonist. Experimentally, it inhibits cAMP and cGMP phosphodiesterase activity.. N-ethyl-5'-carboxamidoadenosine : A derivative of adenosine in which the 5'-hydroxymethyl group is replaced by an N-ethylcarboxamido group.	2.45	2	0	adenosines; monocarboxylic acid amide	adenosine A1 receptor agonist; adenosine A2A receptor agonist; antineoplastic agent; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; vasodilator agent
prostaglandin d2 Prostaglandin D2: The principal cyclooxygenase metabolite of arachidonic acid. It is released upon activation of mast cells and is also synthesized by alveolar macrophages. Among its many biological actions, the most important are its bronchoconstrictor, platelet-activating-factor-inhibitory, and cytotoxic effects.. prostaglandin D2 : A member of the class of prostaglandins D that is prosta-5,13-dien-1-oic acid substituted by hydroxy groups at positions 9 and 15 and an oxo group at position 11 (the 5Z,9alpha,13E,15S- stereoisomer).	2.68	3	0	prostaglandins D	human metabolite; mouse metabolite
diethylstilbestrol Diethylstilbestrol: A synthetic nonsteroidal estrogen used in the treatment of menopausal and postmenopausal disorders. It was also used formerly as a growth promoter in animals. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), diethylstilbestrol has been listed as a known carcinogen. (Merck, 11th ed). diethylstilbestrol : An olefinic compound that is trans-hex-3-ene in which the hydrogens at positions 3 and 4 have been replaced by p-hydroxyphenyl groups.	2.4	2	0	olefinic compound; polyphenol	antifungal agent; antineoplastic agent; autophagy inducer; calcium channel blocker; carcinogenic agent; EC 1.1.1.146 (11beta-hydroxysteroid dehydrogenase) inhibitor; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor; endocrine disruptor; xenoestrogen
bms 214662 7-cyano-2,3,4,5-tetrahydro-1-(1H-imidazol-4-ylmethyl)-3-(phenylmethyl)-4-(2-thienylsulfonyl)-1H-1,4-benzodiazepine: a farnesyltransferase inhibitor; structure in first source. BMS-214662 : A member of the class of benzodiazepines that is 2,3,4,5-tetrahydro-1H-1,4-benzodiazepine substituted by (1H-imidazol-5-yl)methyl, benzyl, (thiophen-2-yl)sulfonyl, and cyano groups at positions 1, 3R, 4 and 7, respectively. It is a potent inhibitor of farnesyltransferase (IC50 = 1.35nM) which was under clinical development for the treatment of solid tumors.	3.41	1	0	benzenes; benzodiazepine; imidazoles; nitrile; sulfonamide; thiophenes	antineoplastic agent; apoptosis inducer; EC 2.5.1.58 (protein farnesyltransferase) inhibitor
alitretinoin Alitretinoin: A retinoid that is used for the treatment of chronic hand ECZEMA unresponsive to topical CORTICOSTEROIDS. It is also used to treat cutaneous lesions associated with AIDS-related KAPOSI SARCOMA.	2.05	1	0	retinoic acid	antineoplastic agent; keratolytic drug; metabolite; retinoid X receptor agonist
roflumilast [no description available]	3.41	1	0	aromatic ether; benzamides; chloropyridine; cyclopropanes; organofluorine compound	anti-asthmatic drug; phosphodiesterase IV inhibitor
h 89 N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide: structure given in first source. N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide : A member of the class of isoquinolines that is the sulfonamide obtained by formal condensation of the sulfo group of isoquinoline-5-sulfonic acid with the primary amino group of N(1)-[3-(4-bromophenyl)prop-2-en-1-yl]ethane-1,2-diamine. It is a protein kinase A inhibitor.. (E)-N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide : A N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide in which the double bond adopts a trans-configuration.	3.26	6	0	N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide
decitabine [no description available]	2.05	1	0	2'-deoxyribonucleoside
teniposide [no description available]	2.05	1	0	aromatic ether; beta-D-glucoside; cyclic acetal; furonaphthodioxole; gamma-lactone; monosaccharide derivative; phenols; thiophenes	antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor
kt 5720 KT 5720: indolocarbazole; synthetic derivative of K 252a. KT 5720 : An organic heterooctacyclic compound that is 1H,1'H-2,2'-biindole in which the nitrogens have undergone formal oxidative coupling to positions 2 and 5 of hexyl (3S)-3-hydroxy-2-methyltetrahydrofuran-3-carboxylate (the 2R,3S,5S product), and in which the 3 and 3' positions of the biindole moiety have also undergone formal oxidative coupling to positions 3 and 4 of 1,5-dihydro-2H-pyrrol-2-one.	3.12	5	0	carboxylic ester; gamma-lactam; hemiaminal; indolocarbazole; organic heterooctacyclic compound; semisynthetic derivative; tertiary alcohol	EC 2.7.11.11 (cAMP-dependent protein kinase) inhibitor
laminaran laminaran: beta-1,3-glucan	2.01	1	0
neomycin c neomycin C: RN given refers to parent cpd. neomycin C : A tetracyclic antibacterial agent derived from neomycin, being a glycoside ester of neamine and neobiosamine C.	3.66	10	0	aminoglycoside
cefamandole Cefamandole: Semisynthetic wide-spectrum cephalosporin with prolonged action, probably due to beta-lactamase resistance. It is used also as the nafate.. cefamandole : A cephalosporin compound having (R)-mandelamido and N-methylthiotetrazole side-groups.	4.04	3	1	cephalosporin; semisynthetic derivative	antibacterial drug
dactinomycin Dactinomycin: A compound composed of a two CYCLIC PEPTIDES attached to a phenoxazine that is derived from STREPTOMYCES parvullus. It binds to DNA and inhibits RNA synthesis (transcription), with chain elongation more sensitive than initiation, termination, or release. As a result of impaired mRNA production, protein synthesis also declines after dactinomycin therapy. (From AMA Drug Evaluations Annual, 1993, p2015)	6.47	25	0	actinomycin	mutagen
gamma-sitosterol clionasterol : A member of the class of phytosterols that is poriferast-5-ene carrying a beta-hydroxy substituent at position 3.	4.99	3	1	3beta-hydroxy-Delta(5)-steroid; 3beta-sterol; phytosterols	marine metabolite; plant metabolite
tiazofurin tiazofurin: RN given refers to (beta-D)-isomer; structure given in first source. tiazofurine : A C-glycosyl compound that is 1,3-thiazole-4-carboxamide in which the hydrogen at position 2 has been replaced by a beta-D-ribofuranosyl group. It is metabolised to thiazole-4-carboxamide adenine dinucleotide (TAD), a selective inhibitor of inosine monophosphate dehydrogenase (IMP dehydrogenase).	2.05	1	0	1,3-thiazoles; C-glycosyl compound; monocarboxylic acid amide	antineoplastic agent; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; prodrug
arsphenamine Arsphenamine: An organoarsenic compound that was commonly used for treating SYPHILIS and other diseases.	1.95	1	0
azaserine Azaserine: Antibiotic substance produced by various Streptomyces species. It is an inhibitor of enzymatic activities that involve glutamine and is used as an antineoplastic and immunosuppressive agent.. azaserine : A carboxylic ester resulting from the formal condensation of the carboxy group of diazoacetic acid with the alcoholic hydroxy group of L-serine. An antibiotic produced by a Streptomyces species.	1.94	1	0	carboxylic ester; diazo compound; L-serine derivative; non-proteinogenic L-alpha-amino acid	antifungal agent; antimetabolite; antimicrobial agent; antineoplastic agent; glutamine antagonist; immunosuppressive agent; metabolite
melphalan Melphalan: An alkylating nitrogen mustard that is used as an antineoplastic in the form of the levo isomer - MELPHALAN, the racemic mixture - MERPHALAN, and the dextro isomer - MEDPHALAN; toxic to bone marrow, but little vesicant action; potential carcinogen.. melphalan : A phenylalanine derivative comprising L-phenylalanine having [bis(2-chloroethyl)amino group at the 4-position on the phenyl ring.	2.45	2	0	L-phenylalanine derivative; nitrogen mustard; non-proteinogenic L-alpha-amino acid; organochlorine compound	alkylating agent; antineoplastic agent; carcinogenic agent; drug allergen; immunosuppressive agent
benzyloxycarbonylleucyl-leucyl-leucine aldehyde benzyloxycarbonylleucyl-leucyl-leucine aldehyde: proteasome inhibitor. N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal : A tripeptide that is L-leucyl-L-leucyl-L-leucine in which the C-terminal carboxy group has been reduced to the corresponding aldehyde and the N-terminal amino group is protected as its benzyloxycarbonyl derivative.	2.48	2	0	amino aldehyde; carbamate ester; tripeptide	proteasome inhibitor
tenofovir tenofovir (anhydrous) : A member of the class of phosphonic acids that is methylphosphonic acid in which one of the methyl hydrogens is replaced by a [(2R)-1-(6-amino-9H-purin-9-yl)propan-2-yl]oxy group. An inhibitor of HIV-1 reverse transcriptase, the bis(isopropyloxycarbonyloxymethyl) ester (disoproxil ester) prodrug is used as the fumaric acid salt in combination therapy for the treatment of HIV infection.	2.46	2	0	nucleoside analogue; phosphonic acids	antiviral drug; drug metabolite; HIV-1 reverse transcriptase inhibitor
dibekacin Dibekacin: Analog of KANAMYCIN with antitubercular as well as broad-spectrum antimicrobial properties.. dibekacin : A kanamycin that is kanamycin B lacking the 3- and 4-hydroxy groups on the 2,6-diaminosugar ring.	3.49	8	0	kanamycins	antibacterial agent; protein synthesis inhibitor
bromodeoxycytidine Bromodeoxycytidine: 5-Bromo-2'-deoxycytidine. Can be incorporated into DNA in the presence of DNA polymerase, replacing dCTP.	1.93	1	0
rubitecan rubitecan: RN refers to (+-)-isomer; anti-HIV agent; DNA Topoisomerases, Type I inhibitor. rubitecan : A pyranoindolizinoquinoline that is camptothecin in which the hydrogen at position 9 has been replaced by a nitro group. It is a prodrug for 9-aminocamptothecin.	2.05	1	0	C-nitro compound; delta-lactone; pyranoindolizinoquinoline; semisynthetic derivative; tertiary alcohol	antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor; prodrug
streptothricins Streptothricins: A group of antibiotic aminoglycosides differing only in the number of repeating residues in the peptide side chain. They are produced by Streptomyces and Actinomyces and may have broad spectrum antimicrobial and some antiviral properties.. streptothricin : An N-glycosyl compound consisting of 2-amino-4-O-carbamoyl-2-deoxy-N-[(3aS,7R,7aS)-7-hydroxy-4-oxooctahydro-2H-imidazo[4,5-c]pyridin-2-ylidene]-beta-D-gulopyranosylamine in which the amino group at position 2 of the gulopyranosyl moiety is acylated by a peptide unit made up of between 1 and 7 N(epsilon)-linked units of beta-lysine.	4.45	7	0
micafungin Micafungin: A cyclic lipo-hexapeptide echinocandin antifungal agent that is used for the treatment and prevention of CANDIDIASIS.. micafungin : A cyclic hexapeptide echinocandin antibiotic which exerts its effect by inhibiting the synthesis of 1,3-beta-D-glucan, an integral component of the fungal cell wall. It is used as the sodium salt for the treatment of invasive candidiasis, and of aspergillosis in patients who are intolerant of other therapy.	2.05	1	0	antibiotic antifungal drug; echinocandin	antiinfective agent
riboflavin vitamin B2 : Any member of a group of vitamers that belong to the chemical structural class called flavins that exhibit biological activity against vitamin B2 deficiency. Symptoms associated with vitamin B2 deficiency include glossitis, seborrhea, angular stomaitis, cheilosis and photophobia. The vitamers include riboflavin and its phosphate derivatives (and includes their salt, ionised and hydrate forms).	3.06	5	0	flavin; vitamin B2	anti-inflammatory agent; antioxidant; cofactor; Escherichia coli metabolite; food colouring; fundamental metabolite; human urinary metabolite; mouse metabolite; photosensitizing agent; plant metabolite
potassium permanganate Potassium Permanganate: Permanganic acid (HMnO4), potassium salt. A highly oxidative, water-soluble compound with purple crystals, and a sweet taste. (From McGraw-Hill Dictionary of Scientific and Technical Information, 4th ed)	2.34	2	0
sodium bicarbonate Sodium Bicarbonate: A white, crystalline powder that is commonly used as a pH buffering agent, an electrolyte replenisher, systemic alkalizer and in topical cleansing solutions.	4.64	6	1	one-carbon compound; organic sodium salt	antacid; food anticaking agent
sodium acetate, anhydrous Sodium Acetate: The trihydrate sodium salt of acetic acid, which is used as a source of sodium ions in solutions for dialysis and as a systemic and urinary alkalizer, diuretic, and expectorant.	2.05	1	0	organic sodium salt	NMR chemical shift reference compound
sodium benzoate Sodium Benzoate: The sodium salt of BENZOIC ACID. It is used as an antifungal preservative in pharmaceutical preparations and foods. It may also be used as a test for liver function.. sodium benzoate : An organic sodium salt resulting from the replacement of the proton from the carboxy group of benzoic acid by a sodium ion.	3.85	3	0	organic sodium salt	algal metabolite; antimicrobial food preservative; drug allergen; EC 1.13.11.33 (arachidonate 15-lipoxygenase) inhibitor; EC 3.1.1.3 (triacylglycerol lipase) inhibitor; human xenobiotic metabolite; plant metabolite
dipyrone Dipyrone: A drug that has analgesic, anti-inflammatory, and antipyretic properties. It is the sodium sulfonate of AMINOPYRINE.. metamizole sodium : An organic sodium salt of antipyrine substituted at C-4 by a methyl(sulfonatomethyl)amino group, commonly used as a powerful analgesic and antipyretic.	2.37	2	0	organic sodium salt	anti-inflammatory agent; antipyretic; antirheumatic drug; cyclooxygenase 3 inhibitor; non-narcotic analgesic; peripheral nervous system drug; prodrug
ditiocarb sodium [no description available]	2.05	1	0	organic molecular entity
bromochloroacetic acid Keratins: A class of fibrous proteins or scleroproteins that represents the principal constituent of EPIDERMIS; HAIR; NAILS; horny tissues, and the organic matrix of tooth ENAMEL. Two major conformational groups have been characterized, alpha-keratin, whose peptide backbone forms a coiled-coil alpha helical structure consisting of TYPE I KERATIN and a TYPE II KERATIN, and beta-keratin, whose backbone forms a zigzag or pleated sheet structure. alpha-Keratins have been classified into at least 20 subtypes. In addition multiple isoforms of subtypes have been found which may be due to GENE DUPLICATION.. bromochloroacetic acid : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens is replaced by bromine while a second is replaced by chlorine. A low-melting (27.5-31.5degreeC), hygroscopic crystalline solid, it can be formed during the disinfection (by chlorination) of water that contains bromide ions and organic matter, so can occur in drinking water as a byproduct of the disinfection process.	3.22	6	0	2-bromocarboxylic acid; monocarboxylic acid; organochlorine compound
sch 22219 alclometasone dipropionate : A prednisolone compound having an alpha-chloro substituent at the 7-position, an alpha-methyl substituent at the 16-position and O-propanoyl groups at the 17- and 21-positions.	3.36	1	1	11beta-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(1),Delta(4)-steroid; chlorinated steroid; glucocorticoid; propanoate ester; steroid ester	anti-inflammatory drug
carbenoxolone [no description available]	2.05	1	0
cinnamaldehyde 3-phenylprop-2-enal : A member of the class of cinnamaldehydes that is prop-2-enal in which a hydrogen at position 3 has been replaced by a phenyl group. The configuration of the double bond is not specified; the name "cinnamaldehyde" is widely used to refer to the E (trans) isomer.. (E)-cinnamaldehyde : The E (trans) stereoisomer of cinnamaldehyde, the parent of the class of cinnamaldehydes.	2.41	2	0	3-phenylprop-2-enal; cinnamaldehydes	antifungal agent; EC 4.3.1.24 (phenylalanine ammonia-lyase) inhibitor; flavouring agent; hypoglycemic agent; plant metabolite; sensitiser; vasodilator agent
glycosides [no description available]	6.42	24	0
isomethyleugenol Methylation: Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)	4.96	12	0	isomethyleugenol
retinaldehyde Retinaldehyde: A diterpene derived from the carotenoid VITAMIN A which functions as the active component of the visual cycle. It is the prosthetic group of RHODOPSIN (i.e., covalently bonded to ROD OPSIN as 11-cis-retinal). When stimulated by visible light, rhodopsin transforms this cis-isomer of retinal to the trans-isomer (11-trans-retinal). This transformation straightens-out the bend of the retinal molecule and causes a change in the shape of rhodopsin triggering the visual process. A series of energy-requiring enzyme-catalyzed reactions convert the 11-trans-retinal back to the cis-isomer.. all-trans-retinal : A retinal in which all four exocyclic double bonds have E- (trans-) geometry.	1.98	1	0	retinal; vitamin A	gap junctional intercellular communication inhibitor; human metabolite; mouse metabolite
squalene Addavax: an oil-water nanoemulsion and adjuvant containing squalene, Tween 80, and sorbitane trioleate	2.35	2	0	triterpene	human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
discodermolide [no description available]	2.05	1	0	diterpenoid
flavin-adenine dinucleotide Flavin-Adenine Dinucleotide: A condensation product of riboflavin and adenosine diphosphate. The coenzyme of various aerobic dehydrogenases, e.g., D-amino acid oxidase and L-amino acid oxidase. (Lehninger, Principles of Biochemistry, 1982, p972)	2	1	0	flavin adenine dinucleotide; vitamin B2	cofactor; Escherichia coli metabolite; human metabolite; mouse metabolite; prosthetic group
flavin mononucleotide [no description available]	2.43	2	0	flavin mononucleotide; vitamin B2	bacterial metabolite; coenzyme; cofactor; human metabolite; mouse metabolite
cannabidiol Cannabidiol: Compound isolated from Cannabis sativa extract.. cannabidiol : An cannabinoid that is cyclohexene which is substituted by a methyl group at position 1, a 2,6-dihydroxy-4-pentylphenyl group at position 3, and a prop-1-en-2-yl group at position 4.	2.05	1	0	olefinic compound; phytocannabinoid; resorcinols	antimicrobial agent; plant metabolite
lypressin Lypressin: The porcine antidiuretic hormone (VASOPRESSINS). It is a cyclic nonapeptide that differs from ARG-VASOPRESSIN by one amino acid, containing a LYSINE at residue 8 instead of an ARGININE. Lys-vasopressin is used to treat DIABETES INSIPIDUS or to improve vasomotor tone and BLOOD PRESSURE.	2.02	1	0	cyclic peptide
arginine vasopressin Arginine Vasopressin: The predominant form of mammalian antidiuretic hormone. It is a nonapeptide containing an ARGININE at residue 8 and two disulfide-linked cysteines at residues of 1 and 6. Arg-vasopressin is used to treat DIABETES INSIPIDUS or to improve vasomotor tone and BLOOD PRESSURE.. argipressin : The predominant form of mammalian vasopressin (antidiuretic hormone). It is a nonapeptide containing an arginine at residue 8 and two disulfide-linked cysteines at residues of 1 and 6.	3.76	11	0	vasopressin	cardiovascular drug; hematologic agent; mitogen
pyrophosphate Diphosphates: Inorganic salts of phosphoric acid that contain two phosphate groups.	2.9	4	0	diphosphate ion
palmitoyl coenzyme a Palmitoyl Coenzyme A: A fatty acid coenzyme derivative which plays a key role in fatty acid oxidation and biosynthesis.. palmitoyl-CoA : A long-chain fatty acyl-CoA resulting from the formal condensation of the carboxy group of hexadecanoic acid with the thiol group of coenzyme A.	1.99	1	0	11,12-saturated fatty acyl-CoA; 3-substituted propionyl-CoA; long-chain fatty acyl-CoA; palmitoyl bioconjugate	Escherichia coli metabolite; mouse metabolite
mezlocillin Mezlocillin: Semisynthetic ampicillin-derived acylureido penicillin. It has been proposed for infections with certain anaerobes and may be useful in inner ear, bile, and CNS infections.. mezlocillin : A penicillin in which the substituent at position 6 of the penam ring is a (2R)-2-[3-(methanesulfonyl)-2-oxoimidazolidine-1-carboxamido]-2-phenylacetamido group.	4.85	4	2	penicillin allergen; penicillin	antibacterial drug
amygdalin (R)-amygdalin : An amygdalin in which the stereocentre on the cyanohydrin function has R-configuration.	2.06	1	0	amygdalin	antineoplastic agent; apoptosis inducer; plant metabolite
mitobronitol Mitobronitol: Brominated analog of MANNITOL which is an antineoplastic agent appearing to act as an alkylating agent.	2.04	1	0	alcohol; organobromine compound
xe 991, anthracenone 10,10-bis(4-pyridinylmethyl)-9(10H)-anthracenone: neurotransmitter release enhancer and potassium channel blocker; structure given in first source	2.08	1	0	anthracenes
prednisolone hemisuccinate prednisolone hemisuccinate: RN given refers to (11 beta)-isomer. prednisolone succinate : A hemisuccinate resulting from the formal condensation of the 21-hydroxy group prednisolone with one of the carboxy groups of succinic acid. It is used to treat mild to moderate non-infectious eye allergies and inflammation, including damage caused by chemical and thermal burns.	2.04	1	0	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(1),Delta(4)-steroid; hemisuccinate; tertiary alpha-hydroxy ketone	anti-inflammatory drug
tiamulin tiamulin: 81723 HFU and tiamutin are for fumarate salt; prevents senescence in ascomycete; pleuromutilin derivative; RN given refers to ((3aS-(3aalpha,4beta,5alpha,6alpha,8beta,9alpha,9abeta,10S*))-isomer. tiamulin : A carbotricyclic compound that is pleuromutilin in which the hydroxyacetate group is replaced by a 2-{[2-(diethylamino)ethyl]sulfanyl}acetate group. An antibacterial drug, tiamulin is used in veterinary medicine (generally as its hydrogen fumarate salt) for the treatment of swine dysentery caused by Serpulina hyodysenteriae.	2.44	2	0	carbotricyclic compound; carboxylic ester; cyclic ketone; organic sulfide; secondary alcohol; semisynthetic derivative; tertiary amino compound; tetracyclic diterpenoid	antibacterial drug
octotropine methylbromide octotropine methylbromide: minor descriptor (65-86); on line & INDEX MEDICUS search TROPANES (69-86); RN given refers to endo-isomer. anisotropine methylbromide : A quaternary ammonium salt resulting from the reaction of the amino group of anisotropine with methyl bromide.	2.04	1	0
propylthiouracil Propylthiouracil: A thiourea antithyroid agent. Propythiouracil inhibits the synthesis of thyroxine and inhibits the peripheral conversion of throxine to tri-iodothyronine. It is used in the treatment of hyperthyroidism. (From Martindale, The Extra Pharmacopeoia, 30th ed, p534). 6-propyl-2-thiouracil : A pyrimidinethione consisting of uracil in which the 2-oxo group is substituted by a thio group and the hydrogen at position 6 is substituted by a propyl group.	3.27	6	0	pyrimidinethione	antidote to paracetamol poisoning; antimetabolite; antioxidant; antithyroid drug; carcinogenic agent; EC 1.14.13.39 (nitric oxide synthase) inhibitor; hormone antagonist
nsc 4347 NSC 4347: structure in first source	2.04	1	0
r 59949 R 59949: diacylglycerol kinase inhibitor	2.02	1	0	diarylmethane
prothionamide Prothionamide: Antitubercular agent similar in action and side effects to ETHIONAMIDE. It is used mostly in combination with other agents.	2.05	1	0	pyridines
sesquiterpenes [no description available]	2.9	4	0
etomidate Etomidate: Imidazole derivative anesthetic and hypnotic with little effect on blood gases, ventilation, or the cardiovascular system. It has been proposed as an induction anesthetic.. etomidate : The ethyl ester of 1-[(1R)-1-phenylethyl]-1H-imidazole-5-carboxylic acid. It is an intravenous general anaesthetic with no analgesic activity.	2.45	2	0	ethyl ester; imidazoles	intravenous anaesthetic; sedative
mercaptopurine Mercaptopurine: An antimetabolite antineoplastic agent with immunosuppressant properties. It interferes with nucleic acid synthesis by inhibiting purine metabolism and is used, usually in combination with other drugs, in the treatment of or in remission maintenance programs for leukemia.. purine-6-thiol : A thiol that is the tautomer of mercaptopurine.. mercaptopurine : A member of the class of purines that is 6,7-dihydro-1H-purine carrying a thione group at position 6. An adenine analogue, it is used in the treatment of acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), Crohn's disease, and ulcerative colitis.	2.92	4	0	aryl thiol; purines; thiocarbonyl compound	anticoronaviral agent; antimetabolite; antineoplastic agent
ag-213 tyrphostin 47: inhibits protein-tyrosine kinase activity of EGF-R both in vitro and in living cells;	1.98	1	0
bemesetron [no description available]	2.04	1	0
lobeline [no description available]	2.04	1	0
2,4,6-trimethyl-n-(meta-3-trifluoromethylphenyl)benzenesulfonamide 2,4,6-trimethyl-N-(meta-3-trifluoromethylphenyl)benzenesulfonamide: stimulates phospholipase C; structure in first source	2.02	1	0	sulfonamide
flunarizine Flunarizine: Flunarizine is a selective calcium entry blocker with calmodulin binding properties and histamine H1 blocking activity. It is effective in the prophylaxis of migraine, occlusive peripheral vascular disease, vertigo of central and peripheral origin, and as an adjuvant in the therapy of epilepsy.	2.39	2	0	diarylmethane
thiothixene [no description available]	2.04	1	0	N-methylpiperazine	anticoronaviral agent
benztropine Benztropine: A centrally active muscarinic antagonist that has been used in the symptomatic treatment of PARKINSON DISEASE. Benztropine also inhibits the uptake of dopamine.. benzatropine : Tropane in which a hydrogen at position 3 is substituted by a diphenylmethoxy group (endo-isomer). An acetylcholine receptor antagonist, it is used (particularly as its methanesulphonate salt) in the treatment of Parkinson's disease, and to reduce parkinsonism and akathisia side effects of antipsychotic treatments.	2.46	2	0	diarylmethane
thiouracil Thiouracil: Occurs in seeds of Brassica and Crucifera species. Thiouracil has been used as antithyroid, coronary vasodilator, and in congestive heart failure although its use has been largely supplanted by other drugs. It is known to cause blood dyscrasias and suspected of terato- and carcinogenesis.. thiouracil : A nucleobase analogue that is uracil in which the oxo group at C-2 is replaced by a thioxo group.	2.04	1	0	nucleobase analogue; thiocarbonyl compound	antithyroid drug; metabolite
thiohydantoins Thiohydantoins: Sulfur analogs of hydantoins with one or both carbonyl groups replaced by thiocarbonyl groups.	4.8	1	1
methimazole Methimazole: A thioureylene antithyroid agent that inhibits the formation of thyroid hormones by interfering with the incorporation of iodine into tyrosyl residues of thyroglobulin. This is done by interfering with the oxidation of iodide ion and iodotyrosyl groups through inhibition of the peroxidase enzyme.. methimazole : A member of the class of imidazoles that it imidazole-2-thione in which a methyl group replaces the hydrogen which is attached to a nitrogen.	2.46	2	0	1,3-dihydroimidazole-2-thiones	antithyroid drug
cinnarizine Cinnarizine: A piperazine derivative having histamine H1-receptor and calcium-channel blocking activity with vasodilating and antiemetic properties but it induces PARKINSONIAN DISORDERS.	2.05	1	0	diarylmethane; N-alkylpiperazine; olefinic compound	anti-allergic agent; antiemetic; calcium channel blocker; geroprotector; H1-receptor antagonist; histamine antagonist; muscarinic antagonist
sulindac Sulindac: A sulfinylindene derivative prodrug whose sulfinyl moiety is converted in vivo to an active NSAID analgesic. Specifically, the prodrug is converted by liver enzymes to a sulfide which is excreted in the bile and then reabsorbed from the intestine. This helps to maintain constant blood levels with reduced gastrointestinal side effects.. sulindac : A monocarboxylic acid that is 1-benzylidene-1H-indene which is substituted at positions 2, 3, and 5 by methyl, carboxymethyl, and fluorine respectively, and in which the phenyl group of the benzylidene moiety is substituted at the para position by a methylsulfinyl group. It is a prodrug for the corresponding sulfide, a non-steroidal anti-inflammatory drug, used particularly in the treatment of acute and chronic inflammatory conditions.	2.97	4	0	monocarboxylic acid; organofluorine compound; sulfoxide	analgesic; antineoplastic agent; antipyretic; apoptosis inducer; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; prodrug; tocolytic agent
capsaicin ALGRX-4975: an injectable capsaicin (TRPV1 receptor agonist) formulation for longlasting pain relief. capsaicinoid : A family of aromatic fatty amides produced as secondary metabolites by chilli peppers.	2.94	4	0	capsaicinoid	non-narcotic analgesic; TRPV1 agonist; voltage-gated sodium channel blocker
terbinafine [no description available]	2.74	3	0	acetylenic compound; allylamine antifungal drug; enyne; naphthalenes; tertiary amine	EC 1.14.13.132 (squalene monooxygenase) inhibitor; P450 inhibitor; sterol biosynthesis inhibitor
1,4-benzoquinone guanylhydrazone thiosemicarbazone 1,4-benzoquinone guanylhydrazone thiosemicarbazone: structure given in first source	2.04	1	0
2-pentylcinnamaldehyde 2-pentylcinnamaldehyde: jasmine-like odor, widely used synthetic fragrance & suspected allergen; structure given in first source	1.96	1	0	cinnamaldehydes
drotaverin drotaverin: Hungarian drug; RN given refers to parent cpd; structure	2.05	1	0	isoquinolines
chlorogenic acid caffeoylquinic acid: Antiviral Agent; structure in first source. chlorogenate : A monocarboxylic acid anion that is the conjugate base of chlorogenic acid; major species at pH 7.3.	4.8	1	1	cinnamate ester; tannin	food component; plant metabolite
thioguanine anhydrous Thioguanine: An antineoplastic compound which also has antimetabolite action. The drug is used in the therapy of acute leukemia.. tioguanine : A 2-aminopurine that is the 6-thiono derivative of 2-amino-1,9-dihydro-6H-purine. Incorporates into DNA and inhibits synthesis. Used in the treatment of leukaemia.	2.7	3	0	2-aminopurines	anticoronaviral agent; antimetabolite; antineoplastic agent
tacrine hydrochloride [no description available]	2.05	1	0
thiourea Thiourea: A photographic fixative used also in the manufacture of resins. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), this substance may reasonably be anticipated to be a carcinogen (Merck Index, 9th ed). Many of its derivatives are ANTITHYROID AGENTS and/or FREE RADICAL SCAVENGERS.. thiourea : The simplest member of the thiourea class, consisting of urea with the oxygen atom substituted by sulfur.	5.38	4	1	one-carbon compound; thioureas; ureas	antioxidant; chromophore
sodium propionate sodium propionate: was term of propionic acid (1986-2006). sodium propionate : An organic sodium salt comprising equal numbers of sodium and propionate ions.	2.05	1	0	organic sodium salt	antifungal drug; food preservative
D-fructopyranose [no description available]	4.43	7	0	cyclic hemiketal; D-fructose; fructopyranose	sweetening agent
thioacetamide Thioacetamide: A crystalline compound used as a laboratory reagent in place of HYDROGEN SULFIDE. It is a potent hepatocarcinogen.. thioacetamide : A thiocarboxamide consiting of acetamide having the oxygen replaced by sulfur.	1.99	1	0	thiocarboxamide	hepatotoxic agent
digoxin Digoxin: A cardiotonic glycoside obtained mainly from Digitalis lanata; it consists of three sugars and the aglycone DIGOXIGENIN. Digoxin has positive inotropic and negative chronotropic activity. It is used to control ventricular rate in ATRIAL FIBRILLATION and in the management of congestive heart failure with atrial fibrillation. Its use in congestive heart failure and sinus rhythm is less certain. The margin between toxic and therapeutic doses is small. (From Martindale, The Extra Pharmacopoeia, 30th ed, p666). digoxin : A cardenolide glycoside that is digitoxin beta-hydroxylated at C-12. A cardiac glycoside extracted from the foxglove plant, Digitalis lanata, it is used to control ventricular rate in atrial fibrillation and in the management of congestive heart failure with atrial fibrillation, but the margin between toxic and therapeutic doses is small.	4.84	6	0	cardenolide glycoside; steroid saponin	anti-arrhythmia drug; cardiotonic drug; EC 3.6.3.9 (Na(+)/K(+)-transporting ATPase) inhibitor; epitope
streptozocin [no description available]	2.75	3	0
capsazepine capsazepine: modified capsaicin molecule; a capsaicin receptor antagonist. capsazepine : A benzazepine that is 2,3,4,5-tetrahydro-1H-2-benzazepine which is substituted by hydroxy groups at positions 7 and 8 and on the nitrogen atom by a 2-(p-chlorophenyl)ethylaminothiocarbonyl group. A synthetic analogue of capsaicin, it was the first reported capsaicin receptor antagonist.	2.01	1	0	benzazepine; catechols; monochlorobenzenes; thioureas	capsaicin receptor antagonist
tamoxifen [no description available]	3.62	9	0	stilbenoid; tertiary amino compound	angiogenesis inhibitor; antineoplastic agent; bone density conservation agent; EC 1.2.3.1 (aldehyde oxidase) inhibitor; EC 2.7.11.13 (protein kinase C) inhibitor; estrogen antagonist; estrogen receptor antagonist; estrogen receptor modulator
sodium taurodeoxycholate Taurodeoxycholic Acid: A bile salt formed in the liver by conjugation of deoxycholate with taurine, usually as the sodium salt. It is used as a cholagogue and choleretic, also industrially as a fat emulsifier.. taurodeoxycholic acid : A bile acid taurine conjugate of deoxycholic acid.. taurodeoxycholate : An organosulfonate oxoanion that is the conjugate base of taurodeoxycholic acid.	2	1	0	bile acid taurine conjugate	human metabolite
nadp [no description available]	2.63	3	0
ethionamide Ethionamide: A second-line antitubercular agent that inhibits mycolic acid synthesis.. ethionamide : A thiocarboxamide that is pyridine-4-carbothioamide substituted by an ethyl group at position 2. A prodrug that undergoes metabolic activation by conversion to the corresponding S-oxide.	2.87	4	0	pyridines; thiocarboxamide	antilipemic drug; antitubercular agent; fatty acid synthesis inhibitor; leprostatic drug; prodrug
5-carboxytetramethylrhodamine succinimidyl ester [no description available]	2	1	0
5-carboxytetramethylrhodamine 5-carboxytetramethylrhodamine: structure in first source. 5-carboxytetramethylrhodamine : A tetramethylrhodamine compound having a carboxy substituent at the 5-position	2.41	2	0	xanthenes	fluorochrome
zeranol Zeranol: A non-steroidal estrogen analog.	2.04	1	0	macrolide
fusidic acid Fusidic Acid: An antibiotic isolated from the fermentation broth of Fusidium coccineum. (From Merck Index, 11th ed). It acts by inhibiting translocation during protein synthesis.. fusidic acid : A steroid antibiotic that is isolated from the fermentation broth of Fusidium coccineum.	15.53	47	4	11alpha-hydroxy steroid; 3alpha-hydroxy steroid; alpha,beta-unsaturated monocarboxylic acid; steroid acid; steroid antibiotic; sterol ester	EC 2.7.1.33 (pantothenate kinase) inhibitor; Escherichia coli metabolite; protein synthesis inhibitor
tetrachlorodecaoxide tetrachlorodecaoxide: stimulates wound healing; consists of chlorine, oxygen complexes	1.97	1	0
lincomycin Lincomycin: An antibiotic produced by Streptomyces lincolnensis var. lincolnensis. It has been used in the treatment of staphylococcal, streptococcal, and Bacteroides fragilis infections.. lincomycin : A carbohydrate-containing antibiotic produced by the actinomyces Streptomyces lincolnensis.	10.52	97	1	carbohydrate-containing antibiotic; L-proline derivative; monocarboxylic acid amide; pyrrolidinecarboxamide; S-glycosyl compound	antimicrobial agent; bacterial metabolite
valinomycin Valinomycin: A cyclododecadepsipeptide ionophore antibiotic produced by Streptomyces fulvissimus and related to the enniatins. It is composed of 3 moles each of L-valine, D-alpha-hydroxyisovaleric acid, D-valine, and L-lactic acid linked alternately to form a 36-membered ring. (From Merck Index, 11th ed) Valinomycin is a potassium selective ionophore and is commonly used as a tool in biochemical studies.. valinomycin : A twelve-membered cyclodepsipeptide composed of three repeating D-alpha-hydroxyisovaleryl-D-valyl-L-lactoyl-L-valyl units joined in sequence. An antibiotic found in several Streptomyces strains.	2.67	3	0	cyclodepsipeptide; macrocycle	antimicrobial agent; antiviral agent; bacterial metabolite; potassium ionophore
thiopental Thiopental: A barbiturate that is administered intravenously for the induction of general anesthesia or for the production of complete anesthesia of short duration.. thiopental : A barbiturate, the structure of which is that of 2-thiobarbituric acid substituted at C-5 by ethyl and sec-pentyl groups.	2.38	2	0	barbiturates	anticonvulsant; drug allergen; environmental contaminant; intravenous anaesthetic; sedative; xenobiotic
estrone sulfate estrone sulfate: sulfoconjugated estrone; RN given refers to parent cpd	2.05	1	0	17-oxo steroid; steroid sulfate	human metabolite; mouse metabolite
ranitidine Ranitidine: A non-imidazole blocker of those histamine receptors that mediate gastric secretion (H2 receptors). It is used to treat gastrointestinal ulcers.. ranitidine : A member of the class of furans used to treat peptic ulcer disease (PUD) and gastroesophageal reflux disease.	2.69	3	0	C-nitro compound; furans; organic sulfide; tertiary amino compound	anti-ulcer drug; drug allergen; environmental contaminant; H2-receptor antagonist; xenobiotic
aplaviroc aplaviroc: a spiro-diketo-piperazine; a potent noncompetitive allosteric antagonist of the CCR5 receptor with concomitantly potent antiviral effects for HIV-1; structure in first source	2.06	1	0
hmr 3647 [no description available]	2.75	3	0
maraviroc [no description available]	2.06	1	0	tropane alkaloid
toremifene Toremifene: A first generation selective estrogen receptor modulator (SERM). Like TAMOXIFEN, it is an estrogen agonist for bone tissue and cholesterol metabolism but is antagonistic on mammary and uterine tissue.	2.97	4	0	aromatic ether; organochlorine compound; tertiary amine	antineoplastic agent; bone density conservation agent; estrogen antagonist; estrogen receptor modulator
zinc oxide Diaper Rash: A type of irritant dermatitis localized to the area in contact with a diaper and occurring most often as a reaction to prolonged contact with urine, feces, or retained soap or detergent.	3.76	3	0
telaprevir [no description available]	2.05	1	0	cyclopentapyrrole; cyclopropanes; oligopeptide; pyrazines	antiviral drug; hepatitis C protease inhibitor; peptidomimetic
laccase Laccase: A copper-containing oxidoreductase enzyme that catalyzes the oxidation of 4-benzenediol to 4-benzosemiquinone. It also has activity towards a variety of O-quinols and P-quinols. It primarily found in FUNGI and is involved in LIGNIN degradation, pigment biosynthesis and detoxification of lignin-derived products.	2.44	2	0
4-diphenylacetoxy-n-methylpiperidine methiodide 4-DAMP methiodide : A quaternary ammonium salt obtained by combining equimolar amounts of 4-diphenylacetoxy-N-methylpiperidine and iodomethane.	2.45	2	0	iodide salt; quaternary ammonium salt	cholinergic antagonist; muscarinic antagonist
lithium Lithium: An element in the alkali metals family. It has the atomic symbol Li, atomic number 3, and atomic weight [6.938; 6.997]. Salts of lithium are used in treating BIPOLAR DISORDER.	3.85	12	0	alkali metal atom
albutoin albutoin: structure	2.04	1	0	organonitrogen compound; organooxygen compound
iodothiouracil [no description available]	2.04	1	0	organohalogen compound; pyrimidines
cobaltous chloride cobaltous chloride: RN given refers to unlabeled cpd; RN in Chemline for cobalt trichloride: 10241-04-0; RN for 60-labeled cpd: 14543-09-0; RN for 57-labeled cpd: 164113-89-1; RN for 58-labeled cpd: 29377-09-1; structure. cobalt dichloride : A cobalt salt in which the cobalt metal is in the +2 oxidation state and the counter-anion is chloride. It is used as an indicator for water in desiccants.	2.72	3	0	cobalt salt; inorganic chloride	allergen; calcium channel blocker; sensitiser; two-colour indicator
droloxifene [no description available]	2.05	1	0	stilbenoid
or 1259 [no description available]	2.05	1	0	hydrazone; nitrile; pyridazinone	anti-arrhythmia drug; cardiotonic drug; EC 3.1.4.17 (3',5'-cyclic-nucleotide phosphodiesterase) inhibitor; vasodilator agent
gestodene Gestodene: synthetic steroid with progestational activity; RN given refers to (17alpha)-isomer	2.05	1	0	steroid	estrogen
orlistat Orlistat: A lactone derivative of LEUCINE that acts as a pancreatic lipase inhibitor to limit the absorption of dietary fat; it is used in the management of obesity.. orlistat : A carboxylic ester resulting from the formal condensation of the carboxy group of N-formyl-L-leucine with the hydroxy group of (3S,4S)-3-hexyl-4-[(2S)-2-hydroxytridecyl]oxetan-2-one. A pancreatic lipase inhibitor, it is used as an anti-obesity drug.	2.46	2	0	beta-lactone; carboxylic ester; formamides; L-leucine derivative	anti-obesity agent; bacterial metabolite; EC 2.3.1.85 (fatty acid synthase) inhibitor; EC 3.1.1.3 (triacylglycerol lipase) inhibitor
idoxifene idoxifene: structure given in first source	2.05	1	0	stilbenoid
quinine [no description available]	3.46	8	0	cinchona alkaloid	antimalarial; muscle relaxant; non-narcotic analgesic
1,2-bis(2-aminophenoxy)ethane n,n,n',n'-tetraacetic acid acetoxymethyl ester [no description available]	3.6	9	0
boc-tyr(s03)-nle-gly-trp-nle-asp-2-phenylethyl ester JMV 180: distinguishes high-affinity cholecystokinin receptors from low-affinity cholecystokinin receptors; RN given refers to (S)-isomer	1.98	1	0
mdl 72527 MDL 72527: RN given refers to di-HCl; RN for parent cpd not available 6/85; polyamine oxidase inhibitor	2.39	2	0
cystine [no description available]	3.04	5	0
u-50488 3,4-Dichloro-N-methyl-N-(2-(1-pyrrolidinyl)-cyclohexyl)-benzeneacetamide, (trans)-Isomer: A non-peptide, kappa-opioid receptor agonist which has also been found to stimulate the release of adrenocorticotropin (ADRENOCORTICOTROPIC HORMONE) via the release of hypothalamic arginine vasopressin (ARGININE VASOPRESSIN) and CORTICOTROPIN-RELEASING HORMONE. (From J Pharmacol Exp Ther 1997;280(1):416-21). U50488 : A monocarboxylic acid amide obtained by formal condensation between the carboxy group of 3,4-dichlorophenylacetic acid and the secondary amino group of (1R,2R)-N-methyl-2-(pyrrolidin-1-yl)cyclohexanamine	2.42	2	0	dichlorobenzene; monocarboxylic acid amide; N-alkylpyrrolidine	analgesic; antitussive; calcium channel blocker; diuretic; kappa-opioid receptor agonist
sch 23390 SCH 23390: a selective D1-receptor antagonist. SCH 23390 : A benzazepine that is 2,3,4,5-tetrahydro-3-benzazepine bearing a phenyl substituent at position 1, a methyl substituent at position 3, a chloro substituent at position 7 and a hydroxy substituent at position 8.	2.45	2	0	benzazepine
1-thiocarbamoyl-2-imidazolidinone 1-thiocarbamoyl-2-imidazolidinone: immunoregulatory metabolite of niridazole; structure given in first source	1.96	1	0
micronomicin micronomicin: DE 020 & DE 020 eyedrops both consist of KW 1062, benzalkonium chloride, sodium chloride, sodium hydroxide & distilled water pH 7.4; RN given refers to parent cpd; see also record for gentamicin C; structure	3.05	1	0	aminoglycoside
isepamicin [no description available]	2.73	3	0
aspirin, 4-hydroxybenzoic acid propyl ester, drug combination aspirin, 4-hydroxybenzoic acid propyl ester, drug combination: consists of acetylsalicylic acid, p-hydroxybenzoic acid propyl ester & neutral filler	1.96	1	0
zd 6474 CH 331: structure in first source	2.05	1	0	aromatic ether; organobromine compound; organofluorine compound; piperidines; quinazolines; secondary amine	antineoplastic agent; tyrosine kinase inhibitor
apramycin apramycin : An aminoglycoside that is 2-deoxystreptamine that is substituted on the oxygen at position 4 by an (8R)-2-amino-8-O-(4-amino-4-deoxy-alpha-D-glucopyranosyl)-2,3,7-trideoxy-7-(methylamino)-D-glycero-alpha-D-allo-octodialdo-1,5:8,4-dipyranos-1-yl) group.	3.72	10	0	2-deoxystreptamine derivative; aminoglycoside; organic heterobicyclic compound	antibacterial drug; antimicrobial agent
neosamine c neosamine C: sugar moiety found in ribostamycin	2.41	2	0
olivomycins Olivomycins: A mixture of several closely related glycosidic antibiotics obtained from Actinomyces (or Streptomyces) olivoreticuli. They are used as fluorescent dyes that bind to DNA and prevent both RNA and protein synthesis and are also used as antineoplastic agents.	3.44	2	0
gentamicin c gentamicin C: RN given refers to cpd with unknown MF; see also record for micronomicin for which gentamicin C2b is synonym	2.72	3	0
cytellin cytellin: a phytosterol preparation of mainly B-sitosterol, that was marketed by Eli Lilly to lower cholesterol 1957 to 1982	9.94	17	3
octapeptin antibiotics octapeptin antibiotics: complex of cyclic, homodectic octapeptide antibiotics monoacylated with beta-hydroxy fatty acid residues; include above cpd, Bu-1880, 333-25, Y-849r; isolated from Bacillus circulans; RN given refers to octapeptin; structure for octapeptins D1, D2, D3, & D4 in 10th source; RN given refers to octapeptin with MF unknown	1.96	1	0
myomycin myomycin: antibiotic whose hydrolysis products are myo-inositol lysine & 3-amino-3-deoxy-D-mannose	1.97	1	0
silybin [no description available]	2.05	1	0
alatrofloxacin alatrofloxacin: prodrug of trovafloxacin	2.06	1	0
ovalbumin Ovalbumin: An albumin obtained from the white of eggs. It is a member of the serpin superfamily.	2.9	4	0
sodium dodecyl sulfate Sodium Dodecyl Sulfate: An anionic surfactant, usually a mixture of sodium alkyl sulfates, mainly the lauryl; lowers surface tension of aqueous solutions; used as fat emulsifier, wetting agent, detergent in cosmetics, pharmaceuticals and toothpastes; also as research tool in protein biochemistry.. sodium dodecyl sulfate : An organic sodium salt that is the sodium salt of dodecyl hydrogen sulfate.	2.65	3	0	organic sodium salt	detergent; protein denaturant
blister blebbistatin: structure in first source. blebbistatin : A pyrroloquinoline that is 1,2,3,3a-tetrahydro-H-pyrrolo[2,3-b]quinolin-4-one substituted by a hydroxy group at position 3a, a methyl group at position 6 and a phenyl group at position 1. It acts as an inhibitor of ATPase activity of non-muscle myosin II.	2.07	1	0	cyclic ketone; pyrroloquinoline; tertiary alcohol; tertiary alpha-hydroxy ketone	inhibitor
chloramine-t chloramine-T: RN given refers to unlabeled parent cpd. chloramine T : An organic sodium salt derivative of toluene-4-sulfonamide with a chloro substituent in place of an amino hydrogen.	2.05	1	0	organic sodium salt	allergen; antifouling biocide; disinfectant
alpha-chymotrypsin Chymotrypsin: A serine endopeptidase secreted by the pancreas as its zymogen, CHYMOTRYPSINOGEN and carried in the pancreatic juice to the duodenum where it is activated by TRYPSIN. It selectively cleaves aromatic amino acids on the carboxyl side.	9.47	24	0
17-ketosteroids 17-Ketosteroids: Steroids that contain a ketone group at position 17.. 17-oxo steroid : Any oxo steroid carrying the oxo group at position 17.	1.95	1	0
naphthoquinones Naphthoquinones: Naphthalene rings which contain two ketone moieties in any position. They can be substituted in any position except at the ketone groups.	1.94	1	0
d 609 [no description available]	3.13	5	0
sitagliptin sitagliptin : A triazolopyrazine that exhibits hypoglycemic activity.	2.05	1	0	triazolopyrazine; trifluorobenzene	EC 3.4.14.5 (dipeptidyl-peptidase IV) inhibitor; environmental contaminant; hypoglycemic agent; serine proteinase inhibitor; xenobiotic
flosequinan [no description available]	2.05	1	0	quinolines
tolcapone Tolcapone: A benzophenone and nitrophenol compound that acts as an inhibitor of CATECHOL O-METHYLTRANSFERASE, an enzyme involved in the metabolism of DOPAMINE and LEVODOPA. It is used in the treatment of PARKINSON DISEASE in patients for whom levodopa is ineffective or contraindicated.. tolcapone : Benzophenone substituted on one of the phenyl rings at C-3 and C-4 by hydroxy groups and at C-5 by a nitro group, and on the other phenyl ring by a methyl group at C-4. It is an inhibitor of catechol O-methyltransferase.	2.97	4	0	2-nitrophenols; benzophenones; catechols	antiparkinson drug; EC 2.1.1.6 (catechol O-methyltransferase) inhibitor
noxythiolin Noxythiolin: Local antibacterial that probably acts by releasing formaldehyde in aqueous solutions. It is used for THERAPEUTIC IRRIGATION of infected body cavities - bladder, peritoneum, etc. and as a spray for burns.	1.95	1	0	thioureas
sphingosine sphing-4-enine : A sphingenine in which the C=C double bond is located at the 4-position.. sphingenine : A 2-aminooctadecene-1,3-diol having (2S,3R)-configuration.. sphingoid : Sphinganine, its homologs and stereoisomers, and the hydroxy and unsaturated derivatives of these compounds.. 2-aminooctadec-4-ene-1,3-diol : A 2-aminooctadecene-1,3-diol having its double bond at position 4.	3.37	7	0	sphing-4-enine	human metabolite; mouse metabolite
quercetin [no description available]	3.26	6	0	7-hydroxyflavonol; pentahydroxyflavone	antibacterial agent; antineoplastic agent; antioxidant; Aurora kinase inhibitor; chelator; EC 1.10.99.2 [ribosyldihydronicotinamide dehydrogenase (quinone)] inhibitor; geroprotector; phytoestrogen; plant metabolite; protein kinase inhibitor; radical scavenger
bilirubin [no description available]	5.97	15	2	biladienes; dicarboxylic acid	antioxidant; human metabolite; mouse metabolite
dinoprostone prostaglandin E2 : Prostaglandin F2alpha in which the hydroxy group at position 9 has been oxidised to the corresponding ketone. Prostaglandin E2 is the most common and most biologically potent of mammalian prostaglandins.	4.07	15	0	prostaglandins E	human metabolite; mouse metabolite; oxytocic
dinoprost Dinoprost: A naturally occurring prostaglandin that has oxytocic, luteolytic, and abortifacient activities. Due to its vasocontractile properties, the compound has a variety of other biological actions.. prostaglandin F2alpha : A prostaglandins Falpha that is prosta-5,13-dien-1-oic acid substituted by hydroxy groups at positions 9, 11 and 15. It is a naturally occurring prostaglandin used to induce labor.	3.38	7	0	monocarboxylic acid; prostaglandins Falpha	human metabolite; mouse metabolite
tylosin [no description available]	2.46	2	0	aldehyde; disaccharide derivative; enone; leucomycin; macrolide antibiotic; monosaccharide derivative	allergen; bacterial metabolite; environmental contaminant; xenobiotic
apigenin Chamomile: Common name for several daisy-like plants (MATRICARIA; TRIPLEUROSPERMUM; ANTHEMIS; CHAMAEMELUM) native to Europe and Western Asia, now naturalized in the United States and Australia.	2.41	1	0	trihydroxyflavone	antineoplastic agent; metabolite
luteolin [no description available]	4.8	1	1	3'-hydroxyflavonoid; tetrahydroxyflavone	angiogenesis inhibitor; anti-inflammatory agent; antineoplastic agent; apoptosis inducer; c-Jun N-terminal kinase inhibitor; EC 2.3.1.85 (fatty acid synthase) inhibitor; immunomodulator; nephroprotective agent; plant metabolite; radical scavenger; vascular endothelial growth factor receptor antagonist
linoleic acid Linoleic Acid: A doubly unsaturated fatty acid, occurring widely in plant glycosides. It is an essential fatty acid in mammalian nutrition and is used in the biosynthesis of prostaglandins and cell membranes. (From Stedman, 26th ed). linoleic acid : An octadecadienoic acid in which the two double bonds are at positions 9 and 12 and have Z (cis) stereochemistry.	1.93	1	0	octadecadienoic acid; omega-6 fatty acid	algal metabolite; Daphnia galeata metabolite; plant metabolite
calcitriol dihydroxy-vitamin D3: as a major in vitro metabolite of 1alpha,25-dihydroxyvitamin D3, produced in primary cultures of neonatal human keratinocytes	4.52	9	0	D3 vitamins; hydroxycalciol; triol	antineoplastic agent; antipsoriatic; bone density conservation agent; calcium channel agonist; calcium channel modulator; hormone; human metabolite; immunomodulator; metabolite; mouse metabolite; nutraceutical
vitamin k semiquinone radical vitamin K semiquinone radical: found in active preparations of vitamin K-dependent carboxylase. vitamin K : Any member of a group of fat-soluble 2-methyl-1,4-napthoquinones that exhibit biological activity against vitamin K deficiency. Vitamin K is required for the synthesis of prothrombin and certain other blood coagulation factors.	5.24	17	0
beta carotene beta Carotene: A carotenoid that is a precursor of VITAMIN A. Beta carotene is administered to reduce the severity of photosensitivity reactions in patients with erythropoietic protoporphyria (PORPHYRIA, ERYTHROPOIETIC).. provitamin A : A provitamin that can be converted into vitamin A by enzymes from animal tissues.	2.45	2	0	carotenoid beta-end derivative; cyclic carotene	antioxidant; biological pigment; cofactor; ferroptosis inhibitor; human metabolite; mouse metabolite; plant metabolite; provitamin A
thromboxane a2 Thromboxane A2: An unstable intermediate between the prostaglandin endoperoxides and thromboxane B2. The compound has a bicyclic oxaneoxetane structure. It is a potent inducer of platelet aggregation and causes vasoconstriction. It is the principal component of rabbit aorta contracting substance (RCS).. thromboxane A2 : A thromboxane which is produced by activated platelets and has prothrombotic properties: it stimulates activation of new platelets as well as increases platelet aggregation.	2.41	2	0	epoxy monocarboxylic acid; thromboxanes A	mouse metabolite
rosin rosin: Resin from plant. Do not confuse with the specific compound: 3-phenyl-2-propenyl-(E)-beta-D-glucopyranoside, also know as rosin.	1.99	1	0
alprostadil [no description available]	2.41	2	0	prostaglandins E	anticoagulant; human metabolite; platelet aggregation inhibitor; vasodilator agent
vitamin d 2 Ergocalciferols: Derivatives of ERGOSTEROL formed by ULTRAVIOLET RAYS breaking of the C9-C10 bond. They differ from CHOLECALCIFEROL in having a double bond between C22 and C23 and a methyl group at C24.. vitamin D2 : A vitamin D supplement and has been isolated from alfalfa.	2.65	3	0	hydroxy seco-steroid; seco-ergostane; vitamin D	bone density conservation agent; nutraceutical; plant metabolite; rodenticide
cholecalciferol Cholecalciferol: Derivative of 7-dehydroxycholesterol formed by ULTRAVIOLET RAYS breaking of the C9-C10 bond. It differs from ERGOCALCIFEROL in having a single bond between C22 and C23 and lacking a methyl group at C24.. calciol : A hydroxy seco-steroid that is (5Z,7E)-9,10-secocholesta-5,7,10(19)-triene in which the pro-S hydrogen at position 3 has been replaced by a hydroxy group. It is the inactive form of vitamin D3, being hydroxylated in the liver to calcidiol (25-hydroxyvitamin D3), which is then further hydroxylated in the kidney to give calcitriol (1,25-dihydroxyvitamin D3), the active hormone.	2.05	1	0	D3 vitamins; hydroxy seco-steroid; seco-cholestane; secondary alcohol; steroid hormone	geroprotector; human metabolite
leukotriene d4 Leukotriene D4: One of the biologically active principles of SRS-A. It is generated from LEUKOTRIENE C4 after partial hydrolysis of the peptide chain, i.e., cleavage of the gamma-glutamyl portion. Its biological actions include stimulation of vascular and nonvascular smooth muscle, and increases in vascular permeability. (From Dictionary of Prostaglandins and Related Compounds, 1990). leukotriene D4 : A leukotriene that is (7E,9E,11Z,14Z)-icosa-7,9,11,14-tetraenoic acid substituted by a hydroxy group at position 5 (5S) and a L-cysteinylglycinyl group at position 6 (6R).	2.05	1	0	dipeptide; leukotriene; organic sulfide	bronchoconstrictor agent; human metabolite; mouse metabolite
6-ketoprostaglandin f1 alpha 6-Ketoprostaglandin F1 alpha: The physiologically active and stable hydrolysis product of EPOPROSTENOL. Found in nearly all mammalian tissue.. 6-oxoprostaglandin F1alpha : A prostaglandin Falpha that is prostaglandin F1alpha bearing a keto substituent at the 6-position.	2.67	3	0	prostaglandins Falpha	human metabolite; mouse metabolite
genistein [no description available]	3.09	5	0	7-hydroxyisoflavones	antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; geroprotector; human urinary metabolite; phytoestrogen; plant metabolite; tyrosine kinase inhibitor
amphotericin b Amphotericin B: Macrolide antifungal antibiotic produced by Streptomyces nodosus obtained from soil of the Orinoco river region of Venezuela.. amphotericin B : A macrolide antibiotic used to treat potentially life-threatening fungal infections.	10.93	43	5	antibiotic antifungal drug; macrolide antibiotic; polyene antibiotic	antiamoebic agent; antiprotozoal drug; bacterial metabolite
clavulanic acid Clavulanic Acid: A beta-lactam antibiotic produced by the actinobacterium Streptomyces clavuligerus. It is a suicide inhibitor of bacterial beta-lactamase enzymes. Administered alone, it has only weak antibacterial activity against most organisms, but given in combination with other beta-lactam antibiotics it prevents antibiotic inactivation by microbial lactamase.. clavulanate : The conjugate base of clavulanic acid.. clavulanic acid : Antibiotic isolated from Streptomyces clavuligerus. It acts as a suicide inhibitor of bacterial beta-lactamase enzymes.	2.74	3	0	oxapenam	antibacterial drug; anxiolytic drug; bacterial metabolite; EC 3.5.2.6 (beta-lactamase) inhibitor
pulmicort Budesonide: A glucocorticoid used in the management of ASTHMA, the treatment of various skin disorders, and allergic RHINITIS.. budesonide : A glucocorticoid steroid having a highly oxygenated pregna-1,4-diene structure. It is used mainly in the treatment of asthma and non-infectious rhinitis and for treatment and prevention of nasal polyposis.	2.73	3	0	11beta-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; cyclic acetal; glucocorticoid; primary alpha-hydroxy ketone	anti-inflammatory drug; bronchodilator agent; drug allergen
oxymetholone Oxymetholone: A synthetic hormone with anabolic and androgenic properties. It is used mainly in the treatment of anemias. According to the Fourth Annual Report on Carcinogens (NTP 85-002), this compound may reasonably be anticipated to be a carcinogen. (From Merck Index, 11th ed). oxymetholone : A 3-oxo-5alpha- steroid that is 4,5alpha-dihydrotestosterone which is substituted by a hydroxymethylidene group at position 2 and by a methyl group at the 17alpha position. A synthetic androgen, it was mainly used for the treatment of anaemias until being replaced by treatments with fewer side effects.	2.68	3	0
eprosartan eprosartan: angiotensin II receptor antagonist. eprosartan : A member of the class of imidazoles and thiophenes that is an angiotensin II receptor antagonist used for the treatment of high blood pressure.	2.45	2	0	dicarboxylic acid; imidazoles; thiophenes	angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic
montelukast montelukast: a leukotriene D4 receptor antagonist	2.46	2	0	aliphatic sulfide; monocarboxylic acid; quinolines	anti-arrhythmia drug; anti-asthmatic drug; leukotriene antagonist
ethchlorvynol Ethchlorvynol: A sedative and hypnotic that has been used in the short-term management of INSOMNIA. Its use has been superseded by other drugs.. ethchlorvynol : Propargyl alcohol in which the methylene hydrogens are substituted by ethyl and 2-chlorovinyl groups. A hypnotic and sedative, it is used for treatment of insomnia in some cases where an intolerance or allergy to more commonly used drugs exists.	2.04	1	0
mycophenolate mofetil mycophenolate mofetil : A carboxylic ester resulting from the formal condensation between the carboxylic acid group of mycophenolic acid and the hydroxy group of 2-(morpholin-4-yl)ethanol. In the liver, it is metabolised to mycophenolic acid, an immunosuppressant for which it is a prodrug. It is widely used to prevent tissue rejection following organ transplants as well as for the treatment of certain autoimmune diseases.	2.05	1	0	carboxylic ester; ether; gamma-lactone; phenols; tertiary amino compound	anticoronaviral agent; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; immunosuppressive agent; prodrug
entacapone entacapone: structure given in first source. entacapone : A monocarboxylic acid amide that is N,N-diethylprop-2-enamide in which the hydrogen at position 2 is substituted by a cyano group and the hydrogen at the 3E position is substituted by a 3,4-dihydroxy-5-nitrophenyl group.	2.05	1	0	2-nitrophenols; catechols; monocarboxylic acid amide; nitrile	antidyskinesia agent; antiparkinson drug; central nervous system drug; EC 2.1.1.6 (catechol O-methyltransferase) inhibitor
astaxanthine astaxanthine: a keto form of carotene; pigment in flesh of Scottish salmon (Salmo salar) crustacoa-lobster (Homarus gammarus, flamingo feathers; structure; a carotenoid without vitamin A activity, has shown anti-oxidant and anti-inflammatory activities. astaxanthin : A carotenone that consists of beta,beta-carotene-4,4'-dione bearing two hydroxy substituents at positions 3 and 3' (the 3S,3'S diastereomer). A carotenoid pigment found mainly in animals (crustaceans, echinoderms) but also occurring in plants. It can occur free (as a red pigment), as an ester, or as a blue, brown or green chromoprotein.	2.84	3	0	carotenol; carotenone	animal metabolite; anticoagulant; antioxidant; food colouring; plant metabolite
lutein Lutein: A xanthophyll found in the major LIGHT-HARVESTING PROTEIN COMPLEXES of plants. Dietary lutein accumulates in the MACULA LUTEA.. xanthophyll : A subclass of carotenoids consisting of the oxygenated carotenes.	1.94	1	0	carotenol	food colouring; plant metabolite
ophiobolin a ophiobolin A: sesterterpene; phytotoxin produced by plant pathogen Helminthosporium maydis; natural product inhibitor of calmodulin; RN refers to (18R)-isomer; structure given in first source. ophiobolin A : A sesterterpenoid that is ophiobolane with a hydroxy group at position 3, oxo groups at positions 5 and 25, double bonds at positions 7-8 and 19-20, and an oxygen link between positions 14 and 18.	1.99	1	0	cyclic ketone; enal; oxaspiro compound; sesterterpenoid; tertiary alcohol
esculin [no description available]	4.29	4	1	beta-D-glucoside; hydroxycoumarin	antioxidant; metabolite
humulene humulene: structure given in first source. (1E,4E,8E)-alpha-humulene : The (1E,4E,8E)-isomer of alpha-humulene.	4.8	1	1	alpha-humulene
baicalein [no description available]	2.02	1	0	trihydroxyflavone	angiogenesis inhibitor; anti-inflammatory agent; antibacterial agent; anticoronaviral agent; antifungal agent; antineoplastic agent; antioxidant; apoptosis inducer; EC 1.13.11.31 (arachidonate 12-lipoxygenase) inhibitor; EC 1.13.11.33 (arachidonate 15-lipoxygenase) inhibitor; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor; EC 4.1.1.17 (ornithine decarboxylase) inhibitor; ferroptosis inhibitor; geroprotector; hormone antagonist; plant metabolite; prostaglandin antagonist; radical scavenger
diosmin [no description available]	2.05	1	0	dihydroxyflavanone; disaccharide derivative; glycosyloxyflavone; monomethoxyflavone; rutinoside	anti-inflammatory agent; antioxidant
morin morin: a light yellowish pigment found in the wood of old fustic (Chlorophora tinctoria). morin : A pentahydroxyflavone that is 7-hydroxyflavonol bearing three additional hydroxy substituents at positions 2' 4' and 5.	1.98	1	0	7-hydroxyflavonol; pentahydroxyflavone	angiogenesis modulating agent; anti-inflammatory agent; antibacterial agent; antihypertensive agent; antineoplastic agent; antioxidant; EC 5.99.1.2 (DNA topoisomerase) inhibitor; hepatoprotective agent; metabolite; neuroprotective agent
pterostilbene [no description available]	3.35	1	0	diether; methoxybenzenes; stilbenol	anti-inflammatory agent; antineoplastic agent; antioxidant; apoptosis inducer; hypoglycemic agent; neuroprotective agent; neurotransmitter; plant metabolite; radical scavenger
chicoric acid chicoric acid: inhibits HIV-1 integrase	2.41	1	0	organooxygen compound	geroprotector; HIV-1 integrase inhibitor
cynarine cynarine: active principle of the artichoke; functions primarily as a cholagogue and choleretic and also as antilipemic agent	2.05	1	0	alkyl caffeate ester; quinic acid	plant metabolite
caffeic acid phenethyl ester phenethyl caffeate : An alkyl caffeate ester in which 2-phenylethyl is the alkyl component.	2.1	1	0	alkyl caffeate ester	anti-inflammatory agent; antibacterial agent; antineoplastic agent; antioxidant; antiviral agent; immunomodulator; metabolite; neuroprotective agent
rottlerin rottlerin: an angiogenesis inhibitor; an inhibitor of protein kinase Cdelta (PKCdelta) and calmodulin kinase III; RN refers to (E)-isomer; do not confuse this chalcone with an anthraquinone that is also called rottlerin (RN 481-72-1);. rottlerin : A chromenol that is 2,2-dimethyl-2H-chromene substituted by hydroxy groups at positions 5 and 7, a 3-acetyl-2,4,6-trihydroxy-5-methylbenzyl group at position 6 and a (1E)-3-oxo-1-phenylprop-1-en-3-yl group at position 8. A potassium channel opener, it is isolated from Mallotus philippensis.	2.02	1	0	aromatic ketone; benzenetriol; chromenol; enone; methyl ketone	anti-allergic agent; antihypertensive agent; antineoplastic agent; apoptosis inducer; K-ATP channel agonist; metabolite
sdz psc 833 valspodar: nonimmunosuppressive cyclosporin analog which is a potent multidrug resistance modifier; 7-10 fold more potent than cyclosporin A; a potent P glycoprotein inhibitor; MW 1215	2.05	1	0	homodetic cyclic peptide
l 660,711 [no description available]	2.05	1	0	quinolines
coenzyme q10 coenzyme Q10: Ubiquinone ring with a chain of 10 isoprene units; redox equilibrium with ubiqunol serving in mitochondrial inner membrane to transfer electrons; presence during reconstitution of acetylcholine receptor into phospholipid vesicles yields vesicles active in catalyzing carbamylcholine-sensitive Na+ flux; coenzyme Q10 depletion has been noted with use of statins. coenzyme Q10 : A ubiquinone having a side chain of 10 isoprenoid units. In the naturally occurring isomer, all isoprenyl double bonds are in the E- configuration.	2.48	2	0	ubiquinones	antioxidant; ferroptosis inhibitor; human metabolite
anandamide anandamide : An N-acylethanolamine 20:4 resulting from the formal condensation of carboxy group of arachidonic acid with the amino group of ethanolamine.	2.04	1	0	endocannabinoid; N-acylethanolamine 20:4	human blood serum metabolite; neurotransmitter; vasodilator agent
cerulenin Cerulenin: An epoxydodecadienamide isolated from several species, including ACREMONIUM, Acrocylindrum, and Helicoceras. It inhibits the biosynthesis of several lipids by interfering with enzyme function.. cerulenin : An epoxydodecadienamide isolated from several species, including Acremonium, Acrocylindrum and Helicoceras. It inhibits the biosynthesis of several lipids by interfering with enzyme function.	1.95	1	0	epoxide; monocarboxylic acid amide	antifungal agent; antiinfective agent; antilipemic drug; antimetabolite; antimicrobial agent; fatty acid synthesis inhibitor
l 683590 immunomycin: from Streptomyces hygroscopicus; structure given in first source	1.98	1	0	ether; lactol; macrolide; secondary alcohol	antifungal agent; bacterial metabolite; immunosuppressive agent
sorivudine [no description available]	2.05	1	0	organic molecular entity
geranylgeranylacetone geranylgeranylacetone: structure in first source; RN given refers to isomeric cpd without isomeric designation; mixture of (5E,9E,13E) & (5Z,9E,13E)-isomers. teprenone : A terpene ketone in which a (9E,13E)-geranylgernayl group is bonded to one of the alpha-methyls of acetone (it is a mixture of 5E- and 5Z-geoisomers in a 3:2 ratio).	2.17	1	0
rokitamycin rokitamycin: structure in first source	2.04	1	0	organic molecular entity
tranilast tranilast: antiallergic drug; potent inhibitor of homologous passive cutaneous anaphylaxis. tranilast : An amidobenzoic acid that is anthranilic acid in which one of the anilino hydrogens is replaced by a 3,4-dimethoxycinnamoyl group.	2.05	1	0	amidobenzoic acid; cinnamamides; dimethoxybenzene; secondary carboxamide	anti-allergic agent; anti-asthmatic drug; antineoplastic agent; aryl hydrocarbon receptor agonist; calcium channel blocker; hepatoprotective agent; nephroprotective agent
glyceryl 2-arachidonate glyceryl 2-arachidonate: binds to cannabinoid receptors; structure in first source. 2-arachidonoylglycerol : An endocannabinoid and an endogenous agonist of the cannabinoid receptors (CB1 and CB2). It is an ester formed from omega-6-arachidonic acid and glycerol.	1.99	1	0	2-acylglycerol 20:4; endocannabinoid	human metabolite
etretinate retinoid : Oxygenated derivatives of 3,7-dimethyl-1-(2,6,6-trimethylcyclohex-1-enyl)nona-1,3,5,7-tetraene and derivatives thereof.	2.45	2	0	enoate ester; ethyl ester; retinoid	keratolytic drug
isotretinoin Isotretinoin: A topical dermatologic agent that is used in the treatment of ACNE VULGARIS and several other skin diseases. The drug has teratogenic and other adverse effects.. isotretinoin : A retinoic acid that is all-trans-retinoic acid in which the double bond which is alpha,beta- to the carboxy group is isomerised to Z configuration. A synthetic retinoid, it is used for the treatment of severe cases of acne and other skin diseases.	2.46	2	0	retinoic acid	antineoplastic agent; keratolytic drug; teratogenic agent
misoprostol Misoprostol: A synthetic analog of natural prostaglandin E1. It produces a dose-related inhibition of gastric acid and pepsin secretion, and enhances mucosal resistance to injury. It is an effective anti-ulcer agent and also has oxytocic properties.. misoprostol : A diastereoisomeric mixture composed of approximately equal amounts of a double racemate of four of the sixteen possible diastereoisomers of methyl (13E)-11,16-dihydroxy-16-methyl-9-oxoprost-13-en-1-oate that is racemic prostaglandin E1 which is lacking the hydroxy group at position 15, but which has an additional hydroxy group at position 16. It is a synthetic prostaglandin E1 analogue, used in the treatment of gastric and duodenal ulcers. A weak abortifacient, it is also used for cervical ripening prior to surgical termination of pregnancy. The (11R,16S)-diastereoisomer is the pharmacologically active form.	2.45	2	0
epoprostenol [no description available]	2.04	1	0	prostaglandins I	mouse metabolite
ozagrel ozagrel: RN refers to (E)-isomer	2.05	1	0	cinnamic acids
triprolidine Triprolidine: Histamine H1 antagonist used in allergic rhinitis; ASTHMA; and URTICARIA. It is a component of COUGH and COLD medicines. It may cause drowsiness.. triprolidine : An N-alkylpyrrolidine that is acrivastine in which the pyridine ring is lacking the propenoic acid substituent. It is a sedating antihistamine that is used (generally as the monohydrochloride monohydrate) for the relief of the symptoms of uticaria, rhinitis, and various pruritic skin disorders.	2.04	1	0	N-alkylpyrrolidine; olefinic compound; pyridines	H1-receptor antagonist
pitavastatin pitavastatin : A dihydroxy monocarboxylic acid that is (6E)-7-[2-cyclopropyl-4-(4-fluorophenyl)quinolin-3-yl]hept-6-enoic acid in which the two hydroxy groups are located at positions 3 and 5 (the 3R,5S-stereoisomer). Used as its calcium salt for treatment of hypercholesterolemia (elevated levels of cholesterol in the blood) on patients unable to sufficiently lower their cholesterol levels by diet and exercise.	2.05	1	0	cyclopropanes; dihydroxy monocarboxylic acid; monofluorobenzenes; quinolines; statin (synthetic)	antioxidant
zinostatin Zinostatin: An enediyne that alkylates DNA and RNA like MITOMYCIN does, so it is cytotoxic.	1.98	1	0
hydrocortisone valerate hydrocortisone valerate: used in treatment of atopic dermatitis; RN given refers to 11beta-isomer	2.35	2	0	cortisol ester; glucocorticoid; primary alpha-hydroxy ketone; valerate ester
alatrofloxacin mesylate [no description available]	2.05	1	0
arbaprostil Arbaprostil: A synthetic prostaglandin E analog that protects the gastric mucosa, prevents ulceration, and promotes healing of peptic ulcers. The protective effect is independent of acid inhibition. It is also a potent inhibitor of pancreatic function and can inhibit the growth of experimental tumors.	1.98	1	0	prostanoid
thromboxane b2 Thromboxane B2: A stable, physiologically active compound formed in vivo from the prostaglandin endoperoxides. It is important in the platelet-release reaction (release of ADP and serotonin).. thromboxane B2 : A member of the class of thromboxanes B that is (5Z,13E)-thromboxa-5,13-dien-1-oic acid substituted by hydroxy groups at positions 9, 11 and 15.	2.37	2	0	thromboxanes B	human metabolite; mouse metabolite
4-hydroxy-2-nonenal 4-hydroxy-2-nonenal: cytotoxic product from peroxidation of liver microsomal lipids; RN given refers to cpd without isomeric designation. 4-hydroxynon-2-enal : An enal consisting of non-2-ene having an oxo group at the 1-position and a hydroxy group at the 4-position.. 4-hydroxynonenal : A monounsaturated fatty aldehyde that is nonanal that has undergone dehydrogenation to introduce a double bond at any position in the aliphatic chain and in which a hydrogen at position 4 has been replaced by a hydroxy group.	2.49	2	0	4-hydroxynon-2-enal; 4-hydroxynonenal
codeine [no description available]	2.68	3	0	morphinane alkaloid; organic heteropentacyclic compound	antitussive; drug allergen; environmental contaminant; opioid analgesic; opioid receptor agonist; prodrug; xenobiotic
cyclosporine ramihyphin A: one of the metabolites produced by Fusarium sp. S-435; RN given refers to cpd with unknown MF	2.75	3	0	homodetic cyclic peptide	anti-asthmatic drug; anticoronaviral agent; antifungal agent; antirheumatic drug; carcinogenic agent; dermatologic drug; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; geroprotector; immunosuppressive agent; metabolite
phenylephrine hydrochloride Nose: A part of the upper respiratory tract. It contains the organ of SMELL. The term includes the external nose, the nasal cavity, and the PARANASAL SINUSES.. phenylephrine hydrochloride : A hydrochloride that is the monohydrochloride salt of phenylephrine.	6.6	29	2	hydrochloride
natamycin [no description available]	2.45	2	0	antibiotic antifungal drug; dicarboxylic acid monoester; epoxide; macrolide antibiotic; monosaccharide derivative; polyene antibiotic	antifungal agrochemical; antimicrobial food preservative; apoptosis inducer; bacterial metabolite; ophthalmology drug
acitretin Acitretin: An oral retinoid effective in the treatment of psoriasis. It is the major metabolite of ETRETINATE with the advantage of a much shorter half-life when compared with etretinate.. acitretin : A retinoid that consists of 3,7-dimethylnona-2,4,6,8-tetraenoic acid having a 4-methoxy-2,3,6-trimethylphenyl group attached at position 9.	2.46	2	0	acitretin; alpha,beta-unsaturated monocarboxylic acid; retinoid	keratolytic drug
acrivastine acrivastine: a second generation antihistamine. acrivastine : A member of the class of pyridines that is (pyridin-2-yl)acrylic acid substituted at position 6 by a [(1E)-1-(4-methylphenyl)-3-(pyrrolidin-1-yl)prop-1-en-1-yl group. It is a non-sedating antihistamine used for treatment of hayfever, urticaria, and rhinitis.	2.05	1	0	alpha,beta-unsaturated monocarboxylic acid; N-alkylpyrrolidine; olefinic compound; pyridines	H1-receptor antagonist
cloprednol cloprednol: relative anti-inflammatory potency twice prednisolone; synthetic glucocorticoid; structure	2.04	1	0	21-hydroxy steroid
cyproterone Cyproterone: An anti-androgen that, in the form of its acetate (CYPROTERONE ACETATE), also has progestational properties. It is used in the treatment of hypersexuality in males, as a palliative in prostatic carcinoma, and, in combination with estrogen, for the therapy of severe acne and hirsutism in females.	2.04	1	0	17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(4) steroid; chlorinated steroid; tertiary alpha-hydroxy ketone	androgen antagonist
dihydrocodeine dihydrocodeine: RN refers to parent cpd(5alpha,6alpha)-isomer	2.05	1	0	morphinane alkaloid
diminazene aceturate diminazene diaceturate : An N-acetylglycinate salt resulting from the reaction of diminazene with 2 mol eq. of N-acetylglycine.	2.01	1	0	N-acetylglycinate salt	antiparasitic agent; trypanocidal drug
dothiepin [no description available]	2.05	1	0	dothiepin
estropipate estropipate: used therapeutically in menopausal patients	2.04	1	0	piperazinium salt; steroid sulfate
hydroxystilbamidine hydroxystilbamidine: minor descriptor (63-86); on-line & INDEX MEDICUS search STILBAMIDINES (66-86); RN given refers to parent cpd	2.04	1	0
levetiracetam Levetiracetam: A pyrrolidinone and acetamide derivative that is used primarily for the treatment of SEIZURES and some movement disorders, and as a nootropic agent.. levetiracetam : A pyrrolidinone and carboxamide that is N-methylpyrrolidin-2-one in which one of the methyl hydrogens is replaced by an aminocarbonyl group, while another is replaced by an ethyl group (the S enantiomer). An anticonvulsant, it is used for the treatment of epilepsy in both human and veterinary medicine.	2.45	2	0	pyrrolidin-2-ones	anticonvulsant; environmental contaminant; xenobiotic
ly 163892 loracarbef: 1-carbacephem antibiotic; has a broad spectrum of antimicrobial activity; structure given in first source; carbacephems differ from cephalosporins in the substitution of a sulfur atom in the dihydrothiazine ring with a methylene group to form a tetrahydropyridine ring. loracarbef : A synthetic "carba" analogue of cefaclor, with carbon replacing sulfur at position 1. Used to treat a wide range of infections caused by both gram-positive and gram-negative bacteria.	2.05	1	0	carbacephem; zwitterion	antibacterial drug; antimicrobial agent
meprednisone [no description available]	2.04	1	0	21-hydroxy steroid
nalorphine Nalorphine: A narcotic antagonist with some agonist properties. It is an antagonist at mu opioid receptors and an agonist at kappa opioid receptors. Given alone it produces a broad spectrum of unpleasant effects and it is considered to be clinically obsolete.	2.05	1	0	morphinane alkaloid
naloxone Naloxone: A specific opiate antagonist that has no agonist activity. It is a competitive antagonist at mu, delta, and kappa opioid receptors.. naloxone : A synthetic morphinane alkaloid that is morphinone in which the enone double bond has been reduced to a single bond, the hydrogen at position 14 has been replaced by a hydroxy group, and the methyl group attached to the nitrogen has been replaced by an allyl group. A specific opioid antagonist, it is used (commonly as its hydrochloride salt) to reverse the effects of opioids, both following their use of opioids during surgery and in cases of known or suspected opioid overdose.	2.94	4	0	morphinane alkaloid; organic heteropentacyclic compound; tertiary alcohol	antidote to opioid poisoning; central nervous system depressant; mu-opioid receptor antagonist
oxycodone Oxycodone: A semisynthetic derivative of CODEINE.. oxycodone : A semisynthetic opioid of formula C18H21NO4 that is derived from thebaine. It is a moderately potent opioid analgesic, generally used for relief of moderate to severe pain.	2.06	1	0	organic heteropentacyclic compound; semisynthetic derivative	antitussive; mu-opioid receptor agonist; opioid analgesic
oxymorphone Oxymorphone: An opioid analgesic with actions and uses similar to those of MORPHINE, apart from an absence of cough suppressant activity. It is used in the treatment of moderate to severe pain, including pain in obstetrics. It may also be used as an adjunct to anesthesia. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1092)	2.45	2	0	morphinane alkaloid
vitamin k 1 Vitamin K 1: A family of phylloquinones that contains a ring of 2-methyl-1,4-naphthoquinone and an isoprenoid side chain. Members of this group of vitamin K 1 have only one double bond on the proximal isoprene unit. Rich sources of vitamin K 1 include green plants, algae, and photosynthetic bacteria. Vitamin K1 has antihemorrhagic and prothrombogenic activity.. phylloquinone : A member of the class of phylloquinones that consists of 1,4-naphthoquinone having methyl and phytyl groups at positions 2 and 3 respectively. The parent of the class of phylloquinones.	2.36	2	0	phylloquinones; vitamin K	cofactor; human metabolite; plant metabolite
acepreval acepreval: topical steroid used for skin disease therapy	2.04	1	0	corticosteroid hormone
proscillaridin Proscillaridin: A cardiotonic glycoside isolated from Scilla maritima var. alba (Squill).	2.04	1	0	organic molecular entity
sirolimus Sirolimus: A macrolide compound obtained from Streptomyces hygroscopicus that acts by selectively blocking the transcriptional activation of cytokines thereby inhibiting cytokine production. It is bioactive only when bound to IMMUNOPHILINS. Sirolimus is a potent immunosuppressant and possesses both antifungal and antineoplastic properties.. sirolimus : A macrolide lactam isolated from Streptomyces hygroscopicus consisting of a 29-membered ring containing 4 trans double bonds, three of which are conjugated. It is an antibiotic, immunosupressive and antineoplastic agent.	2.76	3	0	antibiotic antifungal drug; cyclic acetal; cyclic ketone; ether; macrolide lactam; organic heterotricyclic compound; secondary alcohol	antibacterial drug; anticoronaviral agent; antineoplastic agent; bacterial metabolite; geroprotector; immunosuppressive agent; mTOR inhibitor
topiramate Topiramate: A sulfamate-substituted fructose analog that was originally identified as a hypoglycemic agent. It is used for the treatment of EPILEPSY and MIGRAINE DISORDERS, and may also promote weight loss.. topiramate : A hexose derivative that is 2,3:4,5-di-O-isopropylidene-beta-D-fructopyranose in which the hydroxy group has been converted to the corresponding sulfamate ester. It blocks voltage-dependent sodium channels and is used as an antiepileptic and for the prevention of migraine.	2.46	2	0	cyclic ketal; ketohexose derivative; sulfamate ester	anticonvulsant; sodium channel blocker
brefeldin a [no description available]	2	1	0	macrolide antibiotic	Penicillium metabolite
alvocidib alvocidib: structure given in first source. alvocidib : A synthetic dihydroxyflavone that is 5,7-dihydroxyflavone which is substituted by a 3-hydroxy-1-methylpiperidin-4-yl group at position 8 and by a chlorine at the 2' position (the (-)-3S,4R stereoisomer). A cyclin-dependent kinase 9 (CDK9) inhibitor, it has been studied for the treatment of acute myeloid leukaemia, arthritis and atherosclerotic plaque formation.	2.05	1	0	dihydroxyflavone; hydroxypiperidine; monochlorobenzenes; tertiary amino compound	antineoplastic agent; antirheumatic drug; apoptosis inducer; EC 2.7.11.22 (cyclin-dependent kinase) inhibitor
seocalcitol seocalcitol: structure given in first source	2.05	1	0
fenretinide Fenretinide: A synthetic retinoid that is used orally as a chemopreventive against prostate cancer and in women at risk of developing contralateral breast cancer. It is also effective as an antineoplastic agent.. 4-hydroxyphenyl retinamide : A retinoid obtained by formal condensation of the carboxy group of all-trans retinoic acid and the anilino group of 4-hydroxyaniline. Synthetic retinoid agonist. Antiproliferative, antioxidant and anticancer agent with a long half-life in vivo. Apoptotic effects appear to be mediated by a mechanism distinct from that of 'classical' retinoids.	2.05	1	0	monocarboxylic acid amide; retinoid	antineoplastic agent; antioxidant
geldanamycin [no description available]	2.05	1	0	1,4-benzoquinones; ansamycin; carbamate ester; organic heterobicyclic compound	antimicrobial agent; antineoplastic agent; antiviral agent; cysteine protease inhibitor; Hsp90 inhibitor
morphine Meconium: The thick green-to-black mucilaginous material found in the intestines of a full-term fetus. It consists of secretions of the INTESTINAL GLANDS; BILE PIGMENTS; FATTY ACIDS; AMNIOTIC FLUID; and intrauterine debris. It constitutes the first stools passed by a newborn.	5.61	10	2	morphinane alkaloid; organic heteropentacyclic compound; tertiary amino compound	anaesthetic; drug allergen; environmental contaminant; geroprotector; mu-opioid receptor agonist; opioid analgesic; plant metabolite; vasodilator agent; xenobiotic
demycarosylturimycin h [no description available]	2.46	2	0
2-methylthio-atp 2-methylthio-ATP: purinergic receptors agonist; relaxes mammalian gut preparations; structure given in first source	1.99	1	0
benzphetamine Benzphetamine: A sympathomimetic agent with properties similar to DEXTROAMPHETAMINE. It is used in the treatment of obesity. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1222). benzphetamine : Dextroamphetamine in which the the hydrogens attached to the amino group are substituted by a methyl and a benzyl group. A sympathomimetic agent with properties similar to dextroamphetamine, it is used as its hydrochloride salt in the treatment of obesity.	2.06	1	0	amphetamines; tertiary amine	adrenergic uptake inhibitor; appetite depressant; dopamine uptake inhibitor; sympathomimetic agent
clobetasol Clobetasol: A derivative of PREDNISOLONE with high glucocorticoid activity and low mineralocorticoid activity. Absorbed through the skin faster than FLUOCINONIDE, it is used topically in treatment of PSORIASIS but may cause marked adrenocortical suppression.. clobetasol : A 3-oxo-Delta(1),Delta(4)-steroid that is 16beta-methylpregna-1,4-diene-3,20-dione bearing hydroxy groups at the 11beta and 17alpha positions, fluorine at position 9, and a chlorine substituent at position 21. It is used as its 17alpha-propionate ester to treat various skin disorders, including exzema and psoriasis.	6.05	8	4	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(1),Delta(4)-steroid; chlorinated steroid; fluorinated steroid; glucocorticoid; tertiary alpha-hydroxy ketone	anti-inflammatory drug; SMO receptor agonist
fluticasone Fluticasone: A STEROID with GLUCOCORTICOID RECEPTOR activity that is used to manage the symptoms of ASTHMA; ALLERGIC RHINITIS, and ATOPIC DERMATITIS.. fluticasone : A trifluorinated corticosteroid used in the form of its propionate ester for treatment of allergic rhinitis.	4.8	1	1	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 3-oxo-Delta(4) steroid; corticosteroid; fluorinated steroid; thioester	anti-allergic agent; anti-asthmatic drug
herbimycin herbimycin: herbicidal antibiotic produced by Streptomyces sp.; see also herbimycin B; structure for herbimycin A in second source. herbimycin : A 19-membered macrocyle incorporating a benzoquinone ring and a lactam functionality. It is an ansamycin antibiotic that induces apoptosis and displays antitumour effects.	1.98	1	0	1,4-benzoquinones; lactam; macrocycle	antimicrobial agent; apoptosis inducer; herbicide; Hsp90 inhibitor; tyrosine kinase inhibitor
iloprost Iloprost: An eicosanoid, derived from the cyclooxygenase pathway of arachidonic acid metabolism. It is a stable and synthetic analog of EPOPROSTENOL, but with a longer half-life than the parent compound. Its actions are similar to prostacyclin. Iloprost produces vasodilation and inhibits platelet aggregation.. iloprost : A carbobicyclic compound that is prostaglandin I2 in which the endocyclic oxygen is replaced by a methylene group and in which the (1E,3S)-3-hydroxyoct-1-en-1-yl side chain is replaced by a (3R)-3-hydroxy-4-methyloct-1-en-6-yn-1-yl group. A synthetic analogue of prostacyclin, it is used as the trometamol salt (generally by intravenous infusion) for the treatment of peripheral vascular disease and pulmonary hypertension.	2.05	1	0	carbobicyclic compound; monocarboxylic acid; secondary alcohol	platelet aggregation inhibitor; vasodilator agent
mdl 100907 Serotonin 5-HT2 Receptor Antagonists: Drugs that bind to but do not activate SEROTONIN 5-HT2 RECEPTORS, thereby blocking the actions of SEROTONIN or SEROTONIN 5-HT2 RECEPTOR AGONISTS. Included under this heading are antagonists for one or more specific 5-HT2 receptor subtypes.	2.03	1	0
cytochalasin b Cytochalasin B: A cytotoxic member of the CYTOCHALASINS.. cytochalasin B : An organic heterotricyclic compound, that is a mycotoxin which is cell permeable an an inhibitor of cytoplasmic division by blocking the formation of contractile microfilaments.	1.99	1	0	cytochalasin; lactam; lactone; organic heterotricyclic compound	actin polymerisation inhibitor; metabolite; mycotoxin; platelet aggregation inhibitor
pd 123319 PD123319 : An imidazopyridine consisting of 4,5,6,7-tetrahydro-1H-imidazo[4,5-c]pyridine having 4-(dimethylamino)-3-methylbenzyl, diphenylacetyl and carboxy and groups at positions 1, 5 and 6 respectively	2.02	1	0	imidazopyridine	angiotensin receptor antagonist; endothelin receptor antagonist; vasoconstrictor agent
calyculin a calyculin A: RN given refers to (5S-(5alpha(2R(1S,3S,4S,5R,6R,7E,9E,11E,13Z),3R),7beta(E(S)),*beta,9alpha))-isomer	1.99	1	0
u 44069 U 44069: has contractile effect on rat pulmonary veins & arteries; a thromboxane-A2 mimetic	1.98	1	0	prostanoid
vinorelbine [no description available]	2.05	1	0	acetate ester; methyl ester; organic heteropentacyclic compound; organic heterotetracyclic compound; ring assembly; vinca alkaloid	antineoplastic agent; photosensitizing agent
(3r)-((2,3-dihydro-5-methyl-3-((4-morpholinyl)methyl)pyrrolo-(1,2,3-de)-1,4-benzoxazin-6-yl)(1-naphthalenyl))methanone WIN 55212-2 : A organic heterotricyclic compound that is 5-methyl-3-(morpholin-4-ylmethyl)-2,3-dihydro[1,4]oxazino[2,3,4-hi]indole substituted at position 6 by a 1-naphthylcarbonyl group.	2.05	1	0	morpholines; naphthyl ketone; organic heterotricyclic compound; synthetic cannabinoid	analgesic; apoptosis inhibitor; neuroprotective agent
kn 62 KN 62: inhibitor of Ca/calmodulin-dependent protein kinase II	2	1	0	piperazines
7,7-dimethyl-5,8-eicosadienoic acid 7,7-dimethyl-5,8-eicosadienoic acid: RN given refers to (Z,Z)-isomer; RN for cpd without isomeric designation not available 6/89	2.4	2	0	long-chain fatty acid
icariin [no description available]	2.08	1	0	flavonols; glycosyloxyflavone	antioxidant; bone density conservation agent; EC 3.1.4.35 (3',5'-cyclic-GMP phosphodiesterase) inhibitor; phytoestrogen
furazolidone [no description available]	2.05	1	0
fluvoxamine Fluvoxamine: A selective serotonin reuptake inhibitor that is used in the treatment of DEPRESSION and a variety of ANXIETY DISORDERS.. fluvoxamine : An oxime O-ether that is benzene substituted by a (1E)-N-(2-aminoethoxy)-5-methoxypentanimidoyl group at position 1 and a trifluoromethyl group at position 4. It is a selective serotonin reuptake inhibitor that is used for the treatment of obsessive-compulsive disorder.	2.45	2	0	(trifluoromethyl)benzenes; 5-methoxyvalerophenone O-(2-aminoethyl)oxime	antidepressant; anxiolytic drug; serotonin uptake inhibitor
semaxinib semaxanib : An oxindole that is 3-methyleneoxindole in which one of the hydrogens of the methylene group is replaced by a 3,5-dimethylpyrrol-2-yl group.	2.05	1	0	olefinic compound; oxindoles; pyrroles	angiogenesis modulating agent; antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; vascular endothelial growth factor receptor antagonist
orantinib orantinib: an antiangiogenic agent. orantinib : An oxindole that is 3-methyleneoxindole in which one of the hydrogens of the methylene group is substituted by a 2-(2-carboxyethyl)-3,5-dimethylpyrrol-3-yl group. It is an ATP-competitive inhibitor of the tyrosine kinase activity of fibroblast growth factor receptor 1.	2.05	1	0
su 11248 [no description available]	2.06	1	0	monocarboxylic acid amide; pyrroles	angiogenesis inhibitor; antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; immunomodulator; neuroprotective agent; vascular endothelial growth factor receptor antagonist
nifuroxazide nifuroxazide: structure	2.45	2	0	benzoic acids
stilbamidine stilbamidine: RN given refers to parent cpd	2.04	1	0
5-hydroxy-3,3',4',7-tetramethoxyflavone 5-hydroxy-3,7,3',4'-tetramethoxyflavone: from the rhizome of Kaempferia parviflora; inhibits monocyte adhesion and cellular reactive oxygen species production in human umbilical vein endothelial cells. 5-hydroxy-3,3',4',7-tetramethoxyflavone : A monohydroxyflavone that is 5-hydroxyflavone which is substituted by methoxy groups at positions 3,3',4' and 7.	2.41	1	0	3'-methoxyflavones; monohydroxyflavone; tetramethoxyflavone	plant metabolite
lead Lead: A soft, grayish metal with poisonous salts; atomic number 82, atomic weight 207.2, symbol Pb.	2.67	3	0	carbon group element atom; elemental lead; metal atom	neurotoxin
12-hydroxy-5,8,10,14-eicosatetraenoic acid 12-Hydroxy-5,8,10,14-eicosatetraenoic Acid: A lipoxygenase metabolite of ARACHIDONIC ACID. It is a highly selective ligand used to label mu-opioid receptors in both membranes and tissue sections. The 12-S-HETE analog has been reported to augment tumor cell metastatic potential through activation of protein kinase C. (J Pharmacol Exp Ther 1995; 274(3):1545-51; J Natl Cancer Inst 1994; 86(15):1145-51)	1.98	1	0
2-(dimethylaminostyryl)-1-ethylpyridinium 2-(dimethylaminostyryl)-1-ethylpyridinium: fluorescent monitor for energetic state of isolated brown- adipose-tissue mitochondria; RN given refers to parent cpd; synonym DASPEI refers to iodide	2.46	2	0	pyridinium ion
(6E)-7-[3-(4-fluorophenyl)-1-(propan-2-yl)-1H-indol-2-yl]-3,5-dihydroxyhept-6-enoic acid (6E)-7-[3-(4-fluorophenyl)-1-(propan-2-yl)-1H-indol-2-yl]-3,5-dihydroxyhept-6-enoic acid : A dihydroxy monocarboxylic acid that is N-isopropylindole which is substituted at position 3 by a p-fluorophenyl group and at position 2 by a 6-carboxy-3,5-dihydroxyhex-1-en-1-yl group. It has four possible diastereoisomers.	2.46	2	0	dihydroxy monocarboxylic acid; indoles; organofluorine compound
molsidomine [no description available]	2.05	1	0	ethyl ester; morpholines; oxadiazole; zwitterion	antioxidant; apoptosis inhibitor; cardioprotective agent; nitric oxide donor; vasodilator agent
psi-tectorigenin psi-tectorigenin: structure given in first source; isolated from Streptomyces	1.97	1	0
15-hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic acid 15-Hydroxy-11 alpha,9 alpha-(epoxymethano)prosta-5,13-dienoic Acid: A stable prostaglandin endoperoxide analog which serves as a thromboxane mimetic. Its actions include mimicking the hydro-osmotic effect of VASOPRESSIN and activation of TYPE C PHOSPHOLIPASES. (From J Pharmacol Exp Ther 1983;224(1): 108-117; Biochem J 1984;222(1):103-110)	2.41	2	0
cesium Cesium: A member of the alkali metals. It has an atomic symbol Cs, atomic number 50, and atomic weight 132.91. Cesium has many industrial applications, including the construction of atomic clocks based on its atomic vibrational frequency.	2.86	4	0	alkali metal atom
barium Barium: An element of the alkaline earth group of metals. It has an atomic symbol Ba, atomic number 56, and atomic weight 138. All of its acid-soluble salts are poisonous.	3.58	9	0	alkaline earth metal atom; elemental barium
rubidium Rubidium: An element that is an alkali metal. It has an atomic symbol Rb, atomic number 37, and atomic weight 85.47. It is used as a chemical reagent and in the manufacture of photoelectric cells.	1.98	1	0	alkali metal atom
aluminum Aluminum: A metallic element that has the atomic number 13, atomic symbol Al, and atomic weight 26.98.	5.2	16	0	boron group element atom; elemental aluminium; metal atom
ethylmorphine Ethylmorphine: A narcotic analgesic and antitussive. It is metabolized in the liver by ETHYLMORPHINE-N-DEMETHYLASE and used as an indicator of liver function.	2.04	1	0	morphinane alkaloid
strontium Strontium: An element of the alkaline earth family of metals. It has the atomic symbol Sr, atomic number 38, and atomic weight 87.62.	5.85	7	1	alkaline earth metal atom
bismuth Bismuth: A metallic element that has the atomic symbol Bi, and atomic number 83. Its principal isotope is Bismuth 209.	6.46	7	2	metal atom; pnictogen
levallorphan Levallorphan: An opioid antagonist with properties similar to those of NALOXONE; in addition it also possesses some agonist properties. It should be used cautiously; levallorphan reverses severe opioid-induced respiratory depression but may exacerbate respiratory depression such as that induced by alcohol or other non-opioid central depressants. (From Martindale, The Extra Pharmacopoeia, 30th ed, p683)	2.35	2	0	morphinane alkaloid
arsenic Arsenic: A shiny gray element with atomic symbol As, atomic number 33, and atomic weight 75. It occurs throughout the universe, mostly in the form of metallic arsenides. Most forms are toxic. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), arsenic and certain arsenic compounds have been listed as known carcinogens. (From Merck Index, 11th ed)	6.59	19	3	metalloid atom; pnictogen	micronutrient
naltrexone Naltrexone: Derivative of noroxymorphone that is the N-cyclopropylmethyl congener of NALOXONE. It is a narcotic antagonist that is effective orally, longer lasting and more potent than naloxone, and has been proposed for the treatment of heroin addiction. The FDA has approved naltrexone for the treatment of alcohol dependence.. naltrexone : An organic heteropentacyclic compound that is naloxone substituted in which the allyl group attached to the nitrogen is replaced by a cyclopropylmethyl group. A mu-opioid receptor antagonist, it is used to treat alcohol dependence.	2.72	3	0	cyclopropanes; morphinane-like compound; organic heteropentacyclic compound	antidote to opioid poisoning; central nervous system depressant; environmental contaminant; mu-opioid receptor antagonist; xenobiotic
dextromethorphan Dextromethorphan: Methyl analog of DEXTRORPHAN that shows high affinity binding to several regions of the brain, including the medullary cough center. This compound is an NMDA receptor antagonist (RECEPTORS, N-METHYL-D-ASPARTATE) and acts as a non-competitive channel blocker. It is one of the widely used ANTITUSSIVES, and is also used to study the involvement of glutamate receptors in neurotoxicity.. dextromethorphan : A 6-methoxy-11-methyl-1,3,4,9,10,10a-hexahydro-2H-10,4a-(epiminoethano)phenanthrene in which the sterocenters at positions 4a, 10 and 10a have S-configuration. It is a prodrug of dextrorphan and used as an antitussive drug for suppressing cough.	2.05	1	0	6-methoxy-11-methyl-1,3,4,9,10,10a-hexahydro-2H-10,4a-(epiminoethano)phenanthrene	antitussive; environmental contaminant; neurotoxin; NMDA receptor antagonist; oneirogen; prodrug; xenobiotic
gallium Gallium: A rare, metallic element designated by the symbol, Ga, atomic number 31, and atomic weight 69.72.. gallium atom : A metallic element predicted as eka-aluminium by Mendeleev in 1870 and discovered by Paul-Emile Lecoq de Boisbaudran in 1875. Named in honour of France (Latin Gallia) and perhaps also from the Latin gallus cock, a translation of Lecoq.	1.95	1	0	boron group element atom
butorphanol Butorphanol: A synthetic morphinan analgesic with narcotic antagonist action. It is used in the management of severe pain.. butorphanol : Levorphanol in which a hydrogen at position 14 of the morphinan skeleton is substituted by hydroxy and one of the hydrogens of the N-methyl group is substituted by cyclopropyl. A semi-synthetic opioid agonist-antagonist analgesic, it is used as its (S,S)-tartaric acid salt for relief or moderate to severe pain.	2.45	2	0	morphinane alkaloid	antitussive; kappa-opioid receptor agonist; mu-opioid receptor agonist; opioid analgesic
cefodizime cefodizime: RN given refers to (6R-(6alpha,7beta(Z)))-isomer. cefodizime : A cephalosporin compound having 5-(carboxymethyl)-4-methyl-1,3-thiazol-2-yl]sulfanyl}methyl and [2-(2-amino-1,3-thiazol-4-yl)-2-(methoxyimino)acetyl]amino side groups located at positions 3 and 7 respectively.	2.06	1	0	1,3-thiazoles; cephalosporin; oxime O-ether	antibacterial drug; EC 1.14.18.1 (tyrosinase) inhibitor
cefixime [no description available]	2.74	3	0	cephalosporin	antibacterial drug; drug allergen
lisinopril Lisinopril: One of the ANGIOTENSIN-CONVERTING ENZYME INHIBITORS (ACE inhibitors), orally active, that has been used in the treatment of hypertension and congestive heart failure.	4.1	4	0	dipeptide	EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor
benazepril benazepril: structure given in first source. benazepril : A benzazepine that is benazeprilat in which the carboxy group of the 2-amino-4-phenylbutanoic acid moiety has been converted to the corresponding ethyl ester. It is used (generally as its hydrochloride salt) as a prodrug for the angiotensin-converting enzyme inhibitor benazeprilat in the treatment of hypertension and heart failure.	2.06	1	0	benzazepine; dicarboxylic acid monoester; ethyl ester; lactam	EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; prodrug
ramipril Ramipril: A long-acting angiotensin-converting enzyme inhibitor. It is a prodrug that is transformed in the liver to its active metabolite ramiprilat.. ramipril : A dipeptide that is the prodrug for ramiprilat, the active metabolite obtained by hydrolysis of the ethyl ester group. An angiotensin-converting enzyme (ACE) inhibitor, used to treat high blood pressure and congestive heart failure.. quark : Quarks comprise one of two classes of the fundamental particles. Quarks possess fractional electric charges and are not observed in free state. The word "quark" first appears in James Joyce's Finnegans Wake and has been chosen by Murray Gell-Mann as a name for fundamental building blocks of particles.	2.46	2	0	azabicycloalkane; cyclopentapyrrole; dicarboxylic acid monoester; dipeptide; ethyl ester	bradykinin receptor B2 agonist; cardioprotective agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; matrix metalloproteinase inhibitor; prodrug
indinavir sulfate Indinavir: A potent and specific HIV protease inhibitor that appears to have good oral bioavailability.	2.96	4	0	dicarboxylic acid diamide; N-(2-hydroxyethyl)piperazine; piperazinecarboxamide	HIV protease inhibitor
sulfur Sulfur: An element that is a member of the chalcogen family. It has an atomic symbol S, atomic number 16, and atomic weight [32.059; 32.076]. It is found in the amino acids cysteine and methionine.	6.13	10	1	chalcogen; nonmetal atom	macronutrient
zimeldine Zimeldine: One of the SEROTONIN UPTAKE INHIBITORS formerly used for depression but was withdrawn worldwide in September 1983 because of the risk of GUILLAIN-BARRE SYNDROME associated with its use. (From Martindale, The Extra Pharmacopoeia, 29th ed, p385)	2.46	2	0	styrenes
veratrine Veratrine: A voltage-gated sodium channel activator.	2.36	2	0	alkaloid
enalapril maleate enalapril maleate : The maleic acid salt of enalapril. It contains one molecule of maleic acid for each molecule of enalapril. Following oral administration, the ethyl ester group of enalapril is hydrolysed to afford the corresponding carboxylic acid, enalaprilat, an angiotensin-converting enzyme (ACE) inhibitor. Enalapril is thus a prodrug for enalaprilat (which, unlike enalapril, is not absorbed by mouth), and its maleate is used in the treatment of hypertension and heart failure, for reduction of proteinuria and renal disease in patients with nephropathies, and for the prevention of stroke, myocardial infarction, and cardiac death in high-risk patients.	2.06	1	0	maleate salt	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; prodrug
enalapril Enalapril: An angiotensin-converting enzyme inhibitor that is used to treat HYPERTENSION and HEART FAILURE.. enalapril : A dicarboxylic acid monoester that is ethyl 4-phenylbutanoate in which a hydrogen alpha to the carboxy group is substituted by the amino group of L-alanyl-L-proline (S-configuration).	2.75	3	0	dicarboxylic acid monoester; dipeptide	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; geroprotector; prodrug
nitrofurazone Nitrofurazone: A topical anti-infective agent effective against gram-negative and gram-positive bacteria. It is used for superficial WOUNDS AND INJURIES and skin infections. Nitrofurazone has also been administered orally in the treatment of TRYPANOSOMIASIS.. nitrofurazone : A semicarbazone resulting from the formal condensation of semicarbazide with 5-nitrofuraldehyde. A broad spectrum antibacterial drug, although with little activity against Pseudomonas species, it is used as a local application for burns, ulcers, wounds and skin infections.	6.75	34	0
cytochalasin a [no description available]	2.05	1	0	cytochalasin
streptogramin a Streptogramin A: A specific streptogramin group A antibiotic produced by Streptomyces graminofaciens and other bacteria.	2.05	1	0	1,3-oxazoles; cyclic ketone; enamide; lactam; macrolide antibiotic; macrolide; pyrroline; secondary alcohol; secondary carboxamide; tertiary carboxamide	antibacterial drug; Mycoplasma genitalium metabolite
dimyristoylphosphatidylcholine 1,2-di-O-myristoyl-sn-glycero-3-phosphocholine : A 1,2-diacyl-sn-glycero-3-phosphocholine where the two phosphatidyl acyl groups are specified as tetradecanoyl (myristoyl).. dimyristoyl phosphatidylcholine : A phosphatidylcholine where the phosphatidyl acyl groups are specified as tetradecanoyl (myristoyl).	2.11	1	0	1,2-diacyl-sn-glycero-3-phosphocholine; phosphatidylcholine 28:0; tetradecanoate ester	antigen; mouse metabolite
beryllium Beryllium: An element with the atomic symbol Be, atomic number 4, and atomic weight 9.01218. Short exposure to this element can lead to a type of poisoning known as BERYLLIOSIS.. beryllium atom : Alkaline earth metal atom with atomic number 4.	2.4	2	0	alkaline earth metal atom; elemental beryllium; metal allergen	adjuvant; carcinogenic agent; epitope
bleomycin [no description available]	2.47	2	0	bleomycin	antineoplastic agent; metabolite
cysteine Cysteine: A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.. L-cysteinium : The L-enantiomer of cysteinium.. cysteine : A sulfur-containing amino acid that is propanoic acid with an amino group at position 2 and a sulfanyl group at position 3.	6.1	17	2	cysteinium	fundamental metabolite
silicon Silicon: A trace element that constitutes about 27.6% of the earth's crust in the form of SILICON DIOXIDE. It does not occur free in nature. Silicon has the atomic symbol Si, atomic number 14, and atomic weight [28.084; 28.086].	2.35	2	0	carbon group element atom; metalloid atom; nonmetal atom
phosphorus Phosphorus: A non-metal element that has the atomic symbol P, atomic number 15, and atomic weight 31. It is an essential element that takes part in a broad variety of biochemical reactions.	4.71	7	1	monoatomic phosphorus; nonmetal atom; pnictogen	macronutrient
boron Boron: A trace element with the atomic symbol B, atomic number 5, and atomic weight [10.806; 10.821]. Boron-10, an isotope of boron, is used as a neutron absorber in BORON NEUTRON CAPTURE THERAPY.	2.62	3	0	boron group element atom; metalloid atom; nonmetal atom	micronutrient
enkephalin, ala(2)-mephe(4)-gly(5)- [no description available]	2.04	1	0	peptide
enalaprilat anhydrous Enalaprilat: The active metabolite of ENALAPRIL and one of the potent, intravenously administered, ANGIOTENSIN-CONVERTING ENZYME INHIBITORS. It is an effective agent for the treatment of essential hypertension and has beneficial hemodynamic effects in heart failure. The drug produces renal vasodilation with an increase in sodium excretion.. enalaprilat dihydrate : The dihydrate form of enalaprilat, an angiotensin-converting enzyme (ACE) inhibitor that is used (often in the form of its prodrug, enalapril) in the treatment of hypertension and heart failure, for reduction of proteinuria and renal disease in patients with nephropathies, and for the prevention of stroke, myocardial infarction, and cardiac death in high-risk patients. Unlike enalapril, enalaprilat is not absorbed by mouth but is administered by intravenous injection.. enalaprilat (anhydrous) : Enalapril in which the ethyl ester group has been hydrolysed to the corresponding carboxylic acid. Enalaprilat is an angiotensin-converting enzyme (ACE) inhibitor and is used (often in the form of its prodrug, enalapril) in the treatment of hypertension and heart failure, for reduction of proteinuria and renal disease in patients with nephropathies, and for the prevention of stroke, myocardial infarction, and cardiac death in high-risk patients. Unlike enalapril, enalaprilat is not absorbed by mouth but is given by intravenous injection, usually as the dihydrate.	2.46	2	0	dicarboxylic acid; dipeptide	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor
imidapril imidapril: structure given in first source. imidapril : A member of the class of imidazolidines that is (4S)-1-methyl-2-oxoimidazolidine-4-carboxylic acid in which the hydrogen of the imidazolidine nitrogen has been substituted by (1S)-1-{[(2S)-1-ethoxy-1-oxo-4-phenylbutan-2-yl]amino}ethyl group. It is the prodrug for imidaprilat, an ACE inhibitor used for the treatment of chronic heart failure.	2.05	1	0	dicarboxylic acid monoester; dipeptide; ethyl ester; imidazolidines; N-acylurea; secondary amino compound	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; prodrug
cefquinome cefquinome: broad spectrum antibiotic; RN given refers to (6R(6alpha,7beta(Z)-isomer); structure given in first source	2.06	1	0
sulindac sulfone sulindac sulfone: inhibits K-ras-dependent cyclooxygenase-2; sulfated analog of indomethacin;; CP248 is an antineoplastic agent that fosters microtubule depolymerization; structure in first source. sulindac sulfone : A sulfone metabolite of sulindac that inhibits cell growth by inducing apoptosis independently of cyclooxygenase inhibition. It inhibits the development and induces regression of premalignant adenomatous polyps. Lipoxygenase and Cox-2 inhibitor.	2.05	1	0	monocarboxylic acid; organofluorine compound; sulfone	apoptosis inducer; cyclooxygenase 2 inhibitor; EC 1.13.11.34 (arachidonate 5-lipoxygenase) inhibitor
pepstatin pepstatin: inhibits the aspartic protease endothiapepsin	2.04	1	0	pentapeptide; secondary carboxamide	bacterial metabolite; EC 3.4.23.* (aspartic endopeptidase) inhibitor
ximelagatran ximelagatran: prodrug (via hydroxylation) of melagatran & a direct thrombin inhibitor; liver toxicity concerns so AZD0837 being developed to replace this. ximelagatran : A member of the class of azetidines that is melagatran in which the carboxylic acid group has been converted to the corresponding ethyl ester and in which the amidine group has been converted into the corresponding amidoxime. A prodrug for melagatran, ximelagatran was the first orally available direct thrombin inhibitor to be brought to market as an anticoagulant, but was withdrawn in 2006 following reports of it causing liver damage.	2.46	2	0	amidoxime; azetidines; carboxamide; ethyl ester; hydroxylamines; secondary amino compound; secondary carboxamide; tertiary carboxamide	anticoagulant; EC 3.4.21.5 (thrombin) inhibitor; prodrug; serine protease inhibitor
cefuroxime [no description available]	2.46	2	0	3-(carbamoyloxymethyl)cephalosporin; furans; oxime O-ether	drug allergen
ceftriaxone [no description available]	2.97	4	0	1,2,4-triazines; 1,3-thiazoles; cephalosporin; oxime O-ether	antibacterial drug; drug allergen; EC 3.5.2.6 (beta-lactamase) inhibitor
cefepime Cefepime: A fourth-generation cephalosporin antibacterial agent that is used in the treatment of infections, including those of the abdomen, urinary tract, respiratory tract, and skin. It is effective against PSEUDOMONAS AERUGINOSA and may also be used in the empiric treatment of FEBRILE NEUTROPENIA.. cefepime : A cephalosporin bearing (1-methylpyrrolidinium-1-yl)methyl and (2Z)-2-(2-amino-1,3-thiazol-4-yl)-2-(methoxyimino)acetamido groups at positions 3 and 7, respectively, of the cephem skeleton.	2.03	1	0	cephalosporin; oxime O-ether	antibacterial drug
pafuramidine pafuramidine: a prodrug of furamidine	2.06	1	0
norbinaltorphimine norbinaltorphimine: kappa opiate receptor antagonist; structure given in first source	1.99	1	0	isoquinolines
ceftazidime [no description available]	2.96	4	0	cephalosporin; oxime O-ether	antibacterial drug; drug allergen; EC 2.4.1.129 (peptidoglycan glycosyltransferase) inhibitor
trandolapril trandolapril : A heterobicylic compound that is (2S,3aR,7aS)-1-[(2S)-2-aminopropanoyl]octahydro-1H-indole-2-carboxylic acid in which the hydrogen of the amino group is substituted by a (2R)-1-ethoxy-1-oxo-4-phenylbutan-2-yl group. It is a angiotensin-converting enzyme inhibitor and a prodrug used for the treatment of hypertension.	2.74	3	0	dicarboxylic acid monoester; dipeptide; ethyl ester; organic heterobicyclic compound; secondary amino compound; tertiary carboxamide	antihypertensive agent; EC 3.4.15.1 (peptidyl-dipeptidase A) inhibitor; prodrug
neuromedin c neuromedin C: decapeptide isolated from porcine spinal cord; corresponds to the C-terminal decapeptide of gastrin-releasing peptide; bombesin-like peptide; RN given refers to all (L)-isomer	2	1	0
n-benzyloxycarbonyl-leucyl-leucyl-phenylalaninal N-benzyloxycarbonyl-leucyl-leucyl-phenylalaninal: slow-binding reversible inhibitor of chymotrypsin-like activity	2.08	1	0
oxyfedrine Oxyfedrine: A drug used in the treatment of angina pectoris, heart failure, conduction defects, and myocardial infarction. It is a partial agonist at beta adrenergic receptors and acts as a coronary vasodilator and cardiotonic agent.	2.46	2	0	aromatic ketone
triolein Triolein: (Z)-9-Octadecenoic acid 1,2,3-propanetriyl ester.. triolein : A triglyceride formed by esterification of the three hydroxy groups of glycerol with oleic acid. Triolein is one of the two components of Lorenzo's oil.	2.63	3	0	triglyceride	Caenorhabditis elegans metabolite; plant metabolite
guanabenz acetate [no description available]	2.05	1	0	dichlorobenzene	geroprotector
guanabenz Guanabenz: An alpha-2 selective adrenergic agonist used as an antihypertensive agent.	2.46	2	0	dichlorobenzene
famotidine [no description available]	3.16	5	0	1,3-thiazoles; guanidines; sulfonamide	anti-ulcer drug; H2-receptor antagonist; P450 inhibitor
abscisic acid Abscisic Acid: Abscission-accelerating plant growth substance isolated from young cotton fruit, leaves of sycamore, birch, and other plants, and from potatoes, lemons, avocados, and other fruits.. (S)-2-trans-abscisic acid : A 2-trans-abscisic acid with (S)-configuration at the chiral centre.. (+)-abscisic acid : The naturally occurring (1'S)-(+) enantiomer of abscisic acid. It is an important sesquiterpenoid plant hormone which acts as a regulator of plant responses to environmental stresses such as drought and cold.	2.42	2	0	2-trans-abscisic acid
cefotaxime Cefotaxime: Semisynthetic broad-spectrum cephalosporin.. cefotaxime : A cephalosporin compound having acetoxymethyl and [2-(2-amino-1,3-thiazol-4-yl)-2-(methoxyimino)acetyl]amino side groups.	5.32	7	2	1,3-thiazoles; cephalosporin; oxime O-ether	antibacterial drug; drug allergen
aztreonam [no description available]	3.3	6	0	beta-lactam antibiotic allergen; monobactam	antibacterial drug; drug allergen; EC 2.4.1.129 (peptidoglycan glycosyltransferase) inhibitor
urobilin [no description available]	1.94	1	0
st 638 [no description available]	1.98	1	0
ammonium sulfate Ammonium Sulfate: Sulfuric acid diammonium salt. It is used in CHEMICAL FRACTIONATION of proteins.. ammonium sulfate : An inorganic sulfate salt obtained by reaction of sulfuric acid with two equivalents of ammonia. A high-melting (decomposes above 280degreeC) white solid which is very soluble in water (70.6 g/100 g water at 0degreeC; 103.8 g/100 g water at 100degreeC), it is widely used as a fertilizer for alkaline soils.	2.38	2	0	ammonium salt; inorganic sulfate salt	fertilizer
magnesium citrate magnesium citrate : A magnesium salt composed of magnesium and dibasic citrate ions in a 1:1 ratio.. trimagnesium dicitrate : A magnesium salt composed of magnesium and citrate ions in a 3:2 ratio.	2.17	1	0	magnesium salt	laxative
4,4'-diisothiocyanostilbene-2,2'-disulfonic acid 4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid: An inhibitor of anion conductance including band 3-mediated anion transport.	2	1	0
proguanil Proguanil: A biguanide compound which metabolizes in the body to form cycloguanil, an anti-malaria agent.. proguanil : A biguanide compound which has isopropyl and p-chlorophenyl substituents on the terminal N atoms. A prophylactic antimalarial drug, it works by inhibiting the enzyme dihydrofolate reductase, which is involved in the reproduction of the malaria parasites Plasmodium falciparum and P. vivax within the red blood cells.	2.05	1	0	biguanides; monochlorobenzenes	antimalarial; antiprotozoal drug; EC 1.5.1.3 (dihydrofolate reductase) inhibitor
cci 15641 [no description available]	2.05	1	0	cephalosporin
coomassie brilliant blue [no description available]	1.98	1	0
rifamycin sv rifamycin SV: RN given refers to parent cpd; structure in Merck Index, 9th ed, #8009. rifamycin SV : A member of the class of rifamycins that exhibits antibiotic and antitubercular properties.	2.87	4	0	acetate ester; cyclic ketal; lactam; macrocycle; organic heterotetracyclic compound; polyphenol; rifamycins	antimicrobial agent; antitubercular agent; bacterial metabolite
mastoparan [no description available]	4.34	20	0	mastoparans; peptidyl amide	antimicrobial agent
saralasin Saralasin: An octapeptide analog of angiotensin II (bovine) with amino acids 1 and 8 replaced with sarcosine and alanine, respectively. It is a highly specific competitive inhibitor of angiotensin II that is used in the diagnosis of HYPERTENSION.	2.45	2	0	oligopeptide
tetrodotoxin Tetrodotoxin: An aminoperhydroquinazoline poison found mainly in the liver and ovaries of fishes in the order TETRAODONTIFORMES, which are eaten. The toxin causes paresthesia and paralysis through interference with neuromuscular conduction.. tetrodotoxin : A quinazoline alkaloid that is a marine toxin isolated from fish such as puffer fish. It has been shown to exhibit potential neutotoxicity due to its ability to block voltage-gated sodium channels.	2.68	3	0	azatetracycloalkane; oxatetracycloalkane; quinazoline alkaloid	animal metabolite; bacterial metabolite; marine metabolite; neurotoxin; voltage-gated sodium channel blocker
selenium Selenium: An element with the atomic symbol Se, atomic number 34, and atomic weight 78.97. It is an essential micronutrient for mammals and other animals but is toxic in large amounts. Selenium protects intracellular structures against oxidative damage. It is an essential component of GLUTATHIONE PEROXIDASE.	4.02	3	1	chalcogen; nonmetal atom	micronutrient
radium Radium: A radioactive element of the alkaline earth series of metals. It has the atomic symbol Ra and atomic number 88. Radium is the product of the disintegration of URANIUM and is present in pitchblende and all ores containing uranium. It is used clinically as a source of beta and gamma-rays in radiotherapy, particularly BRACHYTHERAPY.	2.34	2	0	alkaline earth metal atom
oxalates Oxalates: Derivatives of OXALIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that are derived from the ethanedioic acid structure.	3.46	8	0
epoprostenol sodium [no description available]	2.05	1	0	prostanoid
cefatrizine Cefatrizine: Orally active semisynthetic cephalosporin antibiotic with broad-spectrum activity.. cefatrizine : A cephalosporin compound having (1H-1,2,3-triazol-4-ylsulfanyl)methyl and [(2R)-2-amino-2-(4-hydroxyphenyl)]acetamido side-groups. An antibacterial drug first prepared in the 1970s, it has more recently been found to be an inhibitor of eukaryotic elongation factor-2 kinase (eEF2K), which is known to regulate apoptosis, autophagy and ER stress in many types of human cancers.	2.46	2	0	amino acid amide; carboxylic acid; cephalosporin; phenols; semisynthetic derivative; triazoles	antibacterial drug; EC 2.7.11.20 (elongation factor 2 kinase) inhibitor
dizocilpine maleate Dizocilpine Maleate: A potent noncompetitive antagonist of the NMDA receptor (RECEPTORS, N-METHYL-D-ASPARTATE) used mainly as a research tool. The drug has been considered for the wide variety of neurodegenerative conditions or disorders in which NMDA receptors may play an important role. Its use has been primarily limited to animal and tissue experiments because of its psychotropic effects.. dizocilpine maleate : A maleate salt obtained by reaction of dizocilpine with one equivalent of maleic acid.	2.69	3	0	maleate salt; tetracyclic antidepressant	anaesthetic; anticonvulsant; neuroprotective agent; nicotinic antagonist; NMDA receptor antagonist
antimycin a Antimycin A: An antibiotic substance produced by Streptomyces species. It inhibits mitochondrial respiration and may deplete cellular levels of ATP. Antimycin A1 has been used as a fungicide, insecticide, and miticide. (From Merck Index, 12th ed). antimycin A : A nine-membered bis-lactone having methyl substituents at the 2- and 6-positions, an n-hexyl substituent at the 8-position, an acyloxy substituent at the 7-position and an aroylamido substituent at the 3-position. It is produced by Streptomyces bacteria and has found commercial use as a fish poison.	3.05	5	0	amidobenzoic acid
cholestanol Cholestanol: A cholesterol derivative found in human feces, gallstones, eggs, and other biological matter.	2.65	3	0	cholestanoid
quaternium-15 quaternium-15 : A quaternary ammonium salt derived from hexamethylenetetramine; used as a preservative in many cosmetics and industrial substances. Also acts as a disinfectant and allergenic agent.	3.79	3	0
hygromycin a hygromycin A: a cinnamide derivative produced by Streptomyces hygroscopicus; structure differs from HYGROMYCIN B	5.88	31	0	hydroxycinnamic acid	metabolite
24,25-dihydroxyvitamin d 3 24,25-Dihydroxyvitamin D 3: A physiologically active metabolite of VITAMIN D. The compound is involved in the regulation of calcium metabolism, alkaline phosphatase activity, and enhancing the calcemic effect of CALCITRIOL.	2.43	2	0
nitrocefin nitrocefin: chromogenic cephalosporin used for detection of beta-lactamase activity; Cefinase is name for nitrocefin on paper disc; RN given refers to (6R-(3(E),6 alpha,7 beta))-isomer; structure for mono-Na salt in second source	2.15	1	0
rifaximin [no description available]	2.05	1	0	acetate ester; cyclic ketal; lactam; macrocycle; organic heterohexacyclic compound; rifamycins; semisynthetic derivative	antimicrobial agent; gastrointestinal drug; orphan drug
latrunculin b latrunculin B: 14-membered macrolide attached to 2-thiazolidinone moiety; from Red Sea sponge Latrunculia magnifica; see also latrunculin A; structure given in first source. latrunculin B : A macrolide consisting of a 14-membered bicyclic lactone attached to the rare 2-thiazolidinone moiety. It is obtained from the Red Sea sponge Latrunculia magnifica.	2.74	3	0	cyclic hemiketal; macrolide; oxabicycloalkane; thiazolidinone	actin polymerisation inhibitor; metabolite; toxin
bafilomycin a1 bafilomycin A1: from Streptomyces griseus; structure given in first source. bafilomycin A1 : The most used of the bafilomycins, a family of toxic macrolide antibiotics derived from Streptomyces griseus.	1.98	1	0	cyclic hemiketal; macrolide antibiotic; oxanes	apoptosis inducer; autophagy inhibitor; bacterial metabolite; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor; EC 3.6.3.14 (H(+)-transporting two-sector ATPase) inhibitor; ferroptosis inhibitor; fungicide; potassium ionophore; toxin
1-oleoyl-2-acetylglycerol [no description available]	1.97	1	0	1,2-diglyceride
1,2-dioleoyloxy-3-(trimethylammonium)propane 1,2-dioleoyloxy-3-(trimethylammonium)propane: fluorescent probe for phospholipids; RN & structure given in first source	2.02	1	0
thiazole orange thiazole orange: structure given in first source. thiazole orange : A cyanine dye comprising the thiazole orange cation [1-methyl-4-[(3-methyl-1,3-benzothiazol-2(3H)-ylidene)methyl]quinolinium] with the p-tosylate counterion.	2.08	1	0	cyanine dye	fluorochrome
n-(1-(2,3-dioleyloxy)propyl)-n,n,n-trimethylammonium chloride N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium: cationic lipid; structure given in first source	1.97	1	0
2-(4-amylcinnamoyl)amino-4-chlorobenzoic acid 2-(4-amylcinnamoyl)amino-4-chlorobenzoic acid: phospholipase A2 inhibitor	2	1	0
ixabepilone [no description available]	2.05	1	0	1,3-thiazoles; beta-hydroxy ketone; epoxide; lactam; macrocycle	antineoplastic agent; microtubule-destabilising agent
salvianolic acid B salvianolic acid B: isolated from Salvia miltiorrhiza. salvianolic acid B : A member of the class of 1-benzofurans that is an antioxidant and free radical scavenging compound extracted from S. miltiorrhiza	2.49	2	0	1-benzofurans; catechols; dicarboxylic acid; enoate ester; polyphenol	anti-inflammatory agent; antidepressant; antineoplastic agent; antioxidant; apoptosis inducer; autophagy inhibitor; cardioprotective agent; hepatoprotective agent; hypoglycemic agent; neuroprotective agent; osteogenesis regulator; plant metabolite
beta-escin Escin: Pentacyclic triterpene saponins, biosynthesized from protoaescigenin and barringtogenol, occurring in the seeds of AESCULUS. It inhibits edema formation and decreases vascular fragility.	1.99	1	0	triterpenoid saponin
azlocillin Azlocillin: A semisynthetic ampicillin-derived acylureido penicillin.. azlocillin : A semisynthetic penicillin having a 6beta-{(2R)-2-[(2-oxoimidazolidine-1-carbonyl)amino]-2-phenylacetyl}amino side-group. It is an antibiotic used in treating infections caused by Pseudomonas aeruginosa, Escherichia coli and Haemophilus influenzae.	2.96	4	0	penicillin allergen; penicillin; semisynthetic derivative	antibacterial drug
fm1 43 FM1 43: labels motor nerve terminals in an activity-dependent fashion that involves dye uptake by synaptic vesicles that are recycling; structure given in second source	2.47	2	0	organic bromide salt; pyridinium salt; quaternary ammonium salt; tertiary amine	fluorochrome
cefpodoxime proxetil cefpodoxime proxetil: structure given in first source; prodrug for cefpodoxime. cefpodoxime proxetil : The 1-[(isopropoxycarbonyl)oxy]ethyl (proxetil) ester prodrug of cefpodoxime. After swallowing, hydrolysis of the ester group occurs in the intestinal epithelium, to release active cefpodoxime in the bloodstream. It is used to treat acute otitis media, pharyngitis, and sinusitis.	2.06	1	0	carboxylic acid; carboxylic ester; cephalosporin	antibacterial drug; prodrug
ceftizoxime [no description available]	2.05	1	0	cephalosporin	antibacterial drug
1-methyl-d-lysergic acid butanolamide [no description available]	2.06	1	0	ergot alkaloid; monocarboxylic acid amide	serotonergic antagonist; sympatholytic agent; vasoconstrictor agent
paclobutrazol paclobutrazol: RN given refers to (R,R)-(+-)-isomer. paclobutrazol : A racemate comprising equimolar amounts of (2R,3R)- and (2S,3S)-1-(4-chlorophenyl)-4,4-dimethyl-2-(1H-1,2,4-triazol-1-yl)pentan-3-ol. It acts as a plant-growth retardant and fungicide via inhibition of gibberellin biosynthesis.	2.03	1	0
beta-escin [no description available]	3.07	5	0
dantrolene sodium dantrolene sodium (anhydrous) : The anhydrous sodium salt of dantrolene.	2.05	1	0
nitrofurantoin Nitrofurantoin: A urinary anti-infective agent effective against most gram-positive and gram-negative organisms. Although sulfonamides and antibiotics are usually the agents of choice for urinary tract infections, nitrofurantoin is widely used for prophylaxis and long-term suppression.. nitrofurantoin : An imidazolidine-2,4-dione that is hydantoin substituted at position 1 by a [(5-nitro-2-furyl)methylene]amino group. An antibiotic that damages bacterial DNA.	7.36	63	2	imidazolidine-2,4-dione; nitrofuran antibiotic; organonitrogen heterocyclic antibiotic; organooxygen heterocyclic antibiotic	antibacterial drug; antiinfective agent; hepatotoxic agent
lactacystin [no description available]	2.01	1	0	lactam; S-substituted L-cysteine
nifurtimox Nifurtimox: A nitrofuran thiazine that has been used against TRYPANOSOMIASIS.	2.39	2	0	nitrofuran antibiotic
adenosine-3',5'-cyclic phosphorothioate adenosine-3',5'-cyclic phosphorothioate: RP-cAMP-S is a protein kinase A inhibitor; SP-cAMP-S is a protein kinase A agonist. (Sp)-cAMPS : A nucleoside 3',5'-cyclic phosphorothioate having adenine as the nucleobase (the Sp-stereoisomer).. (Rp)-cAMPS : A nucleoside 3',5'-cyclic phosphorothioate having adenine as the nucleobase (the Rp-stereoisomer).	2	1	0	nucleoside 3',5'-cyclic phosphorothioate
sq-23377 Ionomycin: A divalent calcium ionophore that is widely used as a tool to investigate the role of intracellular calcium in cellular processes.. ionomycin : A very long-chain fatty acid that is docosa-10,16-dienoic acid which is substituted by methyl groups at positions 4, 6, 8, 12, 14, 18 and 20, by hydroxy groups at positions 11, 19 and 21, and by a (2',5-dimethyloctahydro-2,2'-bifuran-5-yl)ethanol group at position 21. An ionophore produced by Streptomyces conglobatus, it is used in research to raise the intracellular level of Ca(2+) and as a research tool to understand Ca(2+) transport across biological membranes.	3.69	10	0	cyclic ether; enol; polyunsaturated fatty acid; very long-chain fatty acid	calcium ionophore; metabolite
dantrolene [no description available]	2.06	1	0
ik 682 IK 682: inhibits TNF-alpha converting enzyme; structure in first source	3.41	1	0	hydroxamic acid; pyrrolidin-2-ones; quinolines
roxithromycin (E)-roxithromycin : A major geometrical isomer of roxithromycin.	2.05	1	0	roxithromycin	environmental contaminant; xenobiotic
fumagillin [no description available]	1.93	1	0	antibiotic antifungal drug; carboxylic ester; dicarboxylic acid monoester; meroterpenoid; organooxygen heterocyclic antibiotic; spiro-epoxide	angiogenesis inhibitor; antibacterial drug; antimicrobial agent; antiprotozoal drug; fungal metabolite; methionine aminopeptidase 2 inhibitor
ci 940 leptomycin : A complex, very long chain, polyunsaturated fatty acid whose core structure comprises 8-oxononadeca-2,10,12,16,18-pentaenoic acid having methyl substituents at positions 3, 5, 7, 9, 11 and 15 and a 3,6-dihydropyran-6-one-2-yl group at position 19.	2.04	1	0	hydroxy polyunsaturated fatty acid; leptomycin	antifungal agent; bacterial metabolite
evernimicin [no description available]	3.05	1	0
beraprost beraprost: stable prostacyclin analog; structure given in first source. beraprost : An organic heterotricyclic compound that is (3aS,8bS)-2,3,3a,8b-tetrahydro-1H-benzo[b]cyclopenta[d]furan in which the hydrogens at positions 1R, 2R and 5 are replaced by (3S)-3-hydroxy-4-methyloct-1-en-6-yn-1-yl, hydroxy and 3-carboxypropyl groups, respectively. It is a prostaglandin receptor agonist which is approved to treat pulmonary arterial hypertension in Asia.	2.05	1	0	enyne; monocarboxylic acid; organic heterotricyclic compound; secondary alcohol; secondary allylic alcohol	anti-inflammatory agent; antihypertensive agent; platelet aggregation inhibitor; prostaglandin receptor agonist; vasodilator agent
lanreotide [no description available]	2.05	1	0
lu 208075 ambrisentan: an ET(A) receptor antagonist and antihypertensive agent; studied for use in pulmonary arterial hypertension	2.46	2	0	diarylmethane
bibx 1382bs BIBX 1382BS: an ErbB receptor kinase inhibitor; no further information available 4/2001	2.06	1	0	substituted aniline
acetylcarnitine O-acetyl-L-carnitine : An O-acyl-L-carnitine where the acyl group specified is acetyl. It facilitates movement of acetyl-CoA into the matrices of mammalian mitochondria during the oxidation of fatty acids.	2.05	1	0	O-acetylcarnitine; saturated fatty acyl-L-carnitine	human metabolite; Saccharomyces cerevisiae metabolite
staurosporine staurosporinium : Conjugate acid of staurosporine.	4.43	22	0	ammonium ion derivative
chlorhexidine Chlorhexidine: A disinfectant and topical anti-infective agent used also as mouthwash to prevent oral plaque.. chlorhexidine : A bisbiguanide compound with a structure consisting of two (p-chlorophenyl)guanide units linked by a hexamethylene bridge.	11.29	48	11	biguanides; monochlorobenzenes	antibacterial agent; antiinfective agent
nidroxyzone nidroxyzone: structure	1.92	1	0	C-nitro compound; furans
cefmenoxime Cefmenoxime: A cephalosporin antibiotic that is administered intravenously or intramuscularly. It is active against most common gram-positive and gram-negative microorganisms, is a potent inhibitor of Enterobacteriaceae, and is highly resistant to hydrolysis by beta-lactamases. The drug has a high rate of efficacy in many types of infection and to date no severe side effects have been noted.. cefmenoxime : A third-generation cephalosporin antibiotic, bearing a 2-(2-amino-1,3-thiazol-4-yl)-2-(methoxyimino)acetyl]amino group at the 7beta-position and a [(1-methyl-1H-tetrazol-5-yl)sulfanyl]methyl group at the 3-position.	1.97	1	0	cephalosporin	antibacterial drug
nifurtoinol nifurtoinol : An imidazolidine-2,4-dione that is hydantoin substituted at position 1 by a [(5-nitro-2-furyl)methylene]amino group and at position 3 by a hydroxymethyl group.	2.05	1	0	hydrazone; imidazolidine-2,4-dione; nitrofuran antibiotic; organonitrogen heterocyclic antibiotic	antibacterial drug; antiinfective agent; hepatotoxic agent
fosinopril [no description available]	2.45	2	0
eflucimibe eflucimibe: a powerful and systemic acylcoenzyme A: cholesterol acyltransferase inhibitor	2.05	1	0
amoxicillin-potassium clavulanate combination Amoxicillin-Potassium Clavulanate Combination: A fixed-ratio combination of amoxicillin trihydrate and potassium clavulanate.	4.87	6	0
5'-amino-5'-deoxyadenosine [no description available]	1.99	1	0
nikkomycin [no description available]	3.12	1	0
gsk 256066 [no description available]	3.41	1	0
sincalide Sincalide: An octapeptide hormone present in the intestine and brain. When secreted from the gastric mucosa, it stimulates the release of bile from the gallbladder and digestive enzymes from the pancreas.	2.68	3	0	oligopeptide
etomoxir [no description available]	2.05	1	0	aromatic ether
halometasone [no description available]	3.35	1	1	21-hydroxy steroid
muromonab-cd3 xestospongin C: was indexed to xestospongin A; from Xestospongia sponge; empties the ER calcium store but does not inhibit InsP3-induced Ca2+ release. xestospongin C : An organic heteropentacyclic compound that is isolated from the marine sponge Xestospongia exigua.	2.06	1	0	alkaloid; macrocycle; organic heteropentacyclic compound; organonitrogen heterocyclic compound; oxacycle; tertiary amino compound	antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; IP3 receptor antagonist; marine metabolite
valnemulin [no description available]	2.05	1	0
pentagastrin Pentagastrin: A synthetic pentapeptide that has effects like gastrin when given parenterally. It stimulates the secretion of gastric acid, pepsin, and intrinsic factor, and has been used as a diagnostic aid.	2.05	1	0	organic molecular entity
mocetinostat mocetinostat: undergoing phase II clinical trials for treatment of cancer. mocetinostat : A benzamide obtained by formal condensation of the carboxy group of 4-({[4-(pyridin-3-yl)pyrimidin-2-yl]amino}methyl)benzoic acid with one of the amino groups of benzene-1,2-diamine. It is an orally active and isotype-selective HDAC inhibitor which exhibits antitumour activity (IC50 = 0.15, 0.29, 1.66 and 0.59 muM for HDAC1, HDAC2, HDAC3 and HDAC11).	2.39	2	0	aminopyrimidine; benzamides; pyridines; secondary amino compound; secondary carboxamide; substituted aniline	antineoplastic agent; apoptosis inducer; autophagy inducer; cardioprotective agent; EC 3.5.1.98 (histone deacetylase) inhibitor; hepatotoxic agent
abt-770 ABT-770: structure in first source	2.04	1	0
xestospongin a xestospongin A: blocks inositol 1,4,5-trisphosphate receptors; structure in first source; from Xestospongia sponge	2.7	3	0
9-n-(1-propyl)erythromyclamine 9-N-(1-propyl)erythromyclamine: structure given in first source	2.04	1	0
gentamicin sulfate [no description available]	4.35	19	0
hki 272 [no description available]	2.41	1	0	nitrile; quinolines	antineoplastic agent; tyrosine kinase inhibitor
3,9-bis((ethylthio)methyl)-k-252a 3,9-bis((ethylthio)methyl)-K-252a: RN given for (9S-(9alpha,10beta,12alpha))-isomer; mixed lineage kinase inhibitor, neuroprotective agent, and neurotrophic agent derived from K-252a; structure in first source	2.41	2	0
phenylalanyl-glycyl-leucyl-methioninamide phenylalanyl-glycyl-leucyl-methioninamide: a substance P-derived peptide	2.11	1	0	tetrapeptide
tetramethylrhodamine tetramethylrhodamine: RN given refers to perchlorate; structure	2.05	1	0	xanthene dye
g(m1) ganglioside G(M1) Ganglioside: A specific monosialoganglioside that accumulates abnormally within the nervous system due to a deficiency of GM1-b-galactosidase, resulting in GM1 gangliosidosis.. ganglioside GM1 : A sialotetraosylceramide consisting of a branched pentasaccharide made up from one sialyl residue, two galactose residues, one N-acetylgalactosamine residue and a glucose residue at the reducing end attached to N-stearoylsphingosine via a beta-linkage.	2.71	3	0	alpha-N-acetylneuraminosyl-(2->3)-[beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminyl-(1->4)]-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-N-acylsphingosine; sialotetraosylceramide
aluminum oxide Aluminum Oxide: An oxide of aluminum, occurring in nature as various minerals such as bauxite, corundum, etc. It is used as an adsorbent, desiccating agent, and catalyst, and in the manufacture of dental cements and refractories.	4.8	1	1
azacosterol Azacosterol: Diaza derivative of cholesterol which acts as a hypocholesteremic agent by blocking delta-24-reductase, which causes the accumulation of desmosterol.	2.04	1	0
phosphoramidite phosphoramidite: structure in first source. phosphoramidite : A compound with the general formula (RO)2PNR2. Phosphoramidites can be regarded as phosphites that have an NR2 instead of an OH group, or as amides of phosphorous acid.	2.41	1	0
fmrfamide FMRFamide: A molluscan neuroactive peptide which induces a fast excitatory depolarizing response due to direct activation of amiloride-sensitive SODIUM CHANNELS. (From Nature 1995; 378(6558): 730-3)	2.41	2	0
pazopanib pazopanib: a protein kinase inhibitor. pazopanib : A pyrimidine that is 5-(pyrimidin-2-yl}amino-2-methylbenzenesulfonamide substituted at position 4 by a (2,3-dimethylindazol-6-yl)(methyl)amino group. Used as its hydrochloride salt for treatment of kidney cancer.	2.06	1	0	aminopyrimidine; indazoles; sulfonamide	angiogenesis modulating agent; antineoplastic agent; tyrosine kinase inhibitor; vascular endothelial growth factor receptor antagonist
azd 6244 AZD 6244: a MEK inhibitor	2.05	1	0	benzimidazoles; bromobenzenes; hydroxamic acid ester; monochlorobenzenes; organofluorine compound; secondary amino compound	anticoronaviral agent; antineoplastic agent; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor
dicerandrol a dicerandrol A: antibiotic and cytotoxic dimer produced by the fungus Phomopsis longicolla isolated from an endangered mint Dicerandra frutescens (Labiatae); structure in first source. dicerandrol A : A biaryl that is 5,5',7,7',9,9',10a,10a'-octahydro-6H,6'H-2,2'-bixanthene substituted by acetoxy groups at C-5 and C-5', hydroxy groups at C-1, C-1', C-8 and C-8', hydroxymethyl groups at C-10a and C-10a', methyl groups at C-6 and C-6' and oxo groups at C-9 and C-9' respectively. A dimeric tetrahydroxanthone derivative isolated from Phomopsis longicolla, it exhibits antibacterial and cytotoxic activities.	2	1	0
carbomycin carbomycin: from Streptomyces halstedii	2.85	4	0
secramine a secramine A: inhibits VSVG transport from the Golgi to the plasma membrane; also inhibits Cdc42-dependent cell functions; structure in first source	2.03	1	0
meciadanol meciadanol: catechin metabolite; RN & N1 from CA Vol 91 Form Index; RN given refers to cpd without isomeric designation	1.97	1	0
norvancomycin norvancomycin: glycopeptide; adverse reactions tend to occur in older patients, those who use other antibiotic concomitantly or those who receive this agent longer than 14 days	3.35	1	0
homatropine methylbromide homatropine methylbromide: RN given refers to bromide (endo-(+-))-isomer	2.04	1	0
glycerol phenylbutyrate glycerol phenylbutyrate: for treating urea cycle disorders	3.21	1	0	triglyceride
oxadiazoles Oxadiazoles: Compounds containing five-membered heteroaromatic rings containing two carbons, two nitrogens, and one oxygen atom which exist in various regioisomeric forms.	1.97	1	0
vinflunine vinflunine: inhibits tubulin assembly; structure in first source. vinflunine : An organic heteropentacyclic compound and an organic heterotetracyclic compound that is vinorelbine in which the tetrahydropyridine moiety of the heterotetracyclic part of the molecule has been redced to the corresponding piperidine, and in which the ethyl group attached to this ring has been replaced by a 1,1-difluoroethyl group.	2.05	1	0	acetate ester; methyl ester; organic heteropentacyclic compound; organic heterotetracyclic compound; semisynthetic derivative; vinca alkaloid	antineoplastic agent
baci-im [no description available]	2.46	2	0	homodetic cyclic peptide; polypeptide; zwitterion	antibacterial agent; antimicrobial agent
ucn 1028 c calphostin C: structure given in first source; isolated from Cladosporium cladosporioides	3.38	7	0
ribose ribopyranose : The pyranose form of ribose.	3.5	8	0	D-ribose; ribopyranose
acebutolol alpha-D-glucosyl-(1->4)-alpha-D-mannose : An alpha-D-glucosyl-(1->4)-D-mannopyranose in which the anomeric hydroxy group has alpha configuration.	2.86	4	0	alpha-D-glucosyl-(1->4)-D-mannopyranose
lactulose Lactulose: A synthetic disaccharide used in the treatment of constipation and hepatic encephalopathy. It has also been used in the diagnosis of gastrointestinal disorders. (From Martindale, The Extra Pharmacopoeia, 30th ed, p887). lactulose : A synthetic galactosylfructose disaccharide used in the treatment of constipation and hepatic encephalopathy.	15.04	78	13
polymyxin b(1) [no description available]	2.41	1	0
brimonidine tartrate Brimonidine Tartrate: A quinoxaline derivative and ADRENERGIC ALHPA-2 RECEPTOR AGONIST that is used to manage INTRAOCULAR PRESSURE associated with OPEN-ANGLE GLAUCOMA and OCULAR HYPERTENSION.	1.97	1	0
nystatin a1 Nystatin: Macrolide antifungal antibiotic complex produced by Streptomyces noursei, S. aureus, and other Streptomyces species. The biologically active components of the complex are nystatin A1, A2, and A3.. nystatin : A heterogeneous mixture of polyene compounds produced by cultures of Streptomyces noursei. It mainly consists of three biologically active components designated nystatin A1, nystatin A2, and nystatin A3. It is used to treat oral and dermal fungal infections.. nystatin A1 : A polyene macrolide antibiotic; part of the nystatin complex produced by several Streptomyces species. It is an antifungal antibiotic used for the treatment of topical fungal infections caused by a broad spectrum of fungal pathogens comprising yeast-like and filamentous species.	13.45	130	28	nystatins
carfilzomib [no description available]	4.8	1	1	epoxide; morpholines; tetrapeptide	antineoplastic agent; proteasome inhibitor
veratridine Veratridine: A benzoate-cevane found in VERATRUM and Schoenocaulon. It activates SODIUM CHANNELS to stay open longer than normal.	2.88	4	0
incb3619 INCB3619: ADAM inhibitor; structure in first source	3.41	1	0
vindesine [no description available]	2.04	1	0
losartan potassium Erythropoietin: Glycoprotein hormone, secreted chiefly by the KIDNEY in the adult and the LIVER in the FETUS, that acts on erythroid stem cells of the BONE MARROW to stimulate proliferation and differentiation.	1.99	1	0
alpha-Neup5Ac-(2->3)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-D-GlcpNAc Sialyl Lewis X Antigen: A sialylated version of Lewis X antigen expressed on cell surfaces. It is a ligand for SELECTINS.. alpha-Neup5Ac-(2->3)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-D-GlcpNAc : A branched amino tetrasaccharide consisting of a sialyl residue, linked (2->3) to a galactosyl residue that in turn is linked (1->4) to a glucosaminyl residue, which is also carrying a fucosyl residue at the 3-position.	3.09	1	0	amino tetrasaccharide; glucosamine oligosaccharide	epitope
empagliflozin [no description available]	4.8	1	1	aromatic ether; C-glycosyl compound; monochlorobenzenes; tetrahydrofuryl ether	hypoglycemic agent; sodium-glucose transport protein subtype 2 inhibitor
calcimycin Calcimycin: An ionophorous, polyether antibiotic from Streptomyces chartreusensis. It binds and transports CALCIUM and other divalent cations across membranes and uncouples oxidative phosphorylation while inhibiting ATPase of rat liver mitochondria. The substance is used mostly as a biochemical tool to study the role of divalent cations in various biological systems.	4.46	23	0	benzoxazole
dextrothyroxine [no description available]	1.99	1	0
sepharose agarose : A linear polysaccharide made up from alternating D-galactose and 3,6-anhydro-alpha-L-galactopyranose residues joined by alpha-(1->3)- and beta-(1->4)-linkages.	2.57	2	0
scopolamine hydrobromide [no description available]	3.46	8	0
pituitrin Pituitrin: A substance or extract from the neurohypophysis (PITUITARY GLAND, POSTERIOR).	3.91	13	0
virginiamycin Virginiamycin: A cyclic polypeptide antibiotic complex from Streptomyces virginiae, S. loidensis, S. mitakaensis, S. pristina-spiralis, S. ostreogriseus, and others. It consists of 2 major components, VIRGINIAMYCIN FACTOR M1 and virginiamycin Factor S1. It is used to treat infections with gram-positive organisms and as a growth promoter in cattle, swine, and poultry.. virginiamycin : A mixture of cyclic polypeptide streptogramin antibiotics produced by Streptomyces virginiae, S. loidensis, S. mitakaensis, S. pristina-spiralis, S. ostreogriseus, and others. The two major components are virginiamycin M1 (also known as pristinamycin IIA) and virginiamycin S1. Virginiamycin has been widely used as a growth promotion agent in livestock and has been to have bacteriostatic activity against Gram-positive organisms such as staphylococci and streptococci.	5.25	10	0
pf 03491390 [no description available]	2.05	1	0
atropine sulfate [no description available]	2.05	1	0
dihydrotachysterol Dihydrotachysterol: A VITAMIN D that can be regarded as a reduction product of vitamin D2.. dihydrotachysterol : A hydroxy seco-steroid that is 9,10-secoergosta-5,7,22-triene substituted by a hydroxy group at position 3. A synthetic analogue of vitamin D that acts a bone density conservation agent.	2.34	2	0
rifamycins [no description available]	12.77	33	5
acid phosphatase Acid Phosphatase: An enzyme that catalyzes the conversion of an orthophosphoric monoester and water to an alcohol and orthophosphate. EC 3.1.3.2.	3.55	9	0
2-deoxyinosose 2-deoxyinosose: structure given in first source; an early intermediate in the biosynthesis of 2-deoxystreptamine	2.49	2	0
kt 5926 KT 5926: indolocarbazole; structure given in first source. KT 5926 : An organic heterooctacyclic compound that is 5-propoxy-1H,1'H-2,2'-biindole in which the nitrogens have undergone formal oxidative coupling to positions 2 and 5 of methyl (3R)-3-hydroxy-2-methyltetrahydrofuran-3-carboxylate (the 2S,3R,5R product), and in which the 3 and 3' positions of the biindole moiety have also undergone formal oxidative coupling to positions 3 and 4 of 1,5-dihydro-2H-pyrrol-2-one.	2	1	0	gamma-lactam; hemiaminal; indolocarbazole; methyl ester; organic heterooctacyclic compound; tertiary alcohol	EC 2.7.11.18 (myosin-light-chain kinase) inhibitor
icatibant icatibant: a potent bradykinin (B2) receptor antagonist; WIN 65365 is an L-Tic(7) stereoisomer. icatibant : A ten-membered synthetic oligopeptide consisting of D-Arg, Arg, Pro, Hyp, Gly, Thi, Ser, D-Tic, Oic, and Arg residues joined in sequrence. A bradykinin receptor antagonist used as its acetate salt for the treatment of acute attacks of hereditary angioedema in adult patients.	1.98	1	0
tixocortol pivalate tixocortol pivalate: used in drug therapy of allergic rhinitis, structure. tixocortol pivalate : The pivalate thioester of tixocortol.	4.84	4	2	corticosteroid; pivalate ester; tertiary alpha-hydroxy ketone; thioester	allergen; anti-allergic agent; glucocorticoid receptor agonist
nad NAD(1-) : An anionic form of nicotinamide adenine dinucleotide arising from deprotonation of the two OH groups of the diphosphate moiety.	2.87	4	0	organophosphate oxoanion	cofactor; human metabolite; hydrogen acceptor; Saccharomyces cerevisiae metabolite
serofendic acid serofendic acid: structure in first source	2.02	1	0
amodiaquine hydrochloride [no description available]	2.45	2	0
cytochrome c-t Cytochromes c: Cytochromes of the c type that are found in eukaryotic MITOCHONDRIA. They serve as redox intermediates that accept electrons from MITOCHONDRIAL ELECTRON TRANSPORT COMPLEX III and transfer them to MITOCHONDRIAL ELECTRON TRANSPORT COMPLEX IV.	2.02	1	0
melitten Melitten: Basic polypeptide from the venom of the honey bee (Apis mellifera). It contains 26 amino acids, has cytolytic properties, causes contracture of muscle, releases histamine, and disrupts surface tension, probably due to lysis of cell and mitochondrial membranes.	1.98	1	0
cholecystokinin Cholecystokinin: A peptide, of about 33 amino acids, secreted by the upper INTESTINAL MUCOSA and also found in the central nervous system. It causes gallbladder contraction, release of pancreatic exocrine (or digestive) enzymes, and affects other gastrointestinal functions. Cholecystokinin may be the mediator of satiety.	3.04	1	0
ceruletide Ceruletide: A specific decapeptide obtained from the skin of Hila caerulea, an Australian amphibian. Caerulein is similar in action and composition to CHOLECYSTOKININ. It stimulates gastric, biliary, and pancreatic secretion; and certain smooth muscle. It is used in paralytic ileus and as diagnostic aid in pancreatic malfunction.. ceruletide : A decapeptide comprising 5-oxoprolyl, glutamyl, aspartyl, O-sulfotyrosyl, threonyl, glycyl, tryptopyl, methionyl, aspartyl and phenylalaninamide residues in sequence. Found in the skins of certain Australian amphibians, it is an analogue of the gastrointestinal peptide hormone cholecystokinin and stimulates gastric, biliary, and pancreatic secretion. It is used in cases of paralysis of the intestine (paralytic ileus) and as a diagnostic aid in pancreatic malfunction.	2.41	2	0	oligopeptide	diagnostic agent; gastrointestinal drug
dynorphins Dynorphins: A class of opioid peptides including dynorphin A, dynorphin B, and smaller fragments of these peptides. Dynorphins prefer kappa-opioid receptors (RECEPTORS, OPIOID, KAPPA) and have been shown to play a role as central nervous system transmitters.	1.99	1	0
somatostatin [no description available]	2.04	1	0	heterodetic cyclic peptide; peptide hormone
atrial natriuretic factor Atrial Natriuretic Factor: A potent natriuretic and vasodilatory peptide or mixture of different-sized low molecular weight PEPTIDES derived from a common precursor and secreted mainly by the HEART ATRIUM. All these peptides share a sequence of about 20 AMINO ACIDS.	2.7	3	0	polypeptide
tannins gallotannin : A class of hydrolysable tannins obtained by condensation of the carboxy group of gallic acid (and its polymeric derivatives) with the hydroxy groups of a monosaccharide (most commonly glucose).	2.05	1	0	tannin
t140 peptide T140 peptide: a strong anti-hiv agent; amino acid sequence in first source	2.04	1	0
nociceptin [no description available]	2.72	3	0	organic molecular entity; polypeptide	human metabolite; rat metabolite
gramicidin a Gramicidin: A group of peptide antibiotics from BACILLUS brevis. Gramicidin C or S is a cyclic, ten-amino acid polypeptide and gramicidins A, B, D are linear. Gramicidin is one of the two principal components of TYROTHRICIN.	13.51	91	19
cobrotoxin Cobra Neurotoxin Proteins: Toxins, contained in cobra (Naja) venom that block cholinergic receptors; two specific proteins have been described, the small (short, Type I) and the large (long, Type II) which also exist in other Elapid venoms.	1.96	1	0
glucagon Glucagon: A 29-amino acid pancreatic peptide derived from proglucagon which is also the precursor of intestinal GLUCAGON-LIKE PEPTIDES. Glucagon is secreted by PANCREATIC ALPHA CELLS and plays an important role in regulation of BLOOD GLUCOSE concentration, ketone metabolism, and several other biochemical and physiological processes. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p1511). glucagon : A 29-amino acid peptide hormone consisting of His, Ser, Gln, Gly, Thr, Phe, Thr, Ser, Asp, Tyr, Ser, Lys, Tyr, Leu, Asp, Ser, Arg, Arg, Ala, Gln, Asp, Phe, Val, Gln, Trp, Leu, Met, Asn and Thr residues joined in sequence.	4.96	9	1	peptide hormone
beta-endorphin beta-Endorphin: A 31-amino acid peptide that is the C-terminal fragment of BETA-LIPOTROPIN. It acts on OPIOID RECEPTORS and is an analgesic. Its first four amino acids at the N-terminal are identical to the tetrapeptide sequence of METHIONINE ENKEPHALIN and LEUCINE ENKEPHALIN.. beta-endorphin : A polypeptide consisting of 31 amino acid residues in the sequence Tyr-Gly-Gly-Phe-Met-Thr-Ser-Glu-Lys-Ser-Gln-Thr-Pro-Leu-Val-Thr-Leu-Phe-Lys-Asn-Ala-Ile-Ile-Lys-Asn-Ala-Tyr-Lys-Lys-Gly-Glu. It is an endogenous opioid peptide neurotransmitter found in the neurons of both the central and peripheral nervous system and results from processing of the precursor protein proopiomelanocortin (POMC).	1.97	1	0
ceca1 protein, drosophila [no description available]	2.13	1	0
neuropeptide y Neuropeptide Y: A 36-amino acid peptide present in many organs and in many sympathetic noradrenergic neurons. It has vasoconstrictor and natriuretic activity and regulates local blood flow, glandular secretion, and smooth muscle activity. The peptide also stimulates feeding and drinking behavior and influences secretion of pituitary hormones.	2.03	1	0
forapin Forapin: used as ointment for treatment of myositis & arthritis; contains bee venom, salicylate, nicotinate & vanillylnonamide	2.41	1	0	peptidyl amide; polypeptide	animal metabolite; antineoplastic agent; apoptosis inducer; EC 2.7.11.13 (protein kinase C) inhibitor; hepatoprotective agent; neuroprotective agent; venom
irl 1620 sovateltide: a potent, specific ligand for the endothelin-B receptor	2.03	1	0
tannins Tannins: Polyphenolic compounds with molecular weights of around 500-3000 daltons and containing enough hydroxyl groups (1-2 per 100 MW) for effective cross linking of other compounds (ASTRINGENTS). The two main types are HYDROLYZABLE TANNINS and CONDENSED TANNINS. Historically, the term has applied to many compounds and plant extracts able to render skin COLLAGEN impervious to degradation. The word tannin derives from the Celtic word for OAK TREE which was used for leather processing.	1.96	1	0
oligonucleotides [no description available]	3.91	12	0
anticodon Anticodon: The sequential set of three nucleotides in TRANSFER RNA that interacts with its complement in MESSENGER RNA, the CODON, during translation in the ribosome.	3.99	4	0
ziconotide ziconotide: amino acid sequence in first source; from venom of South Pacific sea cone snail, Conus magus; calcium channel blocker; administered by injection into Cerebrospinal Fluid; Prialt is synthetic form. omega-conotoxin MVIIA : A heterodetic cyclic polypeptide consisting of the linear sequence Cys-Lys-Gly-Lys-Gly-Ala-Lys-Cys-Ser-Arg-Leu-Met-Tyr-Asp-Cys-Cys-Thr-Gly-Ser-Cys-Arg-Ser-Gly-Lys-Cys-NH2 with three disulfide bridges between cysteine residues 1-16, 8-20 and 15-25. A neuronal N-type Ca(2+) channel blocker in mammalian and amphibian brain, it blocks release of GABA and glutamate at neuronal synapses. Used as a probe for calcium channel receptors, it is selective for different receptor subtypes. A synthetic form, named ziconotide, is an atypical analgesic agent for the amelioration of severe and chronic pain.	1.98	1	0
glucagon-like peptide 1 Glucagon-Like Peptide 1: A peptide of 36 or 37 amino acids that is derived from PROGLUCAGON and mainly produced by the INTESTINAL L CELLS. GLP-1(1-37 or 1-36) is further N-terminally truncated resulting in GLP-1(7-37) or GLP-1-(7-36) which can be amidated. These GLP-1 peptides are known to enhance glucose-dependent INSULIN release, suppress GLUCAGON release and gastric emptying, lower BLOOD GLUCOSE, and reduce food intake.	2.48	2	0
natriuretic peptide, c-type Natriuretic Peptide, C-Type: A PEPTIDE of 22 amino acids, derived mainly from cells of VASCULAR ENDOTHELIUM. It is also found in the BRAIN, major endocrine glands, and other tissues. It shares structural homology with ATRIAL NATRIURETIC FACTOR. It has vasorelaxant activity thus is important in the regulation of vascular tone and blood flow. Several high molecular weight forms containing the 22 amino acids have been identified.	2.08	1	0
ristocetin Ristocetin: An antibiotic mixture of two components, A and B, obtained from Nocardia lurida (or the same substance produced by any other means). It is no longer used clinically because of its toxicity. It causes platelet agglutination and blood coagulation and is used to assay those functions in vitro.. ristocetin : A heterodetic cyclic peptide that is produced by species of Amycolatopsis and Nocardia.	11.77	20	1	glycopeptide; heterodetic cyclic peptide; macrocycle; tetrasaccharide derivative	antibacterial drug; antimicrobial agent; bacterial metabolite; platelet-activating factor receptor agonist
cellulose DEAE-Cellulose: Cellulose derivative used in chromatography, as ion-exchange material, and for various industrial applications.	7.45	13	2	glycoside
ceftiofur ceftiofur: structure in first source	2	1	0
endothelin-1 Endothelin-1: A 21-amino acid peptide produced in a variety of tissues including endothelial and vascular smooth-muscle cells, neurons and astrocytes in the central nervous system, and endometrial cells. It acts as a modulator of vasomotor tone, cell proliferation, and hormone production. (N Eng J Med 1995;333(6):356-63)	3.26	6	0
phosphatidylcholines Phosphatidylcholines: Derivatives of PHOSPHATIDIC ACIDS in which the phosphoric acid is bound in ester linkage to a CHOLINE moiety.	5.15	18	0	1,2-diacyl-sn-glycero-3-phosphocholine
chlorophyll a Chlorophyll: Porphyrin derivatives containing magnesium that act to convert light energy in photosynthetic organisms.. chlorophyll : A family of magnesium porphyrins, defined by the presence of a fifth ring beyond the four pyrrole-like rings. The rings can have various side chains which usually include a long phytol chain.	2.64	3	0	chlorophyll; methyl ester	cofactor
phenylmercuric acetate Phenylmercuric Acetate: A phenyl mercury compound used mainly as a fungicide. Has also been used as a herbicide, slimicide, and bacteriocide.	1.95	1	0	arylmercury compound; benzenes
bismuth subsalicylate bismuth subsalicylate: bismuth subsalicylate is the active ingredient of Pepto-Bismol and in Kaopectate; used to treat nausea, heartburn, indigestion, upset stomach, diarrhea and other temporary discomforts of the stomach; used with Azoles and other drugs to treat Helicobacter. bismuth subsalicylate : A bismuth salt of salicylic acid.	3.35	1	1
thimerosal Thimerosal: An ethylmercury-sulfidobenzoate that has been used as a preservative in VACCINES; ANTIVENINS; and OINTMENTS. It was formerly used as a topical antiseptic. It degrades to ethylmercury and thiosalicylate.. thimerosal : An alkylmercury compound (approximately 49% mercury by weight) used as an antiseptic and antifungal agent.	4.18	5	0	alkylmercury compound	antifungal drug; antiseptic drug; disinfectant; drug allergen
sodium salicylate [no description available]	1.95	1	0	organic molecular entity
valproate sodium Epilim: oral sodium valproate used as antidepressive agent. sodium valproate : The sodium salt of valproic acid.. valproate : A branched-chain saturated fatty acid anion that is the conjugate base of valproic acid.	2.05	1	0	organic sodium salt	geroprotector
ubiquinone Ubiquinone: A lipid-soluble benzoquinone which is involved in ELECTRON TRANSPORT in mitochondrial preparations. The compound occurs in the majority of aerobic organisms, from bacteria to higher plants and animals.	2.1	1	0
flucloronide flucloronide: synthetic glucocorticoid with anti-inflammatory properties; minor descriptor (75-83); on-line & Index Medicus search PREGNADIENETROLS (75-83); RN given refers to (6alpha,11beta,16alpha)-isomer; structure	3.34	1	1	21-hydroxy steroid
calpain Calpain: Cysteine proteinase found in many tissues. Hydrolyzes a variety of endogenous proteins including NEUROPEPTIDES; CYTOSKELETAL PROTEINS; proteins from SMOOTH MUSCLE; CARDIAC MUSCLE; liver; platelets; and erythrocytes. Two subclasses having high and low calcium sensitivity are known. Removes Z-discs and M-lines from myofibrils. Activates phosphorylase kinase and cyclic nucleotide-independent protein kinase. This enzyme was formerly listed as EC 3.4.22.4.	2.94	4	0
lucifer yellow lucifer yellow: RN given refers to di-Li salt	2.06	1	0	organic lithium salt	fluorochrome
urethane acrylate urethane acrylate: UV curing resin cpd implicated in contact dermatitis	1.96	1	0
chitosan [no description available]	3.5	7	0
lincospectin [no description available]	2.03	1	0
9-(tetrahydro-2-furyl)-adenine [no description available]	2.03	1	0
imidazole-1-sulfonyl azide hydrochloride imidazole-1-sulfonyl azide: a diazotransfer reagent.; structure in first source	2.08	1	0
mesna Mesna: A sulfhydryl compound used to prevent urothelial toxicity by inactivating metabolites from ANTINEOPLASTIC AGENTS, such as IFOSFAMIDE or CYCLOPHOSPHAMIDE.	2.72	3	0	organosulfonic acid
bucladesine Bucladesine: A cyclic nucleotide derivative that mimics the action of endogenous CYCLIC AMP and is capable of permeating the cell membrane. It has vasodilator properties and is used as a cardiac stimulant. (From Merck Index, 11th ed). bucladesine : A 3',5'-cyclic purine nucleotide that is the 2'-butanoate ester and 6-N-butanoyl derivative of 3',5'-cyclic AMP.	3.5	8	0	3',5'-cyclic purine nucleotide
cerivastatin sodium cerivastatin sodium : The sodium salt of cerivastatin. Formerly used to lower cholesterol and prevent cardiovascular disease, it was withdrawn from the market worldwide in 2001 following reports of a severe form of muscle toxicity.	2.05	1	0	organic sodium salt; statin (synthetic)
sodium hypochlorite Sodium Hypochlorite: It is used as an oxidizing and bleaching agent and as a disinfectant. (From Grant & Hackh's Chemical Dictionary, 5th ed). sodium hypochlorite : An inorganic sodium salt in which hypochlorite is the counterion. It is used as a bleaching and disinfecting agent and is commonly found in household bleach.	3.22	6	0	inorganic sodium salt	bleaching agent; disinfectant
monensin [no description available]	2.05	1	0
sodium iothalamate [no description available]	2.05	1	0
oxacillin sodium [no description available]	2.05	1	0	organic sodium salt
sodium nitrite Sodium Nitrite: Nitrous acid sodium salt. Used in many industrial processes, in meat curing, coloring, and preserving, and as a reagent in ANALYTICAL CHEMISTRY TECHNIQUES. It is used therapeutically as an antidote in cyanide poisoning. The compound is toxic and mutagenic and will react in vivo with secondary or tertiary amines thereby producing highly carcinogenic nitrosamines.. sodium nitrite : An inorganic sodium salt having nitrite as the counterion. Used as a food preservative and antidote to cyanide poisoning.	1.95	1	0	inorganic sodium salt; nitrite salt	antidote to cyanide poisoning; antihypertensive agent; antimicrobial food preservative; food antioxidant; poison
sodium diatrizoate histopaque: used for separating mononuclear & other cells. sodium amidotrizoate : The sodium salt of a benzoic acid having iodo substituents at the 2-, 4- and 6-positions and acetamido substituents at the 3- and 5-positions. It is used, often as a mixture with the meglumine salt, as an X-ray contrast medium in gastrointestinal studies, angiography, and urography.	2.05	1	0	organic sodium salt; organoiodine compound	radioopaque medium
cefazolin sodium cefazolin sodium : A cephalosporin organic sodium salt having [(5-methyl-1,3,4-thiadiazol-2-yl)sulfanyl]methyl and (1H-tetrazol-1-ylacetyl)amino side-groups.	3.35	1	0	organic sodium salt
ro13-9904 Ceftriaxone: A broad-spectrum cephalosporin antibiotic and cefotaxime derivative with a very long half-life and high penetrability to meninges, eyes and inner ears.. ceftriaxone : A third-generation cephalosporin compound having 2-(2-amino-1,3-thiazol-4-yl)-2-(methoxyimino)acetylamino and [(2-methyl-5,6-dioxo-1,2,5,6-tetrahydro-1,2,4-triazin-3-yl)sulfanyl]methyl side-groups.	6.76	7	3
chiniofon Hydroxyquinolines: The 8-hydroxy derivatives inhibit various enzymes and their halogenated derivatives, though neurotoxic, are used as topical anti-infective agents, among other uses.	3.75	2	1
thiostrepton Thiostrepton: One of the CYCLIC PEPTIDES from Streptomyces that is active against gram-positive bacteria. In veterinary medicine, it has been used in mastitis caused by gram-negative organisms and in dermatologic disorders.. thiostrepton : A heterodetic cyclic peptide, in which the cyclisation step involves a formal lactonisation between the carboxy group of a quinaldic acid-based residue and a secondary alcohol. An antibiotic that inhibits bacterial protein synthesis. Also acts as an antitumor agent.	4.73	7	1
hygromycin b [no description available]	6.71	43	0
phosphatidylinositol 4-phosphate phosphatidylinositol 4-phosphate : A phosphatidylinositol monophosphate carrying the phosphate group at the 4-position.	3.47	8	0
s-adenosylmethionine (R)-S-adenosyl-L-methionine : An S-adenosyl-L-methionine that has R-configuration.. S-adenosyl-L-methionine zwitterion : A zwitterionic tautomer of S-adenosyl-L-methionine arising from shift of the proton from the carboxy group to the amino group.. (R)-S-adenosyl-L-methionine zwitterion : An S-adenosyl-L-methionine zwitterion that has R-configuration; major species at pH 7.3.. (S)-S-adenosyl-L-methionine zwitterion : An S-adenosyl-L-methionine zwitterion that has S-configuration; major species at pH 7.3.. S-adenosyl-L-methionine : A sulfonium compound that is the S-adenosyl derivative of L-methionine. It is an intermediate in the metabolic pathway of methionine.	2.41	2	0	organic cation; sulfonium compound	coenzyme; cofactor; human metabolite; micronutrient; Mycoplasma genitalium metabolite; nutraceutical; Saccharomyces cerevisiae metabolite
intrinsic factor Intrinsic Factor: A glycoprotein secreted by the cells of the GASTRIC GLANDS that is required for the absorption of VITAMIN B 12 (cyanocobalamin). Deficiency of intrinsic factor leads to VITAMIN B 12 DEFICIENCY and ANEMIA, PERNICIOUS.	2.64	3	0
niraparib niraparib: structure in first source. niraparib : A 2-[4-(piperidin-3-yl)phenyl]-2H-indazole-7-carboxamide that has S-configuration. It is a potent inhibitor of PARP1 and PARP2 (IC50 of 3.8 and 2.1 nM, respectively) and approved as a first-line maintenance treatment for women with advanced ovarian cancer after responding to platinum-based chemotherapy.	4.8	1	1	2-[4-(piperidin-3-yl)phenyl]-2H-indazole-7-carboxamide	antineoplastic agent; apoptosis inducer; EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor; radiosensitizing agent
egg white Egg White: The white of an egg, especially a chicken's egg, used in cooking. It contains albumin. (Random House Unabridged Dictionary, 2d ed)	2.36	2	0
cardiovascular agents Cardiovascular Agents: Agents that affect the rate or intensity of cardiac contraction, blood vessel diameter, or blood volume.	2.34	2	0
neurotensin neurotensin, Tyr(11)-: RN given refers to parent cpd & (D)-isomer; RN for cpd without isomeric designation not avail 5/91	2.04	1	0	peptide hormone	human metabolite; mitogen; neurotransmitter; vulnerary
bms-790052 daclatasvir: an HCV NS5A inhibitor. daclatasvir : A member of the class of biphenyls that is a potent inhibitor of nonstructural protein 5A and is used (as its hydrochloride salt) for treatment of hepatitis C.	2.21	1	0	biphenyls; carbamate ester; carboxamide; imidazoles; valine derivative	antiviral drug; nonstructural protein 5A inhibitor
inositol 1,4-bis(phosphate) inositol 1,4-bis(phosphate): induced in human platelets by thrombin; RN given refers to cpd without isomeric designation. 1D-myo-inositol 1,4-bisphosphate(4-) : An organophosphate oxoanion arising from deprotonation of the phosphate OH groups of 1D-myo-inositol 1,4-bisphosphate; major species at pH 7.3.	2.67	3	0
peptones Peptones: Derived proteins or mixtures of cleavage products produced by the partial hydrolysis of a native protein either by an acid or by an enzyme. Peptones are readily soluble in water, and are not precipitable by heat, by alkalis, or by saturation with ammonium sulfate. (Dorland, 28th ed)	2.86	4	0
plx4032 [no description available]	4.8	1	1	aromatic ketone; difluorobenzene; monochlorobenzenes; pyrrolopyridine; sulfonamide	antineoplastic agent; B-Raf inhibitor
achn 490 plazomicin: structure in first source	3.61	2	0
glycolipids [no description available]	2.68	3	0
piperidines Piperidines: A family of hexahydropyridines.	6.33	12	1
ornithine phenylacetate [no description available]	3.21	1	0
endothelins [no description available]	2.04	1	0
colistin Colistin: Cyclic polypeptide antibiotic from Bacillus colistinus. It is composed of Polymyxins E1 and E2 (or Colistins A, B, and C) which act as detergents on cell membranes. Colistin is less toxic than Polymyxin B, but otherwise similar; the methanesulfonate is used orally.. colistin : A multi-component mixture comprising mostly of colistin A (R = Me) and B (R = H), with small amounts of colistin C and other polymyxins, produced by certain strains of Bacillus polymyxa var. colistinus. An antibiotic, it is used as its sulfate salt (for oral or topical use) or as the sodium salt of the N-methylsulfonic acid derivative (the injectable form) in the treatment of severe Gram-negative infections, partiularly those due to Pseudomonas aeruginosa.	15.12	164	19
hydroxocobalamin Hydroxocobalamin: Injectable form of VITAMIN B 12 that has been used therapeutically to treat VITAMIN B 12 DEFICIENCY.	1.96	1	0
tilmicosin tilmicosin: semi-synthetic antibiotic. tilmicosin : A macrolide antibiotic with formula C46H80N2O13. It is used for the treatment of respiratory disease in cattle at high risk of developing bovine respiratory disease associated with Mannheimia haemolytica.	1.99	1	0
tylosin [no description available]	2.89	4	0
unc 0638 UNC 0638: inhibits lysine methyltransferases G9a and GLP; structure in first source	2.08	1	0	quinazolines
bix 01294 BIX 01294: structure in first source	2.08	1	0
methylcellulose Methylcellulose: Methylester of cellulose. Methylcellulose is used as an emulsifying and suspending agent in cosmetics, pharmaceutics and the chemical industry. It is used therapeutically as a bulk laxative.	4.71	7	1
heme Heme: The color-furnishing portion of hemoglobin. It is found free in tissues and as the prosthetic group in many hemeproteins.. ferroheme : Any iron(II)--porphyrin coordination complex.. ferroheme b : Heme b in which the iron has oxidation state +2.. heme : A heme is any tetrapyrrolic chelate of iron.	2.35	2	0
heparitin sulfate Heparitin Sulfate: A heteropolysaccharide that is similar in structure to HEPARIN. It accumulates in individuals with MUCOPOLYSACCHARIDOSIS.	2.92	4	0
ascorbic acid Ascorbic Acid: A six carbon compound related to glucose. It is found naturally in citrus fruits and many vegetables. Ascorbic acid is an essential nutrient in human diets, and necessary to maintain connective tissue and bone. Its biologically active form, vitamin C, functions as a reducing agent and coenzyme in several metabolic pathways. Vitamin C is considered an antioxidant.. L-ascorbic acid : The L-enantiomer of ascorbic acid and conjugate acid of L-ascorbate.. L-ascorbate : The L-enantiomer of ascorbate and conjugate base of L-ascorbic acid, arising from selective deprotonation of the 3-hydroxy group. Required for a range of essential metabolic reactions in all animals and plants.. vitamin C : Any member of a group of vitamers that belong to the chemical structural class called butenolides that exhibit biological activity against vitamin C deficiency in animals. The vitamers include L-ascorbic acid and its salt, ionized and oxidized forms.	6.75	19	1	ascorbic acid; vitamin C	coenzyme; cofactor; flour treatment agent; food antioxidant; food colour retention agent; geroprotector; plant metabolite; skin lightening agent
novobiocin Novobiocin: An antibiotic compound derived from Streptomyces niveus. It has a chemical structure similar to coumarin. Novobiocin binds to DNA gyrase, and blocks adenosine triphosphatase (ATPase) activity. (From Reynolds, Martindale The Extra Pharmacopoeia, 30th ed, p189). novobiocin : A coumarin-derived antibiotic obtained from Streptomyces niveus.	8.81	90	0	carbamate ester; ether; hexoside; hydroxycoumarin; monocarboxylic acid amide; monosaccharide derivative; phenols	antibacterial agent; antimicrobial agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; Escherichia coli metabolite; hepatoprotective agent
tetracycline Tetracycline: A naphthacene antibiotic that inhibits AMINO ACYL TRNA binding during protein synthesis.. tetracycline : A broad-spectrum polyketide antibiotic produced by the Streptomyces genus of actinobacteria.	21.47	588	11
chlortetracycline Chlortetracycline: A TETRACYCLINE with a 7-chloro substitution.. chlortetracycline : A member of the class of tetracyclines with formula C22H23ClN2O8 isolated from Streptomyces aureofaciens.	7.86	148	0
oxytetracycline, anhydrous Oxytetracycline: A TETRACYCLINE analog isolated from the actinomycete STREPTOMYCES RIMOSUS and used in a wide variety of clinical conditions.. oxytetracycline : A tetracycline used for treatment of infections caused by a variety of Gram positive and Gram negative microorganisms including Mycoplasma pneumoniae, Pasteurella pestis, Escherichia coli, Haemophilus influenzae (respiratory infections), and Diplococcus pneumoniae.	12.35	240	8
minocycline Minocycline: A TETRACYCLINE analog, having a 7-dimethylamino and lacking the 5 methyl and hydroxyl groups, which is effective against tetracycline-resistant STAPHYLOCOCCUS infections.. minocycline : A tetracycline analogue having a dimethylamino group at position 7 and lacking the methyl and hydroxy groups at position 5.	3.88	12	0
methacycline Methacycline: A broad-spectrum semisynthetic antibiotic related to TETRACYCLINE but excreted more slowly and maintaining effective blood levels for a more extended period.. methacycline : A tetracycline that is the 6-methylene analogue of oxytetracycline, obtained by formal dehydration at position 6.	3.06	5	0
salicylates Salicylates: The salts or esters of salicylic acids, or salicylate esters of an organic acid. Some of these have analgesic, antipyretic, and anti-inflammatory activities by inhibiting prostaglandin synthesis.. hydroxybenzoate : Any benzoate derivative carrying a single carboxylate group and at least one hydroxy substituent.. salicylates : Any salt or ester arising from reaction of the carboxy group of salicylic acid, or any ester resulting from the condensation of the phenolic hydroxy group of salicylic acid with an organic acid.. salicylate : A monohydroxybenzoate that is the conjugate base of salicylic acid.	7.08	15	2	monohydroxybenzoate	plant metabolite
dicumarol Dicumarol: An oral anticoagulant that interferes with the metabolism of vitamin K. It is also used in biochemical experiments as an inhibitor of reductases.	2.05	1	0	hydroxycoumarin	anticoagulant; EC 1.6.5.2 [NAD(P)H dehydrogenase (quinone)] inhibitor; Hsp90 inhibitor; vitamin K antagonist
piroxicam [no description available]	2.75	3	0	benzothiazine; monocarboxylic acid amide; pyridines	analgesic; antirheumatic drug; cyclooxygenase 1 inhibitor; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-steroidal anti-inflammatory drug
acenocoumarol Acenocoumarol: A coumarin that is used as an anticoagulant. Its actions and uses are similar to those of WARFARIN. (From Martindale, The Extra Pharmacopoeia, 30th ed, p233). acenocoumarol : A hydroxycoumarin that is warfarin in which the hydrogen at position 4 of the phenyl substituent is replaced by a nitro group.	2.05	1	0	C-nitro compound; hydroxycoumarin; methyl ketone	anticoagulant; EC 1.6.5.2 [NAD(P)H dehydrogenase (quinone)] inhibitor
meclocycline [no description available]	2.21	1	0
mobic Meloxicam: A benzothiazine and thiazole derivative that acts as a NSAID and cyclooxygenase-2 (COX-2) inhibitor. It is used in the treatment of RHEUMATOID ARTHRITIS; OSTEOARTHRITIS; and ANKYLOSING SPONDYLITIS.. meloxicam : A benzothiazine that is piroxicam in which the pyridin-2-yl group is replaced by a 5-methyl-1,3-thiazol-2-yl group. A non-steroidal anti-inflammatory drug and selective inhibitor of COX-2, it is used particularly for the management of rheumatoid arthritis.	2.78	3	0	1,3-thiazoles; benzothiazine; monocarboxylic acid amide	analgesic; antirheumatic drug; cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug
mobiflex tenoxicam : A thienothiazine-derived monocarboxylic acid amide obtained by formal condensation of the carboxy group of 4-hydroxy-2-methylthieno[2,3-e][1,2]thiazine-3-carboxylic acid 1,1-dioxide with the amino group of 2-aminopyridine. Used for the treatment of pain and inflammation in osteoarthritis and rheumatoid arthritis. It is also indicated for short term treatment of acute musculoskeletal disorders including strains, sprains and other soft-tissue injuries.	2.75	3	0	heteroaryl hydroxy compound; monocarboxylic acid amide; pyridines; thienothiazine	antipyretic; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug
isoxicam isoxicam : A monocarboxylic acid amide that is piroxicam in which the pyrid-2-yl group is replaced by a 5-methyl-1,2-oxazol-3-yl group. A non-steroidal anti-inflammatory drug, it was withdrawn from the market in the 1980s following its association with cases of Stevens-Johnson syndrome.	2.05	1	0	benzothiazine; isoxazoles; monocarboxylic acid amide	antirheumatic drug; non-steroidal anti-inflammatory drug
warfarin Warfarin: An anticoagulant that acts by inhibiting the synthesis of vitamin K-dependent coagulation factors. Warfarin is indicated for the prophylaxis and/or treatment of venous thrombosis and its extension, pulmonary embolism, and atrial fibrillation with embolization. It is also used as an adjunct in the prophylaxis of systemic embolism after myocardial infarction. Warfarin is also used as a rodenticide.. warfarin : A racemate comprising equal amounts of (R)- and (S)-warfarin. Extensively used as both an anticoagulant drug and as a pesticide against rats and mice.. 4-hydroxy-3-(3-oxo-1-phenylbutyl)-1-benzopyran-2-one : A member of the class of coumarins that is 4-hydroxycoumarin which is substituted at position 3 by a 1-phenyl-3-oxo-1-butyl group.	3.84	12	0	benzenes; hydroxycoumarin; methyl ketone
bephenium hydroxynaphthoate bephenium hydroxynaphthoate: structure	2.04	1	0
metastat tetracycline CMT-3: a non-antimicrobial tetracycline; structure in second source	2.21	1	0
demeclocycline Demeclocycline: A TETRACYCLINE analog having a 7-chloro and a 6-methyl. Because it is excreted more slowly than tetracycline, it maintains effective blood levels for longer periods of time.. demeclocycline : Tetracycline which lacks the methyl substituent at position 7 and in which the hydrogen para- to the phenolic hydroxy group is substituted by chlorine. Like tetracycline, it is an antibiotic, but being excreted more slowly, effective blood levels are maintained for longer. It is used (mainly as the hydrochloride) for the treatment of Lyme disease, acne and bronchitis, as well as for hyponatraemia (low blood sodium concentration) due to the syndrome of inappropriate antidiuretic hormone (SIADH) where fluid restriction alone has been ineffective.	7.43	15	3
phenprocoumon Phenprocoumon: Coumarin derivative that acts as a long acting oral anticoagulant.. phenprocoumon : A hydroxycoumarin that is 4-hydroxycoumarin which is substituted at position 3 by a 1-phenylpropyl group.	2.45	2	0	hydroxycoumarin	anticoagulant; EC 1.6.5.2 [NAD(P)H dehydrogenase (quinone)] inhibitor
tipranavir tipranavir: inhibits HIV-1 protease. tipranavir : A pyridine-2-sulfonamide substituted at C-5 by a trifluoromethyl group and at the sulfonamide nitrogen by a dihydropyrone-containing m-tolyl substituent. It is an HIV-1 protease inhibitor.	2.06	1	0	sulfonamide	antiviral drug; HIV protease inhibitor
tasquinimod tasquinimod: a lead second generation quinoline-3-carboxamide anti-angiogenic agent for the treatment of prostate cancer; structure in first source	3.41	1	0
rolitetracycline Rolitetracycline: A pyrrolidinylmethyl TETRACYCLINE.. rolitetracycline : A derivative of tetracycline in which the amide function is substituted with a pyrrolidinomethyl group.	4.15	5	0
sudoxicam sudoxicam: proposed ant-inflammatory agent; minor descriptor (75-86); on-line & INDEX MEDICUS search THIAZINES (75-86)	2.05	1	0
methacycline monohydrochloride [no description available]	2.07	1	0
ethyl biscoumacetate Ethyl Biscoumacetate: A coumarin that is used as an anticoagulant. It has actions similar to those of WARFARIN. (From Martindale, The Extra Pharmacopoeia, 30th ed, p226)	3.03	1	0	hydroxycoumarin
mysteclin f sigmamycin: RN given contains mixture of tetracycline and oleandomycin	1.96	1	0
minocycline hydrochloride [no description available]	2.07	1	0
demeclocycline hydrochloride demeclocycline hydrochloride : The hydrochloride salt of demeclocycline. A tetracycline antibiotic, it is used (mainly as the hydrochloride) for the treatment of Lyme disease, acne and bronchitis, as well as for hyponatraemia (low blood sodium concentration) due to the syndrome of inappropriate antidiuretic hormone (SIADH) where fluid restriction alone has been ineffective.	2.07	1	0
tigecycline [no description available]	2.5	2	0
lornoxicam lornoxicam : A thienothiazine-derived monocarboxylic acid amide obtained by formal condensation of the carboxy group of 6-chloro-4-hydroxy-2-methylthieno[2,3-e][1,2]thiazine-3-carboxylic acid 1,1-dioxide with the amino group of 2-aminopyridine. Used for the treatment of pain, primarily resulting from inflammatory diseases of the joints, osteoarthritis, surgery, sciatica and other inflammations.	2.46	2	0	heteroaryl hydroxy compound; monocarboxylic acid amide; organochlorine compound; pyridines; thienothiazine	antipyretic; non-narcotic analgesic; non-steroidal anti-inflammatory drug
ledermix Ledermix: contains above two cpds	3.41	1	1
tetracycline hydrochloride Actisite: tradename; fiber for periodontal use	2.46	2	0
byl719 [no description available]	4.8	1	1	proline derivative
omega-agatoxin iva omega-Agatoxin IVA: A neuropeptide toxin from the venom of the funnel web spider, Agelenopsis aperta. It inhibits CALCIUM CHANNELS, P-TYPE by altering the voltage-dependent gating so that very large depolarizations are needed for channel opening. It also inhibits CALCIUM CHANNELS, Q-TYPE.	2.91	4	0
snx 230 omega-conotoxin-MVIIC: isolated from Conus magus; amino acid sequence given in first source	2.4	2	0
epidermal growth factor Epidermal Growth Factor: A 6-kDa polypeptide growth factor initially discovered in mouse submaxillary glands. Human epidermal growth factor was originally isolated from urine based on its ability to inhibit gastric secretion and called urogastrone. Epidermal growth factor exerts a wide variety of biological effects including the promotion of proliferation and differentiation of mesenchymal and EPITHELIAL CELLS. It is synthesized as a transmembrane protein which can be cleaved to release a soluble active form.	3.7	10	0
kaolinite Kaolin: The most common mineral of a group of hydrated aluminum silicates, approximately H2Al2Si2O8-H2O. It is prepared for pharmaceutical and medicinal purposes by levigating with water to remove sand, etc. (From Merck Index, 11th ed) The name is derived from Kao-ling (Chinese: high ridge), the original site. (From Grant & Hackh's Chemical Dictionary, 5th ed). kaolin : An aluminosilicate soft white mineral named after the hill in China (Kao-ling) from which it was mined for centuries. In its natural state kaolin is a white, soft powder consisting principally of the mineral kaolinite, and varying amounts of other minerals such as muscovite, quartz, feldspar, and anatase. It is used in the manufacture of china and porcelain and also widely used in the production of paper, rubber, paint, drying agents, and many other products.	5.39	8	2	aluminosilicate mineral; mixture	antidiarrhoeal drug; excipient
nebacetin Nebacetin: contains bacitracin and neomycin	5.61	77	0
transforming growth factor beta Transforming Growth Factor beta: A factor synthesized in a wide variety of tissues. It acts synergistically with TGF-alpha in inducing phenotypic transformation and can also act as a negative autocrine growth factor. TGF-beta has a potential role in embryonal development, cellular differentiation, hormone secretion, and immune function. TGF-beta is found mostly as homodimer forms of separate gene products TGF-beta1, TGF-beta2 or TGF-beta3. Heterodimers composed of TGF-beta1 and 2 (TGF-beta1.2) or of TGF-beta2 and 3 (TGF-beta2.3) have been isolated. The TGF-beta proteins are synthesized as precursor proteins.	2.92	4	0
okadaic acid Okadaic Acid: A specific inhibitor of phosphoserine/threonine protein phosphatase 1 and 2a. It is also a potent tumor promoter. It is produced by DINOFLAGELLATES and causes diarrhetic SHELLFISH POISONING.. okadaic acid : A polycyclic ether that is produced by several species of dinoflagellates, and is known to accumulate in both marine sponges and shellfish. A polyketide, polyether derivative of a C38 fatty acid, it is one of the primary causes of diarrhetic shellfish poisoning (DSP). It is a potent inhibitor of specific protein phosphatases and is known to have a variety of negative effects on cells.	1.99	1	0	ketal
phosphatidylethanol phosphatidylethanol: formed in rat brain by phospholipase D. phosphatidylethanol : A glycerophospholipid that is the monoethyl ester of any phosphatidic acid.	3.08	5	0
pyrethrins [no description available]	2.68	3	0
ajmaline [no description available]	2.05	1	0
trp-lys-tyr-met-val-met Trp-Lys-Tyr-Met-Val-Met: a synthetic peptide, stimulates phosphoinositide hyrolysis in human leukocytes	2	1	0
maitotoxin [no description available]	1.97	1	0
necrox-5 NecroX-5: prevents hypoxia/reoxygenation injury by inhibiting the mitochondrial calcium uniporter; structure in first source	2.1	1	0
agar Agar: A complex sulfated polymer of galactose units, extracted from Gelidium cartilagineum, Gracilaria confervoides, and related red algae. It is used as a gel in the preparation of solid culture media for microorganisms, as a bulk laxative, in making emulsions, and as a supporting medium for immunodiffusion and immunoelectrophoresis.. agar : A complex mixture of polysaccharides extracted from species of red algae. Its two main components are agarose and agaropectin. Agarose is the component responsible for the high-strength gelling properties of agar, while agaropectin provides the viscous properties.	5.06	44	0
phleomycin d1 phleomycin D1 : A glycopeptide originally isolated from the bacterium Streptomyces verticillus which contains a (4'R)-4',5'-dihydro-2,4'-bi-1,3-thiazole-2',4-diyl moiety with a a 4-guanidylbutylaminocarbonyl group attached to the 4-position of the terminal thiazole ring. Like all phleomycins, phleomycin D1 can form complexes with redox-active metals such as Co, Cu, and Fe.	2.76	3	0	bi-1,3-thiazole; chelate-forming peptide; disaccharide derivative; glycopeptide; guanidines	antibacterial agent; antifungal agent; antimicrobial agent; antineoplastic agent; bacterial metabolite
cbb1007 CBB1007: inhibits lysine-specific demethylase 1	2.11	1	0
fortimicin a sulfate fortimicin A: RN given refers to parent cpd; Abbott-44747 is for disulfate; see also records for fortimicin B & fortimicins; structure in 8th source	1.95	1	0	aminoglycoside sulfate salt
hirudin Hirudin: A 65-residue polypeptide from LEECHES.	1.97	1	0
glutaminase [no description available]	1.98	1	0
cyclin d1 Cyclin D1: Protein encoded by the bcl-1 gene which plays a critical role in regulating the cell cycle. Overexpression of cyclin D1 is the result of bcl-1 rearrangement, a t(11;14) translocation, and is implicated in various neoplasms.	2.7	3	0
caseins Caseins: A mixture of related phosphoproteins occurring in milk and cheese. The group is characterized as one of the most nutritive milk proteins, containing all of the common amino acids and rich in the essential ones.	3.67	10	0
blasticidin a blasticidin A: an inhibitor of aflatoxin production by Aspergillus parasiticus; structure in first source	2.54	2	0
drocinonide phosphate potassium [no description available]	1.95	1	0
oligomycins Oligomycins: A closely related group of toxic substances elaborated by various strains of Streptomyces. They are 26-membered macrolides with lactone moieties and double bonds and inhibit various ATPases, causing uncoupling of phosphorylation from mitochondrial respiration. Used as tools in cytochemistry. Some specific oligomycins are RUTAMYCIN, peliomycin, and botrycidin (formerly venturicidin X).	4.43	7	0
benzyloxycarbonylvalyl-alanyl-aspartyl fluoromethyl ketone benzyloxycarbonylvalyl-alanyl-aspartyl fluoromethyl ketone: an interleukin-1beta converting enzyme (ICE)-like protease inhibitor	2.7	3	0
bassianolide bassianolide: cyclodepsipeptide from mycelia of Beauveria bassiana; inhibits isotonic contractions induced by acetylcholine. bassianolide : A cyclodepsipeptide consisting of a cyclic tetramer of the depsipeptide D-Hiv-N-methyl-L-leucine (where D-Hiv = D-alpha-hydroxyisovaleric acid). Found in the fungal species Beauveria bassiana and Verticillium lecanii, it has insecticidal properties and is used as a commercial biopesticide to control of insects of agricultural, veterinary and medical significance. For elucidation of the structure, see Suzuki et al., Tetrahedron Lett. 1977 v25, 2167-2170.	2.57	2	0	cyclodepsipeptide; cyclooctadepsipeptide	antineoplastic agent; fungal metabolite; insecticide
lewis x antigen Lewis X Antigen: A trisaccharide antigen expressed on glycolipids and many cell-surface glycoproteins. In the blood the antigen is found on the surface of NEUTROPHILS; EOSINOPHILS; and MONOCYTES. In addition, Lewis X antigen is a stage-specific embryonic antigen.	3.09	1	0
calpastatin calpastatin: large mol wt, heat-stable calpain inhibitor; not based on sequestering Ca++ from medium, but binding to calpain does require Ca++. calpastatin peptide Ac 184-210 : A 27-membered polypeptide comprising the sequence Ac-Asp-Pro-Met-Ser-Ser-Thr-Tyr-Ile-Glu-Glu-Leu-Gly-Lys-Arg-Glu-Val-Thr-Ile-Pro-Pro-Lys-Tyr-Arg-Glu-Leu-Leu-Ala-NH2. An acetylated synthetic peptide from human calpastatin that strongly inhibits both calpains I and II but not papain (a cysteine protease) or trypsin (a serine protease).	1.98	1	0	polypeptide	EC 3.4.22.52 (calpain-1) inhibitor; EC 3.4.22.53 (calpain-2) inhibitor
angiotensin i Angiotensin I: A decapeptide that is cleaved from precursor angiotensinogen by RENIN. Angiotensin I has limited biological activity. It is converted to angiotensin II, a potent vasoconstrictor, after the removal of two amino acids at the C-terminal by ANGIOTENSIN CONVERTING ENZYME.. angiotensin I : A ten amino acid peptide formed by renin cleavage of angiotensinogen. Angiotensin I has no direct biological function except that high levels can stimulate catecholamine production. It is metabolized to its biologically active byproduct angiotensin II, a potent vasoconstrictor, by angiotensin converting enzyme (ACE) through cleavage of the two terminal amino acids.. angiotensin I dizwitterion : A peptide zwitterion that is the dizwitterionic form of angiotensin I having both carboxy groups deprotonated and the aspartyl amino group and arginine side-chain protonated. It is the major species at pH 7.3.	2.41	2	0	angiotensin; peptide zwitterion	human metabolite; neurotransmitter agent
carbamix carbamix: used in patch testing; mixture of zinc diethyl- and zinc dibutyldithiocarbamates and diphenylguanidine	1.99	1	0
hyaluronoglucosaminidase Hyaluronoglucosaminidase: An enzyme that catalyzes the random hydrolysis of 1,4-linkages between N-acetyl-beta-D-glucosamine and D-glucuronate residues in hyaluronate. (From Enzyme Nomenclature, 1992) There has been use as ANTINEOPLASTIC AGENTS to limit NEOPLASM METASTASIS.	3.56	9	0
alpha-cobratoxin alpha-cobratoxin: fron Naja nigricollis	1.96	1	0
lipofectamine Lipofectamine: mediates gene transfer; a polycationic lipid reagent	2.42	2	0
daptomycin [no description available]	2.47	2	0
peoniflorin peoniflorin: from Radix and of Paeonia suffruticosa	2.17	1	0
vitamin b 12 Vitamin B 12: A cobalt-containing coordination compound produced by intestinal micro-organisms and found also in soil and water. Higher plants do not concentrate vitamin B 12 from the soil and so are a poor source of the substance as compared with animal tissues. INTRINSIC FACTOR is important for the assimilation of vitamin B 12.	7.84	25	1
butirosin sulfate Butirosin Sulfate: A water-soluble aminoglycosidic antibiotic complex isolated from fermentation filtrates of Bacillus circulans. Two components (A and B) have been separated from the complex. Both are active against many gram-positive and some gram-negative bacteria.	5.71	16	0
1-nitropyrene-4,5-oxide 1-nitropyrene-4,5-oxide: microsomal meabolite of 1-nitropyrene	1.98	1	0
transforming growth factor alpha Transforming Growth Factor alpha: An EPIDERMAL GROWTH FACTOR related protein that is found in a variety of tissues including EPITHELIUM, and maternal DECIDUA. It is synthesized as a transmembrane protein which can be cleaved to release a soluble active form which binds to the EGF RECEPTOR.	3.1	5	0
moxidectin moxidectin: family of macrolide antibiotics with insecticidal & acaricidal activity	1.99	1	0
pimafucort pimafucort: combination of pimaricin 10 mg, neomycin sulfate 5 mg & hydrocortisone 10 mg	5.72	6	1
validamycins validamycins: RN given refers to cpd with unknown MF; structure given in Merck Index, 9th ed, #9570 has been revised in fifth source; structure in fifth source; see also record for validamycin A. validamycins : Any of the inositol-derived beta-D-glucoside antibiotics produced by Streptomyces hygroscopicus.	1.95	1	0
cyclosporine Cyclosporine: A cyclic undecapeptide from an extract of soil fungi. It is a powerful immunosupressant with a specific action on T-lymphocytes. It is used for the prophylaxis of graft rejection in organ and tissue transplantation. (From Martindale, The Extra Pharmacopoeia, 30th ed).	2.68	3	0
blasticidin s blasticidin S: RN given refers to (S)-isomer; structure. blasticidin S : A blasticidin that is an antibiotic obtained from Streptomyces griseochromogene.	2.45	2	0
flavin mononucleotide Flavin Mononucleotide: A coenzyme for a number of oxidative enzymes including NADH DEHYDROGENASE. It is the principal form in which RIBOFLAVIN is found in cells and tissues.	2	1	0
cytochalasin d Cytochalasin D: A fungal metabolite that blocks cytoplasmic cleavage by blocking formation of contractile microfilament structures resulting in multinucleated cell formation, reversible inhibition of cell movement, and the induction of cellular extrusion. Additional reported effects include the inhibition of actin polymerization, DNA synthesis, sperm motility, glucose transport, thyroid secretion, and growth hormone release.. cytochalasin D : An organic heterotricyclic compound that is a mycotoxin produced by Helminthosporium and other moulds which is cell permeable and a potent inhibitor of actin polymerisation and DNA synthesis.	2.69	3	0
antipain Antipain: An oligopeptide produced by various bacteria which acts as a protease inhibitor.	1.97	1	0
lactoferrin Lactoferrin: An iron-binding protein that was originally characterized as a milk protein. It is widely distributed in secretory fluids and is found in the neutrophilic granules of LEUKOCYTES. The N-terminal part of lactoferrin possesses a serine protease which functions to inactivate the TYPE III SECRETION SYSTEM used by bacteria to export virulence proteins for host cell invasion.	2.75	3	0
digitonin Digitonin: A glycoside obtained from Digitalis purpurea; the aglycone is digitogenin which is bound to five sugars. Digitonin solubilizes lipids, especially in membranes and is used as a tool in cellular biochemistry, and reagent for precipitating cholesterol. It has no cardiac effects.. digitonin : A spirostanyl glycoside that is digitogenin in which the 3-hydroxy group is substituted by a beta-D-glucopyranosyl-(1->3)-beta-D-galactopyranosyl-(1->2)-[beta-D-xylopyranosyl-(1->3)]-beta-D-glucopyranosyl-(1->4)-beta-D-galactopyranosyl group. It is a steroidal saponin isolated from the foxglove plant, Digitalis purpurea. It is used extensively as a mild non-ionic detergent for extracting proteins from membranes for structure and function studies.	2.89	4	0
sparsomycin Sparsomycin: An antitumor antibiotic produced by Streptomyces sparsogenes. It inhibits protein synthesis in 70S and 80S ribosomal systems.	1.99	1	0
orabase Orabase: used in therapy of oral mucosal ulcers	2.42	2	0
tixocortol tixocortol: 21-thiol derivative of hydrocortisone. tixocortol : A steroid sulfide in which the sulfanyl group is at C-21 of a polyoxygenated derivative of pregn-4-ene.	2.1	1	0
apyrase Apyrase: A calcium-activated enzyme that catalyzes the hydrolysis of ATP to yield AMP and orthophosphate. It can also act on ADP and other nucleoside triphosphates and diphosphates. EC 3.6.1.5.	2	1	0
muramidase Muramidase: A basic enzyme that is present in saliva, tears, egg white, and many animal fluids. It functions as an antibacterial agent. The enzyme catalyzes the hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrin. EC 3.2.1.17.	4.09	16	0
ribosomal protein l7-l12 [no description available]	2.21	1	0
chondroitin sulfates Chondroitin Sulfates: Derivatives of chondroitin which have a sulfate moiety esterified to the galactosamine moiety of chondroitin. Chondroitin sulfate A, or chondroitin 4-sulfate, and chondroitin sulfate C, or chondroitin 6-sulfate, have the sulfate esterified in the 4- and 6-positions, respectively. Chondroitin sulfate B (beta heparin; DERMATAN SULFATE) is a misnomer and this compound is not a true chondroitin sulfate.	2.03	1	0
angiogenin angiogenin: human tumor protein which stimulates growth of blood vessels; contains 123 amino acids; member of the pancreatic ribonuclease superfamily; MW 14,400	6	13	0
entecavir entecavir (anhydrous) : Guanine substituted at the 9 position by a 4-hydroxy-3-(hydroxymethyl)-2-methylidenecyclopentyl group. A synthetic analogue of 2'-deoxyguanosine, it is a nucleoside reverse transcriptase inhibitor with selective antiviral activity against hepatitis B virus. Entecavir is phosphorylated intracellularly to the active triphosphate form, which competes with deoxyguanosine triphosphate, the natural substrate of hepatitis B virus reverse transcriptase, inhibiting every stage of the enzyme's activity, although it has no activity against HIV. It is used for the treatment of chronic hepatitis B.	2.05	1	0	2-aminopurines; oxopurine; primary alcohol; secondary alcohol	antiviral drug; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor
acyclovir Acyclovir: A GUANOSINE analog that acts as an antimetabolite. Viruses are especially susceptible. Used especially against herpes.. acyclovir : An oxopurine that is guanine substituted by a (2-hydroxyethoxy)methyl substituent at position 9. Used in the treatment of viral infections.	3.14	5	0	2-aminopurines; oxopurine	antimetabolite; antiviral drug
levoleucovorin Levoleucovorin: A folate analog consisting of the pharmacologically active isomer of LEUCOVORIN.. (6S)-5-formyltetrahydrofolic acid : The pharmacologically active (6S)-stereoisomer of 5-formyltetrahydrofolic acid.	2.42	2	0	5-formyltetrahydrofolic acid	antineoplastic agent; metabolite
cyclic gmp Cyclic GMP: Guanosine cyclic 3',5'-(hydrogen phosphate). A guanine nucleotide containing one phosphate group which is esterified to the sugar moiety in both the 3'- and 5'-positions. It is a cellular regulatory agent and has been described as a second messenger. Its levels increase in response to a variety of hormones, including acetylcholine, insulin, and oxytocin and it has been found to activate specific protein kinases. (From Merck Index, 11th ed). 3',5'-cyclic GMP : A 3',5'-cyclic purine nucleotide in which the purine nucleobase is specified as guanidine.	3.59	9	0	3',5'-cyclic purine nucleotide; guanyl ribonucleotide	Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite
guanosine diphosphate Guanosine Diphosphate: A guanine nucleotide containing two phosphate groups esterified to the sugar moiety.	3.92	13	0	guanosine 5'-phosphate; purine ribonucleoside 5'-diphosphate	Escherichia coli metabolite; mouse metabolite; uncoupling protein inhibitor
guanosine triphosphate Guanosine Triphosphate: Guanosine 5'-(tetrahydrogen triphosphate). A guanine nucleotide containing three phosphate groups esterified to the sugar moiety.	4.61	27	0	guanosine 5'-phosphate; purine ribonucleoside 5'-triphosphate	Escherichia coli metabolite; mouse metabolite; uncoupling protein inhibitor
guanine [no description available]	3.09	5	0	2-aminopurines; oxopurine; purine nucleobase	algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
guanosine ribonucleoside : Any nucleoside where the sugar component is D-ribose.	3.25	6	0	guanosines; purines D-ribonucleoside	fundamental metabolite
hypoxanthine [no description available]	1.97	1	0	nucleobase analogue; oxopurine; purine nucleobase	fundamental metabolite
inosine [no description available]	2.67	3	0	inosines; purines D-ribonucleoside	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
inosine triphosphate Inosine Triphosphate: Inosine 5'-(tetrahydrogen triphosphate). An inosine nucleotide containing three phosphate groups esterified to the sugar moiety. Synonym: IRPPP.	2.38	2	0	inosine phosphate; purine ribonucleoside 5'-triphosphate	Escherichia coli metabolite; human metabolite; mouse metabolite
inosine diphosphate Inosine Diphosphate: An inosine nucleotide containing a pyrophosphate group esterified to C5 of the sugar moiety.	1.97	1	0	inosine phosphate; purine ribonucleoside 5'-diphosphate	fundamental metabolite
folic acid folcysteine: used to promote fertility in chickens. vitamin B9 : Any B-vitamin that exhibits biological activity against vitamin B9 deficiency. Vitamin B9 refers to the many forms of folic acid and its derivatives, including tetrahydrofolic acid (the active form), methyltetrahydrofolate (the primary form found in blood), methenyltetrahydrofolate, folinic acid amongst others. They are present in abundance in green leafy vegetables, citrus fruits, and animal products. Lack of vitamin B9 leads to anemia, a condition in which the body cannot produce sufficient number of red blood cells. Symptoms of vitamin B9 deficiency include fatigue, muscle weakness, and pale skin.	5.25	17	0	folic acids; N-acyl-amino acid	human metabolite; mouse metabolite; nutrient
3-methyladenine N3-methyladenine: structure in first source	2.15	1	0
viomycin [no description available]	11.44	59	0	heterodetic cyclic peptide; peptide antibiotic	antitubercular agent
guanosine 5'-o-(3-thiotriphosphate) Guanosine 5'-O-(3-Thiotriphosphate): Guanosine 5'-(trihydrogen diphosphate), monoanhydride with phosphorothioic acid. A stable GTP analog which enjoys a variety of physiological actions such as stimulation of guanine nucleotide-binding proteins, phosphoinositide hydrolysis, cyclic AMP accumulation, and activation of specific proto-oncogenes.	4.5	24	0	nucleoside triphosphate analogue
rifampin Rifampin: A semisynthetic antibiotic produced from Streptomyces mediterranei. It has a broad antibacterial spectrum, including activity against several forms of Mycobacterium. In susceptible organisms it inhibits DNA-dependent RNA polymerase activity by forming a stable complex with the enzyme. It thus suppresses the initiation of RNA synthesis. Rifampin is bactericidal, and acts on both intracellular and extracellular organisms. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p1160)	7.53	47	0	cyclic ketal; hydrazone; N-iminopiperazine; N-methylpiperazine; rifamycins; semisynthetic derivative; zwitterion	angiogenesis inhibitor; antiamoebic agent; antineoplastic agent; antitubercular agent; DNA synthesis inhibitor; EC 2.7.7.6 (RNA polymerase) inhibitor; Escherichia coli metabolite; geroprotector; leprostatic drug; neuroprotective agent; pregnane X receptor agonist; protein synthesis inhibitor
clozapine Clozapine: A tricylic dibenzodiazepine, classified as an atypical antipsychotic agent. It binds several types of central nervous system receptors, and displays a unique pharmacological profile. Clozapine is a serotonin antagonist, with strong binding to 5-HT 2A/2C receptor subtype. It also displays strong affinity to several dopaminergic receptors, but shows only weak antagonism at the dopamine D2 receptor, a receptor commonly thought to modulate neuroleptic activity. Agranulocytosis is a major adverse effect associated with administration of this agent.. clozapine : A benzodiazepine that is 5H-dibenzo[b,e][1,4]diazepine substituted by a chloro group at position 8 and a 4-methylpiperazin-1-yl group at position 11. It is a second generation antipsychotic used in the treatment of psychiatric disorders like schizophrenia.	3.15	5	0	benzodiazepine; N-arylpiperazine; N-methylpiperazine; organochlorine compound	adrenergic antagonist; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; environmental contaminant; GABA antagonist; histamine antagonist; muscarinic antagonist; second generation antipsychotic; serotonergic antagonist; xenobiotic
dacarbazine (E)-dacarbazine : A dacarbazine in which the N=N double bond adopts a trans-configuration.	2.74	3	0	dacarbazine
didanosine Didanosine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by a hydrogen. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. Didanosine is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA by binding to reverse transcriptase; ddI is then metabolized to dideoxyadenosine triphosphate, its putative active metabolite.. didanosine : A purine 2',3'-dideoxyribonucleoside that is inosine in which the hydroxy groups at both the 2' and the 3' positions on the sugar moiety have been replaced by hydrogen. An antiviral drug, it is used as a medication to treat HIV/AIDS.	2.46	2	0	purine 2',3'-dideoxyribonucleoside	antimetabolite; antiviral drug; EC 2.4.2.1 (purine-nucleoside phosphorylase) inhibitor; geroprotector; HIV-1 reverse transcriptase inhibitor
ganciclovir [no description available]	3.54	8	0	2-aminopurines; oxopurine	antiinfective agent; antiviral drug
sildenafil sildenafil : A pyrazolo[4,3-d]pyrimidin-7-one having a methyl substituent at the 1-position, a propyl substituent at the 3-position and a 2-ethoxy-5-[(4-methylpiperazin-1-yl)sulfonyl]phenyl group at the 5-position.	2.05	1	0	piperazines; pyrazolopyrimidine; sulfonamide	EC 3.1.4.35 (3',5'-cyclic-GMP phosphodiesterase) inhibitor; vasodilator agent
olanzapine Olanzapine: A benzodiazepine derivative that binds SEROTONIN RECEPTORS; MUSCARINIC RECEPTORS; HISTAMINE H1 RECEPTORS; ADRENERGIC ALPHA-1 RECEPTORS; and DOPAMINE RECEPTORS. It is an antipsychotic agent used in the treatment of SCHIZOPHRENIA; BIPOLAR DISORDER; and MAJOR DEPRESSIVE DISORDER; it may also reduce nausea and vomiting in patients undergoing chemotherapy.. olanzapine : A benzodiazepine that is 10H-thieno[2,3-b][1,5]benzodiazepine substituted by a methyl group at position 2 and a 4-methylpiperazin-1-yl group at position 4.	2.75	3	0	benzodiazepine; N-arylpiperazine; N-methylpiperazine	antiemetic; dopaminergic antagonist; histamine antagonist; muscarinic antagonist; second generation antipsychotic; serotonergic antagonist; serotonin uptake inhibitor
penciclovir penciclovir : A member of the class of 2-aminopurines that is guanine in which the hydrogen at position 9 is substituted by a 4-hydroxy-3-(hydroxymethyl)but-1-yl group. An antiviral drug, it is administered topically for treatment of herpes labialis. A prodrug, famciclovir, is used for oral administration.	2.05	1	0	2-aminopurines; propane-1,3-diols	antiviral drug
oxypurinol Oxypurinol: A xanthine oxidase inhibitor.. alloxanthine : A pyrazolopyrimidine that is 4,5,6,7-tetrahydro-H-pyrazolo[3,4-d]pyrimidine substituted by oxo groups at positions 4 and 6.	2.05	1	0	pyrazolopyrimidine	drug metabolite; EC 1.17.3.2 (xanthine oxidase) inhibitor
raltitrexed [no description available]	2.05	1	0	N-acyl-amino acid
allopurinol Allopurinol: A XANTHINE OXIDASE inhibitor that decreases URIC ACID production. It also acts as an antimetabolite on some simpler organisms.. allopurinol : A bicyclic structure comprising a pyrazole ring fused to a hydroxy-substituted pyrimidine ring.	2.74	3	0	nucleobase analogue; organic heterobicyclic compound	antimetabolite; EC 1.17.3.2 (xanthine oxidase) inhibitor; gout suppressant; radical scavenger
azaguanine Azaguanine: One of the early purine analogs showing antineoplastic activity. It functions as an antimetabolite and is easily incorporated into ribonucleic acids.. 8-azaguanine : A triazolopyrimidine that consists of 3,6-dihydro-7H-[1,2,3]triazolo[4,5-d]pyrimidine bearing amino and oxo substituents at positions 5 and 7 respectively.	3.56	3	0	nucleobase analogue; triazolopyrimidines	antimetabolite; antineoplastic agent; EC 2.4.2.1 (purine-nucleoside phosphorylase) inhibitor
leucovorin 5-formyltetrahydrofolic acid : A formyltetrahydrofolic acid in which the formyl group is located at position 5.	2.05	1	0	formyltetrahydrofolic acid	Escherichia coli metabolite; mouse metabolite
guanylyl imidodiphosphate Guanylyl Imidodiphosphate: A non-hydrolyzable analog of GTP, in which the oxygen atom bridging the beta to the gamma phosphate is replaced by a nitrogen atom. It binds tightly to G-protein in the presence of Mg2+. The nucleotide is a potent stimulator of ADENYLYL CYCLASES.. guanosine 5'-[beta,gamma-imido]triphosphate : A nucleoside triphosphate analogue that is GTP in which the oxygen atom bridging the beta- to the gamma- phosphate is replaced by a nitrogen atom A non-hydrolyzable analog of GTP, it binds tightly to G-protein in the presence of Mg(2+).	3.37	7	0	nucleoside triphosphate analogue
alanosine [no description available]	2.05	1	0
bl 4162a anagrelide: imidazoquinazoline derivative which lowers platelet count probably by inhibiting thrombopoiesis and reduces platelet aggregation; used for thrombocythemia; structure in first source. anagrelide : A 1,5-dihydroimidazo[2,1-]quinazoline having an oxo substituent at the 2-position and chloro substituents at the 6- and 7-positions.	2.06	1	0	imidazoquinazoline	anticoagulant; antifibrinolytic drug; cardiovascular drug; platelet aggregation inhibitor
guanosine 5'-o-(2-thiodiphosphate) [no description available]	3.48	8	0	nucleoside diphosphate analogue
tirapazamine Tirapazamine: A triazine derivative that introduces breaks into DNA strands in hypoxic cells, sensitizing tumor cells to the cytotoxic activity of other drugs and radiation.. tirapazamine : A member of the class of benzotriazines that is 1,2,4-benzotriazine carrying an amino substituent at position 3 and two oxido substituents at positions 1 and 4.	2.05	1	0	aromatic amine; benzotriazines; N-oxide	antibacterial agent; antineoplastic agent; apoptosis inducer
vicine vicine: pyrimidine glycoside found in fava bean; structure	1.98	1	0	glycoside
rifabutin [no description available]	2.46	2	0
8-bromocyclic gmp 8-bromo-3',5'-cyclic GMP : A 3',5'-cyclic purine nucleotide that is 3',5'-cyclic GMP bearing an additional bromo substituent at position 8 on the guanine ring. A membrane permeable cGMP analogue that activates protein kinase G (PKG). It is 4.3-fold more potent than cGMP in activating PKG1alpha and promotes relaxation of tracheal and vascular smooth muscle tissue in vitro.	1.98	1	0	3',5'-cyclic purine nucleotide; organobromine compound	muscle relaxant; protein kinase G agonist
trypan blue Trypan Blue: A diazo-naphthalene sulfonate that is widely used as a stain.. trypan blue : An organosulfonate salt that is the tetrasodium salt of 3,3'-[(3,3'-dimethylbiphenyl-4,4'-diyl)didiazene-2,1-diyl]bis(5-amino-4-hydroxynaphthalene-2,7-disulfonic acid).	2.01	1	0
methylnitronitrosoguanidine Methylnitronitrosoguanidine: A nitrosoguanidine derivative with potent mutagenic and carcinogenic properties.. N-methyl-N'-nitro-N-nitrosoguanidine : An N-nitroguanidine compound having nitroso and methyl substituents at the N'-position	2.89	4	0	nitroso compound	alkylating agent
asoxime chloride [no description available]	1.97	1	0
arsenazo iii Arsenazo III: Metallochrome indicator that changes color when complexed to the calcium ion under physiological conditions. It is used to measure local calcium ion concentrations in vivo.	1.98	1	0
amg531 [no description available]	2.06	1	0
streptovaricin c streptovaricin C: structure given in first source	1.95	1	0
cupferron cupferron: superoxide dismutase inhibitor; RN given refers to parent cpd; structure	1.93	1	0
8-oxyguanine 8-oxyguanine: structure given in first source. 8-oxoguanine : An oxopurine that is guanine which is substituted by an oxo group at position 8.	1.98	1	0	2-aminopurines; oxopurine
carbadox Carbadox: An antibacterial agent that has been used in veterinary practice for treating swine dysentery and enteritis and for promoting growth. However, its use has been prohibited in the UK following reports of carcinogenicity and mutagenicity. (From Martindale, The Extra Pharmacopoeia, 30th ed, p125)	2.38	2	0	quinoxaline derivative
guanosine 5'-o-(1-thiotriphosphate) [no description available]	1.99	1	0
dibutyryl cyclic gmp Dibutyryl Cyclic GMP: N-(1-Oxobutyl)-cyclic 3',5'-(hydrogen phosphate)-2'-butanoate guanosine. A derivative of cyclic GMP. It has a higher resistance to extracellular and intracellular phosphodiesterase than cyclic GMP.	2.67	3	0
benzylpenicillenic acid benzylpenicillenic acid: forms spontaneously from penicillin G (benzylpenicillin). benzylpenicillenic acid : A penicillenic acid having a benzyl substituent at the 2-position on the oxazolone ring.	1.96	1	0
liproxstatin-1 liproxstatin-1: suppress ferroptosis in cells. liproxstatin-1 : An azaspiro compound that is 1'H-spiro[piperidine-4,2'-quinoxaline] in which the hydrogen at position 3' is replaced by a (3-chlorobenzyl)amino group. It is a potent inhibitor of ferroptosis.	2.25	1	0	azaspiro compound; monochlorobenzenes; organic heterotricyclic compound; secondary amino compound	antioxidant; cardioprotective agent; ferroptosis inhibitor; radical scavenger
lipoteichoic acid lipoteichoic acid: lipopolysaccharides with an acyl group anchored to the cell membrane of gram-positive bacteria; functions as an adhesion molecule to facilitate the binding of bacteria to cells, colonization, and invasion; interacts with CD14 to induce NF-κB activation and inflammatory cytokine production; can function as surface antigen; inhibits remineraliztion of artificial lesions and surface-softened enamels;. lipoteichoic acid : A teichoic acid which is covalently bound to a lipid.	2.21	1	0
cholestyramine resin Cholestyramine Resin: A strongly basic anion exchange resin whose main constituent is polystyrene trimethylbenzylammonium Cl(-) anion.	12.15	62	6
eye [no description available]	5.68	20	1
fructooligosaccharide [no description available]	2.01	1	0	oligosaccharide
acetylcellulose acetylcellulose: coating compound. cellulose acetate : A glucan derivative obtained through the esterification of cellulose by acetic anhydride or acetic acid, resulting in the substitution of some of the hydroxy groups of cellulose by acetyl groups. It is used in a variety of applications including base material for photographic film, clothing, membrane filters, coatings, food packaging, and as a frame material for eyeglasses.	2.02	1	0
concanavalin a Concanavalin A: A MANNOSE/GLUCOSE binding lectin isolated from the jack bean (Canavalia ensiformis). It is a potent mitogen used to stimulate cell proliferation in lymphocytes, primarily T-lymphocyte, cultures.	2.89	4	0
cep-11004 CEP-11004: inhibitors of the c-Jun N-terminal kinase (JNK) signaling pathway	2.03	1	0
metallothionein Metallothionein: A low-molecular-weight (approx. 10 kD) protein occurring in the cytoplasm of kidney cortex and liver. It is rich in cysteinyl residues and contains no aromatic amino acids. Metallothionein shows high affinity for bivalent heavy metals.	2.9	4	0
dinitrobenzenes Dinitrobenzenes: Benzene derivatives which are substituted with two nitro groups in the ortho, meta or para positions.	2.06	1	0
formocresol formocresol: preferred agent for performing pulpotomies in primary teeth	2.04	1	0
phosphorus radioisotopes Phosphorus Radioisotopes: Unstable isotopes of phosphorus that decay or disintegrate emitting radiation. P atoms with atomic weights 28-34 except 31 are radioactive phosphorus isotopes.	3.91	13	0
phosphatidylbutanol [no description available]	2.05	1	0
leptin Leptin: A 16-kDa peptide hormone secreted from WHITE ADIPOCYTES. Leptin serves as a feedback signal from fat cells to the CENTRAL NERVOUS SYSTEM in regulation of food intake, energy balance, and fat storage.	4.95	2	1
pkh 26 PKH 26: no further information available 8/91	1.98	1	0
pyrimidinones Pyrimidinones: Heterocyclic compounds known as 2-pyrimidones (or 2-hydroxypyrimidines) and 4-pyrimidones (or 4-hydroxypyrimidines) with the general formula C4H4N2O.	3.24	6	0
tetrafluoroaluminate tetrafluoroaluminate: induces inositol phosphate formation	1.97	1	0
aluminum magnesium silicate aluminum magnesium silicate: RN given refers to cpd with unspecified composition	1.96	1	0
filipin Filipin: A complex of polyene antibiotics obtained from Streptomyces filipinensis. Filipin III alters membrane function by interfering with membrane sterols, inhibits mitochondrial respiration, and is proposed as an antifungal agent. Filipins I, II, and IV are less important.	1.98	1	0
phenanthrenes Phenanthrenes: POLYCYCLIC AROMATIC HYDROCARBONS composed of three fused BENZENE rings.. phenanthrenes : Any benzenoid aromatic compound that consists of a phenanthrene skeleton and its substituted derivatives thereof.	2.68	3	0

Condition	Indicated	Relationship Strength	Studies	Trials
Cancer of Colon [description not available]	0	8.34	41	9
Colonic Neoplasms Tumors or cancer of the COLON.	0	8.34	41	9
Cancer of Lung [description not available]	0	7.14	19	2
Lung Neoplasms Tumors or cancer of the LUNG.	0	7.14	19	2
Bacterial Infections, Gram-Negative [description not available]	0	5.47	8	2
Gram-Negative Bacterial Infections Infections caused by bacteria that show up as pink (negative) when treated by the gram-staining method.	0	5.47	8	2
Infections, Pseudomonas [description not available]	0	9.26	74	5
Pseudomonas Infections Infections with bacteria of the genus PSEUDOMONAS.	0	9.26	74	5
Bacterial Disease [description not available]	0	14.21	126	38
Bacterial Infections Infections by bacteria, general or unspecified.	0	14.21	126	38
HIV Coinfection [description not available]	0	2.92	4	0
HIV Infections Includes the spectrum of human immunodeficiency virus infections that range from asymptomatic seropositivity, thru AIDS-related complex (ARC), to acquired immunodeficiency syndrome (AIDS).	0	2.92	4	0
Infections, Staphylococcal [description not available]	0	15.61	214	30
Swine Diseases Diseases of domestic swine and of the wild boar of the genus Sus.	0	5.07	17	0
Staphylococcal Infections Infections with bacteria of the genus STAPHYLOCOCCUS.	0	15.61	214	30
Acute Liver Injury, Drug-Induced [description not available]	0	6.57	19	1
Chemical and Drug Induced Liver Injury A spectrum of clinical liver diseases ranging from mild biochemical abnormalities to ACUTE LIVER FAILURE, caused by drugs, drug metabolites, herbal and dietary supplements and chemicals from the environment.	0	6.57	19	1
Mastitis, Bovine INFLAMMATION of the UDDER in cows.	0	7.46	48	3
Cerebral Nocardiosis [description not available]	0	4.59	6	1
Nerve Pain [description not available]	0	2.48	2	0
Neuralgia Intense or aching pain that occurs along the course or distribution of a peripheral or cranial nerve.	0	2.48	2	0
Adverse Drug Event [description not available]	0	7.2	16	1
Drug-Related Side Effects and Adverse Reactions Disorders that result from the intended use of PHARMACEUTICAL PREPARATIONS. Included in this heading are a broad variety of chemically-induced adverse conditions due to toxicity, DRUG INTERACTIONS, and metabolic effects of pharmaceuticals.	0	7.2	16	1
Leucocythaemia [description not available]	0	7.44	21	7
Leukemia A progressive, malignant disease of the blood-forming organs, characterized by distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemias were originally termed acute or chronic based on life expectancy but now are classified according to cellular maturity. Acute leukemias consist of predominately immature cells; chronic leukemias are composed of more mature cells. (From The Merck Manual, 2006)	0	7.44	21	7
Benign Neoplasms [description not available]	0	11.2	152	3
Neoplasms New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.	0	11.2	152	3
Anemia, Fanconi [description not available]	0	2.13	1	0
Fanconi Anemia Congenital disorder affecting all bone marrow elements, resulting in ANEMIA; LEUKOPENIA; and THROMBOPENIA, and associated with cardiac, renal, and limb malformations as well as dermal pigmentary changes. Spontaneous CHROMOSOME BREAKAGE is a feature of this disease along with predisposition to LEUKEMIA. There are at least 7 complementation groups in Fanconi anemia: FANCA, FANCB, FANCC, FANCD1, FANCD2, FANCE, FANCF, FANCG, and FANCL. (from Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=227650, August 20, 2004)	0	2.13	1	0
Bacterial Infections, Gram-Positive [description not available]	0	4.35	4	1
Gram-Positive Bacterial Infections Infections caused by bacteria that retain the crystal violet stain (positive) when treated by the gram-staining method.	0	4.35	4	1
Keratitis Inflammation of the cornea.	0	7.22	37	1
Suffocation [description not available]	0	3.32	2	0
Asphyxia A pathological condition caused by lack of oxygen, manifested in impending or actual cessation of life.	0	3.32	2	0
Injuries Used with anatomic headings, animals, and sports for wounds and injuries. Excludes cell damage, for which pathology is used.	0	9.56	41	2
Wounds and Injuries Damage inflicted on the body as the direct or indirect result of an external force, with or without disruption of structural continuity.	0	9.56	41	2
Extravascular Hemolysis [description not available]	0	3.67	10	0
Hemolysis The destruction of ERYTHROCYTES by many different causal agents such as antibodies, bacteria, chemicals, temperature, and changes in tonicity.	0	3.67	10	0
Chronic Hepatitis C [description not available]	0	2.21	1	0
Dyslipidemia [description not available]	0	2.66	2	0
Hepatitis C, Chronic INFLAMMATION of the LIVER in humans that is caused by HEPATITIS C VIRUS lasting six months or more. Chronic hepatitis C can lead to LIVER CIRRHOSIS.	0	2.21	1	0
Dyslipidemias Abnormalities in the serum levels of LIPIDS, including overproduction or deficiency. Abnormal serum lipid profiles may include high total CHOLESTEROL, high TRIGLYCERIDES, low HIGH DENSITY LIPOPROTEIN CHOLESTEROL, and elevated LOW DENSITY LIPOPROTEIN CHOLESTEROL.	0	2.66	2	0
Auditory Vertigo [description not available]	0	3.58	3	0
Central Nervous System Origin Vertigo [description not available]	0	3.34	7	0
Meniere Disease A disease of the inner ear (LABYRINTH) that is characterized by fluctuating SENSORINEURAL HEARING LOSS; TINNITUS; episodic VERTIGO; and aural fullness. It is the most common form of endolymphatic hydrops.	0	3.58	3	0
Vertigo An illusion of movement, either of the external world revolving around the individual or of the individual revolving in space. Vertigo may be associated with disorders of the inner ear (EAR, INNER); VESTIBULAR NERVE; BRAINSTEM; or CEREBRAL CORTEX. Lesions in the TEMPORAL LOBE and PARIETAL LOBE may be associated with FOCAL SEIZURES that may feature vertigo as an ictal manifestation. (From Adams et al., Principles of Neurology, 6th ed, pp300-1)	0	3.34	7	0
Cronobacter Infections [description not available]	0	11.72	22	12
Enterobacteriaceae Infections Infections with bacteria of the family ENTEROBACTERIACEAE.	0	11.72	22	12
Body Weight The mass or quantity of heaviness of an individual. It is expressed by units of pounds or kilograms.	0	8.13	54	2
Lymphoma, Primary Effusion A rare neoplasm of large B-cells usually presenting as serious effusions without detectable tumor masses. The most common sites of involvement are the pleural, pericardial, and peritoneal cavities. It is associated with HUMAN HERPESVIRUS 8, most often occurring in the setting of immunodeficiency.	0	2.08	1	0
Disease Models, Animal Naturally-occurring or experimentally-induced animal diseases with pathological processes analogous to human diseases.	0	11.79	86	9
Ascites Accumulation or retention of free fluid within the peritoneal cavity.	0	4.19	18	0
Cerebral Infarction, Middle Cerebral Artery [description not available]	0	4.87	2	1
Alloxan Diabetes [description not available]	0	5.68	7	1
Extravasation of Contrast Media [description not available]	0	2.1	1	0
Infarction, Middle Cerebral Artery NECROSIS occurring in the MIDDLE CEREBRAL ARTERY distribution system which brings blood to the entire lateral aspects of each CEREBRAL HEMISPHERE. Clinical signs include impaired cognition; APHASIA; AGRAPHIA; weak and numbness in the face and arms, contralaterally or bilaterally depending on the infarction.	0	4.87	2	1
Disease Exacerbation [description not available]	0	7.98	6	4
Cancer of Mouth [description not available]	0	2.1	1	0
Angiogenesis, Pathologic [description not available]	0	9.32	9	4
Mouth Neoplasms Tumors or cancer of the MOUTH.	0	2.1	1	0
Group A Strep Infection [description not available]	0	10.28	53	7
Streptococcal Infections Infections with bacteria of the genus STREPTOCOCCUS.	0	10.28	53	7
Cancer of Cervix [description not available]	0	5.77	8	1
Invasiveness, Neoplasm [description not available]	0	4.18	6	0
Uterine Cervical Neoplasms Tumors or cancer of the UTERINE CERVIX.	0	5.77	8	1
Tonsillitis Inflammation of the tonsils, especially the PALATINE TONSILS but the ADENOIDS (pharyngeal tonsils) and lingual tonsils may also be involved. Tonsillitis usually is caused by bacterial infection. Tonsillitis may be acute, chronic, or recurrent.	0	4.12	6	0
Nociceptive Pain Dull or sharp aching pain caused by stimulated NOCICEPTORS due to tissue injury, inflammation or diseases. It can be divided into somatic or tissue pain and VISCERAL PAIN.	0	2.11	1	0
Acute Post-operative Pain [description not available]	0	6.85	7	4
Pain, Postoperative Pain during the period after surgery.	0	6.85	7	4
Hepatocellular Carcinoma [description not available]	0	6.16	12	1
Cancer of Liver [description not available]	0	6.36	15	1
Carcinoma, Hepatocellular A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.	0	6.16	12	1
Liver Neoplasms Tumors or cancer of the LIVER.	0	6.36	15	1
Carcinoma, Anaplastic [description not available]	0	4.43	23	0
Cancer of Pancreas [description not available]	0	2.89	4	0
Carcinoma A malignant neoplasm made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. It is a histological type of neoplasm and not a synonym for cancer.	0	4.43	23	0
Pancreatic Neoplasms Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).	0	2.89	4	0
Gradenigo Syndrome Inflammation of PETROUS BONE secondary to chronic OTITIS MEDIA. Its symptoms include fever, occipital headache, ear and retroorbital pain, and facial paralysis.	0	2.13	1	0
Cochlear Hearing Loss [description not available]	0	7.45	28	1
Complication, Postoperative [description not available]	0	14.05	148	36
Aural Cholesteatoma [description not available]	0	3.64	3	0
Hearing Loss, Sensorineural Hearing loss resulting from damage to the COCHLEA and the sensorineural elements which lie internally beyond the oval and round windows. These elements include the AUDITORY NERVE and its connections in the BRAINSTEM.	0	7.45	28	1
Postoperative Complications Pathologic processes that affect patients after a surgical procedure. They may or may not be related to the disease for which the surgery was done, and they may or may not be direct results of the surgery.	0	14.05	148	36
Experimental Hepatoma [description not available]	0	2.93	4	0
Chronic Illness [description not available]	0	13.98	84	22
Otitis Media, Purulent [description not available]	0	9.14	20	7
Chronic Disease Diseases which have one or more of the following characteristics: they are permanent, leave residual disability, are caused by nonreversible pathological alteration, require special training of the patient for rehabilitation, or may be expected to require a long period of supervision, observation, or care (Dictionary of Health Services Management, 2d ed). For epidemiological studies chronic disease often includes HEART DISEASES; STROKE; CANCER; and diabetes (DIABETES MELLITUS, TYPE 2).	0	13.98	84	22
Otitis Media, Suppurative Inflammation of the middle ear with purulent discharge.	0	9.14	20	7
Ovine Diseases [description not available]	0	4.06	3	1
Mastitis INFLAMMATION of the BREAST, or MAMMARY GLAND.	0	5.27	13	1
Sensitivity and Specificity Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)	0	7.65	31	2
Cancer of Prostate [description not available]	0	9.09	20	5
Prostatic Neoplasms Tumors or cancer of the PROSTATE.	0	9.09	20	5
Electrolytes Substances that dissociate into two or more ions, to some extent, in water. Solutions of electrolytes thus conduct an electric current and can be decomposed by it (ELECTROLYSIS). (Grant & Hackh's Chemical Dictionary, 5th ed)	0	6.7	12	2
Opportunistic Infections An infection caused by an organism which becomes pathogenic under certain conditions, e.g., during immunosuppression.	0	3.43	1	1
Burns Injuries to tissues caused by contact with heat, steam, chemicals (BURNS, CHEMICAL), electricity (BURNS, ELECTRIC), or the like.	0	15.18	98	6
Remission, Spontaneous A spontaneous diminution or abatement of a disease over time, without formal treatment.	0	5.93	5	2
Foreign-Body Migration Migration of a foreign body from its original location to some other location in the body.	0	2.05	1	0
Genetic Predisposition [description not available]	0	5.06	3	1
Genetic Diseases [description not available]	0	2.05	1	0
Genetic Diseases, Inborn Diseases that are caused by genetic mutations present during embryo or fetal development, although they may be observed later in life. The mutations may be inherited from a parent's genome or they may be acquired in utero.	0	2.05	1	0
Autosomal Dominant Juvenile Parkinson Disease [description not available]	0	2.96	4	0
Tauopathies Neurodegenerative disorders involving deposition of abnormal tau protein isoforms (TAU PROTEINS) in neurons and glial cells in the brain. Pathological aggregations of tau proteins are associated with mutation of the tau gene on chromosome 17 in patients with ALZHEIMER DISEASE; DEMENTIA; PARKINSONIAN DISORDERS; progressive supranuclear palsy (SUPRANUCLEAR PALSY, PROGRESSIVE); and corticobasal degeneration.	0	2.06	1	0
Amentia [description not available]	0	2.06	1	0
Dementia An acquired organic mental disorder with loss of intellectual abilities of sufficient severity to interfere with social or occupational functioning. The dysfunction is multifaceted and involves memory, behavior, personality, judgment, attention, spatial relations, language, abstract thought, and other executive functions. The intellectual decline is usually progressive, and initially spares the level of consciousness.	0	2.06	1	0
Parkinsonian Disorders A group of disorders which feature impaired motor control characterized by bradykinesia, MUSCLE RIGIDITY; TREMOR; and postural instability. Parkinsonian diseases are generally divided into primary parkinsonism (see PARKINSON DISEASE), secondary parkinsonism (see PARKINSON DISEASE, SECONDARY) and inherited forms. These conditions are associated with dysfunction of dopaminergic or closely related motor integration neuronal pathways in the BASAL GANGLIA.	0	2.96	4	0
Dermatoses [description not available]	0	10.03	125	4
Skin Diseases Diseases involving the DERMIS or EPIDERMIS.	0	10.03	125	4
Bed Sores [description not available]	0	6.75	13	2
Acute Disease Disease having a short and relatively severe course.	0	12.61	79	24
Pressure Ulcer An ulceration caused by prolonged pressure on the SKIN and TISSUES when one stays in one position for a long period of time, such as lying in bed. The bony areas of the body are the most frequently affected sites which become ischemic (ISCHEMIA) under sustained and constant pressure.	0	6.75	13	2
Hemorrhoids Swollen veins in the lower part of the RECTUM or ANUS. Hemorrhoids can be inside the anus (internal), under the skin around the anus (external), or protruding from inside to outside of the anus. People with hemorrhoids may or may not exhibit symptoms which include bleeding, itching, and pain.	0	5.88	9	1
Fasciitis, Necrotizing A fulminating bacterial infection of the deep layers of the skin and FASCIA. It can be caused by many different organisms, with STREPTOCOCCUS PYOGENES being the most common.	0	2.07	1	0
Dental Focal Infection [description not available]	0	3.77	2	1
Tooth Diseases Diseases involving the TEETH.	0	2.38	2	0
Abscess, Epidural [description not available]	0	2.07	1	0
External Ear Inflammation [description not available]	0	12.8	107	37
Otitis Externa Inflammation of the OUTER EAR including the external EAR CANAL, cartilages of the auricle (EAR CARTILAGE), and the TYMPANIC MEMBRANE.	0	12.8	107	37
Eardrum Perforation [description not available]	0	5.7	13	0
Tympanic Membrane Perforation A temporary or persistent opening in the eardrum (TYMPANIC MEMBRANE). Clinical signs depend on the size, location, and associated pathological condition.	0	5.7	13	0
Neuroblastoma A common neoplasm of early childhood arising from neural crest cells in the sympathetic nervous system, and characterized by diverse clinical behavior, ranging from spontaneous remission to rapid metastatic progression and death. This tumor is the most common intraabdominal malignancy of childhood, but it may also arise from thorax, neck, or rarely occur in the central nervous system. Histologic features include uniform round cells with hyperchromatic nuclei arranged in nests and separated by fibrovascular septa. Neuroblastomas may be associated with the opsoclonus-myoclonus syndrome. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, pp2099-2101; Curr Opin Oncol 1998 Jan;10(1):43-51)	0	5.55	9	2
Fistula Abnormal communication most commonly seen between two internal organs, or between an internal organ and the surface of the body.	0	4.95	3	1
Abscess Accumulation of purulent material in tissues, organs, or circumscribed spaces, usually associated with signs of infection.	0	5.47	16	1
Sprains [description not available]	0	2.33	2	0
Sprains and Strains A collective term for muscle and ligament injuries without dislocation or fracture. A sprain is a joint injury in which some of the fibers of a supporting ligament are ruptured but the continuity of the ligament remains intact. A strain is an overstretching or overexertion of some part of the musculature.	0	2.33	2	0
Abscess, Pulmonary [description not available]	0	3.54	3	0
Pleurisy INFLAMMATION of PLEURA, the lining of the LUNG. When PARIETAL PLEURA is involved, there is pleuritic CHEST PAIN.	0	2.62	3	0
Koch's Disease [description not available]	0	5.62	31	0
Pulmonary Consumption [description not available]	0	3.95	14	0
Lung Abscess Solitary or multiple collections of PUS within the lung parenchyma as a result of infection by bacteria, protozoa, or other agents.	0	3.54	3	0
Tuberculosis Any of the infectious diseases of man and other animals caused by species of MYCOBACTERIUM TUBERCULOSIS.	0	10.62	31	0
Tuberculosis, Pulmonary MYCOBACTERIUM infections of the lung.	0	3.95	14	0
Sarcoma, Epithelioid [description not available]	0	4.95	3	1
Sarcoma A connective tissue neoplasm formed by proliferation of mesodermal cells; it is usually highly malignant.	0	4.95	3	1
Pachymeningitis [description not available]	0	5.05	17	0
Meningitis Inflammation of the coverings of the brain and/or spinal cord, which consist of the PIA MATER; ARACHNOID; and DURA MATER. Infections (viral, bacterial, and fungal) are the most common causes of this condition, but subarachnoid hemorrhage (HEMORRHAGES, SUBARACHNOID), chemical irritation (chemical MENINGITIS), granulomatous conditions, neoplastic conditions (CARCINOMATOUS MENINGITIS), and other inflammatory conditions may produce this syndrome. (From Joynt, Clinical Neurology, 1994, Ch24, p6)	0	5.05	17	0
ENT Diseases [description not available]	0	4.65	11	0
Primary Peritonitis [description not available]	0	8.28	34	4
Peritonitis INFLAMMATION of the PERITONEUM lining the ABDOMINAL CAVITY as the result of infectious, autoimmune, or chemical processes. Primary peritonitis is due to infection of the PERITONEAL CAVITY via hematogenous or lymphatic spread and without intra-abdominal source. Secondary peritonitis arises from the ABDOMINAL CAVITY itself through RUPTURE or ABSCESS of intra-abdominal organs.	0	8.28	34	4
E coli Infections [description not available]	0	11.59	111	4
Innate Inflammatory Response [description not available]	0	10.03	31	9
Infant Malnutrition Malnutrition, occurring in infants ages 1 month to 24 months, which is due to insufficient intake of food, dietary nutrients, or a pathophysiologic condition which prevents the absorption and utilization of food. Growth and development are markedly affected.	0	3.32	7	0
Escherichia coli Infections Infections with bacteria of the species ESCHERICHIA COLI.	0	11.59	111	4
Gastroenteritis INFLAMMATION of any segment of the GASTROINTESTINAL TRACT from ESOPHAGUS to RECTUM. Causes of gastroenteritis are many including genetic, infection, HYPERSENSITIVITY, drug effects, and CANCER.	0	8.22	42	3
Inflammation A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function.	0	15.03	31	9
Intra-Abdominal Infections [description not available]	0	1.93	1	0
Enteritis Inflammation of any segment of the SMALL INTESTINE.	0	8.05	35	3
Intraabdominal Infections Infection within the PERITONEAL CAVITY. A frequent cause is an ANASTOMOTIC LEAK following surgery.	0	1.93	1	0
Johne Disease [description not available]	0	1.93	1	0
Bronchitis Inflammation of the large airways in the lung including any part of the BRONCHI, from the PRIMARY BRONCHI to the TERTIARY BRONCHI.	0	5.11	11	0
Indigestion [description not available]	0	5.57	18	1
Cholera Infantum [description not available]	0	5.52	17	0
Dyspepsia Impaired digestion, especially after eating.	0	10.57	18	1
Weight Gain Increase in BODY WEIGHT over existing weight.	0	5.74	11	2
Pyoderma Any purulent skin disease (Dorland, 27th ed).	0	8.25	33	4
Corneal Diseases Diseases of the cornea.	0	3.59	9	0
Disease A definite pathologic process with a characteristic set of signs and symptoms. It may affect the whole body or any of its parts, and its etiology, pathology, and prognosis may be known or unknown.	0	4.23	19	0
Allergic Reaction [description not available]	0	4.42	23	0
Hypersensitivity Altered reactivity to an antigen, which can result in pathologic reactions upon subsequent exposure to that particular antigen.	0	4.42	23	0
Allergic Contact Dermatitis [description not available]	0	13.19	34	2
Contact Dermatitis [description not available]	0	9.88	138	1
Dermatitis, Contact A type of acute or chronic skin reaction in which sensitivity is manifested by reactivity to materials or substances coming in contact with the skin. It may involve allergic or non-allergic mechanisms.	0	9.88	138	1
Dermatitis, Allergic Contact A contact dermatitis due to allergic sensitization to various substances. These substances subsequently produce inflammatory reactions in the skin of those who have acquired hypersensitivity to them as a result of prior exposure.	0	8.19	34	2
Apnea A transient absence of spontaneous respiration.	0	5.25	21	0
Infection [description not available]	0	10.02	41	7
Infections Invasion of the host organism by microorganisms or their toxins or by parasites that can cause pathological conditions or diseases.	0	10.02	41	7
Diarrhea An increased liquidity or decreased consistency of FECES, such as running stool. Fecal consistency is related to the ratio of water-holding capacity of insoluble solids to total water, rather than the amount of water present. Diarrhea is not hyperdefecation or increased fecal weight.	0	11.52	108	10
Diseases of Immune System [description not available]	0	2.62	3	0
Immune System Diseases Disorders caused by abnormal or absent immunologic mechanisms, whether humoral, cell-mediated, or both.	0	2.62	3	0
Infantile Diarrhea [description not available]	0	6.16	33	1
Diarrhea, Infantile DIARRHEA occurring in infants from newborn to 24-months old.	0	6.16	33	1
Alopecia Cicatrisata [description not available]	0	2.38	2	0
Bleb [description not available]	0	2.34	2	0
Anasarca [description not available]	0	6.12	12	1
Cancer, Radiation-Induced [description not available]	0	1.93	1	0
Injuries, Radiation [description not available]	0	3.55	9	0
Alopecia Absence of hair from areas where it is normally present.	0	2.38	2	0
Edema Abnormal fluid accumulation in TISSUES or body cavities. Most cases of edema are present under the SKIN in SUBCUTANEOUS TISSUE.	0	6.12	12	1
Erythema Redness of the skin produced by congestion of the capillaries. This condition may result from a variety of disease processes.	0	4.26	4	1
Necrosis The death of cells in an organ or tissue due to disease, injury or failure of the blood supply.	0	7.96	28	2
Fungal Diseases [description not available]	0	7.24	15	3
Middle Ear Inflammation [description not available]	0	9.71	52	7
Sinus Infections [description not available]	0	8.2	31	4
Mycoses Diseases caused by FUNGI.	0	7.24	15	3
Otitis Media Inflammation of the MIDDLE EAR including the AUDITORY OSSICLES and the EUSTACHIAN TUBE.	0	9.71	52	7
Sinusitis Inflammation of the NASAL MUCOSA in one or more of the PARANASAL SINUSES.	0	8.2	31	4
Brain Abscess A circumscribed collection of purulent exudate in the brain, due to bacterial and other infections. The majority are caused by spread of infected material from a focus of suppuration elsewhere in the body, notably the PARANASAL SINUSES, middle ear (see EAR, MIDDLE); HEART (see also ENDOCARDITIS, BACTERIAL), and LUNG. Penetrating CRANIOCEREBRAL TRAUMA and NEUROSURGICAL PROCEDURES may also be associated with this condition. Clinical manifestations include HEADACHE; SEIZURES; focal neurologic deficits; and alterations of consciousness. (Adams et al., Principles of Neurology, 6th ed, pp712-6)	0	2.35	2	0
Abscess, Intracranial, Subdural [description not available]	0	1.93	1	0
Empyema Presence of pus in a hollow organ or body cavity.	0	4.94	15	0
Health Care Associated Infection [description not available]	0	11.53	57	4
Cross Infection Any infection which a patient contracts in a health-care institution.	0	11.53	57	4
Cancer of Rectum [description not available]	0	6.87	16	5
Enterocolitis Inflammation of the MUCOSA of both the SMALL INTESTINE and the LARGE INTESTINE. Etiology includes ISCHEMIA, infections, allergic, and immune responses.	0	3.73	11	0
Rectal Neoplasms Tumors or cancer of the RECTUM.	1	8.87	16	5
Infection, Postoperative Wound [description not available]	0	16.85	217	68
Dermatitis Any inflammation of the skin.	0	14.8	60	11
Allergy, Drug [description not available]	0	9.63	98	0
Drug Hypersensitivity Immunologically mediated adverse reactions to medicinal substances used legally or illegally.	0	9.63	98	0
Pruritus Ani Intense chronic itching in the anal area.	0	2.34	2	0
Bites [description not available]	0	2.34	2	0
Leg Ulcer Ulceration of the skin and underlying structures of the lower extremity. About 90% of the cases are due to venous insufficiency (VARICOSE ULCER), 5% to arterial disease, and the remaining 5% to other causes.	0	13.1	37	3
Dermatitis Medicamentosa [description not available]	0	7.71	62	0
Eye Disorders [description not available]	0	8.86	61	4
Eye Diseases Diseases affecting the eye.	0	8.86	61	4
Eczema, Atopic [description not available]	0	7.41	26	2
Dermatitis, Eczematous [description not available]	0	9.89	63	7
Dermatitis, Atopic A chronic inflammatory genetically determined disease of the skin marked by increased ability to form reagin (IgE), with increased susceptibility to allergic rhinitis and asthma, and hereditary disposition to a lowered threshold for pruritus. It is manifested by lichenification, excoriation, and crusting, mainly on the flexural surfaces of the elbow and knee. In infants it is known as infantile eczema.	0	7.41	26	2
Eczema A pruritic papulovesicular dermatitis occurring as a reaction to many endogenous and exogenous agents (Dorland, 27th ed).	0	9.89	63	7
Recrudescence [description not available]	0	12.25	49	15
Meningitis, Tuberculous [description not available]	0	2.33	2	0
Tuberculosis, Meningeal A form of bacterial meningitis caused by MYCOBACTERIUM TUBERCULOSIS or rarely MYCOBACTERIUM BOVIS. The organism seeds the meninges and forms microtuberculomas which subsequently rupture. The clinical course tends to be subacute, with progressions occurring over a period of several days or longer. Headache and meningeal irritation may be followed by SEIZURES, cranial neuropathies, focal neurologic deficits, somnolence, and eventually COMA. The illness may occur in immunocompetent individuals or as an OPPORTUNISTIC INFECTION in the ACQUIRED IMMUNODEFICIENCY SYNDROME and other immunodeficiency syndromes. (From Adams et al., Principles of Neurology, 6th ed, pp717-9)	0	2.33	2	0
Actinomyces Infections [description not available]	0	3.97	5	0
Middle Ear Effusion [description not available]	0	8.77	14	6
Otitis Media with Effusion Inflammation of the middle ear with a clear pale yellow-colored transudate.	0	8.77	14	6
Periodontitis, Acute Nonsuppurative [description not available]	0	3.82	2	1
Periapical Periodontitis Inflammation of the PERIAPICAL TISSUE. It includes general, unspecified, or acute nonsuppurative inflammation. Chronic nonsuppurative inflammation is PERIAPICAL GRANULOMA. Suppurative inflammation is PERIAPICAL ABSCESS.	0	3.82	2	1
Ear Diseases Pathological processes of the ear, the hearing, and the equilibrium system of the body.	0	6.92	40	0
Neutropenia A decrease in the number of NEUTROPHILS found in the blood.	0	6.62	10	6
Inflammation, Endodontic [description not available]	0	4.84	8	1
Pulpitis Inflammation of the DENTAL PULP, usually due to bacterial infection in dental caries, tooth fracture, or other conditions causing exposure of the pulp to bacterial invasion. Chemical irritants, thermal factors, hyperemic changes, and other factors may also cause pulpitis.	0	4.84	8	1
Stasis Ulcer [description not available]	0	6.33	22	2
Varicose Ulcer Skin breakdown or ulceration in the drainage area of a VARICOSE VEIN, usually in the leg.	0	6.33	22	2
Infectious Endophthalmitis Infectious condition of the internal eye.	0	6.99	13	1
Endophthalmitis Suppurative inflammation of the tissues of the internal structures of the eye frequently associated with an infection.	0	6.99	13	1
Deafness, Transitory [description not available]	0	8.14	33	2
Inner Ear Disease [description not available]	0	5.53	17	0
Labyrinth Diseases Pathological processes of the inner ear (LABYRINTH) which contains the essential apparatus of hearing (COCHLEA) and balance (SEMICIRCULAR CANALS).	0	5.53	17	0
Hearing Loss A general term for the complete or partial loss of the ability to hear from one or both ears.	0	8.14	33	2
Distorted Hearing [description not available]	0	6.95	53	0
Hyponatremia Deficiency of sodium in the blood; salt depletion. (Dorland, 27th ed)	0	3.56	3	0
Agranulocytosis A decrease in the number of GRANULOCYTES; (BASOPHILS; EOSINOPHILS; and NEUTROPHILS).	0	4.25	4	1
Sclerosis A pathological process consisting of hardening or fibrosis of an anatomical structure, often a vessel or a nerve.	0	1.96	1	0
Anaphylactic Reaction [description not available]	0	5.86	17	0
Anaphylaxis An acute hypersensitivity reaction due to exposure to a previously encountered ANTIGEN. The reaction may include rapidly progressing URTICARIA, respiratory distress, vascular collapse, systemic SHOCK, and death.	0	5.86	17	0
Chalazia [description not available]	0	3.35	2	0
Chalazion A non-neoplastic cyst of the MEIBOMIAN GLANDS of the eyelid.	0	3.35	2	0
Acute Brain Injuries [description not available]	0	5.02	3	1
Brain Injuries Acute and chronic (see also BRAIN INJURIES, CHRONIC) injuries to the brain, including the cerebral hemispheres, CEREBELLUM, and BRAIN STEM. Clinical manifestations depend on the nature of injury. Diffuse trauma to the brain is frequently associated with DIFFUSE AXONAL INJURY or COMA, POST-TRAUMATIC. Localized injuries may be associated with NEUROBEHAVIORAL MANIFESTATIONS; HEMIPARESIS, or other focal neurologic deficits.	0	5.02	3	1
Complications, Pregnancy [description not available]	0	3.73	11	0
Pregnancy The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.	0	11.56	96	6
HIV Human immunodeficiency virus. A non-taxonomic and historical term referring to any of two species, specifically HIV-1 and/or HIV-2. Prior to 1986, this was called human T-lymphotropic virus type III/lymphadenopathy-associated virus (HTLV-III/LAV). From 1986-1990, it was an official species called HIV. Since 1991, HIV was no longer considered an official species name; the two species were designated HIV-1 and HIV-2.	0	2.4	2	0
Conductive Hearing Loss [description not available]	0	2.39	2	0
Parotiditis [description not available]	0	1.99	1	0
AIDS-Related Opportunistic Infections Opportunistic infections found in patients who test positive for human immunodeficiency virus (HIV). The most common include PNEUMOCYSTIS PNEUMONIA, Kaposi's sarcoma, cryptosporidiosis, herpes simplex, toxoplasmosis, cryptococcosis, and infections with Mycobacterium avium complex, Microsporidium, and Cytomegalovirus.	0	1.99	1	0
Anus Diseases Diseases involving the ANUS.	0	2.37	2	0
Sore Throat [description not available]	0	4.94	9	1
Nasal Catarrh [description not available]	0	7	23	4
Pharyngitis Inflammation of the throat (PHARYNX).	0	4.94	9	1
Rhinitis Inflammation of the NASAL MUCOSA, the mucous membrane lining the NASAL CAVITIES.	0	7	23	4
Acariasis [description not available]	0	4.28	4	1
Eye Hemorrhage Intraocular hemorrhage from the vessels of various tissues of the eye.	0	2	1	0
Nearsightedness [description not available]	0	4.08	3	1
Keratoconjunctivitis Simultaneous inflammation of the cornea and conjunctiva.	0	5.73	21	1
Myopia A refractive error in which rays of light entering the EYE parallel to the optic axis are brought to a focus in front of the RETINA when accommodation (ACCOMMODATION, OCULAR) is relaxed. This results from an overly curved CORNEA or from the eyeball being too long from front to back. It is also called nearsightedness.	0	4.08	3	1
Enterovirus Infections Diseases caused by ENTEROVIRUS.	0	2.38	2	0
Conjunctivitis, Acute Hemorrhagic A highly contagious disease characterized by subconjunctival hemorrhage, sudden swelling of the eyelids and congestion, redness, and pain in the eye. Epidemic conjunctivitis caused by Enterovirus 70 (EV-70) was first described in Africa in 1969. It is caused also by Coxsackievirus A24 variant (CA24v). Epidemics by this organism have appeared most frequently in Asia.	0	2	1	0
Abnormalities, Congenital [description not available]	0	2.67	3	0
Francisella tularensis Infection [description not available]	0	2.64	3	0
Tularemia A plague-like disease of rodents, transmissible to man. It is caused by FRANCISELLA TULARENSIS and is characterized by fever, chills, headache, backache, and weakness.	0	2.64	3	0
Blood Poisoning [description not available]	0	12.46	65	13
Bacteroides Infections Infections with bacteria of the genus BACTEROIDES.	0	6.02	8	4
Sepsis Systemic inflammatory response syndrome with a proven or suspected infectious etiology. When sepsis is associated with organ dysfunction distant from the site of infection, it is called severe sepsis. When sepsis is accompanied by HYPOTENSION despite adequate fluid infusion, it is called SEPTIC SHOCK.	0	12.46	65	13
Anemia, Hypoplastic [description not available]	0	3.33	7	0
Anal Fistula [description not available]	0	2.86	4	0
Anemia, Aplastic A form of anemia in which the bone marrow fails to produce adequate numbers of peripheral blood elements.	0	3.33	7	0
Leukemia, Lymphocytic [description not available]	0	4.25	4	1
Acute Myelogenous Leukemia [description not available]	0	4.61	6	1
Leukemia, Lymphoid Leukemia associated with HYPERPLASIA of the lymphoid tissues and increased numbers of circulating malignant LYMPHOCYTES and lymphoblasts.	0	4.25	4	1
Leukemia, Myeloid, Acute Clonal expansion of myeloid blasts in bone marrow, blood, and other tissue. Myeloid leukemias develop from changes in cells that normally produce NEUTROPHILS; BASOPHILS; EOSINOPHILS; and MONOCYTES.	0	4.61	6	1
Canine Diseases [description not available]	0	9.49	33	4
Cat Diseases Diseases of the domestic cat (Felis catus or F. domesticus). This term does not include diseases of the so-called big cats such as CHEETAHS; LIONS; tigers, cougars, panthers, leopards, and other Felidae for which the heading CARNIVORA is used.	0	5.8	16	0
Eye Foreign Bodies Inanimate objects that become enclosed in the eye.	0	5.16	6	2
Leukorrhea A clear or white discharge from the VAGINA, consisting mainly of MUCUS.	0	3.32	7	0
Equine Diseases [description not available]	0	5.3	21	0
Arthropathies [description not available]	0	2.4	2	0
Joint Diseases Diseases involving the JOINTS.	0	2.4	2	0
Bladder Diseases [description not available]	0	3.19	6	0
Ulcer A lesion on the surface of the skin or a mucous surface, produced by the sloughing of inflammatory necrotic tissue.	0	4.6	27	0
Vibrio cholerae Infection [description not available]	0	3.33	7	0
Cholera An acute diarrheal disease endemic in India and Southeast Asia whose causative agent is VIBRIO CHOLERAE. This condition can lead to severe dehydration in a matter of hours unless quickly treated.	0	8.33	7	0
Pink Eye [description not available]	0	7.81	36	6
Conjunctivitis INFLAMMATION of the CONJUNCTIVA.	0	7.81	36	6
Diseases, Occupational [description not available]	0	3.45	8	0
Cardiac Death [description not available]	0	1.95	1	0
Carbon Monoxide Poisoning Toxic asphyxiation due to the displacement of oxygen from oxyhemoglobin by carbon monoxide.	0	1.95	1	0
Rheumatoid Arthritis [description not available]	0	4.26	4	1
Keratitis, Ulcerative [description not available]	0	6.19	33	1
Arthritis, Rheumatoid A chronic systemic disease, primarily of the joints, marked by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures. Etiology is unknown, but autoimmune mechanisms have been implicated.	0	4.26	4	1
Corneal Ulcer Loss of epithelial tissue from the surface of the cornea due to progressive erosion and necrosis of the tissue; usually caused by bacterial, fungal, or viral infection.	0	6.19	33	1
Colitis, Granulomatous [description not available]	0	4.43	5	1
Crohn Disease A chronic transmural inflammation that may involve any part of the DIGESTIVE TRACT from MOUTH to ANUS, mostly found in the ILEUM, the CECUM, and the COLON. In Crohn disease, the inflammation, extending through the intestinal wall from the MUCOSA to the serosa, is characteristically asymmetric and segmental. Epithelioid GRANULOMAS may be seen in some patients.	0	4.43	5	1
Chromosome Deletion Actual loss of portion of a chromosome.	0	3.35	7	0
Emergencies Situations or conditions requiring immediate intervention to avoid serious adverse results.	0	3.75	2	1
Cornea Injuries [description not available]	0	5.51	9	2
Eye Burns Injury to any part of the eye by extreme heat, chemical agents, or ultraviolet radiation.	0	4.43	5	1
Corneal Injuries Damage or trauma inflicted to the CORNEA by external means.	0	5.51	9	2
Poultry Diseases Diseases of birds which are raised as a source of meat or eggs for human consumption and are usually found in barnyards, hatcheries, etc. The concept is differentiated from BIRD DISEASES which is for diseases of birds not considered poultry and usually found in zoos, parks, and the wild.	0	5.69	20	1
Salmonella Infections, Animal Infections in animals with bacteria of the genus SALMONELLA.	0	5.57	29	0
Rotavirus Infections Infection with any of the rotaviruses. Specific infections include human infantile diarrhea, neonatal calf diarrhea, and epidemic diarrhea of infant mice.	0	1.97	1	0
Deaf Mutism [description not available]	0	8.32	115	0
Deafness A general term for the complete loss of the ability to hear from both ears.	0	8.32	115	0
Infection, Wound [description not available]	0	11.1	71	6
Hospital-Acquired Condition [description not available]	0	5.01	16	0
Bacterial Conjunctivitides [description not available]	0	5.38	5	3
Conjunctivitis, Bacterial Purulent infections of the conjunctiva by several species of gram-negative, gram-positive, or acid-fast organisms. Some of the more commonly found genera causing conjunctival infections are Haemophilus, Streptococcus, Neisseria, and Chlamydia.	0	5.38	5	3
Adenoma, Prostatic [description not available]	0	2.37	2	0
Prostatic Hyperplasia Increase in constituent cells in the PROSTATE, leading to enlargement of the organ (hypertrophy) and adverse impact on the lower urinary tract function. This can be caused by increased rate of cell proliferation, reduced rate of cell death, or both.	0	2.37	2	0
Urinary Tract Infections Inflammatory responses of the epithelium of the URINARY TRACT to microbial invasions. They are often bacterial infections with associated BACTERIURIA and PYURIA.	0	9.36	69	6
Hand Dermatosis [description not available]	0	4.67	11	0
Blepharitis Inflammation of the eyelids.	0	6.03	8	4
Hand Dermatoses Skin diseases involving the HANDS.	0	4.67	11	0
Pyrexia [description not available]	0	5.96	10	3
Fever An abnormal elevation of body temperature, usually as a result of a pathologic process.	0	5.96	10	3
Kidney Stones [description not available]	0	1.94	1	0
Kidney Calculi Stones in the KIDNEY, usually formed in the urine-collecting area of the kidney (KIDNEY PELVIS). Their sizes vary and most contains CALCIUM OXALATE.	0	1.94	1	0
Keratoderma Blennorrhagicum [description not available]	0	2.63	3	0
Lichen Ruber Planus [description not available]	0	3.04	5	0
Prurigo A name applied to several itchy skin eruptions of unknown cause. The characteristic course is the formation of a dome-shaped papule with a small transient vesicle on top, followed by crusting over or lichenification. (From Dorland, 27th ed)	0	1.94	1	0
Palmoplantaris Pustulosis [description not available]	0	7.02	19	5
Acne Rosacea [description not available]	0	4.36	8	0
Infectious Skin Diseases [description not available]	0	9.86	33	13
Pityriasis A name originally applied to a group of skin diseases characterized by the formation of fine, branny scales, but now used only with a modifier. (Dorland, 27th ed)	0	1.94	1	0
Keratosis Any horny growth such as a wart or callus.	0	2.63	3	0
Lichen Planus An inflammatory, pruritic disease of the skin and mucous membranes, which can be either generalized or localized. It is characterized by distinctive purplish, flat-topped papules having a predilection for the trunk and flexor surfaces. The lesions may be discrete or coalesce to form plaques. Histologically, there is a saw-tooth pattern of epidermal hyperplasia and vacuolar alteration of the basal layer of the epidermis along with an intense upper dermal inflammatory infiltrate composed predominantly of T-cells. Etiology is unknown.	0	3.04	5	0
Psoriasis A common genetically determined, chronic, inflammatory skin disease characterized by rounded erythematous, dry, scaling patches. The lesions have a predilection for nails, scalp, genitalia, extensor surfaces, and the lumbosacral region. Accelerated epidermopoiesis is considered to be the fundamental pathologic feature in psoriasis.	0	7.02	19	5
Rosacea A cutaneous disorder primarily of convexities of the central part of the FACE, such as FOREHEAD; CHEEK; NOSE; and CHIN. It is characterized by FLUSHING; ERYTHEMA; EDEMA; RHINOPHYMA; papules; and ocular symptoms. It may occur at any age but typically after age 30. There are various subtypes of rosacea: erythematotelangiectatic, papulopustular, phymatous, and ocular (National Rosacea Society's Expert Committee on the Classification and Staging of Rosacea, J Am Acad Dermatol 2002; 46:584-7).	0	4.36	8	0
Skin Diseases, Infectious Skin diseases caused by bacteria, fungi, parasites, or viruses.	0	9.86	33	13
B Virus Infection [description not available]	0	4.06	3	1
Mucositis, Oral [description not available]	0	3.65	10	0
Aphthae [description not available]	0	4.43	5	1
Stomatitis INFLAMMATION of the soft tissues of the MOUTH, such as MUCOSA; PALATE; GINGIVA; and LIP.	0	3.65	10	0
Stomatitis, Aphthous A recurrent disease of the oral mucosa of unknown etiology. It is characterized by small white ulcerative lesions, single or multiple, round or oval. Two to eight crops of lesions occur per year, lasting for 7 to 14 days and then heal without scarring. (From Jablonski's Dictionary of Dentistry, 1992, p742)	0	4.43	5	1
Fusiform Aneurysm Elongated, spindle-shaped dilation in the wall of blood vessels, usually large ARTERIES with ATHEROSCLEROSIS.	0	2.35	2	0
Aneurysm Pathological outpouching or sac-like dilatation in the wall of any blood vessel (ARTERIES or VEINS) or the heart (HEART ANEURYSM). It indicates a thin and weakened area in the wall which may later rupture. Aneurysms are classified by location, etiology, or other characteristics.	0	2.35	2	0
Hematoma A collection of blood outside the BLOOD VESSELS. Hematoma can be localized in an organ, space, or tissue.	0	2.35	2	0
Dental Pulp Disease [description not available]	0	3.19	6	0
Dental Pulp Diseases Endodontic diseases of the DENTAL PULP inside the tooth, which is distinguished from PERIAPICAL DISEASES of the tissue surrounding the root.	0	3.19	6	0
Pericementitis [description not available]	0	6.76	13	2
Abscess, Periodontal [description not available]	0	2.35	2	0
Periodontitis Inflammation and loss of connective tissues supporting or surrounding the teeth. This may involve any part of the PERIODONTIUM. Periodontitis is currently classified by disease progression (CHRONIC PERIODONTITIS; AGGRESSIVE PERIODONTITIS) instead of age of onset. (From 1999 International Workshop for a Classification of Periodontal Diseases and Conditions, American Academy of Periodontology)	0	6.76	13	2
Cold Sore [description not available]	0	3.73	2	1
Herpes Labialis Herpes simplex, caused by type 1 virus, primarily spread by oral secretions and usually occurring as a concomitant of fever. It may also develop in the absence of fever or prior illness. It commonly involves the facial region, especially the lips and the nares. (Dorland, 27th ed.)	0	3.73	2	1
Amaurosis [description not available]	0	1.94	1	0
Blindness The inability to see or the loss or absence of perception of visual stimuli. This condition may be the result of EYE DISEASES; OPTIC NERVE DISEASES; OPTIC CHIASM diseases; or BRAIN DISEASES affecting the VISUAL PATHWAYS or OCCIPITAL LOBE.	0	1.94	1	0
Glaucoma An ocular disease, occurring in many forms, having as its primary characteristics an unstable or a sustained increase in the intraocular pressure which the eye cannot withstand without damage to its structure or impairment of its function. The consequences of the increased pressure may be manifested in a variety of symptoms, depending upon type and severity, such as excavation of the optic disk, hardness of the eyeball, corneal anesthesia, reduced visual acuity, seeing of colored halos around lights, disturbed dark adaptation, visual field defects, and headaches. (Dictionary of Visual Science, 4th ed)	0	4.02	3	1
Meningitis, Meningococcal, Serogroup A [description not available]	0	2.64	3	0
Experimental Pneumococcal Meningitis [description not available]	0	1.94	1	0
Listeria Cerebritis [description not available]	0	2.35	2	0
Haemophilus influenzae Meningitis Type B [description not available]	0	2.35	2	0
Meningitis, Meningococcal A fulminant infection of the meninges and subarachnoid fluid by the bacterium NEISSERIA MENINGITIDIS, producing diffuse inflammation and peri-meningeal venous thromboses. Clinical manifestations include FEVER, nuchal rigidity, SEIZURES, severe HEADACHE, petechial rash, stupor, focal neurologic deficits, HYDROCEPHALUS, and COMA. The organism is usually transmitted via nasopharyngeal secretions and is a leading cause of meningitis in children and young adults. Organisms from Neisseria meningitidis serogroups A, B, C, Y, and W-135 have been reported to cause meningitis. (From Adams et al., Principles of Neurology, 6th ed, pp689-701; Curr Opin Pediatr 1998 Feb;10(1):13-8)	0	2.64	3	0
Meningitis, Pneumococcal An acute purulent infection of the meninges and subarachnoid space caused by Streptococcus pneumoniae, most prevalent in children and adults over the age of 60. This illness may be associated with OTITIS MEDIA; MASTOIDITIS; SINUSITIS; RESPIRATORY TRACT INFECTIONS; sickle cell disease (ANEMIA, SICKLE CELL); skull fractures; and other disorders. Clinical manifestations include FEVER; HEADACHE; neck stiffness; and somnolence followed by SEIZURES; focal neurologic deficits (notably DEAFNESS); and COMA. (From Miller et al., Merritt's Textbook of Neurology, 9th ed, p111)	0	1.94	1	0
Equine Strongyle Infections [description not available]	0	1.95	1	0
Colitis Inflammation of the COLON section of the large intestine (INTESTINE, LARGE), usually with symptoms such as DIARRHEA (often with blood and mucus), ABDOMINAL PAIN, and FEVER.	0	4.1	16	0
Bovine Diseases [description not available]	0	8.2	46	1
Sterility, Male [description not available]	0	2.38	2	0
Infertility, Male The inability of the male to effect FERTILIZATION of an OVUM after a specified period of unprotected intercourse. Male sterility is permanent infertility.	0	2.38	2	0
Deficiency, Mental [description not available]	0	5.27	7	2
Foot Dermatoses Skin diseases of the foot, general or unspecified.	0	3.33	1	1
Intellectual Disability Subnormal intellectual functioning which originates during the developmental period. This has multiple potential etiologies, including genetic defects and perinatal insults. Intelligence quotient (IQ) scores are commonly used to determine whether an individual has an intellectual disability. IQ scores between 70 and 79 are in the borderline range. Scores below 67 are in the disabled range. (from Joynt, Clinical Neurology, 1992, Ch55, p28)	0	5.27	7	2
Anal Fissure [description not available]	0	4.02	3	1
Fissure in Ano A painful linear tear at the margin of the anus. It appears as a crack or slit in the mucous membrane of the anus and is very painful and difficult to heal.	0	4.02	3	1
Uveitis, Anterior Inflammation of the anterior uvea comprising the iris, angle structures, and the ciliary body. Manifestations of this disorder include ciliary injection, exudation into the anterior chamber, iris changes, and adhesions between the iris and lens (posterior synechiae). Intraocular pressure may be increased or reduced.	0	3.73	2	1
Pleuropericarditis Inflammation of both the PERICARDIUM and the PLEURA.	0	2.36	2	0
Pericarditis Inflammation of the PERICARDIUM from various origins, such as infection, neoplasm, autoimmune process, injuries, or drug-induced. Pericarditis usually leads to PERICARDIAL EFFUSION, or CONSTRICTIVE PERICARDITIS.	0	2.36	2	0
Buphthalmos [description not available]	0	1.94	1	0
Leukoma [description not available]	0	2.65	3	0
Corneal Opacity Disorder occurring in the central or peripheral area of the cornea. The usual degree of transparency becomes relatively opaque.	0	2.65	3	0
Egyptian Ophthalmia [description not available]	0	4.83	8	1
Blennorrhea, Inclusion [description not available]	0	2.64	3	0
Conjunctivitis, Inclusion An infection of the eyes characterized by the presence in conjunctival epithelial cells of inclusion bodies indistinguishable from those of trachoma. It is acquired by infants during birth and by adults from swimming pools. The etiological agent is CHLAMYDIA TRACHOMATIS whose natural habitat appears to be the genito-urinary tract. Inclusion conjunctivitis is a less severe disease than trachoma and usually clears up spontaneously.	0	2.64	3	0
Osteomyelitis INFLAMMATION of the bone as a result of infection. It may be caused by a variety of infectious agents, especially pyogenic (PUS - producing) BACTERIA.	1	7.63	19	1
Infectious Diseases [description not available]	0	4.01	15	0
Communicable Diseases An illness caused by an infectious agent or its toxins that occurs through the direct or indirect transmission of the infectious agent or its products from an infected individual or via an animal, vector or the inanimate environment to a susceptible animal or human host.	0	4.01	15	0
Anemia, Hypochromic Anemia characterized by a decrease in the ratio of the weight of hemoglobin to the volume of the erythrocyte, i.e., the mean corpuscular hemoglobin concentration is less than normal. The individual cells contain less hemoglobin than they could have under optimal conditions. Hypochromic anemia may be caused by iron deficiency from a low iron intake, diminished iron absorption, or excessive iron loss. It can also be caused by infections or other diseases, therapeutic drugs, lead poisoning, and other conditions. (Stedman, 25th ed; from Miale, Laboratory Medicine: Hematology, 6th ed, p393)	0	1.94	1	0
Pallor A clinical manifestation consisting of an unnatural paleness of the skin.	0	1.94	1	0
Gastric Ulcer [description not available]	0	3.2	6	0
Stomach Ulcer Ulceration of the GASTRIC MUCOSA due to contact with GASTRIC JUICE. It is often associated with HELICOBACTER PYLORI infection or consumption of nonsteroidal anti-inflammatory drugs (NSAIDS).	0	3.2	6	0
Vulvitis Inflammation of the VULVA. It is characterized by PRURITUS and painful urination.	0	2.34	2	0
Vaginitis Inflammation of the vagina characterized by pain and a purulent discharge.	0	6.04	11	1
Leishmania Infection [description not available]	0	1.94	1	0
Leishmaniasis A disease caused by any of a number of species of protozoa in the genus LEISHMANIA. There are four major clinical types of this infection: cutaneous (Old and New World) (LEISHMANIASIS, CUTANEOUS), diffuse cutaneous (LEISHMANIASIS, DIFFUSE CUTANEOUS), mucocutaneous (LEISHMANIASIS, MUCOCUTANEOUS), and visceral (LEISHMANIASIS, VISCERAL).	0	1.94	1	0
Foreign Bodies Inanimate objects that become enclosed in the body.	0	2.86	4	0
Boils [description not available]	0	4.58	6	1
Infections, Pneumococcal [description not available]	0	7.07	11	2
Pneumococcal Infections Infections with bacteria of the species STREPTOCOCCUS PNEUMONIAE.	0	7.07	11	2
Cicatrization The formation of fibrous tissue in the place of normal tissue during the process of WOUND HEALING. It includes scar tissue formation occurring in healing internal organs as well as in the skin after surface injuries.	0	5.51	9	2
Cicatrix The fibrous tissue that replaces normal tissue during the process of WOUND HEALING.	0	5.51	9	2
Dentin Hypersensitivity [description not available]	0	3.8	1	1
Allergy, Food [description not available]	0	2.41	1	0
Food Hypersensitivity Gastrointestinal disturbances, skin eruptions, or shock due to allergic reactions to allergens in food.	0	2.41	1	0
Insulin Sensitivity [description not available]	0	2.63	2	0
Insulin Resistance Diminished effectiveness of INSULIN in lowering blood sugar levels: requiring the use of 200 units or more of insulin per day to prevent HYPERGLYCEMIA or KETOSIS.	0	2.63	2	0
Nasal Diseases [description not available]	0	5.86	9	1
Autoimmune Disease [description not available]	0	2.66	2	0
MS (Multiple Sclerosis) [description not available]	0	2.65	3	0
Autoimmune Diseases Disorders that are characterized by the production of antibodies that react with host tissues or immune effector cells that are autoreactive to endogenous peptides.	0	2.66	2	0
Multiple Sclerosis An autoimmune disorder mainly affecting young adults and characterized by destruction of myelin in the central nervous system. Pathologic findings include multiple sharply demarcated areas of demyelination throughout the white matter of the central nervous system. Clinical manifestations include visual loss, extra-ocular movement disorders, paresthesias, loss of sensation, weakness, dysarthria, spasticity, ataxia, and bladder dysfunction. The usual pattern is one of recurrent attacks followed by partial recovery (see MULTIPLE SCLEROSIS, RELAPSING-REMITTING), but acute fulminating and chronic progressive forms (see MULTIPLE SCLEROSIS, CHRONIC PROGRESSIVE) also occur. (Adams et al., Principles of Neurology, 6th ed, p903)	0	2.65	3	0
Disbacteriosis [description not available]	0	2.96	3	0
Breast Cancer [description not available]	0	8.95	18	5
Breast Neoplasms Tumors or cancer of the human BREAST.	0	8.95	18	5
Obesity A status with BODY WEIGHT that is grossly above the recommended standards, usually due to accumulation of excess FATS in the body. The standards may vary with age, sex, genetic or cultural background. In the BODY MASS INDEX, a BMI greater than 30.0 kg/m2 is considered obese, and a BMI greater than 40.0 kg/m2 is considered morbidly obese (MORBID OBESITY).	0	6.82	15	1
Fish Diseases Diseases of freshwater, marine, hatchery or aquarium fish. This term includes diseases of both teleosts (true fish) and elasmobranchs (sharks, rays and skates).	0	4.32	4	1
DNA Virus Infections Diseases caused by DNA VIRUSES.	0	2.41	1	0
Drug-Induced Cochlear Toxicity [description not available]	0	4.13	11	0
Ototoxicity Damage to the EAR or its function secondary to exposure to toxic substances such as drugs used in CHEMOTHERAPY; IMMUNOTHERAPY; or RADIATION.	0	4.13	11	0
Acute Edematous Pancreatitis [description not available]	0	6.51	18	1
Pancreatitis INFLAMMATION of the PANCREAS. Pancreatitis is classified as acute unless there are computed tomographic or endoscopic retrograde cholangiopancreatographic findings of CHRONIC PANCREATITIS (International Symposium on Acute Pancreatitis, Atlanta, 1992). The two most common forms of acute pancreatitis are ALCOHOLIC PANCREATITIS and gallstone pancreatitis.	0	6.51	18	1
C gattii Infection [description not available]	0	2.41	1	0
Cryptococcosis Fungal infection caused by genus CRYPTOCOCCUS.	0	2.41	1	0
Besnoitiasis [description not available]	0	2.41	1	0
Autoimmune Diabetes [description not available]	0	3.15	5	0
Diabetes Mellitus, Type 1 A subtype of DIABETES MELLITUS that is characterized by INSULIN deficiency. It is manifested by the sudden onset of severe HYPERGLYCEMIA, rapid progression to DIABETIC KETOACIDOSIS, and DEATH unless treated with insulin. The disease may occur at any age, but is most common in childhood or adolescence.	0	3.15	5	0
Carcinoma, Non-Small Cell Lung [description not available]	0	5.28	4	1
Paronychia An inflammatory reaction involving the folds of the skin surrounding the fingernail. It is characterized by acute or chronic purulent, tender, and painful swellings of the tissues around the nail, caused by an abscess of the nail fold. The pathogenic yeast causing paronychia is most frequently Candida albicans. Saprophytic fungi may also be involved. The causative bacteria are usually Staphylococcus, Pseudomonas aeruginosa, or Streptococcus. (Andrews' Diseases of the Skin, 8th ed, p271)	0	3.33	7	0
Angiolymphoid Hyperplasia with Eosinophilia Solitary or multiple benign cutaneous nodules comprised of immature and mature vascular structures intermingled with endothelial cells and a varied infiltrate of eosinophils, histiocytes, lymphocytes, and mast cells.	0	2.6	1	0
Carcinoma, Non-Small-Cell Lung A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy.	0	5.28	4	1
Bacterial Eye Infections [description not available]	0	5.44	13	0
Liver Dysfunction [description not available]	0	10.27	54	4
Hepatitis INFLAMMATION of the LIVER.	0	5.58	18	1
Liver Diseases Pathological processes of the LIVER.	0	10.27	54	4
Calculosis [description not available]	0	2.25	1	0
Cholangitis Inflammation of the biliary ductal system (BILE DUCTS); intrahepatic, extrahepatic, or both.	0	6.86	7	4
Vitiligo A disorder consisting of areas of macular depigmentation, commonly on extensor aspects of extremities, on the face or neck, and in skin folds. Age of onset is often in young adulthood and the condition tends to progress gradually with lesions enlarging and extending until a quiescent state is reached.	0	4.99	2	1
Encephalopathy, Hepatic [description not available]	0	15.89	158	27
Hepatic Encephalopathy A syndrome characterized by central nervous system dysfunction in association with LIVER FAILURE, including portal-systemic shunts. Clinical features include lethargy and CONFUSION (frequently progressing to COMA); ASTERIXIS; NYSTAGMUS, PATHOLOGIC; brisk oculovestibular reflexes; decorticate and decerebrate posturing; MUSCLE SPASTICITY; and bilateral extensor plantar reflexes (see REFLEX, BABINSKI). ELECTROENCEPHALOGRAPHY may demonstrate triphasic waves. (From Adams et al., Principles of Neurology, 6th ed, pp1117-20; Plum & Posner, Diagnosis of Stupor and Coma, 3rd ed, p222-5)	0	15.89	158	27
Cardiometabolic Syndrome A cluster of symptoms that are risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components not only include metabolic dysfunctions of METABOLIC SYNDROME but also HYPERTENSION, and ABDOMINAL OBESITY.	0	2.21	1	0
Liver Steatosis [description not available]	0	3.75	11	0
Hyperglycemia, Postprandial Abnormally high BLOOD GLUCOSE level after a meal.	0	2.21	1	0
Fatty Liver Lipid infiltration of the hepatic parenchymal cells resulting in a yellow-colored liver. The abnormal lipid accumulation is usually in the form of TRIGLYCERIDES, either as a single large droplet or multiple small droplets. Fatty liver is caused by an imbalance in the metabolism of FATTY ACIDS.	0	3.75	11	0
Hyperglycemia Abnormally high BLOOD GLUCOSE level.	0	2.21	1	0
Metabolic Syndrome A cluster of symptoms that are risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components of metabolic syndrome include ABDOMINAL OBESITY; atherogenic DYSLIPIDEMIA; HYPERTENSION; HYPERGLYCEMIA; INSULIN RESISTANCE; a proinflammatory state; and a prothrombotic (THROMBOSIS) state.	0	2.21	1	0
Nerve Degeneration Loss of functional activity and trophic degeneration of nerve axons and their terminal arborizations following the destruction of their cells of origin or interruption of their continuity with these cells. The pathology is characteristic of neurodegenerative diseases. Often the process of nerve degeneration is studied in research on neuroanatomical localization and correlation of the neurophysiology of neural pathways.	0	4.42	22	0
Adhesions, Tissue [description not available]	0	4.28	7	0
Genital Herpes [description not available]	0	2.25	1	0
Herpes Genitalis Infection of the genitals (GENITALIA) with HERPES SIMPLEX VIRUS in either the males or the females.	0	2.25	1	0
Endotoxemia A condition characterized by the presence of ENDOTOXINS in the blood. On lysis, the outer cell wall of gram-negative bacteria enters the systemic circulation and initiates a pathophysiologic cascade of pro-inflammatory mediators.	0	4.33	4	1
Attachment Loss, Periodontal [description not available]	0	4.62	1	1
Infections, Coronavirus [description not available]	0	4.62	1	1
Chemical Dependence [description not available]	0	4.7	2	1
Osteoarthritis of Knee [description not available]	0	4.62	1	1
Liver Abscess, Pyogenic Single or multiple areas of PUS due to bacterial infection within the hepatic parenchyma. It can be caused by a variety of BACTERIA, local or disseminated from infections elsewhere such as in APPENDICITIS; CHOLECYSTITIS; PERITONITIS; and after LIVER TRANSPLANTATION.	0	4.62	1	1
Complications of Diabetes Mellitus [description not available]	0	9.07	14	6
Acute Kidney Failure [description not available]	0	8.99	24	4
Carcinogenesis The origin, production or development of cancer through genotypic and phenotypic changes which upset the normal balance between cell proliferation and cell death. Carcinogenesis generally requires a constellation of steps, which may occur quickly or over a period of many years.	0	8.19	10	4
Fatty Liver, Nonalcoholic [description not available]	0	4.62	1	1
Esophageal Squamous Cell Carcinoma A carcinoma that originates usually from cells on the surface of the middle and lower third of the ESOPHAGUS. Tumor cells exhibit typical squamous morphology and form large polypoid lesions. Mutations in RNF6, LZTS1, TGFBR2, DEC1, and WWOX1 genes are associated with this cancer.	0	4.62	1	1
2019 Novel Coronavirus Disease [description not available]	0	8.29	6	5
Ancylostomiasis Infection of humans or animals with hookworms of the genus ANCYLOSTOMA. Characteristics include anemia, dyspepsia, eosinophilia, and abdominal swelling.	0	4.62	1	1
Auricular Fibrillation [description not available]	0	4.62	1	1
Bladder Cancer [description not available]	0	5.52	6	1
Bladder Disorder, Neurogenic [description not available]	0	6.46	6	3
Benign Neoplasms, Brain [description not available]	0	7.87	6	4
Carcinoma, Epidermoid [description not available]	0	5.64	7	1
Cerebral Ischemia [description not available]	0	4.75	2	1
Caries, Dental [description not available]	0	4.62	1	1
Diabetes Mellitus, Adult-Onset [description not available]	0	4.62	1	1
Cancer of Esophagus [description not available]	0	5.38	5	1
Cancer of Gastrointestinal Tract [description not available]	0	5.19	4	1
Astrocytoma, Grade IV [description not available]	0	4.62	1	1
Glial Cell Tumors [description not available]	0	6.1	11	1
Focal Segmental Glomerulosclerosis [description not available]	0	4.62	1	1
Cardiac Failure [description not available]	0	7.68	5	4
Bleeding [description not available]	0	7.04	12	1
Infections, Klebsiella [description not available]	0	6.99	10	2
Cirrhosis, Liver [description not available]	0	13.62	90	13
Malignant Melanoma [description not available]	0	8.49	10	2
Mitral Incompetence [description not available]	0	4.62	1	1
Kahler Disease [description not available]	0	4.97	3	1
Cardiomyopathies, Primary [description not available]	0	4.62	1	1
Morbid Obesity [description not available]	0	4.62	1	1
Arthritis, Degenerative [description not available]	0	4.7	2	1
Pocket, Periodontal [description not available]	0	5.56	3	2
Condition, Preneoplastic [description not available]	0	4.68	2	1
Embolism, Pulmonary [description not available]	0	4.71	2	1
Acute Respiratory Distress Syndrome [description not available]	0	4.75	2	1
Linear Skull Fracture [description not available]	0	4.79	2	1
Cancer of Stomach [description not available]	0	10.29	16	10
Nicotine Addiction [description not available]	0	4.62	1	1
Zoonoses Diseases of non-human animals that may be transmitted to HUMANS or may be transmitted from humans to non-human animals.	0	4.62	1	1
Coxarthrosis [description not available]	0	4.62	1	1
Injury, Ischemia-Reperfusion [description not available]	0	7.97	7	4
MPTP Neurotoxicity Syndrome [description not available]	0	4.62	1	1
Shoulder Injuries Injuries involving the SHOULDERS and SHOULDER JOINT.	0	4.62	1	1
Hemorrhage, Gingival [description not available]	0	5.31	2	2
Local Neoplasm Recurrence [description not available]	0	8.16	12	6
Atrial Fibrillation Abnormal cardiac rhythm that is characterized by rapid, uncoordinated firing of electrical impulses in the upper chambers of the heart (HEART ATRIA). In such case, blood cannot be effectively pumped into the lower chambers of the heart (HEART VENTRICLES). It is caused by abnormal impulse generation.	0	4.62	1	1
Biliary Tract Diseases Diseases in any part of the BILIARY TRACT including the BILE DUCTS and the GALLBLADDER.	0	6.34	9	1
Urinary Bladder Neoplasms Tumors or cancer of the URINARY BLADDER.	0	5.52	6	1
Urinary Bladder, Neurogenic Dysfunction of the URINARY BLADDER due to disease of the central or peripheral nervous system pathways involved in the control of URINATION. This is often associated with SPINAL CORD DISEASES, but may also be caused by BRAIN DISEASES or PERIPHERAL NERVE DISEASES.	0	6.46	6	3
Brain Neoplasms Neoplasms of the intracranial components of the central nervous system, including the cerebral hemispheres, basal ganglia, hypothalamus, thalamus, brain stem, and cerebellum. Brain neoplasms are subdivided into primary (originating from brain tissue) and secondary (i.e., metastatic) forms. Primary neoplasms are subdivided into benign and malignant forms. In general, brain tumors may also be classified by age of onset, histologic type, or presenting location in the brain.	0	7.87	6	4
Carcinoma, Squamous Cell A carcinoma derived from stratified SQUAMOUS EPITHELIAL CELLS. It may also occur in sites where glandular or columnar epithelium is normally present. (From Stedman, 25th ed)	0	5.64	7	1
Cardiovascular Diseases Pathological conditions involving the CARDIOVASCULAR SYSTEM including the HEART; the BLOOD VESSELS; or the PERICARDIUM.	0	7.9	7	4
Brain Ischemia Localized reduction of blood flow to brain tissue due to arterial obstruction or systemic hypoperfusion. This frequently occurs in conjunction with brain hypoxia (HYPOXIA, BRAIN). Prolonged ischemia is associated with BRAIN INFARCTION.	0	4.75	2	1
Dental Caries Localized destruction of the tooth surface initiated by decalcification of the enamel followed by enzymatic lysis of organic structures and leading to cavity formation. If left unchecked, the cavity may penetrate the enamel and dentin and reach the pulp.	0	4.62	1	1
Diabetes Mellitus A heterogeneous group of disorders characterized by HYPERGLYCEMIA and GLUCOSE INTOLERANCE.	0	7.98	14	3
Diabetes Mellitus, Type 2 A subclass of DIABETES MELLITUS that is not INSULIN-responsive or dependent (NIDDM). It is characterized initially by INSULIN RESISTANCE and HYPERINSULINEMIA; and eventually by GLUCOSE INTOLERANCE; HYPERGLYCEMIA; and overt diabetes. Type II diabetes mellitus is no longer considered a disease exclusively found in adults. Patients seldom develop KETOSIS but often exhibit OBESITY.	0	4.62	1	1
Esophageal Neoplasms Tumors or cancer of the ESOPHAGUS.	0	5.38	5	1
Gingival Hemorrhage The flowing of blood from the marginal gingival area, particularly the sulcus, seen in such conditions as GINGIVITIS, marginal PERIODONTITIS, injury, and ASCORBIC ACID DEFICIENCY.	0	5.31	2	2
Glioblastoma A malignant form of astrocytoma histologically characterized by pleomorphism of cells, nuclear atypia, microhemorrhage, and necrosis. They may arise in any region of the central nervous system, with a predilection for the cerebral hemispheres, basal ganglia, and commissural pathways. Clinical presentation most frequently occurs in the fifth or sixth decade of life with focal neurologic signs or seizures.	0	4.62	1	1
Glioma Benign and malignant central nervous system neoplasms derived from glial cells (i.e., astrocytes, oligodendrocytes, and ependymocytes). Astrocytes may give rise to astrocytomas (ASTROCYTOMA) or glioblastoma multiforme (see GLIOBLASTOMA). Oligodendrocytes give rise to oligodendrogliomas (OLIGODENDROGLIOMA) and ependymocytes may undergo transformation to become EPENDYMOMA; CHOROID PLEXUS NEOPLASMS; or colloid cysts of the third ventricle. (From Escourolle et al., Manual of Basic Neuropathology, 2nd ed, p21)	0	6.1	11	1
Glomerulosclerosis, Focal Segmental A clinicopathological syndrome or diagnostic term for a type of glomerular injury that has multiple causes, primary or secondary. Clinical features include PROTEINURIA, reduced GLOMERULAR FILTRATION RATE, and EDEMA. Kidney biopsy initially indicates focal segmental glomerular consolidation (hyalinosis) or scarring which can progress to globally sclerotic glomeruli leading to eventual KIDNEY FAILURE.	0	4.62	1	1
Heart Failure A heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (VENTRICULAR DYSFUNCTION), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as MYOCARDIAL INFARCTION.	0	7.68	5	4
Hemorrhage Bleeding or escape of blood from a vessel.	0	7.04	12	1
Ischemia A hypoperfusion of the BLOOD through an organ or tissue caused by a PATHOLOGIC CONSTRICTION or obstruction of its BLOOD VESSELS, or an absence of BLOOD CIRCULATION.	0	7.47	8	1
Kidney Diseases Pathological processes of the KIDNEY or its component tissues.	0	8.79	40	1
Klebsiella Infections Infections with bacteria of the genus KLEBSIELLA.	0	6.99	10	2
Liver Cirrhosis Liver disease in which the normal microcirculation, the gross vascular anatomy, and the hepatic architecture have been variably destroyed and altered with fibrous septa surrounding regenerated or regenerating parenchymal nodules.	0	13.62	90	13
Melanoma A malignant neoplasm derived from cells that are capable of forming melanin, which may occur in the skin of any part of the body, in the eye, or, rarely, in the mucous membranes of the genitalia, anus, oral cavity, or other sites. It occurs mostly in adults and may originate de novo or from a pigmented nevus or malignant lentigo. Melanomas frequently metastasize widely, and the regional lymph nodes, liver, lungs, and brain are likely to be involved. The incidence of malignant skin melanomas is rising rapidly in all parts of the world. (Stedman, 25th ed; from Rook et al., Textbook of Dermatology, 4th ed, p2445)	0	8.49	10	2
Mitral Valve Insufficiency Backflow of blood from the LEFT VENTRICLE into the LEFT ATRIUM due to imperfect closure of the MITRAL VALVE. This can lead to mitral valve regurgitation.	0	4.62	1	1
Multiple Myeloma A malignancy of mature PLASMA CELLS engaging in monoclonal immunoglobulin production. It is characterized by hyperglobulinemia, excess Bence-Jones proteins (free monoclonal IMMUNOGLOBULIN LIGHT CHAINS) in the urine, skeletal destruction, bone pain, and fractures. Other features include ANEMIA; HYPERCALCEMIA; and RENAL INSUFFICIENCY.	0	4.97	3	1
Cardiomyopathies A group of diseases in which the dominant feature is the involvement of the CARDIAC MUSCLE itself. Cardiomyopathies are classified according to their predominant pathophysiological features (DILATED CARDIOMYOPATHY; HYPERTROPHIC CARDIOMYOPATHY; RESTRICTIVE CARDIOMYOPATHY) or their etiological/pathological factors (CARDIOMYOPATHY, ALCOHOLIC; ENDOCARDIAL FIBROELASTOSIS).	0	4.62	1	1
Obesity, Morbid The condition of weighing two, three, or more times the ideal weight, so called because it is associated with many serious and life-threatening disorders. In the BODY MASS INDEX, morbid obesity is defined as having a BMI greater than 40.0 kg/m2.	0	4.62	1	1
Osteoarthritis A progressive, degenerative joint disease, the most common form of arthritis, especially in older persons. The disease is thought to result not from the aging process but from biochemical changes and biomechanical stresses affecting articular cartilage. In the foreign literature it is often called osteoarthrosis deformans.	0	4.7	2	1
Periodontal Pocket An abnormal extension of a gingival sulcus accompanied by the apical migration of the epithelial attachment and bone resorption.	0	5.56	3	2
Pneumonia, Viral Inflammation of the lung parenchyma that is caused by a viral infection.	0	4.95	3	1
Precancerous Conditions Pathological conditions that tend eventually to become malignant.	0	4.68	2	1
Pulmonary Embolism Blocking of the PULMONARY ARTERY or one of its branches by an EMBOLUS.	0	4.71	2	1
Respiratory Distress Syndrome A syndrome characterized by progressive life-threatening RESPIRATORY INSUFFICIENCY in the absence of known LUNG DISEASES, usually following a systemic insult such as surgery or major TRAUMA.	0	4.75	2	1
Stomach Neoplasms Tumors or cancer of the STOMACH.	0	10.29	16	10
Tobacco Use Disorder Tobacco used to the detriment of a person's health or social functioning. Tobacco dependence is included.	0	4.62	1	1
Osteoarthritis, Hip Noninflammatory degenerative disease of the hip joint which usually appears in late middle or old age. It is characterized by growth or maturational disturbances in the femoral neck and head, as well as acetabular dysplasia. A dominant symptom is pain on weight-bearing or motion.	0	4.62	1	1
Reperfusion Injury Adverse functional, metabolic, or structural changes in tissues that result from the restoration of blood flow to the tissue (REPERFUSION) following ISCHEMIA.	0	7.97	7	4
Coronavirus Infections Virus diseases caused by the CORONAVIRUS genus. Some specifics include transmissible enteritis of turkeys (ENTERITIS, TRANSMISSIBLE, OF TURKEYS); FELINE INFECTIOUS PERITONITIS; and transmissible gastroenteritis of swine (GASTROENTERITIS, TRANSMISSIBLE, OF SWINE).	0	4.62	1	1
Substance-Related Disorders Disorders related to substance use or abuse.	0	4.7	2	1
Osteoarthritis, Knee Noninflammatory degenerative disease of the knee joint consisting of three large categories: conditions that block normal synchronous movement, conditions that produce abnormal pathways of motion, and conditions that cause stress concentration resulting in changes to articular cartilage. (Crenshaw, Campbell's Operative Orthopaedics, 8th ed, p2019)	0	4.62	1	1
Lipid Metabolism Disorders Pathological conditions resulting from abnormal anabolism or catabolism of lipids in the body.	0	4.62	1	1
Acute Kidney Injury Abrupt reduction in kidney function. Acute kidney injury encompasses the entire spectrum of the syndrome including acute kidney failure; ACUTE KIDNEY TUBULAR NECROSIS; and other less severe conditions.	0	8.99	24	4
Non-alcoholic Fatty Liver Disease Fatty liver finding without excessive ALCOHOL CONSUMPTION.	0	4.62	1	1
Nasal Bleeding [description not available]	0	9.66	21	7
Epistaxis Bleeding from the nose.	0	9.66	21	7
Blood Clot [description not available]	0	3.8	4	0
Thrombosis Formation and development of a thrombus or blood clot in the blood vessel.	0	3.8	4	0
Dermatomycoses Superficial infections of the skin or its appendages by any of various fungi.	0	7.18	14	3
Astrocytosis [description not available]	0	2.15	1	0
Anastomotic Leak Breakdown of the connection and subsequent leakage of effluent (fluids, secretions, air) from a SURGICAL ANASTOMOSIS of the digestive, respiratory, genitourinary, and cardiovascular systems. Most common leakages are from the breakdown of suture lines in gastrointestinal or bowel anastomosis.	0	2.17	1	0
Chromoblastomycosis Scaly papule or warty growth, caused by five fungi, that spreads as a result of satellite lesions affecting the foot or leg. The extremity may become swollen and, at its distal portion, covered with various nodular, tumorous, verrucous lesions that resemble cauliflower. In rare instances, the disease may begin on the hand or wrist and involve the entire upper extremity. (Arnold, Odom, and James, Andrew's Diseases of the Skin, 8th ed, p362)	0	2.17	1	0
Experimental Lung Inflammation Inflammation of any part, segment or lobe, of the lung parenchyma.	0	6.55	19	1
Fibroma, Shope [description not available]	0	4.26	4	1
Pneumonia Infection of the lung often accompanied by inflammation.	0	6.55	19	1
Bacterial Skin Diseases [description not available]	0	5	9	0
Skin Diseases, Bacterial Skin diseases caused by bacteria.	0	5	9	0
Cane-Cutter Fever [description not available]	0	3.79	4	0
Leptospirosis Infections with bacteria of the genus LEPTOSPIRA.	0	3.79	4	0
Adenomatous Polyposis Coli, Familial [description not available]	0	3.81	2	1
Adenomatous Polyposis Coli A polyposis syndrome due to an autosomal dominant mutation of the APC genes (GENES, APC) on CHROMOSOME 5. The syndrome is characterized by the development of hundreds of ADENOMATOUS POLYPS in the COLON and RECTUM of affected individuals by early adulthood.	0	3.81	2	1
Dysentery, Shiga bacillus [description not available]	0	7.13	50	2
Dysentery, Bacillary DYSENTERY caused by gram-negative rod-shaped enteric bacteria (ENTEROBACTERIACEAE), most often by the genus SHIGELLA. Shigella dysentery, Shigellosis, is classified into subgroups according to syndrome severity and the infectious species. Group A: SHIGELLA DYSENTERIAE (severest); Group B: SHIGELLA FLEXNERI; Group C: SHIGELLA BOYDII; and Group D: SHIGELLA SONNEI (mildest).	0	7.13	50	2
Ocular Infections [description not available]	0	2.66	3	0
Eye Infections Infection, moderate to severe, caused by bacteria, fungi, or viruses, which occurs either on the external surface of the eye or intraocularly with probable inflammation, visual impairment, or blindness.	1	4.66	3	0
Mouth Ulcer [description not available]	0	2.17	1	0
Aldosteronism [description not available]	0	2.17	1	0
Hypokalemia Abnormally low potassium concentration in the blood. It may result from potassium loss by renal secretion or by the gastrointestinal route, as by vomiting or diarrhea. It may be manifested clinically by neuromuscular disorders ranging from weakness to paralysis, by electrocardiographic abnormalities (depression of the T wave and elevation of the U wave), by renal disease, and by gastrointestinal disorders. (Dorland, 27th ed)	0	3.06	5	0
Drop Attack [description not available]	0	2.17	1	0
Hyperaldosteronism A condition caused by the overproduction of ALDOSTERONE. It is characterized by sodium retention and potassium excretion with resultant HYPERTENSION and HYPOKALEMIA.	0	2.17	1	0
Syncope A transient loss of consciousness and postural tone caused by diminished blood flow to the brain (i.e., BRAIN ISCHEMIA). Presyncope refers to the sensation of lightheadedness and loss of strength that precedes a syncopal event or accompanies an incomplete syncope. (From Adams et al., Principles of Neurology, 6th ed, pp367-9)	0	2.17	1	0
Oral Ulcer A loss of mucous substance of the mouth showing local excavation of the surface, resulting from the sloughing of inflammatory necrotic tissue. It is the result of a variety of causes, e.g., denture irritation, aphthous stomatitis (STOMATITIS, APHTHOUS); NOMA; necrotizing gingivitis (GINGIVITIS, NECROTIZING ULCERATIVE); TOOTHBRUSHING; and various irritants. (From Jablonski, Dictionary of Dentistry, 1992, p842)	0	2.17	1	0
Phlegmon [description not available]	0	3.97	5	0
Eosinophilia, Tropical [description not available]	0	3.09	1	0
Cellulitis An acute, diffuse, and suppurative inflammation of loose connective tissue, particularly the deep subcutaneous tissues, and sometimes muscle, which is most commonly seen as a result of infection of a wound, ulcer, or other skin lesions.	0	3.97	5	0
Eosinophilia Abnormal increase of EOSINOPHILS in the blood, tissues or organs.	0	3.09	1	0
Itching [description not available]	0	3.45	8	0
Pruritus An intense itching sensation that produces the urge to rub or scratch the skin to obtain relief.	0	3.45	8	0
Blood Pressure, High [description not available]	0	4.58	10	0
Hypertension Persistently high systemic arterial BLOOD PRESSURE. Based on multiple readings (BLOOD PRESSURE DETERMINATION), hypertension is currently defined as when SYSTOLIC PRESSURE is consistently greater than 140 mm Hg or when DIASTOLIC PRESSURE is consistently 90 mm Hg or more.	0	4.58	10	0
Adenocarcinoma, Basal Cell [description not available]	0	5.99	15	2
Adenocarcinoma A malignant epithelial tumor with a glandular organization.	0	5.99	15	2
Lacrimal Duct Obstruction Interference with the secretion of tears by the lacrimal glands. Obstruction of the LACRIMAL SAC or NASOLACRIMAL DUCT causing acute or chronic inflammation of the lacrimal sac (DACRYOCYSTITIS). It is caused also in infants by failure of the nasolacrimal duct to open into the inferior meatus and occurs about the third week of life. In adults occlusion may occur spontaneously or after injury or nasal disease. (Newell, Ophthalmology: Principles and Concepts, 7th ed, p250)	0	4.96	9	1
Biliary Cirrhosis [description not available]	0	2.66	3	0
Liver Cirrhosis, Biliary FIBROSIS of the hepatic parenchyma due to obstruction of BILE flow (CHOLESTASIS) in the intrahepatic or extrahepatic bile ducts (BILE DUCTS, INTRAHEPATIC; BILE DUCTS, EXTRAHEPATIC). Primary biliary cholangitis involves the destruction of small intra-hepatic bile ducts and decreased bile secretion. Secondary biliary cholangitis is produced by prolonged obstruction of large intrahepatic or extrahepatic bile ducts from a variety of causes.	0	2.66	3	0
Contracture Prolonged shortening of the muscle or other soft tissue around a joint, preventing movement of the joint.	0	2.17	1	0
Dermatitis, Contact, Phototoxic [description not available]	0	2.21	1	0
Candidiasis, Genital [description not available]	0	5.03	5	2
Bacterial Vaginitides [description not available]	0	5.07	5	2
Candidiasis, Vulvovaginal Infection of the VULVA and VAGINA with a fungus of the genus CANDIDA.	0	5.03	5	2
Vaginosis, Bacterial Polymicrobial, nonspecific vaginitis associated with positive cultures of Gardnerella vaginalis and other anaerobic organisms and a decrease in lactobacilli. It remains unclear whether the initial pathogenic event is caused by the growth of anaerobes or a primary decrease in lactobacilli.	0	5.07	5	2
Bordetella pertussis Infection, Respiratory [description not available]	0	2.39	2	0
Whooping Cough A respiratory infection caused by BORDETELLA PERTUSSIS and characterized by paroxysmal coughing ending in a prolonged crowing intake of breath.	0	2.39	2	0
Afferent Pupillary Defect [description not available]	0	2.08	1	0
Chorioretinitis Inflammation of the choroid in which the sensory retina becomes edematous and opaque. The inflammatory cells and exudate may burst through the sensory retina to cloud the vitreous body.	0	2.08	1	0
Panuveitis Inflammation in which both the anterior and posterior segments of the uvea are involved and a specific focus is not apparent. It is often severe and extensive and a serious threat to vision. Causes include systemic diseases such as tuberculosis, sarcoidosis, and syphilis, as well as malignancies. The intermediate segment of the eye is not involved.	0	2.45	2	0
Deafness, Sudden Complete sensorineural hearing loss which develops suddenly over a period of hours or a few days.	0	2.08	1	0
Lymphoma of Mucosa-Associated Lymphoid Tissue [description not available]	0	3.48	1	1
Conjunctival Neoplasms Tumors or cancer of the CONJUNCTIVA.	0	3.8	2	1
Lymphoma, B-Cell, Marginal Zone Extranodal lymphoma of lymphoid tissue associated with mucosa that is in contact with exogenous antigens. Many of the sites of these lymphomas, such as the stomach, salivary gland, and thyroid, are normally devoid of lymphoid tissue. They acquire mucosa-associated lymphoid tissue (MALT) type as a result of an immunologically mediated disorder.	0	3.48	1	1
Chemical Sensitivities, Multiple [description not available]	0	2.1	1	0
Allergic Conjunctivitis [description not available]	0	4.29	4	1
Conjunctivitis, Allergic Conjunctivitis due to hypersensitivity to various allergens.	0	4.29	4	1
Abnormality, Heart [description not available]	0	2.39	2	0
Asplenia Syndrome [description not available]	0	2.08	1	0
Heart Defects, Congenital Developmental abnormalities involving structures of the heart. These defects are present at birth but may be discovered later in life.	0	2.39	2	0
Allodynia [description not available]	0	5.37	7	0
Ileitis Inflammation of any segment of the ILEUM and the ILEOCECAL VALVE.	0	5.35	7	0
Calcification, Pathologic [description not available]	0	3.15	5	0
Calcinosis Pathologic deposition of calcium salts in tissues.	0	3.15	5	0
Urinary Tract Diseases [description not available]	0	2.62	3	0
Amyotonia Congenita [description not available]	0	4.11	6	0
Neuromuscular Diseases A general term encompassing lower MOTOR NEURON DISEASE; PERIPHERAL NERVOUS SYSTEM DISEASES; and certain MUSCULAR DISEASES. Manifestations include MUSCLE WEAKNESS; FASCICULATION; muscle ATROPHY; SPASM; MYOKYMIA; MUSCLE HYPERTONIA, myalgias, and MUSCLE HYPOTONIA.	0	4.11	6	0
Neuromuscular Blockade The intentional interruption of transmission at the NEUROMUSCULAR JUNCTION by external agents, usually neuromuscular blocking agents. It is distinguished from NERVE BLOCK in which nerve conduction (NEURAL CONDUCTION) is interrupted rather than neuromuscular transmission. Neuromuscular blockade is commonly used to produce MUSCLE RELAXATION as an adjunct to anesthesia during surgery and other medical procedures. It is also often used as an experimental manipulation in basic research. It is not strictly speaking anesthesia but is grouped here with anesthetic techniques. The failure of neuromuscular transmission as a result of pathological processes is not included here.	0	3.2	6	0
Colitis, Mucous [description not available]	0	11.19	13	10
Irritable Bowel Syndrome A disorder with chronic or recurrent colonic symptoms without a clearcut etiology. This condition is characterized by chronic or recurrent ABDOMINAL PAIN, bloating, MUCUS in FECES, and an erratic disturbance of DEFECATION.	0	11.19	13	10
Colonic Inertia Symptom characterized by the passage of stool once a week or less.	0	10.39	14	12
Constipation Infrequent or difficult evacuation of FECES. These symptoms are associated with a variety of causes, including low DIETARY FIBER intake, emotional or nervous disturbances, systemic and structural disorders, drug-induced aggravation, and infections.	0	10.39	14	12
Lichen Planus, Oral Oral lesions accompanying cutaneous lichen planus or often occurring alone. The buccal mucosa, lips, gingivae, floor of the mouth, and palate are usually affected (in a descending order of frequency). Typically, oral lesions consist of radiating white or gray, velvety, threadlike lines, arranged in a reticular pattern, at the intersection of which there may be minute, white, elevated dots or streaks (Wickham's striae). (Jablonski, Illustrated Dictionary of Dentistry)	0	3.48	1	1
Sicca Syndrome [description not available]	0	2.38	2	0
Sjogren's Syndrome Chronic inflammatory and autoimmune disease in which the salivary and lacrimal glands undergo progressive destruction by lymphocytes and plasma cells resulting in decreased production of saliva and tears. The primary form, often called sicca syndrome, involves both KERATOCONJUNCTIVITIS SICCA and XEROSTOMIA. The secondary form includes, in addition, the presence of a connective tissue disease, usually rheumatoid arthritis.	0	2.38	2	0
Visceral Pain Pain originating from internal organs (VISCERA) associated with autonomic phenomena (PALLOR; SWEATING; NAUSEA; and VOMITING). It often becomes a REFERRED PAIN.	0	2.1	1	0
Anxiety Feelings or emotions of dread, apprehension, and impending disaster but not disabling as with ANXIETY DISORDERS.	0	2.1	1	0
Cushing's Syndrome [description not available]	0	3.61	3	0
Cushing Syndrome A condition caused by prolonged exposure to excess levels of cortisol (HYDROCORTISONE) or other GLUCOCORTICOIDS from endogenous or exogenous sources. It is characterized by upper body OBESITY; OSTEOPOROSIS; HYPERTENSION; DIABETES MELLITUS; HIRSUTISM; AMENORRHEA; and excess body fluid. Endogenous Cushing syndrome or spontaneous hypercortisolism is divided into two groups, those due to an excess of ADRENOCORTICOTROPIN and those that are ACTH-independent.	0	3.61	3	0
Lung Injury, Acute [description not available]	0	2.1	1	0
Acute Lung Injury A condition of lung damage that is characterized by bilateral pulmonary infiltrates (PULMONARY EDEMA) rich in NEUTROPHILS, and in the absence of clinical HEART FAILURE. This can represent a spectrum of pulmonary lesions, endothelial and epithelial, due to numerous factors (physical, chemical, or biological).	0	2.1	1	0
Muscle Contraction A process leading to shortening and/or development of tension in muscle tissue. Muscle contraction occurs by a sliding filament mechanism whereby actin filaments slide inward among the myosin filaments.	0	4.94	38	0
Atresia, Biliary [description not available]	0	5.57	3	2
Biliary Atresia Progressive destruction or the absence of all or part of the extrahepatic BILE DUCTS, resulting in the complete obstruction of BILE flow. Usually, biliary atresia is found in infants and accounts for one third of the neonatal cholestatic JAUNDICE.	0	5.57	3	2
Airflow Obstruction, Chronic [description not available]	0	2.11	1	0
Pulmonary Disease, Chronic Obstructive A disease of chronic diffuse irreversible airflow obstruction. Subcategories of COPD include CHRONIC BRONCHITIS and PULMONARY EMPHYSEMA.	0	2.11	1	0
Aging The gradual irreversible changes in structure and function of an organism that occur as a result of the passage of time.	0	4.98	15	0
Deafness Unilateral [description not available]	0	2.48	2	0
Kidney Failure A severe irreversible decline in the ability of kidneys to remove wastes, concentrate URINE, and maintain ELECTROLYTE BALANCE; BLOOD PRESSURE; and CALCIUM metabolism.	0	2.86	4	0
Renal Insufficiency Conditions in which the KIDNEYS perform below the normal level in the ability to remove wastes, concentrate URINE, and maintain ELECTROLYTE BALANCE; BLOOD PRESSURE; and CALCIUM metabolism. Renal insufficiency can be classified by the degree of kidney damage (as measured by the level of PROTEINURIA) and reduction in GLOMERULAR FILTRATION RATE.	0	2.86	4	0
Infections, Staphylococcal Skin [description not available]	0	4.51	5	1
Staphylococcal Skin Infections Infections to the skin caused by bacteria of the genus STAPHYLOCOCCUS.	0	4.51	5	1
Keratitis, Acanthamoeba [description not available]	0	6.78	23	1
Acanthamoeba Keratitis Infection of the cornea by an ameboid protozoan which may cause corneal ulceration leading to blindness.	0	6.78	23	1
Animal Diseases Diseases that occur in VERTEBRATE animals.	0	2.65	3	0
Rodent Diseases Diseases of rodents of the order RODENTIA. This term includes diseases of Sciuridae (squirrels), Geomyidae (gophers), Heteromyidae (pouched mice), Castoridae (beavers), Cricetidae (rats and mice), Muridae (Old World rats and mice), Erethizontidae (porcupines), and Caviidae (guinea pigs).	0	3.22	6	0
Skin Ulcer An ULCER of the skin and underlying tissues.	0	6.55	19	3
Delayed Effects, Prenatal Exposure [description not available]	0	2.13	1	0
Dermatitis, Irritant A non-allergic contact dermatitis caused by prolonged exposure to irritants and not explained by delayed hypersensitivity mechanisms.	0	2.13	1	0
Facial Dermatoses Skin diseases involving the FACE.	0	3.34	7	0
Leg Dermatoses A nonspecific term used to denote any cutaneous lesion or group of lesions, or eruptions of any type on the leg. (From Stedman, 25th ed)	0	3.21	6	0
Barrett Epithelium [description not available]	0	2.13	1	0
Esophageal Reflux [description not available]	0	2.13	1	0
Barrett Esophagus A condition with damage to the lining of the lower ESOPHAGUS resulting from chronic acid reflux (ESOPHAGITIS, REFLUX). Through the process of metaplasia, the squamous cells are replaced by a columnar epithelium with cells resembling those of the INTESTINE or the salmon-pink mucosa of the STOMACH. Barrett's columnar epithelium is a marker for severe reflux and precursor to ADENOCARCINOMA of the esophagus.	0	2.13	1	0
Gastroesophageal Reflux Retrograde flow of gastric juice (GASTRIC ACID) and/or duodenal contents (BILE ACIDS; PANCREATIC JUICE) into the distal ESOPHAGUS, commonly due to incompetence of the LOWER ESOPHAGEAL SPHINCTER.	0	2.13	1	0
Complications, Infectious Pregnancy [description not available]	0	6.33	15	1
Insect Bites [description not available]	0	2.13	1	0
American Trypanosomiasis [description not available]	0	2.44	2	0
Insect Bites and Stings Bites and stings inflicted by insects.	0	2.13	1	0
Chagas Disease Infection with the protozoan parasite TRYPANOSOMA CRUZI, a form of TRYPANOSOMIASIS endemic in Central and South America. It is named after the Brazilian physician Carlos Chagas, who discovered the parasite. Infection by the parasite (positive serologic result only) is distinguished from the clinical manifestations that develop years later, such as destruction of PARASYMPATHETIC GANGLIA; CHAGAS CARDIOMYOPATHY; and dysfunction of the ESOPHAGUS or COLON.	0	2.44	2	0
Cerebrospinal Fluid Otorrhea Discharge of cerebrospinal fluid through the external auditory meatus or through the eustachian tube into the nasopharynx. This is usually associated with CRANIOCEREBRAL TRAUMA (e.g., SKULL FRACTURE involving the TEMPORAL BONE;), NEUROSURGICAL PROCEDURES; or other conditions, but may rarely occur spontaneously. (From Am J Otol 1995 Nov;16(6):765-71)	0	6.59	6	2
Exertional Heat Illness [description not available]	0	2.04	1	0
Cacosmia [description not available]	0	2.96	1	0
Milk-Alkali Syndrome [description not available]	0	2.04	1	0
Hypercalcemia Abnormally high level of calcium in the blood.	0	2.04	1	0
Burns, Chemical Burns caused by contact with or exposure to CAUSTICS or strong ACIDS.	0	3.45	8	0
Graft-Versus-Host Disease [description not available]	0	4.87	8	1
Cytomegalovirus A genus of the family HERPESVIRIDAE, subfamily BETAHERPESVIRINAE, infecting the salivary glands, liver, spleen, lungs, eyes, and other organs, in which they produce characteristically enlarged cells with intranuclear inclusions. Infection with Cytomegalovirus is also seen as an opportunistic infection in AIDS.	0	3.71	10	0
Graft vs Host Disease The clinical entity characterized by anorexia, diarrhea, loss of hair, leukopenia, thrombocytopenia, growth retardation, and eventual death brought about by the GRAFT VS HOST REACTION.	0	4.87	8	1
Cancer of the Vagina [description not available]	0	3.43	1	1
Vaginal Diseases Pathological processes of the VAGINA.	0	5.15	6	2
Vaginal Neoplasms Tumors or cancer of the VAGINA.	0	3.43	1	1
Corneal Angiogenesis [description not available]	0	2.05	1	0
Corneal Edema An excessive amount of fluid in the cornea due to damage of the epithelium or endothelium causing decreased visual acuity.	0	2.05	1	0
Corneal Neovascularization New blood vessels originating from the corneal blood vessels and extending from the limbus into the adjacent CORNEAL STROMA. Neovascularization in the superficial and/or deep corneal stroma is a sequel to numerous inflammatory diseases of the ocular anterior segment, such as TRACHOMA, viral interstitial KERATITIS, microbial KERATOCONJUNCTIVITIS, and the immune response elicited by CORNEAL TRANSPLANTATION.	0	2.05	1	0
Autolysis, Dental Pulp [description not available]	0	2.87	4	0
Exposure, Dental Pulp [description not available]	0	4.03	3	1
Dental Pulp Exposure The result of pathological changes in the hard tissue of a tooth caused by carious lesions, mechanical factors, or trauma, which render the pulp susceptible to bacterial invasion from the external environment.	0	4.03	3	1
Short Bowel Syndrome A malabsorption syndrome resulting from extensive operative resection of the SMALL INTESTINE, the absorptive region of the GASTROINTESTINAL TRACT.	0	3.09	5	0
Antibiotic-Associated Colitis [description not available]	0	5.78	12	2
Enterocolitis, Pseudomembranous An acute inflammation of the INTESTINAL MUCOSA that is characterized by the presence of pseudomembranes or plaques in the SMALL INTESTINE (pseudomembranous enteritis) and the LARGE INTESTINE (pseudomembranous colitis). It is commonly associated with antibiotic therapy and CLOSTRIDIUM DIFFICILE colonization.	0	5.78	12	2
Intraepithelial Prostatic Neoplasia [description not available]	0	2.05	1	0
Prostatic Intraepithelial Neoplasia A premalignant change arising in the prostatic epithelium, regarded as the most important and most likely precursor of prostatic adenocarcinoma. The neoplasia takes the form of an intra-acinar or ductal proliferation of secretory cells with unequivocal nuclear anaplasia, which corresponds to nuclear grade 2 and 3 invasive prostate cancer.	0	2.05	1	0
Atopic Hypersensitivity [description not available]	0	2.65	3	0
Cardiac Hypertrophy Enlargement of the HEART due to chamber HYPERTROPHY, an increase in wall thickness without an increase in the number of cells (MYOCYTES, CARDIAC). It is the result of increase in myocyte size, mitochondrial and myofibrillar mass, as well as changes in extracellular matrix.	0	2.05	1	0
Cardiomegaly Enlargement of the HEART, usually indicated by a cardiothoracic ratio above 0.50. Heart enlargement may involve the right, the left, or both HEART VENTRICLES or HEART ATRIA. Cardiomegaly is a nonspecific symptom seen in patients with chronic systolic heart failure (HEART FAILURE) or several forms of CARDIOMYOPATHIES.	0	2.05	1	0
Ache [description not available]	0	6.22	13	3
Pain An unpleasant sensation induced by noxious stimuli which are detected by NERVE ENDINGS of NOCICEPTIVE NEURONS.	0	6.22	13	3
Foot Diseases Anatomical and functional disorders affecting the foot.	0	3.45	8	0
Pemphigus Foliaceus [description not available]	0	3.21	6	0
Pemphigus Group of chronic blistering diseases characterized histologically by ACANTHOLYSIS and blister formation within the EPIDERMIS.	0	3.21	6	0
Herpes Simplex Keratitis [description not available]	0	3.08	5	0
Keratitis, Herpetic A superficial, epithelial Herpesvirus hominis infection of the cornea, characterized by the presence of small vesicles which may break down and coalesce to form dendritic ulcers (KERATITIS, DENDRITIC). (Dictionary of Visual Science, 3d ed)	0	3.08	5	0
Affective Disorders [description not available]	0	2.05	1	0
Mood Disorders Those disorders that have a disturbance in mood as their predominant feature.	0	2.05	1	0
Abnormal Movements [description not available]	0	2.96	1	0
Marasmus [description not available]	0	3.77	2	0
Protein-Energy Malnutrition The lack of sufficient energy or protein to meet the body's metabolic demands, as a result of either an inadequate dietary intake of protein, intake of poor quality dietary protein, increased demands due to disease, or increased nutrient losses.	0	3.77	2	0
Anaplastic Astrocytoma [description not available]	0	2.05	1	0
Astrocytoma Neoplasms of the brain and spinal cord derived from glial cells which vary from histologically benign forms to highly anaplastic and malignant tumors. Fibrillary astrocytomas are the most common type and may be classified in order of increasing malignancy (grades I through IV). In the first two decades of life, astrocytomas tend to originate in the cerebellar hemispheres; in adults, they most frequently arise in the cerebrum and frequently undergo malignant transformation. (From Devita et al., Cancer: Principles and Practice of Oncology, 5th ed, pp2013-7; Holland et al., Cancer Medicine, 3d ed, p1082)	0	2.05	1	0
Alcoholic Hepatitis [description not available]	0	2.67	3	0
Hepatitis, Alcoholic INFLAMMATION of the LIVER due to ALCOHOL ABUSE. It is characterized by NECROSIS of HEPATOCYTES, infiltration by NEUTROPHILS, and deposit of MALLORY BODIES. Depending on its severity, the inflammatory lesion may be reversible or progress to LIVER CIRRHOSIS.	0	2.67	3	0
Cancer of Skin [description not available]	0	3.21	6	0
Facial Neoplasms New abnormal growth of tissue in the FACE.	0	2.04	1	0
Skin Neoplasms Tumors or cancer of the SKIN.	0	3.21	6	0
Vaccinia The cutaneous and occasional systemic reactions associated with vaccination using smallpox (variola) vaccine.	0	3.05	5	0
Brown Tendon Sheath Syndrome [description not available]	0	2.05	1	0
Cellulitis, Orbital [description not available]	0	2.05	1	0
Eye Infections, Viral Infections of the eye caused by minute intracellular agents. These infections may lead to severe inflammation in various parts of the eye - conjunctiva, iris, eyelids, etc. Several viruses have been identified as the causative agents. Among these are Herpesvirus, Adenovirus, Poxvirus, and Myxovirus.	0	2.05	1	0
Experimental Radiation Injuries [description not available]	0	4.37	8	0
Anemia, Cooley's [description not available]	0	2.05	1	0
beta-Thalassemia A disorder characterized by reduced synthesis of the beta chains of hemoglobin. There is retardation of hemoglobin A synthesis in the heterozygous form (thalassemia minor), which is asymptomatic, while in the homozygous form (thalassemia major, Cooley's anemia, Mediterranean anemia, erythroblastic anemia), which can result in severe complications and even death, hemoglobin A synthesis is absent.	0	2.05	1	0
Aortitis Inflammation of the wall of the AORTA.	0	2.05	1	0
Infections, Prosthesis-Related [description not available]	0	2.74	3	0
Diaper Rashes [description not available]	0	3.58	3	0
Diaper Rash A type of irritant dermatitis localized to the area in contact with a diaper and occurring most often as a reaction to prolonged contact with urine, feces, or retained soap or detergent.	0	3.58	3	0
Depression Depressive states usually of moderate intensity in contrast with MAJOR DEPRESSIVE DISORDER present in neurotic and psychotic disorders.	0	2.37	2	0
Air Embolism [description not available]	0	2.06	1	0
Day Blindness [description not available]	0	4.26	4	0
Arthritis, Post-Infectious [description not available]	0	3.79	2	1
Arthritis, Reactive An aseptic, inflammatory arthritis developing secondary to a primary extra-articular infection, most typically of the GASTROINTESTINAL TRACT or UROGENITAL SYSTEM. The initiating trigger pathogens are usually SHIGELLA; SALMONELLA; YERSINIA; CAMPYLOBACTER; or CHLAMYDIA TRACHOMATIS. Reactive arthritis is strongly associated with HLA-B27 ANTIGEN.	0	3.79	2	1
Cochlear Diseases Pathological processes of the snail-like structure (COCHLEA) of the inner ear (LABYRINTH) which can involve its nervous tissue, blood vessels, or fluid (ENDOLYMPH).	0	2.7	3	0
Anesthesia A state characterized by loss of feeling or sensation. This depression of nerve function is usually the result of pharmacologic action and is induced to allow performance of surgery or other painful procedures.	0	4.02	15	0
Injuries, Spinal Cord [description not available]	0	4.1	3	1
Spinal Cord Injuries Penetrating and non-penetrating injuries to the spinal cord resulting from traumatic external forces (e.g., WOUNDS, GUNSHOT; WHIPLASH INJURIES; etc.).	0	4.1	3	1
Infections, Salmonella [description not available]	0	6.69	32	2
Inflammatory Response Syndrome, Systemic [description not available]	0	2.99	1	0
Chronic Liver Failure [description not available]	0	2.99	1	0
Systemic Inflammatory Response Syndrome A systemic inflammatory response to a variety of clinical insults, characterized by two or more of the following conditions: (1) fever	0	2.99	1	0
End Stage Liver Disease Final stage of a liver disease when the liver failure is irreversible and LIVER TRANSPLANTATION is needed.	0	2.99	1	0
HPV Infection [description not available]	0	2.45	2	0
Female Genital Diseases [description not available]	0	5.9	14	2
Sexually Transmitted Diseases Diseases due to or propagated by sexual contact.	0	2.06	1	0
Sexually Transmitted Disease, Viral [description not available]	0	2.06	1	0
Genital Diseases, Female Pathological processes involving the female reproductive tract (GENITALIA, FEMALE).	0	5.9	14	2
Papillomavirus Infections Neoplasms of the skin and mucous membranes caused by papillomaviruses. They are usually benign but some have a high risk for malignant progression.	0	2.45	2	0
Allergy, Peanut [description not available]	0	2.73	3	0
Peanut Hypersensitivity Allergic reaction to peanuts that is triggered by the immune system.	0	2.73	3	0
Agricultural Worker Disease [description not available]	0	2.67	3	0
EBV Infections [description not available]	0	2.01	1	0
Acquired Autoimmune Hemolytic Anemia [description not available]	0	3.29	2	0
Hepatic Failure [description not available]	0	2.66	3	0
Anemia, Hemolytic, Autoimmune Acquired hemolytic anemia due to the presence of AUTOANTIBODIES which agglutinate or lyse the patient's own RED BLOOD CELLS.	0	3.29	2	0
Liver Failure Severe inability of the LIVER to perform its normal metabolic functions, as evidenced by severe JAUNDICE and abnormal serum levels of AMMONIA; BILIRUBIN; ALKALINE PHOSPHATASE; ASPARTATE AMINOTRANSFERASE; LACTATE DEHYDROGENASES; and albumin/globulin ratio. (Blakiston's Gould Medical Dictionary, 4th ed)	0	2.66	3	0
Epstein-Barr Virus Infections Infection with human herpesvirus 4 (HERPESVIRUS 4, HUMAN); which may facilitate the development of various lymphoproliferative disorders. These include BURKITT LYMPHOMA (African type), INFECTIOUS MONONUCLEOSIS, and oral hairy leukoplakia (LEUKOPLAKIA, HAIRY).	0	2.01	1	0
Viral Conjunctivitis [description not available]	0	3.39	1	1
Conjunctivitis, Viral Inflammation, often mild, of the conjunctiva caused by a variety of viral agents. Conjunctival involvement may be part of a systemic infection.	0	3.39	1	1
Candida Infection [description not available]	0	6.49	26	2
Critical Illness A disease or state in which death is possible or imminent.	0	3.39	1	1
Candidiasis Infection with a fungus of the genus CANDIDA. It is usually a superficial infection of the moist areas of the body and is generally caused by CANDIDA ALBICANS. (Dorland, 27th ed)	0	6.49	26	2
Osteogenic Sarcoma [description not available]	0	3.36	7	0
Osteosarcoma A sarcoma originating in bone-forming cells, affecting the ends of long bones. It is the most common and most malignant of sarcomas of the bones, and occurs chiefly among 10- to 25-year-old youths. (From Stedman, 25th ed)	0	3.36	7	0
Melanoma, Amelanotic An unpigmented malignant melanoma. It is an anaplastic melanoma consisting of cells derived from melanoblasts but not forming melanin. (Dorland, 27th ed; Stedman, 25th ed)	0	2.01	1	0
Granulomas [description not available]	0	3.2	6	0
Besnier-Boeck Disease [description not available]	0	2.37	2	0
Iris Neoplasms Tumors of the iris characterized by increased pigmentation of melanocytes. Iris nevi are composed of proliferated melanocytes and are associated with neurofibromatosis and malignant melanoma of the choroid and ciliary body. Malignant melanoma of the iris often originates from preexisting nevi.	0	2.01	1	0
Iris Diseases Diseases, dysfunctions, or disorders of or located in the iris.	0	2.4	2	0
Granuloma A relatively small nodular inflammatory lesion containing grouped mononuclear phagocytes, caused by infectious and noninfectious agents.	0	3.2	6	0
Sarcoidosis An idiopathic systemic inflammatory granulomatous disorder comprised of epithelioid and multinucleated giant cells with little necrosis. It usually invades the lungs with fibrosis and may also involve lymph nodes, skin, liver, spleen, eyes, phalangeal bones, and parotid glands.	0	2.37	2	0
Bacteremia The presence of viable bacteria circulating in the blood. Fever, chills, tachycardia, and tachypnea are common acute manifestations of bacteremia. The majority of cases are seen in already hospitalized patients, most of whom have underlying diseases or procedures which render their bloodstreams susceptible to invasion.	0	5.63	7	1
Colonic Diseases, Functional Chronic or recurrent colonic disorders without an identifiable structural or biochemical explanation. The widely recognized IRRITABLE BOWEL SYNDROME falls into this category.	0	9.63	9	9
Colorectal Cancer [description not available]	0	5.82	6	4
Colorectal Neoplasms Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.	0	5.82	6	4
Acute Hepatic Failure [description not available]	0	2.66	3	0
Liver Failure, Acute A form of rapid-onset LIVER FAILURE, also known as fulminant hepatic failure, caused by severe liver injury or massive loss of HEPATOCYTES. It is characterized by sudden development of liver dysfunction and JAUNDICE. Acute liver failure may progress to exhibit cerebral dysfunction even HEPATIC COMA depending on the etiology that includes hepatic ISCHEMIA, drug toxicity, malignant infiltration, and viral hepatitis such as post-transfusion HEPATITIS B and HEPATITIS C.	0	2.66	3	0
Erysipeloid An infection caused by Erysipelothrix rhusiopathiae that is almost wholly restricted to persons who in their occupation handle infected fish, shellfish, poultry, or meat. Three forms of this condition exist: a mild localized form manifested by local swelling and redness of the skin; a diffuse form that might present with fever; and a rare systemic form associated with endocarditis.	0	2.34	2	0
Infective Endocarditis [description not available]	0	2.85	4	0
Bouillaud Disease [description not available]	0	1.93	1	0
Bacterial Endocarditides [description not available]	0	4.65	11	0
Endocarditis Inflammation of the inner lining of the heart (ENDOCARDIUM), the continuous membrane lining the four chambers and HEART VALVES. It is often caused by microorganisms including bacteria, viruses, fungi, and rickettsiae. Left untreated, endocarditis can damage heart valves and become life-threatening.	0	2.85	4	0
Endocarditis, Bacterial Inflammation of the ENDOCARDIUM caused by BACTERIA that entered the bloodstream. The strains of bacteria vary with predisposing factors, such as CONGENITAL HEART DEFECTS; HEART VALVE DISEASES; HEART VALVE PROSTHESIS IMPLANTATION; or intravenous drug use.	0	4.65	11	0
Rheumatic Heart Disease Cardiac manifestation of systemic rheumatological conditions, such as RHEUMATIC FEVER. Rheumatic heart disease can involve any part the heart, most often the HEART VALVES and the ENDOCARDIUM.	0	1.93	1	0
Blood Pressure, Low [description not available]	0	3.77	4	0
Hypotension Abnormally low BLOOD PRESSURE that can result in inadequate blood flow to the brain and other vital organs. Common symptom is DIZZINESS but greater negative impacts on the body occur when there is prolonged depravation of oxygen and nutrients.	0	3.77	4	0
Ear Infection [description not available]	0	6.39	16	3
Burkholderia pseudomallei Infection [description not available]	0	1.93	1	0
Dysentery Acute inflammation of the intestine associated with infectious DIARRHEA of various etiologies, generally acquired by eating contaminated food containing TOXINS, BIOLOGICAL derived from BACTERIA or other microorganisms. Dysentery is characterized initially by watery FECES then by bloody mucoid stools. It is often associated with ABDOMINAL PAIN; FEVER; and DEHYDRATION.	0	4.07	16	0
Sinusitis, Maxillary [description not available]	0	3.03	5	0
Paranasal Sinus Diseases Diseases affecting or involving the PARANASAL SINUSES and generally manifesting as inflammation, abscesses, cysts, or tumors.	0	3.03	5	0
Maxillary Sinusitis Inflammation of the NASAL MUCOSA in the MAXILLARY SINUS. In many cases, it is caused by an infection of the bacteria HAEMOPHILUS INFLUENZAE; STREPTOCOCCUS PNEUMONIAE; or STAPHYLOCOCCUS AUREUS.	0	3.03	5	0
Craniocerebral Injuries [description not available]	0	2.85	4	0
Craniocerebral Trauma Traumatic injuries involving the cranium and intracranial structures (i.e., BRAIN; CRANIAL NERVES; MENINGES; and other structures). Injuries may be classified by whether or not the skull is penetrated (i.e., penetrating vs. nonpenetrating) or whether there is an associated hemorrhage.	0	2.85	4	0
Foot Ulcer Lesion on the surface of the skin of the foot, usually accompanied by inflammation. The lesion may become infected or necrotic and is frequently associated with diabetes or leprosy.	0	2.36	2	0
Neisseria gonorrhoeae Infection [description not available]	0	3.96	5	0
Gonorrhea Acute infectious disease characterized by primary invasion of the urogenital tract. The etiologic agent, NEISSERIA GONORRHOEAE, was isolated by Neisser in 1879.	0	3.96	5	0
Vulvovaginitis Inflammation of the VULVA and the VAGINA, characterized by discharge, burning, and PRURITUS.	0	2.85	4	0
Disease, Pulmonary [description not available]	0	4.71	7	1
Lung Diseases Pathological processes involving any part of the LUNG.	0	4.71	7	1
Urethritis Inflammation involving the URETHRA. Similar to CYSTITIS, clinical symptoms range from vague discomfort to painful urination (DYSURIA), urethral discharge, or both.	0	2.63	3	0
Anorectal Diseases [description not available]	0	6.85	13	6
Rectal Diseases Pathological developments in the RECTUM region of the large intestine (INTESTINE, LARGE).	0	6.85	13	6
Poisoning Used with drugs, chemicals, and industrial materials for human or animal poisoning, acute or chronic, whether the poisoning is accidental, occupational, suicidal, by medication error, or by environmental exposure.	0	4.24	4	1
Endometrial Diseases [description not available]	0	4.11	6	0
Infections, Proteus [description not available]	0	5.93	26	1
Uterine Diseases Pathological processes involving any part of the UTERUS.	0	4.11	6	0
Pyelitis Inflammation of the KIDNEY PELVIS and KIDNEY CALICES where urine is collected before discharge, but does not involve the renal parenchyma (the NEPHRONS) where urine is processed.	0	2.34	2	0
Cystopyelitis [description not available]	0	1.93	1	0
Ureteral Diseases Pathological processes involving the URETERS.	0	1.93	1	0
Bronchiectasis Persistent abnormal dilatation of the bronchi.	0	2.63	3	0
Hypovolemic [description not available]	0	1.93	1	0
Circulatory Collapse [description not available]	0	4.11	6	0
Endotoxin Shock [description not available]	0	5.02	6	0
Shock A pathological condition manifested by failure to perfuse or oxygenate vital organs.	0	4.11	6	0
Shock, Septic Sepsis associated with HYPOTENSION or hypoperfusion despite adequate fluid resuscitation. Perfusion abnormalities may include but are not limited to LACTIC ACIDOSIS; OLIGURIA; or acute alteration in mental status.	0	5.02	6	0
Hypovolemia An abnormally low volume of blood circulating through the body. It may result in hypovolemic shock (see SHOCK).	0	1.93	1	0
Bruise [description not available]	0	2.36	2	0
Finger Injuries General or unspecified injuries involving the fingers.	0	3.27	2	0
Contusions Injuries resulting in hemorrhage, usually manifested in the skin.	0	2.36	2	0
Parodontosis [description not available]	0	3.65	10	0
Periodontal Diseases Pathological processes involving the PERIODONTIUM including the gum (GINGIVA), the alveolar bone (ALVEOLAR PROCESS), the DENTAL CEMENTUM, and the PERIODONTAL LIGAMENT.	0	3.65	10	0
Infections, Trichomonas [description not available]	0	2.62	3	0
Trichomoniasis, Human [description not available]	0	2.34	2	0
Trichomonas Infections Infections in birds and mammals produced by various species of Trichomonas.	0	2.62	3	0
Trichomonas Vaginitis Inflammation of the vagina, marked by a purulent discharge. This disease is caused by the protozoan TRICHOMONAS VAGINALIS.	0	2.34	2	0
Abscess, Amebic [description not available]	0	4.57	10	0
Amebiasis, Intestinal [description not available]	0	3.18	6	0
Amebiasis Infection with any of various amebae. It is an asymptomatic carrier state in most individuals, but diseases ranging from chronic, mild diarrhea to fulminant dysentery may occur.	0	4.57	10	0
Infant, Newborn, Diseases Diseases of newborn infants present at birth (congenital) or developing within the first month of birth. It does not include hereditary diseases not manifesting at birth or within the first 30 days of life nor does it include inborn errors of metabolism. Both HEREDITARY DISEASES and METABOLISM, INBORN ERRORS are available as general concepts.	0	6.88	32	0
Intestinal Obstruction Any impairment, arrest, or reversal of the normal flow of INTESTINAL CONTENTS toward the ANAL CANAL.	0	4.19	18	0
Cystic Fibrosis of Pancreas [description not available]	0	3.89	13	0
Pancreatic Diseases Pathological processes of the PANCREAS.	0	2.63	3	0
Cystic Fibrosis An autosomal recessive genetic disease of the EXOCRINE GLANDS. It is caused by mutations in the gene encoding the CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR expressed in several organs including the LUNG, the PANCREAS, the BILIARY SYSTEM, and the SWEAT GLANDS. Cystic fibrosis is characterized by epithelial secretory dysfunction associated with ductal obstruction resulting in AIRWAY OBSTRUCTION; chronic RESPIRATORY INFECTIONS; PANCREATIC INSUFFICIENCY; maldigestion; salt depletion; and HEAT PROSTRATION.	0	3.89	13	0
Impetigo Contagiosa [description not available]	0	4.94	9	1
Impetigo A common superficial bacterial infection caused by STAPHYLOCOCCUS AUREUS or group A beta-hemolytic streptococci. Characteristics include pustular lesions that rupture and discharge a thin, amber-colored fluid that dries and forms a crust. This condition is commonly located on the face, especially about the mouth and nose.	0	4.94	9	1
Miliaria A syndrome of cutaneous changes associated with sweat retention and extravasation of sweat at different levels in the skin. Miliaria rubra, or prickly heat, results from apocrine duct obstruction. The sweat then seeps into the epidermis, producing pruritic erythematous papulovesicles. (From Dorland, 27th ed)	0	4.01	3	1
Mouth Diseases Diseases involving the MOUTH.	0	4.12	6	0
Pruritus Vulvae Intense itching of the external female genitals.	0	2.63	3	0
Vulvar Diseases Pathological processes of the VULVA.	0	1.93	1	0
Pus [description not available]	0	7	17	2
Acute Hypercapnic Respiratory Failure [description not available]	0	5.38	24	0
Respiratory Insufficiency Failure to adequately provide oxygen to cells of the body and to remove excess carbon dioxide from them. (Stedman, 25th ed)	0	5.38	24	0
Coma A profound state of unconsciousness associated with depressed cerebral activity from which the individual cannot be aroused. Coma generally occurs when there is dysfunction or injury involving both cerebral hemispheres or the brain stem RETICULAR FORMATION.	0	2.86	4	0
Deficiency, Protein [description not available]	0	3.77	4	0
Mastoiditis Inflammation of the honeycomb-like MASTOID BONE in the skull just behind the ear. It is usually a complication of OTITIS MEDIA.	0	4.03	3	1
Hand-Schu00FCller-Christian Disease [description not available]	0	3.56	3	0
Necrotizing Pyelonephritis [description not available]	0	7.05	18	2
Pyelonephritis, Xanthogranulomatous A chronic inflammatory condition of the KIDNEY resulting in diffuse renal destruction, a grossly enlarged and nonfunctioning kidney associated with NEPHROLITHIASIS and KIDNEY STONES.	0	1.93	1	0
Histiocytosis, Langerhans-Cell A group of disorders resulting from the abnormal proliferation of and tissue infiltration by LANGERHANS CELLS which can be detected by their characteristic Birbeck granules (X bodies), or by monoclonal antibody staining for their surface CD1 ANTIGENS. Langerhans-cell granulomatosis can involve a single organ, or can be a systemic disorder.	0	3.56	3	0
Pyelonephritis Inflammation of the KIDNEY involving the renal parenchyma (the NEPHRONS); KIDNEY PELVIS; and KIDNEY CALICES. It is characterized by ABDOMINAL PAIN; FEVER; NAUSEA; VOMITING; and occasionally DIARRHEA.	0	7.05	18	2
Cystitis Inflammation of the URINARY BLADDER, either from bacterial or non-bacterial causes. Cystitis is usually associated with painful urination (dysuria), increased frequency, urgency, and suprapubic pain.	0	3.89	13	0
Intestinal Diseases Pathological processes in any segment of the INTESTINE from DUODENUM to RECTUM.	0	5.34	14	0
Breast Diseases Pathological processes of the BREAST.	0	2.34	2	0
Hypothermia, Accidental [description not available]	0	2.34	2	0
Aortic Diseases Pathological processes involving any part of the AORTA.	0	1.93	1	0
Hypothermia Lower than normal body temperature, especially in warm-blooded animals.	0	2.34	2	0
Bronchial Diseases Diseases involving the BRONCHI.	0	3.04	5	0
Hay Fever [description not available]	0	5.27	13	1
Vasomotor Rhinitis [description not available]	0	2.63	3	0
Rhinitis, Allergic, Seasonal Allergic rhinitis that occurs at the same time every year. It is characterized by acute CONJUNCTIVITIS with lacrimation and ITCHING, and regarded as an allergic condition triggered by specific ALLERGENS.	0	5.27	13	1
Rhinitis, Vasomotor A form of non-allergic rhinitis that is characterized by nasal congestion and posterior pharyngeal drainage.	0	2.63	3	0
Infections, Soft Tissue [description not available]	0	2.34	2	0
Soft Tissue Infections Infections of non-skeletal tissue, i.e., exclusive of bone, ligaments, cartilage, and fibrous tissue. The concept is usually referred to as skin and soft tissue infections and usually subcutaneous and muscle tissue are involved. The predisposing factors in anaerobic infections are trauma, ischemia, and surgery. The organisms often derive from the fecal or oral flora, particularly in wounds associated with intestinal surgery, decubitus ulcer, and human bites. (From Cecil Textbook of Medicine, 19th ed, p1688)	0	2.34	2	0
Lichen Simplex Chronicus [description not available]	0	4.99	5	2
Neurodermatitis An extremely variable eczematous skin disease that is presumed to be a response to prolonged vigorous scratching, rubbing, or pinching to relieve intense pruritus. It varies in intensity, severity, course, and morphologic expression in different individuals. Neurodermatitis is believed by some to be psychogenic. The circumscribed or localized form is often referred to as lichen simplex chronicus.	0	4.99	5	2
Stye [description not available]	0	4.95	3	1
Hordeolum Purulent infection of one of the sebaceous glands of Zeis along the eyelid margin (external) or of the meibomian gland on the conjunctival side of the eyelid (internal).	0	4.95	3	1
Hematochezia The passage of bright red blood from the rectum. The blood may or may not be mixed with formed stool in the form of blood, blood clots, bloody stool or diarrhea.	0	5.41	15	0
Gastrointestinal Hemorrhage Bleeding in any segment of the GASTROINTESTINAL TRACT from ESOPHAGUS to RECTUM.	0	5.41	15	0
Infection, Puerperal [description not available]	0	3.19	6	0
Steatorrhea A condition that is characterized by chronic fatty DIARRHEA, a result of abnormal DIGESTION and/or INTESTINAL ABSORPTION of FATS.	0	2.63	3	0
Celiac Sprue [description not available]	0	6.54	35	0
Celiac Disease A malabsorption syndrome that is precipitated by the ingestion of foods containing GLUTEN, such as wheat, rye, and barley. It is characterized by INFLAMMATION of the SMALL INTESTINE, loss of MICROVILLI structure, failed INTESTINAL ABSORPTION, and MALNUTRITION.	0	6.54	35	0
Bacterial Endocarditides, Subacute [description not available]	0	2.34	2	0
Ecchymosis Extravasation of blood into the skin, resulting in a nonelevated, rounded or irregular, blue or purplish patch, larger than a petechia.	0	1.93	1	0
Nervous System Disorders [description not available]	0	4.83	8	0
Palsy [description not available]	0	3.44	8	0
Nervous System Diseases Diseases of the central and peripheral nervous system. This includes disorders of the brain, spinal cord, cranial nerves, peripheral nerves, nerve roots, autonomic nervous system, neuromuscular junction, and muscle.	0	4.83	8	0
Paralysis A general term most often used to describe severe or complete loss of muscle strength due to motor system disease from the level of the cerebral cortex to the muscle fiber. This term may also occasionally refer to a loss of sensory function. (From Adams et al., Principles of Neurology, 6th ed, p45)	0	3.44	8	0
Symptom Cluster [description not available]	0	3.19	6	0
Syndrome A characteristic symptom complex.	0	3.19	6	0
Anaplasma Infection [description not available]	0	1.93	1	0
Experimental Neoplasms [description not available]	0	3.46	8	0
Asystole [description not available]	0	3.55	3	0
Heart Arrest Cessation of heart beat or MYOCARDIAL CONTRACTION. If it is treated within a few minutes, heart arrest can be reversed in most cases to normal cardiac rhythm and effective circulation.	0	3.55	3	0
Focal Neurologic Deficits [description not available]	0	6.66	8	1
Infections, Respiratory [description not available]	0	7.53	18	2
Respiratory Tract Infections Invasion of the host RESPIRATORY SYSTEM by microorganisms, usually leading to pathological processes or diseases.	0	7.53	18	2
Vaginal Discharge A common gynecologic disorder characterized by an abnormal, nonbloody discharge from the genital tract.	0	1.93	1	0
Keloid A sharply elevated, irregularly shaped, progressively enlarging scar resulting from formation of excessive amounts of collagen in the dermis during connective tissue repair. It is differentiated from a hypertrophic scar (CICATRIX, HYPERTROPHIC) in that the former does not spread to surrounding tissues.	0	2.85	4	0
Atherogenesis [description not available]	0	1.93	1	0
Atherosclerosis A thickening and loss of elasticity of the walls of ARTERIES that occurs with formation of ATHEROSCLEROTIC PLAQUES within the ARTERIAL INTIMA.	0	1.93	1	0
Neoplasms, Bronchial [description not available]	0	1.93	1	0
Carcinoma, Bronchial [description not available]	0	1.93	1	0
Bronchial Neoplasms Tumors or cancer of the BRONCHI.	0	1.93	1	0
Carcinoma, Bronchogenic Malignant neoplasm arising from the epithelium of the BRONCHI. It represents a large group of epithelial lung malignancies which can be divided into two clinical groups: SMALL CELL LUNG CANCER and NON-SMALL-CELL LUNG CARCINOMA.	0	1.93	1	0
Injuries, Soft Tissue [description not available]	0	1.93	1	0
Respiration Disorders Diseases of the respiratory system in general or unspecified or for a specific respiratory disease not available.	0	1.93	1	0
Empyema, Thoracic [description not available]	0	2.63	3	0
Empyema, Pleural Suppurative inflammation of the pleural space.	0	2.63	3	0
Infant, Premature, Diseases Diseases that occur in PREMATURE INFANTS.	0	4.11	6	0
Conjunctival Diseases Diseases involving the CONJUNCTIVA.	0	2.36	2	0
Acute Hemolytic Transfusion Reaction [description not available]	0	2.35	2	0
Transfusion Reaction Complications of BLOOD TRANSFUSION. Included adverse reactions are common allergic and febrile reactions; hemolytic (delayed and acute) reactions; and other non-hemolytic adverse reactions such as infections and adverse immune reactions related to immunocompatibility.	0	2.35	2	0
Diathesis [description not available]	0	3.2	6	0
Carcinoma, Ehrlich Tumor A transplantable, poorly differentiated malignant tumor which appeared originally as a spontaneous breast carcinoma in a mouse. It grows in both solid and ascitic forms.	0	3.64	10	0
EHS Tumor [description not available]	0	3.55	3	0
Experimental Mammary Neoplasms [description not available]	0	3.03	5	0
Cancer of Kidney [description not available]	0	4.44	5	1
Kidney Neoplasms Tumors or cancers of the KIDNEY.	0	4.44	5	1
Shingles [description not available]	0	2.35	2	0
Herpes Zoster An acute infectious, usually self-limited, disease believed to represent activation of latent varicella-zoster virus (HERPESVIRUS 3, HUMAN) in those who have been rendered partially immune after a previous attack of CHICKENPOX. It involves the SENSORY GANGLIA and their areas of innervation and is characterized by severe neuralgic pain along the distribution of the affected nerve and crops of clustered vesicles over the area. (From Dorland, 27th ed)	0	2.35	2	0
Cancer of Head [description not available]	0	3.74	2	1
Head and Neck Neoplasms Soft tissue tumors or cancer arising from the mucosal surfaces of the LIP; oral cavity; PHARYNX; LARYNX; and cervical esophagus. Other sites included are the NOSE and PARANASAL SINUSES; SALIVARY GLANDS; THYROID GLAND and PARATHYROID GLANDS; and MELANOMA and non-melanoma skin cancers of the head and neck. (from Holland et al., Cancer Medicine, 4th ed, p1651)	0	3.74	2	1
Encephalitis, Polio [description not available]	0	1.93	1	0
Poliomyelitis An acute infectious disease of humans, particularly children, caused by any of three serotypes of human poliovirus (POLIOVIRUS). Usually the infection is limited to the gastrointestinal tract and nasopharynx, and is often asymptomatic. The central nervous system, primarily the spinal cord, may be affected, leading to rapidly progressive paralysis, coarse FASCICULATION and hyporeflexia. Motor neurons are primarily affected. Encephalitis may also occur. The virus replicates in the nervous system, and may cause significant neuronal loss, most notably in the spinal cord. A rare related condition, nonpoliovirus poliomyelitis, may result from infections with nonpoliovirus enteroviruses. (From Adams et al., Principles of Neurology, 6th ed, pp764-5)	0	1.93	1	0
Plasma Cell Tumor [description not available]	0	2.35	2	0
Plasmacytoma Any discrete, presumably solitary, mass of neoplastic PLASMA CELLS either in BONE MARROW or various extramedullary sites.	0	2.35	2	0
Consciousness, Loss of [description not available]	0	4.24	4	1
Abdominal Neoplasms New abnormal growth of tissue in the ABDOMEN.	0	1.93	1	0
Acanthosis Nigricans A circumscribed melanosis consisting of a brown-pigmented, velvety verrucosity or fine papillomatosis appearing in the axillae and other body folds. It occurs in association with endocrine disorders, underlying malignancy, administration of certain drugs, or as in inherited disorder.	0	1.93	1	0
Atrophy Decrease in the size of a cell, tissue, organ, or multiple organs, associated with a variety of pathological conditions such as abnormal cellular changes, ischemia, malnutrition, or hormonal changes.	0	4.25	7	0
Hypertrophy General increase in bulk of a part or organ due to CELL ENLARGEMENT and accumulation of FLUIDS AND SECRETIONS, not due to tumor formation, nor to an increase in the number of cells (HYPERPLASIA).	0	2.64	3	0
Cancer of Larynx [description not available]	0	2.63	3	0
Cancer of the Tonsil [description not available]	0	1.93	1	0
Laryngeal Neoplasms Cancers or tumors of the LARYNX or any of its parts: the GLOTTIS; EPIGLOTTIS; LARYNGEAL CARTILAGES; LARYNGEAL MUSCLES; and VOCAL CORDS.	0	2.63	3	0
Tonsillar Neoplasms Tumors or cancer of the PALATINE TONSIL.	0	1.93	1	0
Cell Transformation, Neoplastic Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill.	0	3.92	13	0
Germinoblastoma [description not available]	0	2.86	4	0
Diffuse Mixed Small and Large Cell Lymphoma [description not available]	0	4.25	4	1
Lymphoma A general term for various neoplastic diseases of the lymphoid tissue.	0	2.86	4	0
Lymphoma, Non-Hodgkin Any of a group of malignant tumors of lymphoid tissue that differ from HODGKIN DISEASE, being more heterogeneous with respect to malignant cell lineage, clinical course, prognosis, and therapy. The only common feature among these tumors is the absence of giant REED-STERNBERG CELLS, a characteristic of Hodgkin's disease.	0	4.25	4	1
Bright Disease A historical classification which is no longer used. It described acute glomerulonephritis, acute nephritic syndrome, or acute nephritis. Named for Richard Bright.	0	4.43	5	1
Glomerulonephritis Inflammation of the renal glomeruli (KIDNEY GLOMERULUS) that can be classified by the type of glomerular injuries including antibody deposition, complement activation, cellular proliferation, and glomerulosclerosis. These structural and functional abnormalities usually lead to HEMATURIA; PROTEINURIA; HYPERTENSION; and RENAL INSUFFICIENCY.	0	4.43	5	1
Connective Tissue Neoplasms [description not available]	0	1.93	1	0
Hyperplasia An increase in the number of cells in a tissue or organ without tumor formation. It differs from HYPERTROPHY, which is an increase in bulk without an increase in the number of cells.	0	3.06	5	0
Avian Sarcoma [description not available]	0	1.93	1	0
Epithelial Neoplasms [description not available]	0	1.93	1	0
Cells, Neoplasm Circulating [description not available]	0	1.93	1	0
Carcinosarcoma A malignant neoplasm that contains elements of carcinoma and sarcoma so extensively intermixed as to indicate neoplasia of epithelial and mesenchymal tissue. (Stedman, 25th ed)	0	1.93	1	0
Reticulum Cell-Like Sarcoma, Yoshida [description not available]	0	1.93	1	0
Osteitis Fibrosa Cystica A fibrous degeneration, cyst formation, and the presence of fibrous nodules in bone, usually due to HYPERPARATHYROIDISM.	0	1.93	1	0
Pleural Diseases Diseases involving the PLEURA.	0	1.93	1	0
Pleural Effusion Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces. It is a sign of disease and not a diagnosis in itself.	0	2.34	2	0
Papilloma, Squamous Cell [description not available]	0	2.86	4	0
Papilloma A circumscribed benign epithelial tumor projecting from the surrounding surface; more precisely, a benign epithelial neoplasm consisting of villous or arborescent outgrowths of fibrovascular stroma covered by neoplastic cells. (Stedman, 25th ed)	0	2.86	4	0
Epulides [description not available]	0	1.93	1	0
Gingival Diseases Diseases involving the GINGIVA.	0	1.93	1	0
Idiopathic Tropical Malabsorption Syndrome [description not available]	0	2.85	4	0
Hepatic Insufficiency Conditions in which the LIVER functions fall below the normal ranges. Severe hepatic insufficiency may cause LIVER FAILURE or DEATH. Treatment may include LIVER TRANSPLANTATION.	0	1.93	1	0
Carcinoma, Basal Cell, Pigmented [description not available]	0	2.37	2	0
Carcinoma, Basal Cell A malignant skin neoplasm that seldom metastasizes but has potentialities for local invasion and destruction. Clinically it is divided into types: nodular, cicatricial, morphaic, and erythematoid (pagetoid). They develop on hair-bearing skin, most commonly on sun-exposed areas. Approximately 85% are found on the head and neck area and the remaining 15% on the trunk and limbs. (From DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1471)	0	2.37	2	0
Ileus A condition caused by the lack of intestinal PERISTALSIS or INTESTINAL MOTILITY without any mechanical obstruction. This interference of the flow of INTESTINAL CONTENTS often leads to INTESTINAL OBSTRUCTION. Ileus may be classified into postoperative, inflammatory, metabolic, neurogenic, and drug-induced.	0	1.93	1	0
Brain Disorders [description not available]	0	7.58	31	2
Brain Diseases Pathologic conditions affecting the BRAIN, which is composed of the intracranial components of the CENTRAL NERVOUS SYSTEM. This includes (but is not limited to) the CEREBRAL CORTEX; intracranial white matter; BASAL GANGLIA; THALAMUS; HYPOTHALAMUS; BRAIN STEM; and CEREBELLUM.	0	7.58	31	2
Coronary Heart Disease [description not available]	0	8.34	11	1
Elevated Cholesterol [description not available]	0	10.61	37	6
Coronary Disease An imbalance between myocardial functional requirements and the capacity of the CORONARY VESSELS to supply sufficient blood flow. It is a form of MYOCARDIAL ISCHEMIA (insufficient blood supply to the heart muscle) caused by a decreased capacity of the coronary vessels.	0	8.34	11	1
Hypercholesterolemia A condition with abnormally high levels of CHOLESTEROL in the blood. It is defined as a cholesterol value exceeding the 95th percentile for the population.	0	10.61	37	6
Bone Fractures [description not available]	0	4.11	6	0
Fractures, Bone Breaks in bones.	0	4.11	6	0
Breathlessness [description not available]	0	1.93	1	0
Airway Hyper-Responsiveness [description not available]	0	4.02	3	1
Dyspnea Difficult or labored breathing.	0	1.93	1	0
Paratyphoid Fever A prolonged febrile illness commonly caused by several Paratyphi serotypes of SALMONELLA ENTERICA. It is similar to TYPHOID FEVER but less severe.	0	1.93	1	0
Dermatitis Seborrheica [description not available]	0	5.59	10	2
Sebaceous Gland Diseases Diseases of the sebaceous glands such as sebaceous hyperplasia and sebaceous cell carcinoma (SEBACEOUS GLAND NEOPLASMS).	0	1.93	1	0
Dermatitis, Seborrheic A chronic inflammatory disease of the skin with unknown etiology. It is characterized by moderate ERYTHEMA, dry, moist, or greasy (SEBACEOUS GLAND) scaling and yellow crusted patches on various areas, especially the scalp, that exfoliate as dandruff. Seborrheic dermatitis is common in children and adolescents with HIV INFECTIONS.	0	5.59	10	2
Hepatitis, Infectious [description not available]	0	6.32	15	1
Hepatitis A INFLAMMATION of the LIVER in humans caused by a member of the HEPATOVIRUS genus, HUMAN HEPATITIS A VIRUS. It can be transmitted through fecal contamination of food or water.	0	6.32	15	1
Cruveilhier-Baumgarten Syndrome Liver cirrhosis with intrahepatic portal obstruction, HYPERTENSION, and patent UMBILICAL VEINS.	0	5.12	11	0
Hypertension, Portal Abnormal increase of resistance to blood flow within the hepatic PORTAL SYSTEM, frequently seen in LIVER CIRRHOSIS and conditions with obstruction of the PORTAL VEIN.	0	5.12	11	0
Corneal Dystrophies [description not available]	0	1.93	1	0
Collagen Diseases Historically, a heterogeneous group of acute and chronic diseases, including rheumatoid arthritis, systemic lupus erythematosus, progressive systemic sclerosis, dermatomyositis, etc. This classification was based on the notion that collagen was equivalent to connective tissue, but with the present recognition of the different types of collagen and the aggregates derived from them as distinct entities, the term collagen diseases now pertains exclusively to those inherited conditions in which the primary defect is at the gene level and affects collagen biosynthesis, post-translational modification, or extracellular processing directly. (From Cecil Textbook of Medicine, 19th ed, p1494)	0	2.35	2	0
Esophageal Varices [description not available]	0	3.33	7	0
Esophageal and Gastric Varices Dilated blood vessels in the ESOPHAGUS or GASTRIC FUNDUS that shunt blood from the portal circulation (PORTAL SYSTEM) to the systemic venous circulation. Often they are observed in individuals with portal hypertension (HYPERTENSION, PORTAL).	0	3.33	7	0
Polyarthritis [description not available]	0	4.02	3	1
Arthritis Acute or chronic inflammation of JOINTS.	0	4.02	3	1
Tenosynovitis Inflammation of the synovial lining of a tendon sheath. Causes include trauma, tendon stress, bacterial disease (gonorrhea, tuberculosis), rheumatic disease, and gout. Common sites are the hand, wrist, shoulder capsule, hip capsule, hamstring muscles, and Achilles tendon. The tendon sheaths become inflamed and painful, and accumulate fluid. Joint mobility is usually reduced.	0	1.93	1	0
Malabsorption Syndromes General term for a group of MALNUTRITION syndromes caused by failure of normal INTESTINAL ABSORPTION of nutrients.	0	9.32	54	1
Dehydration The condition that results from excessive loss of water from a living organism.	0	3.77	4	0
Colonic Diseases Pathological processes in the COLON region of the large intestine (INTESTINE, LARGE).	0	9.41	27	10
Angor Pectoris [description not available]	0	2.34	2	0
Cardiovascular Stroke [description not available]	0	4.25	4	1
Angina Pectoris The symptom of paroxysmal pain consequent to MYOCARDIAL ISCHEMIA usually of distinctive character, location and radiation. It is thought to be provoked by a transient stressful situation during which the oxygen requirements of the MYOCARDIUM exceed that supplied by the CORONARY CIRCULATION.	0	2.34	2	0
Arteriosclerosis Thickening and loss of elasticity of the walls of ARTERIES of all sizes. There are many forms classified by the types of lesions and arteries involved, such as ATHEROSCLEROSIS with fatty lesions in the ARTERIAL INTIMA of medium and large muscular arteries.	0	8.8	18	3
Myocardial Infarction NECROSIS of the MYOCARDIUM caused by an obstruction of the blood supply to the heart (CORONARY CIRCULATION).	0	4.25	4	1
Dacryoadenitis [description not available]	0	3.05	5	0
Complications, Hematologic Pregnancy [description not available]	0	2.34	2	0
Petechiae Pinhead size (3 mm) skin discolorization due to hemorrhage.	0	2.34	2	0
Thrombopenia [description not available]	0	2.63	3	0
Purpura, Thrombopenic [description not available]	0	1.93	1	0
Purpura Purplish or brownish red discoloration, easily visible through the epidermis, caused by hemorrhage into the tissues. When the size of the discolorization is	0	2.34	2	0
Purpura, Thrombocytopenic Any form of purpura in which the PLATELET COUNT is decreased. Many forms are thought to be caused by immunological mechanisms.	0	1.93	1	0
Thrombocytopenia A subnormal level of BLOOD PLATELETS.	0	2.63	3	0
Dementia Praecox [description not available]	0	1.93	1	0
Schizophrenia A severe emotional disorder of psychotic depth characteristically marked by a retreat from reality with delusion formation, HALLUCINATIONS, emotional disharmony, and regressive behavior.	0	1.93	1	0
Colonic Diverticulitis [description not available]	0	5.14	6	2
Diverticulitis Inflammation of a DIVERTICULUM or diverticula.	0	4.42	5	1
Pilonidal Cyst [description not available]	0	2.34	2	0
Pilonidal Sinus A hair-containing cyst or sinus, occurring chiefly in the coccygeal region.	0	2.34	2	0
Acne [description not available]	0	6.94	16	2
Alopecia Circumscripta [description not available]	0	1.93	1	0
Leukokeratosis Leukoplakic lesions related to abnormal keratin fiber formation.	0	1.93	1	0
Hypertrichosis Excessive hair growth at inappropriate locations, such as on the extremities, the head, and the back. It is caused by genetic or acquired factors, and is an androgen-independent process. This concept does not include HIRSUTISM which is an androgen-dependent excess hair growth in WOMEN and CHILDREN.	0	1.93	1	0
Acne Vulgaris A chronic disorder of the pilosebaceous apparatus associated with an increase in sebum secretion. It is characterized by open comedones (blackheads), closed comedones (whiteheads), and pustular nodules. The cause is unknown, but heredity and age are predisposing factors.	0	6.94	16	2
Alopecia Areata Loss of scalp and body hair involving microscopically inflammatory patchy areas.	0	1.93	1	0
Leukoplakia A white patch lesion found on a MUCOUS MEMBRANE that cannot be scraped off. Leukoplakia is generally considered a precancerous condition, however its appearance may also result from a variety of HEREDITARY DISEASES.	0	1.93	1	0
Amino Acid Metabolism Disorders, Inborn [description not available]	0	3.33	7	0
Aminoaciduria, Renal [description not available]	0	2.85	4	0
Infections, Pasteurella [description not available]	0	2.85	4	0
Perforated Appendicitis [description not available]	0	3.04	5	0
Appendicitis Acute inflammation of the APPENDIX. Acute appendicitis is classified as simple, gangrenous, or perforated.	0	3.04	5	0
Moniliasis, Oral [description not available]	0	2.63	3	0
Dermatitis Exfoliativa [description not available]	0	2.64	3	0
Embryopathies [description not available]	0	4.75	5	0
Candidiasis, Cutaneous Candidiasis of the skin manifested as eczema-like lesions of the interdigital spaces, perleche, or chronic paronychia. (Dorland, 27th ed)	0	7.47	17	9
Candidiasis, Oral Infection of the mucous membranes of the mouth by a fungus of the genus CANDIDA. (Dorland, 27th ed)	0	2.63	3	0
Dermatitis, Exfoliative The widespread involvement of the skin by a scaly, erythematous dermatitis occurring either as a secondary or reactive process to an underlying cutaneous disorder (e.g., atopic dermatitis, psoriasis, etc.), or as a primary or idiopathic disease. It is often associated with the loss of hair and nails, hyperkeratosis of the palms and soles, and pruritus. (From Dorland, 27th ed)	0	2.64	3	0
Adenovirus Infections [description not available]	0	2.34	2	0
Adenoviridae Infections Virus diseases caused by the ADENOVIRIDAE.	0	2.34	2	0
Focal Infection An infection at a specific location that may spread to another region of the body.	0	1.94	1	0
Empyema, Gall Bladder [description not available]	0	6.68	6	4
Cholecystitis Inflammation of the GALLBLADDER; generally caused by impairment of BILE flow, GALLSTONES in the BILIARY TRACT, infections, or other diseases.	0	6.68	6	4
Esophageal Stricture [description not available]	0	1.93	1	0
Esophageal Stenosis A stricture of the ESOPHAGUS. Most are acquired but can be congenital.	0	1.93	1	0
Hyperlipemia [description not available]	0	9.84	39	2
Hyperlipidemias Conditions with excess LIPIDS in the blood.	0	9.84	39	2
Erythroblastosis Fetalis [description not available]	0	1.93	1	0
Intestinal Perforation Opening or penetration through the wall of the INTESTINES.	0	4.42	5	1
Tracheitis INFLAMMATION of the TRACHEA that is usually associated with RESPIRATORY TRACT INFECTIONS.	0	2.63	3	0
Cancer of Parotid [description not available]	0	1.93	1	0
Parotid Neoplasms Tumors or cancer of the PAROTID GLAND.	0	1.93	1	0
Acute Yellow Atrophy [description not available]	0	1.94	1	0
Balanitis Inflammation of the head of the PENIS, glans penis.	0	3.04	5	0
Actinic Reticuloid Syndrome [description not available]	0	2.63	3	0
Lupus Erythematosus, Chronic Cutaneous [description not available]	0	2.37	2	0
Cheilitis Inflammation of the lips. It is of various etiologies and degrees of pathology.	0	2.63	3	0
Erythema Multiforme A skin and mucous membrane disease characterized by an eruption of macules, papules, nodules, vesicles, and/or bullae with characteristic bull's-eye lesions usually occurring on the dorsal aspect of the hands and forearms.	0	2.65	3	0
Lupus Erythematosus, Discoid A chronic form of cutaneous lupus erythematosus (LUPUS ERYTHEMATOSUS, CUTANEOUS) in which the skin lesions mimic those of the systemic form but in which systemic signs are rare. It is characterized by the presence of discoid skin plaques showing varying degrees of edema, erythema, scaliness, follicular plugging, and skin atrophy. Lesions are surrounded by an elevated erythematous border. The condition typically involves the face and scalp, but widespread dissemination may occur.	0	2.37	2	0
Herpes Simplex Virus Infection [description not available]	0	3.05	5	0
Herpes Simplex A group of acute infections caused by herpes simplex virus type 1 or type 2 that is characterized by the development of one or more small fluid-filled vesicles with a raised erythematous base on the skin or mucous membrane. It occurs as a primary infection or recurs due to a reactivation of a latent infection. (Dorland, 27th ed.)	0	3.05	5	0
Injuries, Eye [description not available]	0	4.72	7	1
Eye Injuries Damage or trauma inflicted to the eye by external means. The concept includes both surface injuries and intraocular injuries.	0	4.72	7	1
Anemia A reduction in the number of circulating ERYTHROCYTES or in the quantity of HEMOGLOBIN.	0	2.85	4	0
Abdomen, Acute A clinical syndrome with acute abdominal pain that is severe, localized, and rapid in onset. Acute abdomen may be caused by a variety of disorders, injuries, or diseases.	0	1.94	1	0
Back Ache [description not available]	0	1.94	1	0
Spinal Diseases Diseases involving the SPINE.	0	2.63	3	0
Colicky Pain [description not available]	0	1.94	1	0
Back Pain Acute or chronic pain located in the posterior regions of the THORAX; LUMBOSACRAL REGION; or the adjacent regions.	0	1.94	1	0
Abdominal Pain Sensation of discomfort, distress, or agony in the abdominal region.	0	1.94	1	0
Human Trichinellosis [description not available]	0	2.34	2	0
Trichinellosis An infection with TRICHINELLA. It is caused by eating raw or undercooked meat that is infected with larvae of nematode worms TRICHINELLA genus. All members of the TRICHINELLA genus can infect human in addition to TRICHINELLA SPIRALIS, the traditional etiological agent. It is distributed throughout much of the world and is re-emerging in some parts as a public health hazard and a food safety problem.	0	2.34	2	0
Melena The black, tarry, foul-smelling FECES that contain degraded blood.	0	2.63	3	0
Ecthyma An ulcerative pyoderma usually caused by group A beta-hemolytic streptococcal infection at the site of minor trauma. (Dorland, 27th ed)	0	1.94	1	0
Aspergillus Infection [description not available]	0	3.04	5	0
Aspergillosis Infections with fungi of the genus ASPERGILLUS.	0	3.04	5	0
Friedreich Disease [description not available]	0	2.34	2	0
Diseases, Metabolic [description not available]	0	3.95	5	0
Pellagra A disease due to deficiency of NIACIN, a B-complex vitamin, or its precursor TRYPTOPHAN. It is characterized by scaly DERMATITIS which is often associated with DIARRHEA and DEMENTIA (the three D's).	0	2.34	2	0
Amino Acid Transport Disorder, Neutral [description not available]	0	3.04	5	0
Friedreich Ataxia An autosomal recessive disease, usually of childhood onset, characterized pathologically by degeneration of the spinocerebellar tracts, posterior columns, and to a lesser extent the corticospinal tracts. Clinical manifestations include GAIT ATAXIA, pes cavus, speech impairment, lateral curvature of spine, rhythmic head tremor, kyphoscoliosis, congestive heart failure (secondary to a cardiomyopathy), and lower extremity weakness. Most forms of this condition are associated with a mutation in a gene on chromosome 9, at band q13, which codes for the mitochondrial protein frataxin. (From Adams et al., Principles of Neurology, 6th ed, p1081; N Engl J Med 1996 Oct 17;335(16):1169-75) The severity of Friedreich ataxia associated with expansion of GAA repeats in the first intron of the frataxin gene correlates with the number of trinucleotide repeats. (From Durr et al, N Engl J Med 1996 Oct 17;335(16):1169-75)	0	2.34	2	0
Metabolic Diseases Generic term for diseases caused by an abnormal metabolic process. It can be congenital due to inherited enzyme abnormality (METABOLISM, INBORN ERRORS) or acquired due to disease of an endocrine organ or failure of a metabolically important organ such as the liver. (Stedman, 26th ed)	0	3.95	5	0
Paralysis, Legs [description not available]	0	3.19	6	0
Abortion, Septic Any type of abortion, induced or spontaneous, that is associated with infection of the UTERUS and its appendages. It is characterized by FEVER, uterine tenderness, and foul discharge.	0	1.94	1	0
Paraplegia Severe or complete loss of motor function in the lower extremities and lower portions of the trunk. This condition is most often associated with SPINAL CORD DISEASES, although BRAIN DISEASES; PERIPHERAL NERVOUS SYSTEM DISEASES; NEUROMUSCULAR DISEASES; and MUSCULAR DISEASES may also cause bilateral leg weakness.	0	3.19	6	0
Enteric Fever [description not available]	0	2.63	3	0
Typhoid Fever An acute systemic febrile infection caused by SALMONELLA TYPHI, a serotype of SALMONELLA ENTERICA.	0	2.63	3	0
Adnexitis Inflammation of the uterine appendages (ADNEXA UTERI) including infection of the FALLOPIAN TUBES (SALPINGITIS), the ovaries (OOPHORITIS), or the supporting ligaments (PARAMETRITIS).	0	1.94	1	0
Asphyxia Neonatorum Respiratory failure in the newborn. (Dorland, 27th ed)	0	1.94	1	0
Edema-Proteinuria-Hypertension Gestosis [description not available]	0	2.63	3	0
Pelvic Inflammatory Disease A spectrum of inflammation involving the female upper genital tract and the supporting tissues. It is usually caused by an ascending infection of organisms from the endocervix. Infection may be confined to the uterus (ENDOMETRITIS), the FALLOPIAN TUBES; (SALPINGITIS); the ovaries (OOPHORITIS), the supporting ligaments (PARAMETRITIS), or may involve several of the above uterine appendages. Such inflammation can lead to functional impairment and infertility.	0	1.94	1	0
Pre-Eclampsia A complication of PREGNANCY, characterized by a complex of symptoms including maternal HYPERTENSION and PROTEINURIA with or without pathological EDEMA. Symptoms may range between mild and severe. Pre-eclampsia usually occurs after the 20th week of gestation, but may develop before this time in the presence of trophoblastic disease.	0	2.63	3	0
Alcohol Abuse [description not available]	0	7.36	17	1
Alcoholism A primary, chronic disease with genetic, psychosocial, and environmental factors influencing its development and manifestations. The disease is often progressive and fatal. It is characterized by impaired control over drinking, preoccupation with the drug alcohol, use of alcohol despite adverse consequences, and distortions in thinking, most notably denial. Each of these symptoms may be continuous or periodic. (Morse & Flavin for the Joint Commission of the National Council on Alcoholism and Drug Dependence and the American Society of Addiction Medicine to Study the Definition and Criteria for the Diagnosis of Alcoholism: in JAMA 1992;268:1012-4)	0	7.36	17	1
Chronic Bronchitis [description not available]	0	2.85	1	0
Bronchitis, Chronic A subcategory of CHRONIC OBSTRUCTIVE PULMONARY DISEASE. The disease is characterized by hypersecretion of mucus accompanied by a chronic (more than 3 months in 2 consecutive years) productive cough. Infectious agents are a major cause of chronic bronchitis.	0	2.85	1	0
Acrodermatitis Inflammation involving the skin of the extremities, especially the hands and feet. Several forms are known, some idiopathic and some hereditary. The infantile form is called Gianotti-Crosti syndrome.	0	2.35	2	0
Cancer of Pelvis [description not available]	0	1.94	1	0
Choline Deficiency A condition produced by a deficiency of CHOLINE in animals. Choline is known as a lipotropic agent because it has been shown to promote the transport of excess fat from the liver under certain conditions in laboratory animals. Combined deficiency of choline (included in the B vitamin complex) and all other methyl group donors causes liver cirrhosis in some animals. Unlike compounds normally considered as vitamins, choline does not serve as a cofactor in enzymatic reactions. (From Saunders Dictionary & Encyclopedia of Laboratory Medicine and Technology, 1984)	0	2.63	3	0
Cirrhoses, Experimental Liver [description not available]	0	2.36	2	0
Sycosis [description not available]	0	3.04	5	0
Folliculitis Inflammation of follicles, primarily hair follicles.	0	3.04	5	0
Encephalomyelitis, Inflammatory [description not available]	0	1.94	1	0
Fasting Hypoglycemia HYPOGLYCEMIA expressed in the postabsorptive state, after prolonged FASTING, or an overnight fast.	0	2.64	3	0
Leukocytosis A transient increase in the number of leukocytes in a body fluid.	0	1.94	1	0
Viral Diseases [description not available]	0	4.94	9	0
Encephalitis, Equine [description not available]	0	1.94	1	0
Hepatitis, Animal INFLAMMATION of the LIVER in non-human animals.	0	2.36	2	0
Albuminuria The presence of albumin in the urine, an indicator of KIDNEY DISEASES.	0	1.94	1	0
Encephalomyelitis A general term indicating inflammation of the BRAIN and SPINAL CORD, often used to indicate an infectious process, but also applicable to a variety of autoimmune and toxic-metabolic conditions. There is significant overlap regarding the usage of this term and ENCEPHALITIS in the literature.	0	1.94	1	0
Hemoglobinuria The presence of free HEMOGLOBIN in the URINE, indicating hemolysis of ERYTHROCYTES within the vascular system. After saturating the hemoglobin-binding proteins (HAPTOGLOBINS), free hemoglobin begins to appear in the urine.	0	1.94	1	0
Hypoglycemia A syndrome of abnormally low BLOOD GLUCOSE level. Clinical hypoglycemia has diverse etiologies. Severe hypoglycemia eventually lead to glucose deprivation of the CENTRAL NERVOUS SYSTEM resulting in HUNGER; SWEATING; PARESTHESIA; impaired mental function; SEIZURES; COMA; and even DEATH.	0	2.64	3	0
Virus Diseases A general term for diseases caused by viruses.	0	4.94	9	0
Intertrigo A superficial dermatitis occurring on skin surfaces in contact with each other, such as the axillae, neck creases, intergluteal fold, between the toes, etc. Obesity is a predisposing factor. The condition is caused by moisture and friction and is characterized by erythema, maceration, burning, and exudation.	0	4.42	5	1
Epiphora [description not available]	0	4.04	3	1
Lacrimal Apparatus Diseases Diseases of the LACRIMAL APPARATUS.	0	4.04	3	1
Otospongiosis [description not available]	0	3.27	2	0
Otosclerosis Formation of spongy bone in the labyrinth capsule which can progress toward the STAPES (stapedial fixation) or anteriorly toward the COCHLEA leading to conductive, sensorineural, or mixed HEARING LOSS. Several genes are associated with familial otosclerosis with varied clinical signs.	0	3.27	2	0
Gingivitis Inflammation of gum tissue (GINGIVA) without loss of connective tissue.	0	2.86	4	0
Dermatitis, Periocular [description not available]	0	1.94	1	0
Dermatitis, Perioral A papular eruption of unknown etiology that progresses to residual papular erythema and scaling usually confined to the area of the mouth, and almost exclusively occurring in young women. It may also be localized or extend to involve the eyelids and adjacent glabella area of the forehead (periocular dermatitis). (Dorland, 28th ed)	0	1.94	1	0
Leukocytopenia [description not available]	0	3.78	4	0
Staphylococcal Pneumonia [description not available]	0	3.55	3	0
Leukopenia A decrease in the number of LEUKOCYTES in a blood sample below the normal range (LEUKOCYTE COUNT less than 4000).	0	3.78	4	0
Pneumonia, Staphylococcal Pneumonia caused by infections with bacteria of the genus STAPHYLOCOCCUS, usually with STAPHYLOCOCCUS AUREUS.	0	3.55	3	0
Glycosuria The appearance of an abnormally large amount of GLUCOSE in the urine, such as more than 500 mg/day in adults. It can be due to HYPERGLYCEMIA or genetic defects in renal reabsorption (RENAL GLYCOSURIA).	0	2.63	3	0
Proteinuria The presence of proteins in the urine, an indicator of KIDNEY DISEASES.	0	3.04	5	0
Asthma, Bronchial [description not available]	0	2.63	3	0
Centriacinar Emphysema [description not available]	0	1.94	1	0
Asthma A form of bronchial disorder with three distinct components: airway hyper-responsiveness (RESPIRATORY HYPERSENSITIVITY), airway INFLAMMATION, and intermittent AIRWAY OBSTRUCTION. It is characterized by spasmodic contraction of airway smooth muscle, WHEEZING, and dyspnea (DYSPNEA, PAROXYSMAL).	0	2.63	3	0
Carcinoma, Intraepithelial [description not available]	0	1.94	1	0
Carcinoma in Situ A lesion with cytological characteristics associated with invasive carcinoma but the tumor cells are confined to the epithelium of origin, without invasion of the basement membrane.	0	1.94	1	0
Chest Injuries [description not available]	0	3.26	2	0
Plant Poisoning Poisoning by the ingestion of plants or its leaves, berries, roots or stalks. The manifestations in both humans and animals vary in severity from mild to life threatening. In animals, especially domestic animals, it is usually the result of ingesting moldy or fermented forage.	0	2.64	3	0
Uveitis Inflammation of part or all of the uvea, the middle (vascular) tunic of the eye, and commonly involving the other tunics (sclera and cornea, and the retina). (Dorland, 27th ed)	0	2.36	2	0
Shock, Traumatic Shock produced as a result of trauma.	0	3.77	4	0
Adiadochokinesis [description not available]	0	2.34	2	0
Conjugate Nystagmus [description not available]	0	1.94	1	0
Cerebellar Ataxia Incoordination of voluntary movements that occur as a manifestation of CEREBELLAR DISEASES. Characteristic features include a tendency for limb movements to overshoot or undershoot a target (dysmetria), a tremor that occurs during attempted movements (intention TREMOR), impaired force and rhythm of diadochokinesis (rapidly alternating movements), and GAIT ATAXIA. (From Adams et al., Principles of Neurology, 6th ed, p90)	0	2.34	2	0
Anoxemia [description not available]	0	5.29	8	0
Brain Inflammation [description not available]	0	2.34	2	0
Grippe [description not available]	0	1.94	1	0
Infections, Plasmodium [description not available]	0	3.27	2	0
Rubeola [description not available]	0	1.94	1	0
Mumps An acute infectious disease caused by RUBULAVIRUS, spread by direct contact, airborne droplet nuclei, fomites contaminated by infectious saliva, and perhaps urine, and usually seen in children under the age of 15, although adults may also be affected. (From Dorland, 28th ed)	0	2.34	2	0
Hypoxia Sub-optimal OXYGEN levels in the ambient air of living organisms.	0	5.29	8	0
Encephalitis Inflammation of the BRAIN due to infection, autoimmune processes, toxins, and other conditions. Viral infections (see ENCEPHALITIS, VIRAL) are a relatively frequent cause of this condition.	0	2.34	2	0
Influenza, Human An acute viral infection in humans involving the respiratory tract. It is marked by inflammation of the NASAL MUCOSA; the PHARYNX; and conjunctiva, and by headache and severe, often generalized, myalgia.	0	1.94	1	0
Malaria A protozoan disease caused in humans by four species of the PLASMODIUM genus: PLASMODIUM FALCIPARUM; PLASMODIUM VIVAX; PLASMODIUM OVALE; and PLASMODIUM MALARIAE; and transmitted by the bite of an infected female mosquito of the genus ANOPHELES. Malaria is endemic in parts of Asia, Africa, Central and South America, Oceania, and certain Caribbean islands. It is characterized by extreme exhaustion associated with paroxysms of high FEVER; SWEATING; shaking CHILLS; and ANEMIA. Malaria in ANIMALS is caused by other species of plasmodia.	0	3.27	2	0
Measles A highly contagious infectious disease caused by MORBILLIVIRUS, common among children but also seen in the nonimmune of any age, in which the virus enters the respiratory tract via droplet nuclei and multiplies in the epithelial cells, spreading throughout the MONONUCLEAR PHAGOCYTE SYSTEM.	0	1.94	1	0
Carditis [description not available]	0	1.94	1	0
Myocarditis Inflammatory processes of the muscular walls of the heart (MYOCARDIUM) which result in injury to the cardiac muscle cells (MYOCYTES, CARDIAC). Manifestations range from subclinical to sudden death (DEATH, SUDDEN). Myocarditis in association with cardiac dysfunction is classified as inflammatory CARDIOMYOPATHY usually caused by INFECTION, autoimmune diseases, or responses to toxic substances. Myocarditis is also a common cause of DILATED CARDIOMYOPATHY and other cardiomyopathies.	0	1.94	1	0
Pulsatile Tinnitus [description not available]	0	1.94	1	0
Tinnitus A nonspecific symptom of hearing disorder characterized by the sensation of buzzing, ringing, clicking, pulsations, and other noises in the ear. Objective tinnitus refers to noises generated from within the ear or adjacent structures that can be heard by other individuals. The term subjective tinnitus is used when the sound is audible only to the affected individual. Tinnitus may occur as a manifestation of COCHLEAR DISEASES; VESTIBULOCOCHLEAR NERVE DISEASES; INTRACRANIAL HYPERTENSION; CRANIOCEREBRAL TRAUMA; and other conditions.	0	1.94	1	0
Lipodystrophy, Intestinal [description not available]	0	2.63	3	0
Lipodystrophy A collection of heterogenous conditions resulting from defective LIPID METABOLISM and characterized by ADIPOSE TISSUE atrophy. Often there is redistribution of body fat resulting in peripheral fat wasting and central adiposity. They include generalized, localized, congenital, and acquired lipodystrophy.	0	1.94	1	0
Cancer of Intestines [description not available]	0	4.99	5	2
Diffuse Large B-Cell Lymphoma [description not available]	0	1.94	1	0
Intestinal Neoplasms Tumors or cancer of the INTESTINES.	0	4.99	5	2
Lymphoma, Large B-Cell, Diffuse Malignant lymphoma composed of large B lymphoid cells whose nuclear size can exceed normal macrophage nuclei, or more than twice the size of a normal lymphocyte. The pattern is predominantly diffuse. Most of these lymphomas represent the malignant counterpart of B-lymphocytes at midstage in the process of differentiation.	0	1.94	1	0
Hemorrhagic Shock [description not available]	0	4.18	2	0
Mucocele A retention cyst of the salivary gland, lacrimal sac, paranasal sinuses, appendix, or gallbladder. (Stedman, 26th ed)	0	1.93	1	0
Hematemesis Vomiting of blood that is either fresh bright red, or older coffee-ground in character. It generally indicates bleeding of the UPPER GASTROINTESTINAL TRACT.	0	2.63	3	0
Cancer of Pharynx [description not available]	0	1.94	1	0
Pharyngeal Neoplasms Tumors or cancer of the PHARYNX.	0	1.94	1	0
Anterior Optic Neuritis [description not available]	0	2.35	2	0
Optic Atrophy Atrophy of the optic disk which may be congenital or acquired. This condition indicates a deficiency in the number of nerve fibers which arise in the RETINA and converge to form the OPTIC DISK; OPTIC NERVE; OPTIC CHIASM; and optic tracts. GLAUCOMA; ISCHEMIA; inflammation, a chronic elevation of intracranial pressure, toxins, optic nerve compression, and inherited conditions (see OPTIC ATROPHIES, HEREDITARY) are relatively common causes of this condition.	0	1.94	1	0
Optic Neuritis Inflammation of the optic nerve. Commonly associated conditions include autoimmune disorders such as MULTIPLE SCLEROSIS, infections, and granulomatous diseases. Clinical features include retro-orbital pain that is aggravated by eye movement, loss of color vision, and contrast sensitivity that may progress to severe visual loss, an afferent pupillary defect (Marcus-Gunn pupil), and in some instances optic disc hyperemia and swelling. Inflammation may occur in the portion of the nerve within the globe (neuropapillitis or anterior optic neuritis) or the portion behind the globe (retrobulbar neuritis or posterior optic neuritis).	0	2.35	2	0
Hives [description not available]	0	2.35	2	0
Urticaria A vascular reaction of the skin characterized by erythema and wheal formation due to localized increase of vascular permeability. The causative mechanism may be allergy, infection, or stress.	0	2.35	2	0
Deficiency, Vitamin K [description not available]	0	2.63	3	0
Vitamin K Deficiency A nutritional condition produced by a deficiency of VITAMIN K in the diet, characterized by an increased tendency to hemorrhage (HEMORRHAGIC DISORDERS). Such bleeding episodes may be particularly severe in newborn infants. (From Cecil Textbook of Medicine, 19th ed, p1182)	0	2.63	3	0
Cataract, Membranous [description not available]	0	2.35	2	0
Cataract Partial or complete opacity on or in the lens or capsule of one or both eyes, impairing vision or causing blindness. The many kinds of cataract are classified by their morphology (size, shape, location) or etiology (cause and time of occurrence). (Dorland, 27th ed)	0	2.35	2	0
Chemotherapy-Induced Acral Erythema [description not available]	0	1.94	1	0
HbS Disease [description not available]	0	4.02	3	1
Anemia, Sickle Cell A disease characterized by chronic hemolytic anemia, episodic painful crises, and pathologic involvement of many organs. It is the clinical expression of homozygosity for hemoglobin S.	0	4.02	3	1
Hand-Foot Syndrome Chemotherapy-induced dermal side effects that are associated with the use of various CYTOSTATIC AGENTS. Symptoms range from mild ERYTHEMA and/or PARESTHESIA to severe ulcerative dermatitis with debilitating pain involving typically palmoplantar and intertriginous areas. These cutaneous manifestations are sometimes accompanied by nail anomalies.	0	1.94	1	0
Bacteriuria The presence of bacteria in the urine which is normally bacteria-free. These bacteria are from the URINARY TRACT and are not contaminants of the surrounding tissues. Bacteriuria can be symptomatic or asymptomatic. Significant bacteriuria is an indicator of urinary tract infection.	0	8.33	24	6
Metabolic Acidosis [description not available]	0	4.26	7	0
Acidosis A pathologic condition of acid accumulation or depletion of base in the body. The two main types are RESPIRATORY ACIDOSIS and metabolic acidosis, due to metabolic acid build up.	0	4.26	7	0
Hepatitis B Virus Infection [description not available]	0	2.35	2	0
Hepatitis B INFLAMMATION of the LIVER in humans caused by a member of the ORTHOHEPADNAVIRUS genus, HEPATITIS B VIRUS. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.	0	2.35	2	0
Emphysema, Mediastinal [description not available]	0	1.94	1	0
Periphlebitis Periphlebitis is inflammation of the outer coat of a vein or of tissues surrounding the vein.	0	4.99	5	2
Phlebitis Inflammation of a vein, often a vein in the leg. Phlebitis associated with a blood clot is called (THROMBOPHLEBITIS).	0	4.99	5	2
Dermatitis, Radiation-Induced [description not available]	0	2.34	2	0
Kraurosis Vulvae [description not available]	0	1.94	1	0
Vulvar Lichen Sclerosus Atrophy and shriveling of the SKIN of the VULVA that is characterized by the whitish LICHEN SCLEROSUS appearance, inflammation, and PRURITUS.	0	1.94	1	0
Radiodermatitis A cutaneous inflammatory reaction occurring as a result of exposure to ionizing radiation.	0	2.34	2	0
Clostridioides difficile Infection [description not available]	0	3.96	5	0
Clostridium Infections Infections with bacteria of the genus CLOSTRIDIUM and closely related CLOSTRIDIOIDES species.	0	3.96	5	0
Bone Marrow Diseases Diseases involving the BONE MARROW.	0	4.26	4	1
Metastase [description not available]	0	3.67	10	0
Neoplasm Metastasis The transfer of a neoplasm from one organ or part of the body to another remote from the primary site.	0	3.67	10	0
Diverticula [description not available]	0	3.19	6	0
Diverticulum, Meckel [description not available]	0	2.34	2	0
Furrow Keratitis [description not available]	0	3.33	7	0
Infarct [description not available]	0	2.63	3	0
Peritoneal Diseases Pathological processes involving the PERITONEUM.	0	2.63	3	0
Muscle Spasm [description not available]	0	2.64	3	0
Spasm An involuntary contraction of a muscle or group of muscles. Spasms may involve SKELETAL MUSCLE or SMOOTH MUSCLE.	0	2.64	3	0
Food Poisoning, Salmonella [description not available]	0	3.19	6	0
Salmonella Food Poisoning Poisoning caused by ingestion of food harboring species of SALMONELLA. Conditions of raising, shipping, slaughtering, and marketing of domestic animals contribute to the spread of this bacterium in the food supply.	0	3.19	6	0
Nephrosis Pathological processes of the KIDNEY without inflammatory or neoplastic components. Nephrosis may be a primary disorder or secondary complication of other diseases. It is characterized by the NEPHROTIC SYNDROME indicating the presence of PROTEINURIA and HYPOALBUMINEMIA with accompanying EDEMA.	0	2.35	2	0
CBS Deficiency [description not available]	0	1.94	1	0
Homocystinuria Autosomal recessive inborn error of methionine metabolism usually caused by a deficiency of CYSTATHIONINE BETA-SYNTHASE and associated with elevations of homocysteine in plasma and urine. Clinical features include a tall slender habitus, SCOLIOSIS, arachnodactyly, MUSCLE WEAKNESS, genu varus, thin blond hair, malar flush, lens dislocations, an increased incidence of MENTAL RETARDATION, and a tendency to develop fibrosis of arteries, frequently complicated by CEREBROVASCULAR ACCIDENTS and MYOCARDIAL INFARCTION. (From Adams et al., Principles of Neurology, 6th ed, p979)	0	1.94	1	0
Deficiency, Folic Acid [description not available]	0	3.77	4	0
Bronze Diabetes [description not available]	0	2.34	2	0
Folic Acid Deficiency A nutritional condition produced by a deficiency of FOLIC ACID in the diet. Many plant and animal tissues contain folic acid, abundant in green leafy vegetables, yeast, liver, and mushrooms but destroyed by long-term cooking. Alcohol interferes with its intermediate metabolism and absorption. Folic acid deficiency may develop in long-term anticonvulsant therapy or with use of oral contraceptives. This deficiency causes anemia, macrocytic anemia, and megaloblastic anemia. It is indistinguishable from vitamin B 12 deficiency in peripheral blood and bone marrow findings, but the neurologic lesions seen in B 12 deficiency do not occur. (Merck Manual, 16th ed)	0	3.77	4	0
Hemochromatosis A disorder of iron metabolism characterized by a triad of HEMOSIDEROSIS; LIVER CIRRHOSIS; and DIABETES MELLITUS. It is caused by massive iron deposits in parenchymal cells that may develop after a prolonged increase of iron absorption. (Jablonski's Dictionary of Syndromes & Eponymic Diseases, 2d ed)	0	2.34	2	0
Arbovirus Infections Infections caused by arthropod-borne viruses, general or unspecified.	0	1.94	1	0
Alpha Virus Infections [description not available]	0	1.94	1	0
Reproductive Sterility [description not available]	0	1.94	1	0
Infertility A reduced or absent capacity to reproduce.	0	1.94	1	0
Monkey Diseases Diseases of Old World and New World monkeys. This term includes diseases of baboons but not of chimpanzees or gorillas (= APE DISEASES).	0	2.86	4	0
Proctitis INFLAMMATION of the MUCOUS MEMBRANE of the RECTUM, the distal end of the large intestine (INTESTINE, LARGE).	0	2.35	2	0
Pyuria The presence of white blood cells (LEUKOCYTES) in the urine. It is often associated with bacterial infections of the urinary tract. Pyuria without BACTERIURIA can be caused by TUBERCULOSIS, stones, or cancer.	0	1.93	1	0
Infection, Toxoplasma gondii [description not available]	0	2.34	2	0
Toxoplasmosis The acquired form of infection by Toxoplasma gondii in animals and man.	0	2.34	2	0
Co-infection [description not available]	0	1.93	1	0
Behavior Disorders [description not available]	0	7.01	7	1
Mental Disorders Psychiatric illness or diseases manifested by breakdowns in the adaptational process expressed primarily as abnormalities of thought, feeling, and behavior producing either distress or impairment of function.	0	7.01	7	1
Catarrh Inflammation of a mucous membrane with increased flow of mucous in humans or animals. Catarrh is used mostly in a historical context.	0	2.63	3	0
Common Cold A catarrhal disorder of the upper respiratory tract, which may be viral or a mixed infection. It generally involves a runny nose, nasal congestion, and sneezing.	0	2.63	3	0
Dermatitis, Occupational A recurrent contact dermatitis caused by substances found in the work place.	0	3.21	6	0
Venous Insufficiency Impaired venous blood flow or venous return (venous stasis), usually caused by inadequate venous valves. Venous insufficiency often occurs in the legs, and is associated with EDEMA and sometimes with VENOUS STASIS ULCERS at the ankle.	0	2.65	3	0
Jaundice, Cholestatic [description not available]	0	2.01	1	0
Jaundice, Obstructive Jaundice, the condition with yellowish staining of the skin and mucous membranes, that is due to impaired BILE flow in the BILIARY TRACT, such as INTRAHEPATIC CHOLESTASIS, or EXTRAHEPATIC CHOLESTASIS.	0	2.01	1	0
Infections, Meningococcal [description not available]	0	2.01	1	0
Meningococcal Infections Infections with bacteria of the species NEISSERIA MENINGITIDIS.	0	2.01	1	0
Lactic Acidosis [description not available]	0	3.1	5	0
Acidosis, Lactic Acidosis caused by accumulation of lactic acid more rapidly than it can be metabolized. It may occur spontaneously or in association with diseases such as DIABETES MELLITUS; LEUKEMIA; or LIVER FAILURE.	0	3.1	5	0
Leukemoid Reaction A peripheral blood picture resembling that of leukemia or indistinguishable from it on the basis of morphologic appearance alone. (Dorland, 27th ed)	0	1.92	1	0
Cancer of the Thyroid [description not available]	0	2.35	2	0
Thyroid Neoplasms Tumors or cancer of the THYROID GLAND.	0	2.35	2	0
Cancer, Second Primary [description not available]	0	1.92	1	0
Acute Radiation Syndrome A condition caused by a brief whole body exposure to more than one sievert dose equivalent of radiation. Acute radiation syndrome is initially characterized by ANOREXIA; NAUSEA; VOMITING; but can progress to hematological, gastrointestinal, neurological, pulmonary, and other major organ dysfunction.	0	1.92	1	0
Bacterial Meningitides [description not available]	0	1.93	1	0
Meningitis, Bacterial Bacterial infections of the leptomeninges and subarachnoid space, frequently involving the cerebral cortex, cranial nerves, cerebral blood vessels, spinal cord, and nerve roots.	0	1.93	1	0
Brittle Bone Disease [description not available]	0	2.02	1	0
Osteogenesis Imperfecta COLLAGEN DISEASES characterized by brittle, osteoporotic, and easily fractured bones. It may also present with blue sclerae, loose joints, and imperfect dentin formation. Most types are autosomal dominant and are associated with mutations in COLLAGEN TYPE I.	0	2.02	1	0
Polyuria Urination of a large volume of urine with an increase in urinary frequency, commonly seen in diabetes (DIABETES MELLITUS; DIABETES INSIPIDUS).	0	2.02	1	0
Eyelid Diseases Diseases involving the EYELIDS.	0	6.13	12	3
ADPKD [description not available]	0	2.02	1	0
Polycystic Kidney, Autosomal Dominant Kidney disorders with autosomal dominant inheritance and characterized by multiple CYSTS in both KIDNEYS with progressive deterioration of renal function.	0	2.02	1	0
Dysembryoma [description not available]	0	3.47	8	0
Teratoma A true neoplasm composed of a number of different types of tissue, none of which is native to the area in which it occurs. It is composed of tissues that are derived from three germinal layers, the endoderm, mesoderm, and ectoderm. They are classified histologically as mature (benign) or immature (malignant). (From DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1642)	0	3.47	8	0
Chondromalacia Softening and degeneration of the CARTILAGE.	0	2.37	2	0
Cartilage Diseases Pathological processes involving the chondral tissue (CARTILAGE).	0	2.37	2	0
Constriction, Pathological [description not available]	0	2.02	1	0
Constriction, Pathologic The condition of an anatomical structure's being constricted beyond normal dimensions.	0	2.02	1	0
Hyperplasia, Reactive Lymphoid [description not available]	0	2.02	1	0
Central Retinal Edema, Cystoid [description not available]	0	2.02	1	0
Macular Edema Fluid accumulation in the outer layer of the MACULA LUTEA that results from intraocular or systemic insults. It may develop in a diffuse pattern where the macula appears thickened or it may acquire the characteristic petaloid appearance referred to as cystoid macular edema. Although macular edema may be associated with various underlying conditions, it is most commonly seen following intraocular surgery, venous occlusive disease, DIABETIC RETINOPATHY, and posterior segment inflammatory disease. (From Survey of Ophthalmology 2004; 49(5) 470-90)	0	2.02	1	0
Eyelid Neoplasms Tumors of cancer of the EYELIDS.	0	2.4	2	0
Bone Loss, Osteoclastic [description not available]	0	3.09	5	0
Delayed Hypersensitivity [description not available]	0	4.38	8	0
Intraocular Pressure The pressure of the fluids in the eye.	0	4.45	5	1
Nasal Polyps Focal accumulations of EDEMA fluid in the NASAL MUCOSA accompanied by HYPERPLASIA of the associated submucosal connective tissue. Polyps may be NEOPLASMS, foci of INFLAMMATION, degenerative lesions, or malformations.	0	4.04	3	1
Teeth, Impacted [description not available]	0	5.24	2	2
Alveolalgia [description not available]	0	5.92	5	2
Exanthem [description not available]	0	2.87	4	0
Exanthema Diseases in which skin eruptions or rashes are a prominent manifestation. Classically, six such diseases were described with similar rashes; they were numbered in the order in which they were reported. Only the fourth (Duke's disease), fifth (ERYTHEMA INFECTIOSUM), and sixth (EXANTHEMA SUBITUM) numeric designations survive as occasional synonyms in current terminology.	0	2.87	4	0
Bone Cancer [description not available]	0	2.67	3	0
Bone Neoplasms Tumors or cancer located in bone tissue or specific BONES.	0	2.67	3	0
Genome Instability [description not available]	0	2.03	1	0
Polyploid [description not available]	0	2.03	1	0
Deep Vein Thrombosis [description not available]	0	2.03	1	0
Venous Thrombosis The formation or presence of a blood clot (THROMBUS) within a vein.	0	2.03	1	0
Abscess, Hepatic [description not available]	0	2.03	1	0
Liver Abscess Solitary or multiple collections of PUS within the liver as a result of infection by bacteria, protozoa, or other agents.	0	2.03	1	0
Chromosomal Translocation [description not available]	0	2.41	2	0
Chondrodystrophic Myotonia [description not available]	0	2.03	1	0
Chlamydiaceae Infections Infections with bacteria of the family CHLAMYDIACEAE.	0	2.02	1	0
Rupture, Spontaneous Tear or break of an organ, vessel or other soft part of the body, occurring in the absence of external force.	0	3.8	4	0
Chronic Kidney Failure [description not available]	0	4.89	14	0
Kidney Failure, Chronic The end-stage of CHRONIC RENAL INSUFFICIENCY. It is characterized by the severe irreversible kidney damage (as measured by the level of PROTEINURIA) and the reduction in GLOMERULAR FILTRATION RATE to less than 15 ml per min (Kidney Foundation: Kidney Disease Outcome Quality Initiative, 2002). These patients generally require HEMODIALYSIS or KIDNEY TRANSPLANTATION.	0	4.89	14	0
Penile Diseases Pathological processes involving the PENIS or its component tissues.	0	2.66	3	0
Chromosome Inversion An aberration in which a chromosomal segment is deleted and reinserted in the same place but turned 180 degrees from its original orientation, so that the gene sequence for the segment is reversed with respect to that of the rest of the chromosome.	0	3.08	5	0
Acute Confusional Senile Dementia [description not available]	0	2.04	1	0
Maggot Infestations [description not available]	0	2.37	2	0
Alzheimer Disease A degenerative disease of the BRAIN characterized by the insidious onset of DEMENTIA. Impairment of MEMORY, judgment, attention span, and problem solving skills are followed by severe APRAXIAS and a global loss of cognitive abilities. The condition primarily occurs after age 60, and is marked pathologically by severe cortical atrophy and the triad of SENILE PLAQUES; NEUROFIBRILLARY TANGLES; and NEUROPIL THREADS. (From Adams et al., Principles of Neurology, 6th ed, pp1049-57)	0	2.04	1	0
Age-Related Osteoporosis [description not available]	0	2.04	1	0
Osteoporosis Reduction of bone mass without alteration in the composition of bone, leading to fractures. Primary osteoporosis can be of two major types: postmenopausal osteoporosis (OSTEOPOROSIS, POSTMENOPAUSAL) and age-related or senile osteoporosis.	0	2.04	1	0
Angiospasm, Intracranial [description not available]	0	2.42	2	0
Hemorrhage, Subarachnoid [description not available]	0	2.04	1	0
Subarachnoid Hemorrhage Bleeding into the intracranial or spinal SUBARACHNOID SPACE, most resulting from INTRACRANIAL ANEURYSM rupture. It can occur after traumatic injuries (SUBARACHNOID HEMORRHAGE, TRAUMATIC). Clinical features include HEADACHE; NAUSEA; VOMITING, nuchal rigidity, variable neurological deficits and reduced mental status.	0	2.04	1	0
Vasospasm, Intracranial Constriction of arteries in the SKULL due to sudden, sharp, and often persistent smooth muscle contraction in blood vessels. Intracranial vasospasm results in reduced vessel lumen caliber, restricted blood flow to the brain, and BRAIN ISCHEMIA that may lead to hypoxic-ischemic brain injury (HYPOXIA-ISCHEMIA, BRAIN).	0	2.42	2	0
Episcleritis [description not available]	0	2.42	2	0
Scleritis Refers to any inflammation of the sclera including episcleritis, a benign condition affecting only the episclera, which is generally short-lived and easily treated. Classic scleritis, on the other hand, affects deeper tissue and is characterized by higher rates of visual acuity loss and even mortality, particularly in necrotizing form. Its characteristic symptom is severe and general head pain. Scleritis has also been associated with systemic collagen disease. Etiology is unknown but is thought to involve a local immune response. Treatment is difficult and includes administration of anti-inflammatory and immunosuppressive agents such as corticosteroids. Inflammation of the sclera may also be secondary to inflammation of adjacent tissues, such as the conjunctiva.	0	2.42	2	0
Mesenteric Vascular Occlusion Obstruction of the flow in the SPLANCHNIC CIRCULATION by ATHEROSCLEROSIS; EMBOLISM; THROMBOSIS; STENOSIS; TRAUMA; and compression or intrinsic pressure from adjacent tumors. Rare causes are drugs, intestinal parasites, and vascular immunoinflammatory diseases such as PERIARTERITIS NODOSA and THROMBOANGIITIS OBLITERANS. (From Juergens et al., Peripheral Vascular Diseases, 5th ed, pp295-6)	0	2.65	3	0
Alcoholic Intoxication An acute brain syndrome which results from the excessive ingestion of ETHANOL or ALCOHOLIC BEVERAGES.	0	1.94	1	0
Nutritional Disorders [description not available]	0	4.9	6	0
Nutrition Disorders Disorders caused by nutritional imbalance, either overnutrition or undernutrition.	0	4.9	6	0
Arteriosclerosis Obliterans Common occlusive arterial disease which is caused by ATHEROSCLEROSIS. It is characterized by lesions in the innermost layer (ARTERIAL INTIMA) of arteries including the AORTA and its branches to the extremities. Risk factors include smoking, HYPERLIPIDEMIA, and HYPERTENSION.	0	1.94	1	0
Nausea An unpleasant sensation in the stomach usually accompanied by the urge to vomit. Common causes are early pregnancy, sea and motion sickness, emotional stress, intense pain, food poisoning, and various enteroviruses.	0	4.02	3	1
Alactasia [description not available]	0	4.44	5	1
Lactose Intolerance The condition resulting from the absence or deficiency of LACTASE in the MUCOSA cells of the GASTROINTESTINAL TRACT, and the inability to break down LACTOSE in milk for ABSORPTION. Bacterial fermentation of the unabsorbed lactose leads to symptoms that range from a mild indigestion (DYSPEPSIA) to severe DIARRHEA. Lactose intolerance may be an inborn error or acquired.	0	4.44	5	1
Nephritis Inflammation of any part of the KIDNEY.	0	2.35	2	0
Chorea Disorders [description not available]	0	1.94	1	0
Athetoid Movements [description not available]	0	1.94	1	0
Chorea Involuntary, forcible, rapid, jerky movements that may be subtle or become confluent, markedly altering normal patterns of movement. Hypotonia and pendular reflexes are often associated. Conditions which feature recurrent or persistent episodes of chorea as a primary manifestation of disease are referred to as CHOREATIC DISORDERS. Chorea is also a frequent manifestation of BASAL GANGLIA DISEASES.	0	1.94	1	0
Sterility, Female [description not available]	0	1.94	1	0
Infertility, Female Diminished or absent ability of a female to achieve conception.	0	1.94	1	0
Epulides, Giant Cell [description not available]	0	1.96	1	0
Orbital Diseases Diseases of the bony orbit and contents except the eyeball.	0	1.96	1	0
Granuloma, Giant Cell A non-neoplastic inflammatory lesion, usually of the jaw or gingiva, containing large, multinucleated cells. It includes reparative giant cell granuloma. Peripheral giant cell granuloma refers to the gingiva (giant cell epulis); central refers to the jaw.	0	1.96	1	0
Granulocytic Leukemia [description not available]	0	4.05	3	1
Leukemia, Myeloid Form of leukemia characterized by an uncontrolled proliferation of the myeloid lineage and their precursors (MYELOID PROGENITOR CELLS) in the bone marrow and other sites.	0	4.05	3	1
Bone Cysts Benign unilocular lytic areas in the proximal end of a long bone with well defined and narrow endosteal margins. The cysts contain fluid and the cyst walls may contain some giant cells. Bone cysts usually occur in males between the ages 3-15 years.	0	2.36	2	0
Pseudarthrosis A pathologic entity characterized by deossification of a weight-bearing long bone, followed by bending and pathologic fracture, with inability to form normal BONY CALLUS leading to existence of the false joint that gives the condition its name. (Dorland, 27th ed)	0	1.96	1	0
Bone Diseases Diseases of BONES.	0	2.64	3	0
Bilateral Deafness [description not available]	0	1.96	1	0
Cell Transformation, Viral An inheritable change in cells manifested by changes in cell division and growth and alterations in cell surface properties. It is induced by infection with a transforming virus.	0	3.58	9	0
Labyrinthitis Inflammation of the inner ear (LABYRINTH).	0	3.28	2	0
Apolipoprotein B-100, Familial Defective [description not available]	0	9.35	20	7
Hyperlipoproteinemia Type II A group of familial disorders characterized by elevated circulating cholesterol contained in either LOW-DENSITY LIPOPROTEINS alone or also in VERY-LOW-DENSITY LIPOPROTEINS (pre-beta lipoproteins).	0	9.35	20	7
Ozena [description not available]	0	2.36	2	0
Rhinitis, Atrophic A chronic inflammation in which the NASAL MUCOSA gradually changes from a functional to a non-functional lining without mucociliary clearance. It is often accompanied by degradation of the bony TURBINATES, and the foul-smelling mucus which forms a greenish crust (ozena).	0	2.36	2	0
Acoustic Trauma Usually refer to hearing loss due to a single noise event such as an explosion or shotgun blast.	0	4.57	10	0
Presbycusis Gradual bilateral hearing loss associated with aging that is due to progressive degeneration of cochlear structures and central auditory pathways. Hearing loss usually begins with the high frequencies then progresses to sounds of middle and low frequencies.	0	2.36	2	0
Hearing Loss, Noise-Induced Hearing loss due to exposure to explosive loud noise or chronic exposure to sound level greater than 85 dB. The hearing loss is often in the frequency range 4000-6000 hertz.	0	4.57	10	0
Auricular Cancer [description not available]	0	2.64	3	0
Ear Neoplasms Tumors or cancer of any part of the hearing and equilibrium system of the body (the EXTERNAL EAR, the MIDDLE EAR, and the INNER EAR).	0	2.64	3	0
Neurofibroma A moderately firm, benign, encapsulated tumor resulting from proliferation of SCHWANN CELLS and FIBROBLASTS that includes portions of nerve fibers. The tumors usually develop along peripheral or cranial nerves and are a central feature of NEUROFIBROMATOSIS 1, where they may occur intracranially or involve spinal roots. Pathologic features include fusiform enlargement of the involved nerve. Microscopic examination reveals a disorganized and loose cellular pattern with elongated nuclei intermixed with fibrous strands. (From Adams et al., Principles of Neurology, 6th ed, p1016)	0	1.96	1	0
Dermatophytoses [description not available]	0	2.64	3	0
Tinea Fungal infection of keratinized tissues such as hair, skin and nails. The main causative fungi include MICROSPORUM; TRICHOPHYTON; and EPIDERMOPHYTON.	0	2.64	3	0
Infections, Yersinia [description not available]	0	3.34	1	1
Far East Scarlet-like Fever [description not available]	0	3.34	1	1
Nevoxanthoendothelioma [description not available]	0	2.87	1	0
Intestinal Polyps Discrete abnormal tissue masses that protrude into the lumen of the INTESTINE. A polyp is attached to the intestinal wall either by a stalk, pedunculus, or by a broad base.	0	3.74	2	1
Hypocalcemia Reduction of the blood calcium below normal. Manifestations include hyperactive deep tendon reflexes, Chvostek's sign, muscle and abdominal cramps, and carpopedal spasm. (Dorland, 27th ed)	0	3.34	7	0
Acute Kidney Tubular Necrosis [description not available]	0	3.56	3	0
Kidney Tubular Necrosis, Acute Acute kidney failure resulting from destruction of EPITHELIAL CELLS of the KIDNEY TUBULES. It is commonly attributed to exposure to toxic agents or renal ISCHEMIA following severe TRAUMA.	0	3.56	3	0
Infections, Spirochaetales [description not available]	0	1.96	1	0
Pancreatic Insufficiency [description not available]	0	1.96	1	0
Exocrine Pancreatic Insufficiency A malabsorption condition resulting from greater than 10% reduction in the secretion of pancreatic digestive enzymes (LIPASE; PROTEASES; and AMYLASE) by the EXOCRINE PANCREAS into the DUODENUM. This condition is often associated with CYSTIC FIBROSIS and with chronic PANCREATITIS.	0	1.96	1	0
Gastroduodenal Ulcer [description not available]	0	2.36	2	0
Peptic Ulcer Ulcer that occurs in the regions of the GASTROINTESTINAL TRACT which come into contact with GASTRIC JUICE containing PEPSIN and GASTRIC ACID. It occurs when there are defects in the MUCOSA barrier. The common forms of peptic ulcers are associated with HELICOBACTER PYLORI and the consumption of nonsteroidal anti-inflammatory drugs (NSAIDS).	0	2.36	2	0
Myoclonic Jerk [description not available]	0	2.87	1	0
Gallstone Disease [description not available]	0	5.63	7	1
Curling Ulcer Acute stress DUODENAL ULCER, usually observed in patients with extensive third-degree burns.	0	4.94	3	1
Cholelithiasis Presence or formation of GALLSTONES in the BILIARY TRACT, usually in the gallbladder (CHOLECYSTOLITHIASIS) or the common bile duct (CHOLEDOCHOLITHIASIS).	0	5.63	7	1
Duodenal Ulcer A PEPTIC ULCER located in the DUODENUM.	0	4.94	3	1
Hyperlipoproteinemia [description not available]	0	5.37	5	1
Hyperlipoproteinemias Conditions with abnormally elevated levels of LIPOPROTEINS in the blood. They may be inherited, acquired, primary, or secondary. Hyperlipoproteinemias are classified according to the pattern of lipoproteins on electrophoresis or ultracentrifugation.	0	5.37	5	1
Alcoholic Cirrhosis [description not available]	0	1.96	1	0
Liver Cirrhosis, Alcoholic FIBROSIS of the hepatic parenchyma due to chronic excess ALCOHOL DRINKING.	0	1.96	1	0
Viral Hepatitis, Human [description not available]	0	2.87	4	0
Hepatitis, Viral, Human INFLAMMATION of the LIVER in humans due to infection by VIRUSES. There are several significant types of human viral hepatitis with infection caused by enteric-transmission (HEPATITIS A; HEPATITIS E) or blood transfusion (HEPATITIS B; HEPATITIS C; and HEPATITIS D).	0	2.87	4	0
Phlegmasia Alba Dolens Inflammation that is characterized by swollen, pale, and painful limb. It is usually caused by DEEP VEIN THROMBOSIS in a FEMORAL VEIN, following PARTURITION or an illness. This condition is also called milk leg or white leg.	0	2.64	3	0
Thrombophlebitis Inflammation of a vein associated with a blood clot (THROMBUS).	0	2.64	3	0
Uremia A clinical syndrome associated with the retention of renal waste products or uremic toxins in the blood. It is usually the result of RENAL INSUFFICIENCY. Most uremic toxins are end products of protein or nitrogen CATABOLISM, such as UREA or CREATININE. Severe uremia can lead to multiple organ dysfunctions with a constellation of symptoms.	0	6.39	16	1
Retinal Pigment Epithelial Detachment [description not available]	0	1.96	1	0
Retinal Detachment Separation of the inner layers of the retina (neural retina) from the pigment epithelium. Retinal detachment occurs more commonly in men than in women, in eyes with degenerative myopia, in aging and in aphakia. It may occur after an uncomplicated cataract extraction, but it is seen more often if vitreous humor has been lost during surgery. (Dorland, 27th ed; Newell, Ophthalmology: Principles and Concepts, 7th ed, p310-12).	0	1.96	1	0
Disc, Herniated [description not available]	0	1.96	1	0
Intervertebral Disc Displacement An INTERVERTEBRAL DISC in which the NUCLEUS PULPOSUS has protruded through surrounding ANNULUS FIBROSUS. This occurs most frequently in the lower lumbar region.	0	1.96	1	0
Rhinitis, Allergic, Nonseasonal [description not available]	0	1.96	1	0
Rhinitis, Allergic, Perennial Inflammation of the mucous membrane of the nose similar to that found in hay fever except that symptoms persist throughout the year. The causes are usually air-borne allergens, particularly dusts, feathers, molds, animal fur, etc.	0	1.96	1	0
Cervix Diseases [description not available]	0	4.27	4	1
Anemia, Macrocytic Anemia characterized by larger than normal erythrocytes, increased mean corpuscular volume (MCV) and increased mean corpuscular hemoglobin (MCH).	0	2.64	3	0
Anemia, Megaloblastic A disorder characterized by the presence of ANEMIA, abnormally large red blood cells (megalocytes or macrocytes), and MEGALOBLASTS.	0	2.37	2	0
Deficiency, Vitamin B 12 [description not available]	0	3.05	5	0
Vitamin B 12 Deficiency A nutritional condition produced by a deficiency of VITAMIN B 12 in the diet, characterized by megaloblastic anemia. Since vitamin B 12 is not present in plants, humans have obtained their supply from animal products, from multivitamin supplements in the form of pills, and as additives to food preparations. A wide variety of neuropsychiatric abnormalities is also seen in vitamin B 12 deficiency and appears to be due to an undefined defect involving myelin synthesis. (From Cecil Textbook of Medicine, 19th ed, p848)	0	3.05	5	0
Fractures, Compound [description not available]	0	1.95	1	0
Bile Duct Obstruction [description not available]	0	2.87	4	0
Cholestasis Impairment of bile flow due to obstruction in small bile ducts (INTRAHEPATIC CHOLESTASIS) or obstruction in large bile ducts (EXTRAHEPATIC CHOLESTASIS).	0	2.87	4	0
Methemoglobinemia The presence of methemoglobin in the blood, resulting in cyanosis. A small amount of methemoglobin is present in the blood normally, but injury or toxic agents convert a larger proportion of hemoglobin into methemoglobin, which does not function reversibly as an oxygen carrier. Methemoglobinemia may be due to a defect in the enzyme NADH methemoglobin reductase (an autosomal recessive trait) or to an abnormality in hemoglobin M (an autosomal dominant trait). (Dorland, 27th ed)	0	2.87	4	0
Corynebacterium Infections Infections with bacteria of the genus CORYNEBACTERIUM.	0	2.65	3	0
Avian Diseases [description not available]	0	2.64	3	0
Hand Injuries General or unspecified injuries to the hand.	0	3.2	6	0
Infections, Helicobacter [description not available]	0	1.98	1	0
Cecal Diseases Pathological developments in the CECUM.	0	2.37	2	0
Helicobacter Infections Infections with organisms of the genus HELICOBACTER, particularly, in humans, HELICOBACTER PYLORI. The clinical manifestations are focused in the stomach, usually the gastric mucosa and antrum, and the upper duodenum. This infection plays a major role in the pathogenesis of type B gastritis and peptic ulcer disease.	0	1.98	1	0
Animal Mammary Carcinoma [description not available]	0	1.98	1	0
Hormone-Dependent Neoplasms [description not available]	0	1.98	1	0
Hearing Loss, High-Frequency Hearing loss in frequencies above 1000 hertz.	0	3.77	2	1
Fibrosarcoma A sarcoma derived from deep fibrous tissue, characterized by bundles of immature proliferating fibroblasts with variable collagen formation, which tends to invade locally and metastasize by the bloodstream. (Stedman, 25th ed)	0	3.23	6	0
Earache Pain in the ear.	0	3.37	1	1
Acute Promyelocytic Leukemia [description not available]	0	2.39	2	0
Leukemia, Promyelocytic, Acute An acute myeloid leukemia in which abnormal PROMYELOCYTES predominate. It is frequently associated with DISSEMINATED INTRAVASCULAR COAGULATION.	0	2.39	2	0
Ichthyosis Simplex [description not available]	0	1.98	1	0
Leukemia, Lymphocytic, T Cell [description not available]	0	2.68	3	0
Leukemia, T-Cell A malignant disease of the T-LYMPHOCYTES in the bone marrow, thymus, and/or blood.	0	2.68	3	0
Giardia duodenalis Infection [description not available]	0	3.78	2	1
Giardiasis An infection of the SMALL INTESTINE caused by the flagellated protozoan GIARDIA. It is spread via contaminated food and water and by direct person-to-person contact.	0	3.78	2	1
Acquired Metabolic Diseases, Brain [description not available]	0	2.4	2	0
Colon Diverticula [description not available]	0	2.9	1	0
Diverticulum, Colon A pouch or sac opening from the COLON.	0	2.9	1	0
Alcoholic Liver Diseases [description not available]	0	2.67	3	0
Liver Diseases, Alcoholic Liver diseases associated with ALCOHOLISM. It usually refers to the coexistence of two or more subentities, i.e., ALCOHOLIC FATTY LIVER; ALCOHOLIC HEPATITIS; and ALCOHOLIC CIRRHOSIS.	0	2.67	3	0
Heart Disease, Ischemic [description not available]	0	2.67	3	0
Myocardial Ischemia A disorder of cardiac function caused by insufficient blood flow to the muscle tissue of the heart. The decreased blood flow may be due to narrowing of the coronary arteries (CORONARY ARTERY DISEASE), to obstruction by a thrombus (CORONARY THROMBOSIS), or less commonly, to diffuse narrowing of arterioles and other small vessels within the heart. Severe interruption of the blood supply to the myocardial tissue may result in necrosis of cardiac muscle (MYOCARDIAL INFARCTION).	0	2.67	3	0
Constitutional Liver Dysfunction [description not available]	0	3.37	1	1
Adenocarcinoma Of Kidney [description not available]	0	3.77	2	1
Carcinoma, Renal Cell A heterogeneous group of sporadic or hereditary carcinoma derived from cells of the KIDNEYS. There are several subtypes including the clear cells, the papillary, the chromophobe, the collecting duct, the spindle cells (sarcomatoid), or mixed cell-type carcinoma.	0	3.77	2	1
Icterus [description not available]	0	3.05	5	0
Jaundice A clinical manifestation of HYPERBILIRUBINEMIA, characterized by the yellowish staining of the SKIN; MUCOUS MEMBRANE; and SCLERA. Clinical jaundice usually is a sign of LIVER dysfunction.	0	3.05	5	0
Deficiency, Vitamin A [description not available]	0	1.98	1	0
Vitamin A Deficiency A nutritional condition produced by a deficiency of VITAMIN A in the diet, characterized by NIGHT BLINDNESS and other ocular manifestations such as dryness of the conjunctiva and later of the cornea (XEROPHTHALMIA). Vitamin A deficiency is a very common problem worldwide, particularly in developing countries as a consequence of famine or shortages of vitamin A-rich foods. In the United States it is found among the urban poor, the elderly, alcoholics, and patients with malabsorption. (From Cecil Textbook of Medicine, 19th ed, p1179)	0	1.98	1	0
Duncan Disease [description not available]	0	3.37	1	1
Dysmyelopoietic Syndromes [description not available]	0	3.37	1	1
Lymphoproliferative Disorders Disorders characterized by proliferation of lymphoid tissue, general or unspecified.	0	3.37	1	1
Myelodysplastic Syndromes Clonal hematopoietic stem cell disorders characterized by dysplasia in one or more hematopoietic cell lineages. They predominantly affect patients over 60, are considered preleukemic conditions, and have high probability of transformation into ACUTE MYELOID LEUKEMIA.	0	3.37	1	1
Injury, Myocardial Reperfusion [description not available]	0	2.39	2	0
Adrenal Cancer [description not available]	0	1.98	1	0
Cancer of Ovary [description not available]	0	2.4	2	0
Ovarian Neoplasms Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS.	0	2.4	2	0
Aura [description not available]	0	1.98	1	0
Epilepsy A disorder characterized by recurrent episodes of paroxysmal brain dysfunction due to a sudden, disorderly, and excessive neuronal discharge. Epilepsy classification systems are generally based upon: (1) clinical features of the seizure episodes (e.g., motor seizure), (2) etiology (e.g., post-traumatic), (3) anatomic site of seizure origin (e.g., frontal lobe seizure), (4) tendency to spread to other structures in the brain, and (5) temporal patterns (e.g., nocturnal epilepsy). (From Adams et al., Principles of Neurology, 6th ed, p313)	0	1.98	1	0
Heart Valve Diseases Pathological conditions involving any of the various HEART VALVES and the associated structures (PAPILLARY MUSCLES and CHORDAE TENDINEAE).	0	2.37	2	0
Angiokeratoma A vascular, horny neoplasm of the skin characterized by TELANGIECTASIS and secondary epithelial changes including acanthosis and hyperkeratosis.	0	1.98	1	0
Colonic Polyps Discrete tissue masses that protrude into the lumen of the COLON. These POLYPS are connected to the wall of the colon either by a stalk, pedunculus, or by a broad base.	0	1.98	1	0
Mediastinal Diseases Disorders of the mediastinum, general or unspecified.	0	1.98	1	0
Absence Seizure [description not available]	0	2.65	3	0
Seizures Clinical or subclinical disturbances of cortical function due to a sudden, abnormal, excessive, and disorganized discharge of brain cells. Clinical manifestations include abnormal motor, sensory and psychic phenomena. Recurrent seizures are usually referred to as EPILEPSY or seizure disorder.	0	2.65	3	0
Emesis [description not available]	0	2.87	4	0
Vomiting The forcible expulsion of the contents of the STOMACH through the MOUTH.	0	2.87	4	0
Cancer of Nasopharynx [description not available]	0	1.98	1	0
Nasopharyngeal Neoplasms Tumors or cancer of the NASOPHARYNX.	0	1.98	1	0
Di Guglielmo Disease [description not available]	0	2.89	4	0
Leukemia, Erythroblastic, Acute A myeloproliferative disorder characterized by neoplastic proliferation of erythroblastic and myeloblastic elements with atypical erythroblasts and myeloblasts in the peripheral blood.	0	2.89	4	0
Ataxia Telangiectasia Syndrome [description not available]	0	2.38	2	0
Ataxia Telangiectasia An autosomal recessive inherited disorder characterized by choreoathetosis beginning in childhood, progressive CEREBELLAR ATAXIA; TELANGIECTASIS of CONJUNCTIVA and SKIN; DYSARTHRIA; B- and T-cell immunodeficiency, and RADIOSENSITIVITY to IONIZING RADIATION. Affected individuals are prone to recurrent sinobronchopulmonary infections, lymphoreticular neoplasms, and other malignancies. Serum ALPHA-FETOPROTEINS are usually elevated. (Menkes, Textbook of Child Neurology, 5th ed, p688) The gene for this disorder (ATM) encodes a cell cycle checkpoint protein kinase and has been mapped to chromosome 11 (11q22-q23).	0	2.38	2	0
Aneuploid [description not available]	0	1.98	1	0
Muscle Relaxation That phase of a muscle twitch during which a muscle returns to a resting position.	0	1.98	1	0
Epidermitis, Exudative of Swine [description not available]	0	2.37	2	0
Acute Lymphoid Leukemia [description not available]	0	1.99	1	0
P carinii Pneumonia [description not available]	0	1.99	1	0
Pneumonia, Pneumocystis A pulmonary disease in humans occurring in immunodeficient or malnourished patients or infants, characterized by DYSPNEA, tachypnea, and HYPOXEMIA. Pneumocystis pneumonia is a frequently seen opportunistic infection in AIDS. It is caused by the fungus PNEUMOCYSTIS JIROVECII. The disease is also found in other MAMMALS where it is caused by related species of Pneumocystis.	0	1.99	1	0
Precursor Cell Lymphoblastic Leukemia-Lymphoma A neoplasm characterized by abnormalities of the lymphoid cell precursors leading to excessive lymphoblasts in the marrow and other organs. It is the most common cancer in children and accounts for the vast majority of all childhood leukemias.	0	1.99	1	0
Peritoneal Carcinomatosis [description not available]	0	1.99	1	0
Peritoneal Neoplasms Tumors or cancer of the PERITONEUM.	0	1.99	1	0
Granulocytic Leukemia, Chronic [description not available]	0	2.67	3	0
Leukemia, Myelogenous, Chronic, BCR-ABL Positive Clonal hematopoetic disorder caused by an acquired genetic defect in PLURIPOTENT STEM CELLS. It starts in MYELOID CELLS of the bone marrow, invades the blood and then other organs. The condition progresses from a stable, more indolent, chronic phase (LEUKEMIA, MYELOID, CHRONIC PHASE) lasting up to 7 years, to an advanced phase composed of an accelerated phase (LEUKEMIA, MYELOID, ACCELERATED PHASE) and BLAST CRISIS.	0	2.67	3	0
Hyperesthesia Increased sensitivity to cutaneous stimulation due to a diminished threshold or an increased response to stimuli.	0	1.99	1	0
Peripheral Nerve Diseases [description not available]	0	2.37	2	0
Peripheral Nervous System Diseases Diseases of the peripheral nerves external to the brain and spinal cord, which includes diseases of the nerve roots, ganglia, plexi, autonomic nerves, sensory nerves, and motor nerves.	0	2.37	2	0
Concomitant Strabismus [description not available]	0	3.38	1	1
Strabismus Misalignment of the visual axes of the eyes. In comitant strabismus the degree of ocular misalignment does not vary with the direction of gaze. In noncomitant strabismus the degree of misalignment varies depending on direction of gaze or which eye is fixating on the target. (Miller, Walsh & Hoyt's Clinical Neuro-Ophthalmology, 4th ed, p641)	0	3.38	1	1
Glaucoma, Suspect [description not available]	0	1.99	1	0
Ocular Hypertension A condition in which the intraocular pressure is elevated above normal and which may lead to glaucoma.	0	1.99	1	0
Wounds, Stab Penetrating wounds caused by a pointed object.	0	1.99	1	0
Eye Infections, Fungal Infection by a variety of fungi, usually through four possible mechanisms: superficial infection producing conjunctivitis, keratitis, or lacrimal obstruction; extension of infection from neighboring structures - skin, paranasal sinuses, nasopharynx; direct introduction during surgery or accidental penetrating trauma; or via the blood or lymphatic routes in patients with underlying mycoses.	0	2.91	1	0
Infections, Legionella pneumophila [description not available]	0	1.99	1	0
Granuloma, Hodgkin [description not available]	0	4.61	3	2
Hodgkin Disease A malignant disease characterized by progressive enlargement of the lymph nodes, spleen, and general lymphoid tissue. In the classical variant, giant usually multinucleate Hodgkin's and REED-STERNBERG CELLS are present; in the nodular lymphocyte predominant variant, lymphocytic and histiocytic cells are seen.	0	4.61	3	2
Basophilic Leukemia, Acute [description not available]	0	2.4	2	0
Leukemia, Basophilic, Acute A rare acute myeloid leukemia in which the primary differentiation is to BASOPHILS. It is characterized by an extreme increase of immature basophilic granulated cells in the bone marrow and blood. Mature basophils are usually sparse.	0	2.4	2	0
Infections, Nematode [description not available]	0	1.99	1	0
Arrhythmia [description not available]	0	2.37	2	0
Arrhythmias, Cardiac Any disturbances of the normal rhythmic beating of the heart or MYOCARDIAL CONTRACTION. Cardiac arrhythmias can be classified by the abnormalities in HEART RATE, disorders of electrical impulse generation, or impulse conduction.	0	2.37	2	0
Abscess, Periapical [description not available]	0	4.43	5	1
Bowel Diseases, Inflammatory [description not available]	0	1.99	1	0
Inflammatory Bowel Diseases Chronic, non-specific inflammation of the GASTROINTESTINAL TRACT. Etiology may be genetic or environmental. This term includes CROHN DISEASE and ULCERATIVE COLITIS.	0	1.99	1	0
Obstructive Lung Diseases [description not available]	0	2	1	0
Lung Diseases, Obstructive Any disorder marked by obstruction of conducting airways of the lung. AIRWAY OBSTRUCTION may be acute, chronic, intermittent, or persistent.	0	2	1	0
Hemoglobinopathies A group of inherited disorders characterized by structural alterations within the hemoglobin molecule.	0	1.99	1	0
Bare Lymphocyte Syndrome [description not available]	0	2	1	0
Severe Combined Immunodeficiency Group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. It is inherited as an X-linked or autosomal recessive defect. Mutations occurring in many different genes cause human Severe Combined Immunodeficiency (SCID).	0	2	1	0
Interstitial Cell Tumor [description not available]	0	2	1	0
Foreign-Body Granuloma [description not available]	0	2	1	0
Wounds, Penetrating Wounds caused by objects penetrating the skin.	0	3.06	5	0
Stunted Growth [description not available]	0	2	1	0
Growth Disorders Deviations from the average values for a specific age and sex in any or all of the following: height, weight, skeletal proportions, osseous development, or maturation of features. Included here are both acceleration and retardation of growth.	0	2	1	0
Hypermelanosis [description not available]	0	3.39	1	1
Hyperpigmentation Excessive pigmentation of the skin, usually as a result of increased epidermal or dermal melanin pigmentation, hypermelanosis. Hyperpigmentation can be localized or generalized. The condition may arise from exposure to light, chemicals or other substances, or from a primary metabolic imbalance.	0	3.39	1	1
Abnormalities, Drug-Induced Congenital abnormalities caused by medicinal substances or drugs of abuse given to or taken by the mother, or to which she is inadvertently exposed during the manufacture of such substances. The concept excludes abnormalities resulting from exposure to non-medicinal chemicals in the environment.	0	2.65	3	0
Polychondritis, Chronic Atrophic [description not available]	0	2	1	0
Choroid Diseases Disorders of the choroid including hereditary choroidal diseases, neoplasms, and other abnormalities of the vascular layer of the uvea.	0	2	1	0
Polychondritis, Relapsing An acquired disease of unknown etiology, chronic course, and tendency to recur. It is characterized by inflammation and degeneration of cartilage and can result in deformities such as floppy ear and saddle nose. Loss of cartilage in the respiratory tract can lead to respiratory obstruction.	0	2	1	0
Angioneurotic Edema [description not available]	0	1.99	1	0
Angioedema Swelling involving the deep DERMIS, subcutaneous, or submucosal tissues, representing localized EDEMA. Angioedema often occurs in the face, lips, tongue, and larynx.	0	1.99	1	0
Sulfhemoglobinemia A morbid condition due to the presence of sulfmethemoglobin in the blood. It is marked by persistent cyanosis, but the blood count does not reveal any special abnormality in the blood. It is thought to be caused by the action of hydrogen sulfide absorbed from the intestine. (Stedman, 25th ed)	0	2.65	3	0
ANS (Autonomic Nervous System) Diseases [description not available]	0	2	1	0
Asymmetric Diabetic Proximal Motor Neuropathy [description not available]	0	2	1	0
Diabetic Neuropathies Peripheral, autonomic, and cranial nerve disorders that are associated with DIABETES MELLITUS. These conditions usually result from diabetic microvascular injury involving small blood vessels that supply nerves (VASA NERVORUM). Relatively common conditions which may be associated with diabetic neuropathy include third nerve palsy (see OCULOMOTOR NERVE DISEASES); MONONEUROPATHY; mononeuropathy multiplex; diabetic amyotrophy; a painful POLYNEUROPATHY; autonomic neuropathy; and thoracoabdominal neuropathy. (From Adams et al., Principles of Neurology, 6th ed, p1325)	0	2	1	0
Infections, Pasteurellaceae [description not available]	0	2	1	0
Bewilderment [description not available]	0	2	1	0
African Lymphoma [description not available]	0	2	1	0
Burkitt Lymphoma A form of undifferentiated malignant LYMPHOMA usually found in central Africa, but also reported in other parts of the world. It is commonly manifested as a large osteolytic lesion in the jaw or as an abdominal mass. B-cell antigens are expressed on the immature cells that make up the tumor in virtually all cases of Burkitt lymphoma. The Epstein-Barr virus (HERPESVIRUS 4, HUMAN) has been isolated from Burkitt lymphoma cases in Africa and it is implicated as the causative agent in these cases; however, most non-African cases are EBV-negative.	0	2	1	0
Blastocyst Disintegration [description not available]	0	2	1	0
Exomphalos [description not available]	0	2	1	0
Hernia, Umbilical A HERNIA due to an imperfect closure or weakness of the umbilical ring. It appears as a skin-covered protrusion at the UMBILICUS during crying, coughing, or straining. The hernia generally consists of OMENTUM or SMALL INTESTINE. The vast majority of umbilical hernias are congenital but can be acquired due to severe abdominal distention.	0	2	1	0
Alcohol Drinking Behaviors associated with the ingesting of ALCOHOLIC BEVERAGES, including social drinking.	0	2.65	3	0
Odontalgia [description not available]	0	3.76	2	1
Toothache Pain in the adjacent areas of the teeth.	0	3.76	2	1
Weight Reduction [description not available]	0	2.01	1	0
Trichocephaliasis [description not available]	0	2.01	1	0
Trichuriasis Infection with nematodes of the genus TRICHURIS, formerly called Trichocephalus.	0	2.01	1	0
Weight Loss Decrease in existing BODY WEIGHT.	0	2.01	1	0
Varicocele A condition characterized by the dilated tortuous veins of the SPERMATIC CORD with a marked left-sided predominance. Adverse effect on male fertility occurs when varicocele leads to an increased scrotal (and testicular) temperature and reduced testicular volume.	0	2.01	1	0
Encephalitis, West Nile Fever [description not available]	0	2.01	1	0
West Nile Fever A mosquito-borne viral illness caused by the WEST NILE VIRUS, a FLAVIVIRUS and endemic to regions of Africa, Asia, and Europe. Common clinical features include HEADACHE; FEVER; maculopapular rash; gastrointestinal symptoms; and lymphadenopathy. MENINGITIS; ENCEPHALITIS; and MYELITIS may also occur. The disease may occasionally be fatal or leave survivors with residual neurologic deficits. (From Joynt, Clinical Neurology, 1996, Ch26, p13; Lancet 1998 Sep 5;352(9130):767-71)	0	2.01	1	0
Altered Level of Consciousness [description not available]	0	2.01	1	0
Dysarthosis [description not available]	0	2.01	1	0
Urinary Calculi Low-density crystals or stones in any part of the URINARY TRACT. Their chemical compositions often include CALCIUM OXALATE, magnesium ammonium phosphate (struvite), CYSTINE, or URIC ACID.	0	2.87	4	0
Abnormalities, Autosome [description not available]	0	3.3	2	0
Fecal Impaction Formation of a firm impassable mass of stool in the RECTUM or distal COLON.	0	2.35	2	0
Abetalipoproteinemia An autosomal recessive disorder of lipid metabolism. It is caused by mutation of the microsomal triglyceride transfer protein that catalyzes the transport of lipids (TRIGLYCERIDES; CHOLESTEROL ESTERS; PHOSPHOLIPIDS) and is required in the secretion of BETA-LIPOPROTEINS (low density lipoproteins or LDL). Features include defective intestinal lipid absorption, very low serum cholesterol level, and near absent LDL.	0	1.95	1	0
Intestinal Lymphangiectasis [description not available]	0	1.95	1	0
Dental Plaque A film that attaches to teeth, often causing DENTAL CARIES and GINGIVITIS. It is composed of MUCINS, secreted from salivary glands, and microorganisms.	0	2.87	4	0
Coagulation Disorders, Blood [description not available]	0	3.56	3	0
Acid-Base Imbalance Disturbances in the ACID-BASE EQUILIBRIUM of the body.	0	2.87	1	0
Blood Coagulation Disorders Hemorrhagic and thrombotic disorders that occur as a consequence of abnormalities in blood coagulation due to a variety of factors such as COAGULATION PROTEIN DISORDERS; BLOOD PLATELET DISORDERS; BLOOD PROTEIN DISORDERS or nutritional conditions.	0	3.56	3	0
Scalp Dermatoses Skin diseases involving the SCALP.	0	3.73	2	1
Arthritides, Bacterial [description not available]	0	2.64	3	0
Femoral Fractures Fractures of the femur.	0	3.78	4	0
Gas Gangrene A severe condition resulting from bacteria invading healthy muscle from adjacent traumatized muscle or soft tissue. The infection originates in a wound contaminated with bacteria of the genus CLOSTRIDIUM. C. perfringens accounts for the majority of cases (over eighty percent), while C. noyvi, C. septicum, and C. histolyticum cause most of the other cases.	0	2.63	3	0
Foot and Mouth Disease [description not available]	0	1.95	1	0
Endomyometritis Inflammation of both the ENDOMETRIUM and the MYOMETRIUM, usually caused by infections after a CESAREAN SECTION.	0	4.25	7	0
Endometritis Inflammation of the ENDOMETRIUM, usually caused by intrauterine infections. Endometritis is the most common cause of postpartum fever.	0	4.25	7	0
Acquired Meningomyelocele [description not available]	0	1.95	1	0
Xanthoma [description not available]	0	4.04	3	1
Urinary Incontinence Involuntary loss of URINE, such as leaking of urine. It is a symptom of various underlying pathological processes. Major types of incontinence include URINARY URGE INCONTINENCE and URINARY STRESS INCONTINENCE.	0	1.95	1	0
Rupture Forcible or traumatic tear or break of an organ or other soft part of the body.	0	1.95	1	0
Colitis Gravis [description not available]	0	5.63	7	3
Colitis, Ulcerative Inflammation of the COLON that is predominantly confined to the MUCOSA. Its major symptoms include DIARRHEA, rectal BLEEDING, the passage of MUCUS, and ABDOMINAL PAIN.	0	5.63	7	3
Haemophilus Infections Infections with bacteria of the genus HAEMOPHILUS.	0	2.86	4	0
Ataxia Impairment of the ability to perform smoothly coordinated voluntary movements. This condition may affect the limbs, trunk, eyes, pharynx, larynx, and other structures. Ataxia may result from impaired sensory or motor function. Sensory ataxia may result from posterior column injury or PERIPHERAL NERVE DISEASES. Motor ataxia may be associated with CEREBELLAR DISEASES; CEREBRAL CORTEX diseases; THALAMIC DISEASES; BASAL GANGLIA DISEASES; injury to the RED NUCLEUS; and other conditions.	0	3.56	3	0
Diaphragmatic Paralysis [description not available]	0	3.27	2	0
Dehiscence, Surgical Wound [description not available]	0	5.84	13	2
Foreign-Body Reaction Chronic inflammation and granuloma formation around irritating foreign bodies.	0	3.75	2	1
Sigmoid Colon Diseases [description not available]	0	3.34	1	1
Hypoproteinemia A condition in which total serum protein level is below the normal range. Hypoproteinemia can be caused by protein malabsorption in the gastrointestinal tract, EDEMA, or PROTEINURIA.	0	1.95	1	0
Neoplasm Seeding The local implantation of tumor cells by contamination of instruments and surgical equipment during and after surgical resection, resulting in local growth of the cells and tumor formation.	0	3.34	1	1
Alkalosis A pathological condition that removes acid or adds base to the body fluids.	0	3.74	2	0
Water-Electrolyte Imbalance Disturbances in the body's WATER-ELECTROLYTE BALANCE.	0	3.27	2	0
Segond Fracture [description not available]	0	3.27	2	0
Tibial Fractures Fractures of the TIBIA.	0	3.27	2	0
Cyanosis A bluish or purplish discoloration of the skin and mucous membranes due to an increase in the amount of deoxygenated hemoglobin in the blood or a structural defect in the hemoglobin molecule.	0	2.86	4	0
Measles, German [description not available]	0	2.36	2	0
Heat Collapse [description not available]	0	1.95	1	0
Infections, Rickettsia [description not available]	0	2.35	2	0
Intertrochanteric Fractures [description not available]	0	1.95	1	0
Hip Fractures Fractures of the FEMUR HEAD; the FEMUR NECK; (FEMORAL NECK FRACTURES); the trochanters; or the inter- or subtrochanteric region. Excludes fractures of the acetabulum and fractures of the femoral shaft below the subtrochanteric region (FEMORAL FRACTURES).	0	1.95	1	0
Mushroom Poisoning Poisoning from ingestion of mushrooms, primarily from, but not restricted to, toxic varieties.	0	2.35	2	0
Cholecystoduodenal Fistula [description not available]	0	3.55	3	0
Athlete's Foot [description not available]	0	1.95	1	0
Tinea Pedis Dermatological pruritic lesion in the feet, caused by Trichophyton rubrum, T. mentagrophytes, or Epidermophyton floccosum.	0	1.95	1	0
Adenoma, Basal Cell [description not available]	0	2.37	2	0
Adenoma A benign epithelial tumor with a glandular organization.	0	2.37	2	0
Malassezia furfur Infection [description not available]	0	1.95	1	0
Tinea Versicolor A common chronic, noninflammatory and usually symptomless disorder, characterized by the occurrence of multiple macular patches of all sizes and shapes, and varying in pigmentation from fawn-colored to brown. It is seen most frequently in hot, humid, tropical regions and is mostly caused by MALASSEZIA FURFUR (formerly Pityrosporum orbiculare).	0	1.95	1	0
Cystinuria An inherited disorder due to defective reabsorption of CYSTINE and other BASIC AMINO ACIDS by the PROXIMAL RENAL TUBULES. This form of aminoaciduria is characterized by the abnormally high urinary levels of cystine; LYSINE; ARGININE; and ORNITHINE. Mutations involve the amino acid transport protein gene SLC3A1.	0	2.35	2	0
Ophthalmia Neonatorum Acute conjunctival inflammation in the newborn, usually caused by maternal gonococcal infection. The causative agent is NEISSERIA GONORRHOEAE. The baby's eyes are contaminated during passage through the birth canal.	0	3.05	5	0
Leukemia L 1210 [description not available]	0	1.95	1	0
Skin Manifestations Dermatologic disorders attendant upon non-dermatologic disease or injury.	0	2.35	2	0
Brain Swelling [description not available]	0	3.78	4	0
Aqueductal Stenosis [description not available]	0	1.95	1	0
Fatty Liver with Encephalopathy [description not available]	0	3.05	5	0
Brain Edema Increased intracellular or extracellular fluid in brain tissue. Cytotoxic brain edema (swelling due to increased intracellular fluid) is indicative of a disturbance in cell metabolism, and is commonly associated with hypoxic or ischemic injuries (see HYPOXIA, BRAIN). An increase in extracellular fluid may be caused by increased brain capillary permeability (vasogenic edema), an osmotic gradient, local blockages in interstitial fluid pathways, or by obstruction of CSF flow (e.g., obstructive HYDROCEPHALUS). (From Childs Nerv Syst 1992 Sep; 8(6):301-6)	0	3.78	4	0
Frostbite Damage to tissues as the result of low environmental temperatures.	0	1.95	1	0
Clostridium tetani Infection [description not available]	0	2.35	2	0
Tetanus A disease caused by tetanospasmin, a powerful protein toxin produced by CLOSTRIDIUM TETANI. Tetanus usually occurs after an acute injury, such as a puncture wound or laceration. Generalized tetanus, the most common form, is characterized by tetanic muscular contractions and hyperreflexia. Localized tetanus presents itself as a mild condition with manifestations restricted to muscles near the wound. It may progress to the generalized form.	0	2.35	2	0
Oroantral Fistula A fistula between the maxillary sinus and the oral cavity.	0	1.95	1	0
Gangrene Death and putrefaction of tissue usually due to a loss of blood supply.	0	3.04	5	0
A-V Dissociation [description not available]	0	1.95	1	0
Abortion, Veterinary Premature expulsion of the FETUS in animals.	0	1.95	1	0
Enterotoxemia Disease caused by the liberation of exotoxins of CLOSTRIDIUM PERFRINGENS in the intestines of sheep, goats, cattle, foals, and piglets. Type B enterotoxemia in lambs is lamb dysentery; type C enterotoxemia in mature sheep produces struck, and in calves, lambs and piglets it produces hemorrhagic enterotoxemia; type D enterotoxemia in sheep and goats is pulpy-kidney disease or overeating disease.	0	1.95	1	0
Eperythrozoonosis [description not available]	0	2.64	3	0
Infections, Orthomyxoviridae [description not available]	0	1.95	1	0
Hypogalactia A condition of less than normal MILK secretion.	0	1.95	1	0
Orthomyxoviridae Infections Virus diseases caused by the ORTHOMYXOVIRIDAE.	0	1.95	1	0
Fusobacterium Infections Infections with bacteria of the genus FUSOBACTERIUM.	0	1.95	1	0
Muscle Disorders [description not available]	0	2.36	2	0
Anti-MuSK Myasthenia Gravis [description not available]	0	2.35	2	0
Muscular Diseases Acquired, familial, and congenital disorders of SKELETAL MUSCLE and SMOOTH MUSCLE.	0	2.36	2	0
Myasthenia Gravis A disorder of neuromuscular transmission characterized by fatigable weakness of cranial and skeletal muscles with elevated titers of ACETYLCHOLINE RECEPTORS or muscle-specific receptor tyrosine kinase (MuSK) autoantibodies. Clinical manifestations may include ocular muscle weakness (fluctuating, asymmetric, external ophthalmoplegia; diplopia; ptosis; and weakness of eye closure) and extraocular fatigable weakness of facial, bulbar, respiratory, and proximal limb muscles. The disease may remain limited to the ocular muscles (ocular myasthenia). THYMOMA is commonly associated with this condition.	0	2.35	2	0
Parakeratosis Persistence of the nuclei of the keratinocytes into the stratum corneum of the skin. This is a normal state only in the epithelium of true mucous membranes in the mouth and vagina. (Dorland, 27th ed)	0	1.95	1	0
Acute Bacterial Prostatitis [description not available]	0	2.64	3	0
Prostatitis Infiltration of inflammatory cells into the parenchyma of PROSTATE. The subtypes are classified by their varied laboratory analysis, clinical presentation and response to treatment.	0	2.64	3	0
Albinism General term for a number of inherited defects of amino acid metabolism in which there is a deficiency or absence of pigment in the eyes, skin, or hair.	0	1.95	1	0
Deficiency of Glucose-6-Phosphate Dehydrogenase [description not available]	0	2.64	3	0
Glucosephosphate Dehydrogenase Deficiency A disease-producing enzyme deficiency subject to many variants, some of which cause a deficiency of GLUCOSE-6-PHOSPHATE DEHYDROGENASE activity in erythrocytes, leading to hemolytic anemia.	0	2.64	3	0
Adrenal Cortex Cancer [description not available]	0	1.98	1	0
Adrenal Cortex Neoplasms Tumors or cancers of the ADRENAL CORTEX.	0	1.98	1	0
Digestive System Disorders [description not available]	0	3.36	1	1
Digestive System Diseases Diseases in any part of the GASTROINTESTINAL TRACT or the accessory organs (LIVER; BILIARY TRACT; PANCREAS).	0	3.36	1	1
Eye Cancer, Retinoblastoma [description not available]	0	1.98	1	0
Retinoblastoma A malignant tumor arising from the nuclear layer of the retina that is the most common primary tumor of the eye in children. The tumor tends to occur in early childhood or infancy and may be present at birth. The majority are sporadic, but the condition may be transmitted as an autosomal dominant trait. Histologic features include dense cellularity, small round polygonal cells, and areas of calcification and necrosis. An abnormal pupil reflex (leukokoria); NYSTAGMUS, PATHOLOGIC; STRABISMUS; and visual loss represent common clinical characteristics of this condition. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, p2104)	0	1.98	1	0
Morphine Abuse [description not available]	0	1.98	1	0
Drug Withdrawal Symptoms [description not available]	0	1.98	1	0
Morphine Dependence Strong dependence, both physiological and emotional, upon morphine.	0	1.98	1	0
Substance Withdrawal Syndrome Physiological and psychological symptoms associated with withdrawal from the use of a drug after prolonged administration or habituation. The concept includes withdrawal from smoking or drinking, as well as withdrawal from an administered drug.	0	1.98	1	0
Cancer of Parathyroid [description not available]	0	1.98	1	0
Parathyroid Neoplasms Tumors or cancer of the PARATHYROID GLANDS.	0	1.98	1	0
Jejunal Diseases Pathological development in the JEJUNUM region of the SMALL INTESTINE.	0	1.98	1	0
Campylobacter Infection [description not available]	0	2.38	2	0
Placenta Diseases Pathological processes or abnormal functions of the PLACENTA.	0	1.98	1	0
Puerperal Disorders Disorders or diseases associated with PUERPERIUM, the six-to-eight-week period immediately after PARTURITION in humans.	0	2.36	2	0
Blast Phase [description not available]	0	1.97	1	0
Blast Crisis An advanced phase of chronic myelogenous leukemia, characterized by a rapid increase in the proportion of immature white blood cells (blasts) in the blood and bone marrow to greater than 30%.	0	1.97	1	0
Cognition Disorders Disorders characterized by disturbances in mental processes related to learning, thinking, reasoning, and judgment.	0	1.97	1	0
Plasmodium falciparum Malaria [description not available]	0	1.97	1	0
Malaria, Falciparum Malaria caused by PLASMODIUM FALCIPARUM. This is the severest form of malaria and is associated with the highest levels of parasites in the blood. This disease is characterized by irregularly recurring febrile paroxysms that in extreme cases occur with acute cerebral, renal, or gastrointestinal manifestations.	0	1.97	1	0
B16 Melanoma [description not available]	0	1.97	1	0
Akinetic-Rigid Variant of Huntington Disease [description not available]	0	1.97	1	0
Huntington Disease A familial disorder inherited as an autosomal dominant trait and characterized by the onset of progressive CHOREA and DEMENTIA in the fourth or fifth decade of life. Common initial manifestations include paranoia; poor impulse control; DEPRESSION; HALLUCINATIONS; and DELUSIONS. Eventually intellectual impairment; loss of fine motor control; ATHETOSIS; and diffuse chorea involving axial and limb musculature develops, leading to a vegetative state within 10-15 years of disease onset. The juvenile variant has a more fulminant course including SEIZURES; ATAXIA; dementia; and chorea. (From Adams et al., Principles of Neurology, 6th ed, pp1060-4)	0	1.97	1	0
Gardner Syndrome A variant of ADENOMATOUS POLYPOSIS COLI caused by mutation in the APC gene (GENES, APC) on CHROMOSOME 5. It is characterized by not only the presence of multiple colonic polyposis but also extracolonic ADENOMATOUS POLYPS in the UPPER GASTROINTESTINAL TRACT; the EYE; the SKIN; the SKULL; and the FACIAL BONES; as well as malignancy in organs other than the GI tract.	0	3.36	1	1
Experimental Leukemia [description not available]	0	2.38	2	0
Echo Virus Infections [description not available]	0	1.97	1	0
Complication, Intraoperative [description not available]	0	1.97	1	0
Anemia, Hemolytic, Acquired [description not available]	0	2.65	3	0
Anemia, Sideroblastic Anemia characterized by the presence of erythroblasts containing excessive deposits of iron in the marrow.	0	1.97	1	0
Anemia, Hemolytic A condition of inadequate circulating red blood cells (ANEMIA) or insufficient HEMOGLOBIN due to premature destruction of red blood cells (ERYTHROCYTES).	0	2.65	3	0
Hypospermatogenesis [description not available]	0	1.97	1	0
Cancer of the Uterus [description not available]	0	1.97	1	0
Uterine Neoplasms Tumors or cancer of the UTERUS.	0	1.97	1	0
Rhabdomyosarcoma A malignant solid tumor arising from mesenchymal tissues which normally differentiate to form striated muscle. It can occur in a wide variety of sites. It is divided into four distinct types: pleomorphic, predominantly in male adults; alveolar (RHABDOMYOSARCOMA, ALVEOLAR), mainly in adolescents and young adults; embryonal (RHABDOMYOSARCOMA, EMBRYONAL), predominantly in infants and children; and botryoidal, also in young children. It is one of the most frequently occurring soft tissue sarcomas and the most common in children under 15. (From Dorland, 27th ed; Holland et al., Cancer Medicine, 3d ed, p2186; DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, pp1647-9)	0	1.97	1	0
Pericoronitis Inflammation of the gingiva surrounding the crown of a tooth.	0	1.97	1	0
Sinus Tachycardia [description not available]	0	1.97	1	0
Malignant Catarrh A herpesvirus infection of cattle characterized by catarrhal inflammation of the upper respiratory and alimentary epithelia, keratoconjunctivitis, encephalitis and lymph node enlargement. Syn: bovine epitheliosis, snotsiekte.	0	1.97	1	0
Microglossia [description not available]	0	2.36	2	0
Coenuri Infection [description not available]	0	1.97	1	0
Cysticercosis Infection with CYSTICERCUS, the larval form of the various tapeworms of the genus Taenia (usually T. solium in man). In humans they penetrate the intestinal wall and invade subcutaneous tissue, brain, eye, muscle, heart, liver, lung, and peritoneum. Brain involvement results in NEUROCYSTICERCOSIS.	0	1.97	1	0
Starvation Lengthy and continuous deprivation of food. (Stedman, 25th ed)	0	2.89	1	0
Genetic Non-Disjunction [description not available]	0	2.89	1	0
Neoplasm Regression, Spontaneous Disappearance of a neoplasm or neoplastic state without the intervention of therapy.	0	2.36	2	0
Prosthesis Durability [description not available]	0	2.88	4	0
Nail Diseases Diseases of the nail plate and tissues surrounding it. The concept is limited to primates.	0	1.96	1	0
Clinically Isolated CNS Demyelinating Syndrome [description not available]	0	2.88	1	0
Demyelinating Diseases Diseases characterized by loss or dysfunction of myelin in the central or peripheral nervous system.	0	2.88	1	0
Hypernatremia Excessive amount of sodium in the blood. (Dorland, 27th ed)	0	2.88	1	0
Malacoplakia The formation of soft patches on the mucous membrane of a hollow organ, such as the urogenital tract or digestive tract.	0	2.36	2	0
Ankylosing Spondylarthritis [description not available]	0	3.35	1	1
Spondylitis, Ankylosing A chronic inflammatory condition affecting the axial joints, such as the SACROILIAC JOINT and other intervertebral or costovertebral joints. It occurs predominantly in young males and is characterized by pain and stiffness of joints (ANKYLOSIS) with inflammation at tendon insertions.	0	3.35	1	1
Infections, Chlamydia [description not available]	0	2.36	2	0
Chlamydia Infections Infections with bacteria of the genus CHLAMYDIA.	0	2.36	2	0
Biliary Fistula Abnormal passage in any organ of the biliary tract or between biliary organs and other organs.	0	4.25	4	0
Uterine Prolapse Downward displacement of the UTERUS. It is classified in various degrees: in the first degree the UTERINE CERVIX is within the vaginal orifice; in the second degree the cervix is outside the orifice; in the third degree the entire uterus is outside the orifice.	0	1.97	1	0
Gasser Syndrome [description not available]	0	1.97	1	0
Hemolytic-Uremic Syndrome A syndrome that is associated with microvascular diseases of the KIDNEY, such as RENAL CORTICAL NECROSIS. It is characterized by hemolytic anemia (ANEMIA, HEMOLYTIC); THROMBOCYTOPENIA; and ACUTE RENAL FAILURE.	0	1.97	1	0
Antibody Deficiency Syndrome [description not available]	0	3.28	2	0
Immunologic Deficiency Syndromes Syndromes in which there is a deficiency or defect in the mechanisms of immunity, either cellular or humoral.	0	3.28	2	0
Ileal Diseases Pathological development in the ILEUM including the ILEOCECAL VALVE.	0	1.97	1	0
Infectious Keratoconjunctivitis [description not available]	0	1.97	1	0
Erysipelothrix Infections Infections with bacteria of the genus ERYSIPELOTHRIX.	0	2.36	2	0
Adenoma, beta-Cell [description not available]	0	1.96	1	0
Insulinoma A benign tumor of the PANCREATIC BETA CELLS. Insulinoma secretes excess INSULIN resulting in HYPOGLYCEMIA.	0	1.96	1	0
Epileptiform Neuralgia [description not available]	0	1.96	1	0
Herpes Zoster, Ocular [description not available]	0	3.28	2	0
Herpes Zoster Ophthalmicus Virus infection of the Gasserian ganglion and its nerve branches characterized by pain and vesicular eruptions with much swelling. Ocular involvement is usually heralded by a vesicle on the tip of the nose. This area is innervated by the nasociliary nerve.	0	3.28	2	0
Trigeminal Neuralgia A syndrome characterized by recurrent episodes of excruciating pain lasting several seconds or longer in the sensory distribution of the TRIGEMINAL NERVE. Pain may be initiated by stimulation of trigger points on the face, lips, or gums or by movement of facial muscles or chewing. Associated conditions include MULTIPLE SCLEROSIS, vascular anomalies, ANEURYSMS, and neoplasms. (Adams et al., Principles of Neurology, 6th ed, p187)	0	1.96	1	0
Familial Combined Hyperlipidemia [description not available]	0	2.88	1	0
Broad Beta Disease [description not available]	0	3.29	2	0
Carbohydrate Inducible Hyperlipemia [description not available]	0	3.57	3	0
Hyperchylomicronemia Late Onset [description not available]	0	2.88	1	0
Apolipoprotein C-II Deficiency [description not available]	0	2.88	1	0
Hyperlipidemia, Familial Combined A type of familial lipid metabolism disorder characterized by a variable pattern of elevated plasma CHOLESTEROL and/or TRIGLYCERIDES. Multiple genes on different chromosomes may be involved, such as the major late transcription factor (UPSTREAM STIMULATORY FACTORS) on CHROMOSOME 1.	0	2.88	1	0
Hyperlipoproteinemia Type III An autosomal recessively inherited disorder characterized by the accumulation of intermediate-density lipoprotein (IDL or broad-beta-lipoprotein). IDL has a CHOLESTEROL to TRIGLYCERIDES ratio greater than that of VERY-LOW-DENSITY LIPOPROTEINS. This disorder is due to mutation of APOLIPOPROTEINS E, a receptor-binding component of VLDL and CHYLOMICRONS, resulting in their reduced clearance and high plasma levels of both cholesterol and triglycerides.	0	3.29	2	0
Hyperlipoproteinemia Type IV A hypertriglyceridemia disorder, often with autosomal dominant inheritance. It is characterized by the persistent elevations of plasma TRIGLYCERIDES, endogenously synthesized and contained predominantly in VERY-LOW-DENSITY LIPOPROTEINS (pre-beta lipoproteins). In contrast, the plasma CHOLESTEROL and PHOSPHOLIPIDS usually remain within normal limits.	0	3.57	3	0
Hyperlipoproteinemia Type I An inherited condition due to a deficiency of either LIPOPROTEIN LIPASE or APOLIPOPROTEIN C-II (a lipase-activating protein). The lack of lipase activities results in inability to remove CHYLOMICRONS and TRIGLYCERIDES from the blood which has a creamy top layer after standing.	0	2.88	1	0
Drooling [description not available]	0	1.96	1	0
Sialorrhea Increased salivary flow.	0	1.96	1	0
Mast-Cell Sarcoma A unifocal malignant tumor that consists of atypical pathological MAST CELLS without systemic involvement. It causes local destructive growth in organs other than in skin or bone marrow.	0	1.96	1	0
Central Hypothyroidism [description not available]	0	2.36	2	0
Hypothyroidism A syndrome that results from abnormally low secretion of THYROID HORMONES from the THYROID GLAND, leading to a decrease in BASAL METABOLIC RATE. In its most severe form, there is accumulation of MUCOPOLYSACCHARIDES in the SKIN and EDEMA, known as MYXEDEMA. It may be primary or secondary due to other pituitary disease, or hypothalamic dysfunction.	0	2.36	2	0
Action Tremor [description not available]	0	1.96	1	0
Tremor Cyclical movement of a body part that can represent either a physiologic process or a manifestation of disease. Intention or action tremor, a common manifestation of CEREBELLAR DISEASES, is aggravated by movement. In contrast, resting tremor is maximal when there is no attempt at voluntary movement, and occurs as a relatively frequent manifestation of PARKINSON DISEASE.	0	1.96	1	0
Mange, Sarcoptic [description not available]	0	1.95	1	0
Scabies A contagious cutaneous inflammation caused by the bite of the mite SARCOPTES SCABIEI. It is characterized by pruritic papular eruptions and burrows and affects primarily the axillae, elbows, wrists, and genitalia, although it can spread to cover the entire body.	0	1.95	1	0
Fowl Paralysis [description not available]	0	1.95	1	0
Porphyria [description not available]	0	1.95	1	0
Porphyrias A diverse group of metabolic diseases characterized by errors in the biosynthetic pathway of HEME in the LIVER, the BONE MARROW, or both. They are classified by the deficiency of specific enzymes, the tissue site of enzyme defect, or the clinical features that include neurological (acute) or cutaneous (skin lesions). Porphyrias can be hereditary or acquired as a result of toxicity to the hepatic or erythropoietic marrow tissues.	0	1.95	1	0
Analgesia, Congenital [description not available]	0	1.95	1	0
Lymphangitis A lymphatic disease characterized by INFLAMMATION of LYMPHATIC VESSELS.	0	1.95	1	0
Deficiency Diseases A condition produced by dietary or metabolic deficiency. The term includes all diseases caused by an insufficient supply of essential nutrients, i.e., protein (or amino acids), vitamins, and minerals. It also includes an inadequacy of calories. (From Dorland, 27th ed; Stedman, 25th ed)	0	2.86	4	0
Cancer of Sigmoid [description not available]	0	2.63	3	0
Psychoses [description not available]	0	2.35	2	0
Psychotic Disorders Disorders in which there is a loss of ego boundaries or a gross impairment in reality testing with delusions or prominent hallucinations. (From DSM-IV, 1994)	0	2.35	2	0
Bacterial Overgrowth Syndrome [description not available]	0	3.2	6	0
Postgastrectomy Syndromes Sequelae of gastrectomy from the second week after operation on. Include recurrent or anastomotic ulcer, postprandial syndromes (DUMPING SYNDROME and late postprandial hypoglycemia), disordered bowel action, and nutritional deficiencies.	0	2.35	2	0
Zollinger-Ellison Syndrome A syndrome that is characterized by the triad of severe PEPTIC ULCER, hypersecretion of GASTRIC ACID, and GASTRIN-producing tumors of the PANCREAS or other tissue (GASTRINOMA). This syndrome may be sporadic or be associated with MULTIPLE ENDOCRINE NEOPLASIA TYPE 1.	0	3.78	4	0
Bronchial Pneumonia [description not available]	0	4.02	3	1
Hematuria Presence of blood in the urine.	0	2.86	4	0
Urination Disorders Abnormalities in the process of URINE voiding, including bladder control, frequency of URINATION, as well as the volume and composition of URINE.	0	1.95	1	0
Esophagotracheal Fistula [description not available]	0	3.27	2	0
47,XX,+21 [description not available]	0	2.35	2	0
Down Syndrome A chromosome disorder associated either with an extra chromosome 21 or an effective trisomy for chromosome 21. Clinical manifestations include hypotonia, short stature, brachycephaly, upslanting palpebral fissures, epicanthus, Brushfield spots on the iris, protruding tongue, small ears, short, broad hands, fifth finger clinodactyly, Simian crease, and moderate to severe INTELLECTUAL DISABILITY. Cardiac and gastrointestinal malformations, a marked increase in the incidence of LEUKEMIA, and the early onset of ALZHEIMER DISEASE are also associated with this condition. Pathologic features include the development of NEUROFIBRILLARY TANGLES in neurons and the deposition of AMYLOID BETA-PROTEIN, similar to the pathology of ALZHEIMER DISEASE. (Menkes, Textbook of Child Neurology, 5th ed, p213)	0	2.35	2	0
Drug-Induced Stevens Johnson Syndrome [description not available]	0	2.63	3	0
Stevens-Johnson Syndrome Rare cutaneous eruption characterized by extensive KERATINOCYTE apoptosis resulting in skin detachment with mucosal involvement. It is often provoked by the use of drugs (e.g., antibiotics and anticonvulsants) or associated with PNEUMONIA, MYCOPLASMA. It is considered a continuum of Toxic Epidermal Necrolysis.	0	2.63	3	0
Flatus [description not available]	0	3.73	2	1
Flatulence Production or presence of gas in the gastrointestinal tract which may be expelled through the anus.	0	3.73	2	1
Ectopic Pregnancy [description not available]	0	1.94	1	0
Pregnancy, Ectopic A potentially life-threatening condition in which EMBRYO IMPLANTATION occurs outside the cavity of the UTERUS. Most ectopic pregnancies (	0	1.94	1	0
Food Poisoning [description not available]	0	2.35	2	0
Tooth Discoloration Any change in the hue, color, or translucency of a tooth due to any cause. Restorative filling materials, drugs (both topical and systemic), pulpal necrosis, or hemorrhage may be responsible. (Jablonski, Dictionary of Dentistry, 1992, p253)	0	1.94	1	0
Libman-Sacks Disease [description not available]	0	2.35	2	0
Lupus Erythematosus, Systemic A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys, and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow.	0	2.35	2	0
Burns, Electric Burns produced by contact with electric current or from a sudden discharge of electricity.	0	1.94	1	0
Scarlet Fever Infection with group A streptococci that is characterized by tonsillitis and pharyngitis. An erythematous rash is commonly present.	0	1.95	1	0
Chloasma [description not available]	0	1.95	1	0
Melanosis Disorders of increased melanin pigmentation that develop without preceding inflammatory disease.	0	1.95	1	0
Facial Injuries General or unspecified injuries to the soft tissue or bony portions of the face.	0	2.63	3	0
Aortic Stenosis [description not available]	0	2.34	2	0
Aortic Valve Stenosis A pathological constriction that can occur above (supravalvular stenosis), below (subvalvular stenosis), or at the AORTIC VALVE. It is characterized by restricted outflow from the LEFT VENTRICLE into the AORTA.	0	2.34	2	0
Gastric Diseases [description not available]	0	2.85	1	0
Ptosis, Eyelid [description not available]	0	1.94	1	0
Blepharoptosis Drooping of the upper lid due to deficient development or paralysis of the levator palpebrae muscle.	0	1.94	1	0
Bladder Neck Obstruction [description not available]	0	1.94	1	0
Clasp-Knife Spasticity [description not available]	0	1.94	1	0
Muscle Spasticity A form of muscle hypertonia associated with upper MOTOR NEURON DISEASE. Resistance to passive stretch of a spastic muscle results in minimal initial resistance (a free interval) followed by an incremental increase in muscle tone. Tone increases in proportion to the velocity of stretch. Spasticity is usually accompanied by HYPERREFLEXIA and variable degrees of MUSCLE WEAKNESS. (From Adams et al., Principles of Neurology, 6th ed, p54)	0	1.94	1	0
Infections, Reoviridae [description not available]	0	2.34	2	0
Aneurysm, Aortic [description not available]	0	1.94	1	0
Mitral Stenosis [description not available]	0	1.94	1	0
Fallot's Tetralogy [description not available]	0	1.94	1	0
Aortic Aneurysm An abnormal balloon- or sac-like dilatation in the wall of AORTA.	0	1.94	1	0
Mitral Valve Stenosis Narrowing of the passage through the MITRAL VALVE due to FIBROSIS, and CALCINOSIS in the leaflets and chordal areas. This elevates the left atrial pressure which, in turn, raises pulmonary venous and capillary pressure leading to bouts of DYSPNEA and TACHYCARDIA during physical exertion. RHEUMATIC FEVER is its primary cause.	0	1.94	1	0
Tetralogy of Fallot A combination of congenital heart defects consisting of four key features including VENTRICULAR SEPTAL DEFECTS; PULMONARY STENOSIS; RIGHT VENTRICULAR HYPERTROPHY; and a dextro-positioned AORTA. In this condition, blood from both ventricles (oxygen-rich and oxygen-poor) is pumped into the body often causing CYANOSIS.	0	1.94	1	0
Laryngitis Inflammation of the LARYNGEAL MUCOSA, including the VOCAL CORDS. Laryngitis is characterized by irritation, edema, and reduced pliability of the mucosa leading to VOICE DISORDERS such as APHONIA and HOARSENESS.	0	2.86	1	0
Tracheal Diseases Diseases involving the TRACHEA.	0	2.86	1	0
Spasmophilia [description not available]	0	2.35	2	0
Black Death [description not available]	0	1.94	1	0
Plague An acute infectious disease caused by YERSINIA PESTIS that affects humans, wild rodents, and their ectoparasites. This condition persists due to its firm entrenchment in sylvatic rodent-flea ecosystems throughout the world. Bubonic plague is the most common form.	0	1.94	1	0
Bone Inflammation [description not available]	0	1.94	1	0
Panophthalmitis Acute suppurative inflammation of the inner eye with necrosis of the sclera (and sometimes the cornea) and extension of the inflammation into the orbit. Pain may be severe and the globe may rupture. In endophthalmitis the globe does not rupture.	0	3.33	1	1
Iritis Inflammation of the iris characterized by circumcorneal injection, aqueous flare, keratotic precipitates, and constricted and sluggish pupil along with discoloration of the iris.	0	3.33	1	1
Injuries, Leg [description not available]	0	2.35	2	0
Urethral Diseases Pathological processes involving the URETHRA.	0	1.94	1	0
Anterior Urethral Stricture [description not available]	0	2.35	2	0
Urethral Stricture Narrowing of any part of the URETHRA. It is characterized by decreased urinary stream and often other obstructive voiding symptoms.	0	2.35	2	0
Ectropion The turning outward (eversion) of the edge of the eyelid, resulting in the exposure of the palpebral conjunctiva. (Dorland, 27th ed)	0	2.35	2	0
Abdominal Injuries General or unspecified injuries involving organs in the abdominal cavity.	0	3.33	1	1
Airway Obstruction Any hindrance to the passage of air into and out of the lungs.	0	1.95	1	0
Blood Protein Disorders Hematologic diseases caused by structural or functional defects of BLOOD PROTEINS.	0	1.95	1	0
Birth Injuries Mechanical or anoxic trauma incurred by the infant during labor or delivery.	0	1.95	1	0
Hypertension, Renal Persistent high BLOOD PRESSURE due to KIDNEY DISEASES, such as those involving the renal parenchyma, the renal vasculature, or tumors that secrete RENIN.	0	1.94	1	0
Inborn Errors of Metabolism [description not available]	0	2.35	2	0
Metabolism, Inborn Errors Errors in metabolic processes resulting from inborn genetic mutations that are inherited or acquired in utero.	0	2.35	2	0
Central Nervous System Disease [description not available]	0	3.55	3	0
Central Nervous System Diseases Diseases of any component of the brain (including the cerebral hemispheres, diencephalon, brain stem, and cerebellum) or the spinal cord.	0	3.55	3	0
Rheumatoid Nodule Subcutaneous nodules seen in 20-30% of rheumatoid arthritis patients. They may arise anywhere on the body, but are most frequently found over the bony prominences. The nodules are characterized histologically by dense areas of fibrinoid necrosis with basophilic streaks and granules, surrounded by a palisade of cells, mainly fibroblasts and histiocytes.	0	1.94	1	0
Foot Injuries General or unspecified injuries involving the foot.	0	1.94	1	0
Polyps Discrete abnormal tissue masses that protrude into the lumen of the DIGESTIVE TRACT or the RESPIRATORY TRACT. Polyps can be spheroidal, hemispheroidal, or irregular mound-shaped structures attached to the MUCOUS MEMBRANE of the lumen wall either by a stalk, pedunculus, or by a broad base.	0	1.95	1	0
Deficiency, Vitamin B [description not available]	0	1.95	1	0
Vitamin B Deficiency A condition due to deficiency in any member of the VITAMIN B COMPLEX. These B vitamins are water-soluble and must be obtained from the diet because they are easily lost in the urine. Unlike the lipid-soluble vitamins, they cannot be stored in the body fat.	0	1.95	1	0
Adrenal Gland Hyperfunction [description not available]	0	1.95	1	0
Adrenocortical Hyperfunction Excess production of ADRENAL CORTEX HORMONES such as ALDOSTERONE; HYDROCORTISONE; DEHYDROEPIANDROSTERONE; and/or ANDROSTENEDIONE. Hyperadrenal syndromes include CUSHING SYNDROME; HYPERALDOSTERONISM; and VIRILISM.	0	1.95	1	0
Basedow Disease [description not available]	0	1.95	1	0
Graves Disease A common form of hyperthyroidism with a diffuse hyperplastic GOITER. It is an autoimmune disorder that produces antibodies against the THYROID STIMULATING HORMONE RECEPTOR. These autoantibodies activate the TSH receptor, thereby stimulating the THYROID GLAND and hypersecretion of THYROID HORMONES. These autoantibodies can also affect the eyes (GRAVES OPHTHALMOPATHY) and the skin (Graves dermopathy).	0	1.95	1	0
Great Pox [description not available]	0	2.35	2	0
Syphilis A contagious venereal disease caused by the spirochete TREPONEMA PALLIDUM.	0	2.35	2	0
Thoracic Diseases Disorders affecting the organs of the thorax.	0	2.35	2	0
Costen's Syndrome [description not available]	0	1.95	1	0
Mandibular Neoplasms Tumors or cancer of the MANDIBLE.	0	1.95	1	0
Mandibular Diseases Diseases involving the MANDIBLE.	0	2.35	2	0
Acquired Nasal Deformities [description not available]	0	1.95	1	0
Lymphatic Diseases Diseases of LYMPH; LYMPH NODES; or LYMPHATIC VESSELS.	0	1.94	1	0
Budd-Chiari Syndrome A condition in which the hepatic venous outflow is obstructed anywhere from the small HEPATIC VEINS to the junction of the INFERIOR VENA CAVA and the RIGHT ATRIUM. Usually the blockage is extrahepatic and caused by blood clots (THROMBUS) or fibrous webs. Parenchymal FIBROSIS is uncommon.	0	2.35	2	0
Hemorrhage, Oral [description not available]	0	1.95	1	0
Enteropathy, Exudative [description not available]	0	2.86	1	0
Protein-Losing Enteropathies Pathological conditions in the INTESTINES that are characterized by the gastrointestinal loss of serum proteins, including SERUM ALBUMIN; IMMUNOGLOBULINS; and at times LYMPHOCYTES. Severe condition can result in HYPOGAMMAGLOBULINEMIA or LYMPHOPENIA. Protein-losing enteropathies are associated with a number of diseases including INTESTINAL LYMPHANGIECTASIS; WHIPPLE'S DISEASE; and NEOPLASMS of the SMALL INTESTINE.	0	2.86	1	0
Cleft Spine [description not available]	0	2.64	3	0
Gall Bladder Diseases [description not available]	0	2.86	1	0
Cyst [description not available]	0	1.95	1	0
Humeral Fractures Fractures of the HUMERUS.	0	2.86	1	0
Cadaver A dead body, usually a human body.	0	1.95	1	0
Femoral Neoplasms New abnormal growth of tissue in the FEMUR.	0	1.95	1	0
Chondrosarcoma A slowly growing malignant neoplasm derived from cartilage cells, occurring most frequently in pelvic bones or near the ends of long bones, in middle-aged and old people. Most chondrosarcomas arise de novo, but some may develop in a preexisting benign cartilaginous lesion or in patients with ENCHONDROMATOSIS. (Stedman, 25th ed)	0	1.95	1	0
Giant Cell Tumors Tumors of bone tissue or synovial or other soft tissue characterized by the presence of giant cells. The most common are giant cell tumor of tendon sheath and GIANT CELL TUMOR OF BONE.	0	1.95	1	0
Carbon Tetrachloride Poisoning Poisoning that results from ingestion, injection, inhalation, or skin absorption of CARBON TETRACHLORIDE.	0	1.95	1	0
Chondritis, Costal [description not available]	0	1.95	1	0
Mediastinal Cyst Cysts of one of the parts of the mediastinum: the superior part, containing the trachea, esophagus, thoracic duct and thymus organs; the inferior middle part, containing the pericardium; the inferior anterior part containing some lymph nodes; and the inferior posterior part, containing the thoracic duct and esophagus.	0	1.95	1	0
Schwartzman Phenomenon [description not available]	0	2.86	1	0
Kidney Papillary Necrosis A complication of kidney diseases characterized by cell death involving KIDNEY PAPILLA in the KIDNEY MEDULLA. Damages to this area may hinder the kidney to concentrate urine resulting in POLYURIA. Sloughed off necrotic tissue may block KIDNEY PELVIS or URETER. Necrosis of multiple renal papillae can lead to KIDNEY FAILURE.	0	1.95	1	0
Blood Diseases [description not available]	0	2.86	1	0
Psychoses, Drug [description not available]	0	2.86	1	0
Hematologic Diseases Disorders of the blood and blood forming tissues.	0	2.86	1	0
Serum Sickness Immune complex disease caused by the administration of foreign serum or serum proteins and characterized by fever, lymphadenopathy, arthralgia, and urticaria. When they are complexed to protein carriers, some drugs can also cause serum sickness when they act as haptens inducing antibody responses.	0	2.86	1	0
Cholesteatoma A non-neoplastic mass of keratin-producing squamous EPITHELIUM, frequently occurring in the MENINGES; bones of the skull, and most commonly in the MIDDLE EAR and MASTOID region. Cholesteatoma can be congenital or acquired. Cholesteatoma is not a tumor nor is it associated with high CHOLESTEROL.	0	1.95	1	0
Prostatic Diseases Pathological processes involving the PROSTATE or its component tissues.	0	2.86	1	0
Jaw Diseases Diseases involving the JAW.	0	2.35	2	0
Dyskinesia Syndromes [description not available]	0	1.94	1	0
Decerebrate Posturing [description not available]	0	1.94	1	0
Movement Disorders Syndromes which feature DYSKINESIAS as a cardinal manifestation of the disease process. Included in this category are degenerative, hereditary, post-infectious, medication-induced, post-inflammatory, and post-traumatic conditions.	0	1.94	1	0
Alkalosis, Respiratory A state due to excess loss of carbon dioxide from the body. (Dorland, 27th ed)	0	3.27	2	0
Hyperventilation A pulmonary ventilation rate faster than is metabolically necessary for the exchange of gases. It is the result of an increased frequency of breathing, an increased tidal volume, or a combination of both. It causes an excess intake of oxygen and the blowing off of carbon dioxide.	0	1.95	1	0
Ureteral Calculi Stones in the URETER that are formed in the KIDNEY. They are rarely more than 5 mm in diameter for larger renal stones cannot enter ureters. They are often lodged at the ureteral narrowing and can cause excruciating renal colic.	0	1.95	1	0
Actinomycetoma [description not available]	0	1.95	1	0
Fungal Lung Diseases [description not available]	0	2.35	2	0
Mycetoma A chronic progressive subcutaneous infection caused by species of fungi (eumycetoma), or actinomycetes (actinomycetoma). It is characterized by tumefaction, abscesses, and tumor-like granules representing microcolonies of pathogens, such as MADURELLA fungi and bacteria ACTINOMYCETES, with different grain colors.	0	1.95	1	0
Femur Neck Fractures [description not available]	0	1.95	1	0
Femoral Neck Fractures Fractures of the short, constricted portion of the thigh bone between the femur head and the trochanters. It excludes intertrochanteric fractures which are HIP FRACTURES.	0	1.95	1	0
Geotrichosis Infection due to the fungus Geotrichum.	0	1.95	1	0
Edema Disease of Swine An acute disease of young pigs that is usually associated with weaning. It is characterized clinically by paresis and subcutaneous edema.	0	1.95	1	0
Hemorrhage, Retinal [description not available]	0	1.95	1	0
Choroid Neoplasms Tumors of the choroid; most common intraocular tumors are malignant melanomas of the choroid. These usually occur after puberty and increase in incidence with advancing age. Most malignant melanomas of the uveal tract develop from benign melanomas (nevi).	0	1.95	1	0
Retinal Degeneration A retrogressive pathological change in the retina, focal or generalized, caused by genetic defects, inflammation, trauma, vascular disease, or aging. Degeneration affecting predominantly the macula lutea of the retina is MACULAR DEGENERATION. (Newell, Ophthalmology: Principles and Concepts, 7th ed, p304)	0	1.95	1	0
Coagulation, Disseminated Intravascular [description not available]	0	1.95	1	0
Disseminated Intravascular Coagulation A disorder characterized by procoagulant substances entering the general circulation causing a systemic thrombotic process. The activation of the clotting mechanism may arise from any of a number of disorders. A majority of the patients manifest skin lesions, sometimes leading to PURPURA FULMINANS.	0	1.95	1	0
Actinomycosis, Cervicofacial A form of ACTINOMYCOSIS characterized by slow-growing inflammatory lesions of the lymph nodes that drain the mouth (lumpy jaw), reddening of the overlying skin, and intraperitoneal abscesses.	0	2.86	1	0
Anuria Absence of urine formation. It is usually associated with complete bilateral ureteral (URETER) obstruction, complete lower urinary tract obstruction, or unilateral ureteral obstruction when a solitary kidney is present.	0	2.63	3	0
Acinetobacter Infections Infections with bacteria of the genus ACINETOBACTER.	0	3.26	2	0
Infections, Mycobacterium [description not available]	0	2.86	1	0
Mycobacterium Infections Infections with bacteria of the genus MYCOBACTERIUM.	0	2.86	1	0
Age-Related Memory Disorders [description not available]	0	2.86	1	0
Memory Disorders Disturbances in registering an impression, in the retention of an acquired impression, or in the recall of an impression. Memory impairments are associated with DEMENTIA; CRANIOCEREBRAL TRAUMA; ENCEPHALITIS; ALCOHOLISM (see also ALCOHOL AMNESTIC DISORDER); SCHIZOPHRENIA; and other conditions.	0	2.86	1	0
Deficiency, Magnesium [description not available]	0	2.86	1	0
Magnesium Deficiency A nutritional condition produced by a deficiency of magnesium in the diet, characterized by anorexia, nausea, vomiting, lethargy, and weakness. Symptoms are paresthesias, muscle cramps, irritability, decreased attention span, and mental confusion, possibly requiring months to appear. Deficiency of body magnesium can exist even when serum values are normal. In addition, magnesium deficiency may be organ-selective, since certain tissues become deficient before others. (Harrison's Principles of Internal Medicine, 12th ed, p1936)	0	2.86	1	0
Nephrotic Syndrome A condition characterized by severe PROTEINURIA, greater than 3.5 g/day in an average adult. The substantial loss of protein in the urine results in complications such as HYPOPROTEINEMIA; generalized EDEMA; HYPERTENSION; and HYPERLIPIDEMIAS. Diseases associated with nephrotic syndrome generally cause chronic kidney dysfunction.	0	2.86	1	0
Pneumoperitoneum A condition with trapped gas or air in the PERITONEAL CAVITY, usually secondary to perforation of the internal organs such as the LUNG and the GASTROINTESTINAL TRACT, or to recent surgery. Pneumoperitoneum may be purposely introduced to aid radiological examination.	0	2.86	1	0
Cellulitis, Pelvic [description not available]	0	1.94	1	0
Parametritis Inflammation of the parametrium, the connective tissue of the pelvic floor, extending from the subserous coat of the uterus laterally between the layers of the BROAD LIGAMENT.	0	1.94	1	0
Chronic Primary Open Angle Glaucoma [description not available]	0	1.94	1	0
Glaucoma, Open-Angle Glaucoma in which the angle of the anterior chamber is open and the trabecular meshwork does not encroach on the base of the iris.	0	1.94	1	0
Rheumatism [description not available]	0	2.85	1	0
Rheumatic Diseases Disorders of connective tissue, especially the joints and related structures, characterized by inflammation, degeneration, or metabolic derangement.	0	2.85	1	0
Neuritis A general term indicating inflammation of a peripheral or cranial nerve. Clinical manifestation may include PAIN; PARESTHESIAS; PARESIS; or HYPESTHESIA.	0	2.35	2	0
Myelopathy [description not available]	0	1.94	1	0
Spinal Cord Diseases Pathologic conditions which feature SPINAL CORD damage or dysfunction, including disorders involving the meninges and perimeningeal spaces surrounding the spinal cord. Traumatic injuries, vascular diseases, infections, and inflammatory/autoimmune processes may affect the spinal cord.	0	1.94	1	0
Gastroenteritis, Transmissible, of Swine A condition of chronic gastroenteritis in adult pigs and fatal gastroenteritis in piglets caused by a CORONAVIRUS.	0	1.94	1	0
Kwashiorkor A syndrome produced by severe protein deficiency, characterized by retarded growth, changes in skin and hair pigment, edema, and pathologic changes in the liver, including fatty infiltration, necrosis, and fibrosis. The word is a local name in Gold Coast, Africa, meaning displaced child. Although first reported from Africa, kwashiorkor is now known throughout the world, but mainly in the tropics and subtropics. It is considered to be related to marasmus. (From Dorland, 27th ed)	0	1.94	1	0
Parasitic Skin Diseases [description not available]	0	1.94	1	0
Deficiency, Vitamin E [description not available]	0	1.94	1	0
Salivary Gland Diseases Diseases involving the SALIVARY GLANDS.	0	1.94	1	0
Dentin, Secondary Dentin formed by normal pulp after completion of root end formation.	0	1.94	1	0
Adam-Stokes Attacks [description not available]	0	2.34	2	0
Esophageal Diseases Pathological processes in the ESOPHAGUS.	0	1.94	1	0
Addison's Anemia [description not available]	0	3.32	1	1
Funnel Chest A developmental anomaly in which the lower sternum is posteriorly dislocated and concavely deformed, resulting in a funnel-shaped thorax.	0	1.94	1	0
Idiopathic Parkinson Disease [description not available]	0	1.94	1	0
Parkinson Disease A progressive, degenerative neurologic disease characterized by a TREMOR that is maximal at rest, retropulsion (i.e. a tendency to fall backwards), rigidity, stooped posture, slowness of voluntary movements, and a masklike facial expression. Pathologic features include loss of melanin containing neurons in the substantia nigra and other pigmented nuclei of the brainstem. LEWY BODIES are present in the substantia nigra and locus coeruleus but may also be found in a related condition (LEWY BODY DISEASE, DIFFUSE) characterized by dementia in combination with varying degrees of parkinsonism. (Adams et al., Principles of Neurology, 6th ed, p1059, pp1067-75)	0	1.94	1	0
Arthritis, Juvenile Chronic [description not available]	0	1.94	1	0
Acid Aspiration Syndrome [description not available]	0	1.94	1	0
Arthritis, Juvenile Arthritis in children, with onset before 16 years of age. The terms juvenile rheumatoid arthritis (JRA) and juvenile idiopathic arthritis (JIA) refer to classification systems for chronic arthritis in children. Only one subtype of juvenile arthritis (polyarticular-onset, rheumatoid factor-positive) clinically resembles adult rheumatoid arthritis and is considered its childhood equivalent.	0	1.94	1	0
Pneumonia, Aspiration A type of lung inflammation resulting from the aspiration of food, liquid, or gastric contents into the upper RESPIRATORY TRACT.	0	1.94	1	0
Pneumonia, Pneumococcal A febrile disease caused by STREPTOCOCCUS PNEUMONIAE.	0	1.94	1	0
Endarteritis Inflammation of the inner endothelial lining (TUNICA INTIMA) of an artery.	0	1.94	1	0
Cervix Erosion [description not available]	0	1.94	1	0
Esophageal Fistula Abnormal passage communicating with the ESOPHAGUS. The most common type is TRACHEOESOPHAGEAL FISTULA between the esophagus and the TRACHEA.	0	1.94	1	0
Alveolitis, Fibrosing [description not available]	0	2.34	2	0
Pulmonary Fibrosis A process in which normal lung tissues are progressively replaced by FIBROBLASTS and COLLAGEN causing an irreversible loss of the ability to transfer oxygen into the bloodstream via PULMONARY ALVEOLI. Patients show progressive DYSPNEA finally resulting in death.	0	2.34	2	0
Glomerular Necrosis [description not available]	0	1.94	1	0
Dermatomyositis, Adult Type [description not available]	0	1.94	1	0
Dermatomyositis A subacute or chronic inflammatory disease of muscle and skin, marked by proximal muscle weakness and a characteristic skin rash. The illness occurs with approximately equal frequency in children and adults. The skin lesions usually take the form of a purplish rash (or less often an exfoliative dermatitis) involving the nose, cheeks, forehead, upper trunk, and arms. The disease is associated with a complement mediated intramuscular microangiopathy, leading to loss of capillaries, muscle ischemia, muscle-fiber necrosis, and perifascicular atrophy. The childhood form of this disease tends to evolve into a systemic vasculitis. Dermatomyositis may occur in association with malignant neoplasms. (From Adams et al., Principles of Neurology, 6th ed, pp1405-6)	0	1.94	1	0
Adult Rickets [description not available]	0	2.35	2	0
Rachitis [description not available]	0	1.94	1	0
Osteomalacia Disorder caused by an interruption of the mineralization of organic bone matrix leading to bone softening, bone pain, and weakness. It is the adult form of rickets resulting from disruption of VITAMIN D; PHOSPHORUS; or CALCIUM homeostasis.	0	2.35	2	0
Mediastinitis Inflammation of the mediastinum, the area between the pleural sacs.	0	1.94	1	0
Infections, Taenia [description not available]	0	1.94	1	0
Taeniasis Infection with tapeworms of the genus Taenia.	0	1.94	1	0
Cervicitis [description not available]	0	1.94	1	0
Uterine Cervicitis Inflammation of the UTERINE CERVIX.	0	1.94	1	0
Ocular Tuberculosis [description not available]	0	1.94	1	0
Acute Membranous Gingivitis [description not available]	0	1.94	1	0
Arterial Inflammation [description not available]	0	1.94	1	0
Urinary Bladder Fistula An abnormal passage in the URINARY BLADDER or between the bladder and any surrounding organ.	0	1.94	1	0
Histoplasma capsulatum Infection [description not available]	0	1.94	1	0
Histoplasmosis Infection resulting from exposure to the fungus HISTOPLASMA. It is worldwide in distribution and particularly common in the central and eastern states, especially areas around the Ohio and Mississippi River valleys.	0	1.94	1	0
Dumping Syndrome Gastrointestinal symptoms resulting from an absent or nonfunctioning pylorus.	0	1.94	1	0
Apraxia [description not available]	0	1.94	1	0
Apraxias A group of cognitive disorders characterized by the inability to perform previously learned skills that cannot be attributed to deficits of motor or sensory function. The two major subtypes of this condition are ideomotor (see APRAXIA, IDEOMOTOR) and ideational apraxia, which refers to loss of the ability to mentally formulate the processes involved with performing an action. For example, dressing apraxia may result from an inability to mentally formulate the act of placing clothes on the body. Apraxias are generally associated with lesions of the dominant PARIETAL LOBE and supramarginal gyrus. (From Adams et al., Principles of Neurology, 6th ed, pp56-7)	0	1.94	1	0
Erysipelas An acute infection of the skin caused by species of STREPTOCOCCUS. This disease most frequently affects infants, young children, and the elderly. Characteristics include pink-to-red lesions that spread rapidly and are warm to the touch. The commonest site of involvement is the face.	0	1.94	1	0
Hemorrhagic Disease of Newborn Neonatal nasogastric or intracranial hemorrhage caused by vitamin K deficiency.	0	1.94	1	0
Neurilemoma [description not available]	0	1.94	1	0
Neurilemmoma A neoplasm that arises from SCHWANN CELLS of the cranial, peripheral, and autonomic nerves. Clinically, these tumors may present as a cranial neuropathy, abdominal or soft tissue mass, intracranial lesion, or with spinal cord compression. Histologically, these tumors are encapsulated, highly vascular, and composed of a homogenous pattern of biphasic fusiform-shaped cells that may have a palisaded appearance. (From DeVita Jr et al., Cancer: Principles and Practice of Oncology, 5th ed, pp964-5)	0	1.94	1	0
Congenital Familial Lymphedema [description not available]	0	1.94	1	0
Lymphedema Edema due to obstruction of lymph vessels or disorders of the lymph nodes.	0	1.94	1	0
Vascular Diseases Pathological processes involving any of the BLOOD VESSELS in the cardiac or peripheral circulation. They include diseases of ARTERIES; VEINS; and rest of the vasculature system in the body.	0	1.94	1	0
Mesenteric Lymphadenitis INFLAMMATION of LYMPH NODES in the MESENTERY.	0	1.94	1	0
Deficiency, Riboflavin [description not available]	0	1.94	1	0

framycetin

Description

Cross-References

Synonyms (102)

Research Excerpts

Toxicity

Pharmacokinetics

Compound-Compound Interactions

Bioavailability

Dosage Studied

Roles (3)

Drug Classes (1)

Pathways (1)

Protein Targets (62)

Inhibition Measurements

Activation Measurements

Other Measurements

Biological Processes (90)

Molecular Functions (52)

Ceullar Components (41)

Bioassays (662)

Research

Studies (7,586)

Market Indicators

Research Demand Index: 80.60

Study Types