| ID Source | ID |
|---|---|
| PubMed CID | 16133899 |
| MeSH ID | M0015278 |
| Synonym |
|---|
| acacccaattctgaaaatgg |
| antisense oligo to hiv-1 5349-5368 |
| 5'-acacccaattctgaaaatgg-3' |
| 104053-06-7 |
| oligonucleotides , |
Oligonucleotides (ONs) are a group of substances that display great therapeutic potential to interfere with gene expression. PBCA nanocapsules demonstrate to be a versatile delivery platform for small interfering RNA to treat a variety of diseases.
Oligonucleotides (oligos) have been under clinical development for approximately the past 30 years. Oligon nucleotides have been ligated efficiently on solid-phase using CuAAC and SPAAC chemistry to produce up to 186-mer triazole linked DNA products. All oligonucleots investigated have shown a noteworthy antiproliferative activity against lung cancer cell line Calu 6.
| Excerpt | Reference | Relevance |
|---|---|---|
| "CpG oligonucleotides (CpG ODN) activate and support the maturation of immune cells, including plasmacytoid dendritic cells and B lymphocytes, that express Toll-like receptor 9 (TLR9) and are capable of presenting tumor antigens to T cells." | ( TLR-9 agonist immunostimulatory sequence adjuvants linked to cancer antigens. Klinman, DM; Shirota, H, 2014) | 0.88 |
Oligonucleotides have a low systemic half-life and rapid degradation. Clear understanding of the pharmacokinetic (PK)/pharmacodynamic behavior of these compounds is necessary to optimize and characterize the performance of therapeutic oligon nucleotides in vivo.
We investigated the effect of Bcl-2 small interfering RNA (siRNA) combined with miR-15a oligonucleotides (ODN) on the growth of Raji cells. We have compared conventional RFLP methods with PCR used in combination with allele specific oligon nucleotides. The results were used to diagnose AAT deficiency of the ZZ type.
| Excerpt | Reference | Relevance |
|---|---|---|
| " This is the first bioavailability study on a short nonionic oligonucleotide analogue, a class of molecules with potential biomedical applications." | ( Synthesis and biodistribution of a short nonionic oligonucleotide analogue in mouse with a potential to mimic peptides. Benner, SA; Boelsterli, UA; Boess, F; Eschgfäller, B; König, M, 1998) | 0.3 |
| "The chemical modification of antisense oligodeoxynucleotides (ODNs) by conjugating synthetic peptides of known membranotropic activities to the 3' and/or 5' terminus of ODNs may serve two functions that are important for increasing their bioavailability by protecting the ODNs from exonuclease digestion and facilitated delivery into cells." | ( Use of Nalpha-Fmoc-cysteine(S-thiobutyl) derivatized oligodeoxynucleotides for the preparation of oligodeoxynucleotide-peptide hybrid molecules. Haralambidis, J; Soukchareun, S; Tregear, G, ) | 0.13 |
| " In the present study, we have used HYB 165, a novel DNA/RNA hybrid mixed backbone oligonucleotide that exhibits improved pharmacokinetic and bioavailability properties in vivo and is presently undergoing Phase I trials." | ( Cooperative inhibitory effect of novel mixed backbone oligonucleotide targeting protein kinase A in combination with docetaxel and anti-epidermal growth factor-receptor antibody on human breast cancer cell growth. Agrawal, S; Bianco, AR; Caputo, R; Ciardiello, F; Mendelsohn, J; Pepe, S; Pomatico, G; Tortora, G, 1999) | 0.3 |
| "Bioactivatable protecting groups represent an enormously powerful tool to increase bioavailability or to generally help deliver drugs to cells." | ( Prodrugs of biologically active phosphate esters. Schultz, C, 2003) | 0.32 |
| " The Fujita-Ban variant of the classical Free-Wilson analysis gave a highly significant correlation for a series of 48 relatively small molecules demonstrating that (i) the partial contributions of substituents to biological activity (EC(50)) are additive and (ii) assuming similar bioavailability for all quinolines studied, the larger molecules cannot be accommodated within a still unknown biological receptor." | ( Synthesis and activity of substituted 2-phenylquinolin-4-amines, antagonists of immunostimulatory CpG-oligodeoxynucleotides. Bojarski, AJ; Henary, M; Macfarlane, DE; Manzel, L; Ruiz, P; Say, M; Strekowski, L, 2003) | 0.32 |
| " Optimization of the sequence, length, and bioavailability resulted in the selection of a 13-mer NPS oligonucleotide, GRN163, as a drug development candidate." | ( A novel telomerase template antagonist (GRN163) as a potential anticancer agent. Akinaga, S; Asai, A; Chin, AC; Gryaznov, S; Harley, CB; Kusaka, H; Li, S; Oshima, Y; Piatyszek, M; Pongracz, K; Pruzan, R; Uochi, TA; Wunder, E; Yamamoto, Y; Yamashita, Y, 2003) | 0.32 |
| " IKBL encodes a protein resembling members of the IkappaB protein family that regulate bioavailability of NFkappaB." | ( A promoter polymorphism in the central MHC gene, IKBL, influences the binding of transcription factors USF1 and E47 on disease-associated haplotypes. Allcock, RJ; Boodhoo, A; Lee, S; Price, P; Voon, D; Williamson, D; Wong, AM, 2004) | 0.32 |
| " Their affinity and specificity for a given protein make it possible to isolate a ligand to virtually any target, and adjusting their bioavailability expands their clinical utility." | ( Aptamers: an emerging class of therapeutics. Nimjee, SM; Rusconi, CP; Sullenger, BA, 2005) | 0.33 |
| " A novel nicotinamide, AMG 706, was identified as a potent, orally bioavailable inhibitor of the VEGFR1/Flt1, VEGFR2/kinase domain receptor/Flk-1, VEGFR3/Flt4, platelet-derived growth factor receptor, and Kit receptors in preclinical models." | ( AMG 706, an oral, multikinase inhibitor that selectively targets vascular endothelial growth factor, platelet-derived growth factor, and kit receptors, potently inhibits angiogenesis and induces regression in tumor xenografts. Alva, G; Bready, J; Cattley, R; Chen, D; Coxon, A; DeMelfi, T; Diaz, Z; Estrada, J; Gan, Y; Kaufman, S; Kendall, R; Kumar, G; Meyer, J; Montestruque, S; Neervannan, S; Patel, V; Polverino, A; Radinsky, R; Starnes, C; Talvenheimo, J; Tasker, A; Wang, L, 2006) | 0.33 |
| "AMG 706 is an investigational, orally bioavailable inhibitor of vascular endothelial growth factor receptors 1, 2, and 3, platelet-derived growth factor receptor, and stem-cell factor receptor." | ( Safety, pharmacokinetics, and efficacy of AMG 706, an oral multikinase inhibitor, in patients with advanced solid tumors. Bass, MB; Benjamin, R; Chang, DD; Herbst, RS; Koutsoukos, A; Kurzrock, R; Mulay, M; Ng, C; Polverino, A; Purdom, M; Rosen, LS; Silverman, J; Sun, YN; Van Vugt, A; Wiezorek, JS; Xu, RY, 2007) | 0.34 |
| " In vivo, these compounds show good bioavailability and efficient biodistribution to all major organs, while exerting acceptable toxicity at therapeutically relevant doses." | ( Oligonucleotide n3'-->p5' phosphoramidates and thio-phoshoramidates as potential therapeutic agents. Gryaznov, SM, 2010) | 0.36 |
| " Oral bioavailability and preliminary evidence of activity make this compound an appealing choice for additional investigations." | ( Motesanib and advanced NSCLC: experiences and expectations. Blumenschein, GR; Raghav, KP, 2011) | 0.37 |
| "The purpose of this study was to employ a nanoscale liposomal carrier to resolve the delivery problem, and increase the bioavailability and efficiency of pTT." | ( Topical delivery of DNA oligonucleotide to induce p53 generation in the skin via thymidine dinucleotide (pTT)-encapsulated liposomal carrier. Fang, YP, 2011) | 0.37 |
| "Various chemical drug delivery vehicles have been developed aiming at improving the bioavailability of nucleic acid-based drugs." | ( Use of cell-penetrating-peptides in oligonucleotide splice switching therapy. El Andaloussi, SA; Hammond, SM; Mäger, I; Wood, MJ, 2012) | 0.38 |
| " In particular small interfering RNAs (siRNAs) are being rapidly recognized as promising therapeutic tools, but their poor bioavailability limits the full realization of their clinical potential." | ( Exosomes for targeted siRNA delivery across biological barriers. El Andaloussi, S; Lakhal, S; Mäger, I; Wood, MJ, 2013) | 0.39 |
| " Systemic bioavailability was minimal, and no systemic toxicity was observed at exposure levels appreciably above pharmacological doses and doses proposed for clinical trials." | ( Local and systemic tolerability of a 2'O-methoxyethyl antisense oligonucleotide targeting interleukin-4 receptor-α delivery by inhalation in mouse and monkey. Fey, RA; Gigliotti, AP; Henry, SP; Hutt, JA; McDonald, JD; Reed, MD; Templin, MV; Yu, RZ, 2014) | 0.4 |
| "Poor cellular delivery and low bioavailability of novel potent therapeutic molecules continue to remain the bottleneck of modern cancer and gene therapy." | ( Peptide-mediated delivery: an overview of pathways for efficient internalization. Pae, J; Pooga, M, 2014) | 0.4 |
| " Clinical translation of ONs is hampered by the inadequate bioavailability in the target cells due to the substantial extracellular and intracellular barriers exposed to these molecules." | ( Sequence-defined polymers for the delivery of oligonucleotides. Lehto, T; Wagner, E, 2014) | 0.66 |
| " In recent years, small interfering RNA (siRNA) has emerged as promising therapeutic alternative for diseases with gene-based pathophysiology, however poor bioavailability limits its therapeutic potential." | ( Exosomes: Natural Carriers for siRNA Delivery. Gupta, V; Kumar, L; Vaidya, B; Verma, S, 2015) | 0.42 |
| " Despite their undoubted potential, clinical translation of these molecules, however, has been largely held back by their limited bioavailability in the target tissues/cells." | ( Peptides for nucleic acid delivery. El Andaloussi, S; Ezzat, K; Lehto, T; Wood, MJA, 2016) | 0.43 |
| " These CPPs typically deliver their cargoes into cells by an endosomal-dependent mechanism resulting in lower bioavailability of the cargo." | ( CLIP6-PNA-Peptide Conjugates: Non-Endosomal Delivery of Splice Switching Oligonucleotides. Karni, R; Mogilevsky, M; Soudah, T; Yavin, E, 2017) | 0.69 |
| " The latest technological advances in oligonucleotide therapeutics utilizes direct conjugation to targeting ligands, which has improved bioavailability and target tissue exposure many-fold." | ( Recent preclinical and clinical advances in oligonucleotide conjugates. Abrams, M; Amiji, M; Craig, K, 2018) | 0.48 |
| " We highlighted that inhibition of miR-199a-3p and -5p independently increases NO bioavailability by promoting eNOS activity and reducing its degradation, thereby supporting VEGF-induced endothelial tubulogenesis and modulating vessel contractile tone." | ( MicroRNA-199a-3p and MicroRNA-199a-5p Take Part to a Redundant Network of Regulation of the NOS (NO Synthase)/NO Pathway in the Endothelium. Balligand, JL; Catalucci, D; Condorelli, G; Dessy, C; Di Mauro, V; Esfahani, H; Gomez, EL; Joris, V; Lobysheva, I; Menchi, L, 2018) | 0.48 |
| "In vivo bioavailability and delivery of nucleic acids to the site of action is a severe limitation in oligonucleotide (ON) therapeutics." | ( Attachment of Peptides to Oligonucleotides on Solid Support Using Copper(I)-Catalyzed Huisgen 1,3-Dipolar Cycloaddition. Honcharenko, D; Honcharenko, M; Strömberg, R, 2019) | 0.81 |
| "The oral bioavailability of therapeutic proteins is limited by the gastrointestinal barriers." | ( Lyophilisation Improves Bioactivity and Stability of Insulin-Loaded Polymeric-Oligonucleotide Nanoparticles for Diabetes Treatment. Al-Salami, H; Dass, CR; Wong, CY, 2020) | 0.56 |
| " However, their high molecular weight limits their bioavailability for otherwise-treatable neurological disorders." | ( Antibody-oligonucleotide conjugate achieves CNS delivery in animal models for spinal muscular atrophy. Abendroth, F; Ahlskog, N; Burrell, M; Gait, MJ; Goli, L; Gurrell, I; Hammond, SM; Stoodley, J; Thom, G; Webster, CI; Wood, MJ, 2022) | 0.72 |
| " Here, we show that the well-tolerated and orally bioavailable synthetic sphingolipid analog, SH-BC-893, increases the activity of antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) up to 200-fold in vitro without permeabilizing endosomes." | ( Simultaneous inhibition of endocytic recycling and lysosomal fusion sensitizes cells and tissues to oligonucleotide therapeutics. Anderson, BA; Eckenstein, KH; Edinger, AL; Finicle, BT; Fruman, DA; Gil, D; Hanessian, S; McCracken, AN; Revenko, AS; Seth, PP; Wan, WB, 2023) | 1.11 |
Antisense oligonucleotides (ASOs) dosed into cerebrospinal fluid (CSF) distribute broadly throughout the central nervous system. This dosing regime is higher than a patient would be expected to receive in the clinical use of ASOs.
| Timeframe | Studies, This Drug (%) | All Drugs % |
|---|---|---|
| pre-1990 | 3067 (13.82) | 18.7374 |
| 1990's | 3888 (17.52) | 18.2507 |
| 2000's | 7280 (32.81) | 29.6817 |
| 2010's | 5774 (26.02) | 24.3611 |
| 2020's | 2181 (9.83) | 2.80 |
| [information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023] | ||
According to the monthly volume, diversity, and competition of internet searches for this compound, as well the volume and growth of publications, there is estimated to be very strong demand-to-supply ratio for research on this compound.
| This Compound (79.57) All Compounds (24.57) |
| Publication Type | This drug (%) | All Drugs (%) |
|---|---|---|
| Trials | 245 (1.06%) | 5.53% |
| Reviews | 1,629 (7.04%) | 6.00% |
| Case Studies | 102 (0.44%) | 4.05% |
| Observational | 22 (0.10%) | 0.25% |
| Other | 21,130 (91.36%) | 84.16% |
| [information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023] | ||
| Substance | Relationship Strength | Studies | Trials | Classes | Roles |
|---|---|---|---|---|---|
| dinitrochlorobenzene Dinitrochlorobenzene: A skin irritant that may cause dermatitis of both primary and allergic types. Contact sensitization with DNCB has been used as a measure of cellular immunity. DNCB is also used as a reagent for the detection and determination of pyridine compounds.. 1-chloro-2,4-dinitrobenzene : A C-nitro compound that is chlorobenzene carrying a nitro substituent at each of the 2- and 4-positions. | 2.01 | 1 | 0 | C-nitro compound; monochlorobenzenes | allergen; epitope; sensitiser |
| 2-phosphoglycerate 2-phosphoglycerate: RN given refers to cpd without isomeric designation. 2-phosphoglyceric acid : A monophosphoglyceric acid having the phospho group at the 2-position. | 1.96 | 1 | 0 | monophosphoglyceric acid; tetronic acid derivative | |
| 2,3-diphosphoglycerate 2,3-Diphosphoglycerate: A highly anionic organic phosphate which is present in human red blood cells at about the same molar ratio as hemoglobin. It binds to deoxyhemoglobin but not the oxygenated form, therefore diminishing the oxygen affinity of hemoglobin. This is essential in enabling hemoglobin to unload oxygen in tissue capillaries. It is also an intermediate in the conversion of 3-phosphoglycerate to 2-phosphoglycerate by phosphoglycerate mutase (EC 5.4.2.1). (From Stryer Biochemistry, 4th ed, p160; Enzyme Nomenclature, 1992, p508). 2,3-bisphosphoglyceric acid : A bisphosphoglyceric acid that is glyceric acid carrying two phospho substituents at positions 2 and 3. | 2.02 | 1 | 0 | bisphosphoglyceric acid; tetronic acid derivative | human metabolite |
| phosphoserine Phosphoserine: The phosphoric acid ester of serine. | 2.92 | 4 | 0 | non-proteinogenic alpha-amino acid; O-phosphoamino acid; serine derivative | human metabolite |
| gamma-aminobutyric acid gamma-Aminobutyric Acid: The most common inhibitory neurotransmitter in the central nervous system.. gamma-aminobutyric acid : A gamma-amino acid that is butanoic acid with the amino substituent located at C-4. | 2.93 | 4 | 0 | amino acid zwitterion; gamma-amino acid; monocarboxylic acid | human metabolite; neurotransmitter; Saccharomyces cerevisiae metabolite; signalling molecule |
| 4-hydroxybenzaldehyde [no description available] | 2.03 | 1 | 0 | hydroxybenzaldehyde | EC 1.14.17.1 (dopamine beta-monooxygenase) inhibitor; mouse metabolite; plant metabolite |
| 4-hydroxyphenylacetic acid 4-hydroxyphenylacetic acid : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens is substituted by a 4-hydroxyphenyl group. | 2.48 | 2 | 0 | monocarboxylic acid; phenols | fungal metabolite; human metabolite; mouse metabolite; plant metabolite |
| ethylene glycol Ethylene Glycol: A colorless, odorless, viscous dihydroxy alcohol. It has a sweet taste, but is poisonous if ingested. Ethylene glycol is the most important glycol commercially available and is manufactured on a large scale in the United States. It is used as an antifreeze and coolant, in hydraulic fluids, and in the manufacture of low-freezing dynamites and resins.. ethanediol : Any diol that is ethane or substituted ethane carrying two hydroxy groups.. ethylene glycol : A 1,2-glycol compound produced via reaction of ethylene oxide with water. | 3.91 | 12 | 0 | ethanediol; glycol | metabolite; mouse metabolite; solvent; toxin |
| acetic acid Acetic Acid: Product of the oxidation of ethanol and of the destructive distillation of wood. It is used locally, occasionally internally, as a counterirritant and also as a reagent. (Stedman, 26th ed). acetic acid : A simple monocarboxylic acid containing two carbons. | 2.94 | 4 | 0 | monocarboxylic acid | antimicrobial food preservative; Daphnia magna metabolite; food acidity regulator; protic solvent |
| acetaldehyde Acetaldehyde: A colorless, flammable liquid used in the manufacture of acetic acid, perfumes, and flavors. It is also an intermediate in the metabolism of alcohol. It has a general narcotic action and also causes irritation of mucous membranes. Large doses may cause death from respiratory paralysis.. acetaldehyde : The aldehyde formed from acetic acid by reduction of the carboxy group. It is the most abundant carcinogen in tobacco smoke.. aldehyde : A compound RC(=O)H, in which a carbonyl group is bonded to one hydrogen atom and to one R group.. acetyl group : A group, formally derived from acetic acid by dehydroxylation, which is fundamental to the biochemistry of all forms of life. When bound to coenzyme A, it is central to the metabolism of carbohydrates and fats. | 3.37 | 7 | 0 | aldehyde | carcinogenic agent; EC 3.5.1.4 (amidase) inhibitor; electron acceptor; Escherichia coli metabolite; human metabolite; mouse metabolite; mutagen; oxidising agent; Saccharomyces cerevisiae metabolite; teratogenic agent |
| acetamide acetimidic acid : A carboximidic acid that is acetic acid in which the carbonyl oxygen is replaced by an imino group. | 2.4 | 2 | 0 | acetamides; carboximidic acid; monocarboxylic acid amide; N-acylammonia | |
| acetone methyl ketone : A ketone of formula RC(=O)CH3 (R =/= H). | 7.68 | 3 | 0 | ketone body; methyl ketone; propanones; volatile organic compound | EC 3.5.1.4 (amidase) inhibitor; human metabolite; polar aprotic solvent |
| adenine [no description available] | 10.32 | 226 | 1 | 6-aminopurines; purine nucleobase | Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| agmatine Agmatine: Decarboxylated arginine, isolated from several plant and animal sources, e.g., pollen, ergot, herring sperm, octopus muscle. | 2.02 | 1 | 0 | guanidines; primary amino compound | Escherichia coli metabolite; mouse metabolite |
| ammonium hydroxide azane : Saturated acyclic nitrogen hydrides having the general formula NnHn+2. | 5.49 | 21 | 0 | azane; gas molecular entity; mononuclear parent hydride | EC 3.5.1.4 (amidase) inhibitor; metabolite; mouse metabolite; neurotoxin; NMR chemical shift reference compound; nucleophilic reagent; refrigerant |
| arsenic acid arsenic acid: RN given refers to orthoarsenic acid(H3AsO4); see also sodium arsenate. arsenic acid : An arsenic oxoacid comprising one oxo group and three hydroxy groups attached to a central arsenic atom. | 2.01 | 1 | 0 | arsenic oxoacid | Escherichia coli metabolite |
| beta-alanine [no description available] | 2.08 | 1 | 0 | amino acid zwitterion; beta-amino acid | agonist; fundamental metabolite; human metabolite; inhibitor; neurotransmitter |
| benzaldehyde [no description available] | 2.43 | 2 | 0 | benzaldehydes | EC 3.1.1.3 (triacylglycerol lipase) inhibitor; EC 3.5.5.1 (nitrilase) inhibitor; flavouring agent; fragrance; odorant receptor agonist; plant metabolite |
| benzene [no description available] | 2.7 | 3 | 0 | aromatic annulene; benzenes; volatile organic compound | carcinogenic agent; environmental contaminant; non-polar solvent |
| benzoic acid Benzoic Acid: A fungistatic compound that is widely used as a food preservative. It is conjugated to GLYCINE in the liver and excreted as hippuric acid.. benzoic acid : A compound comprising a benzene ring core carrying a carboxylic acid substituent.. aromatic carboxylic acid : Any carboxylic acid in which the carboxy group is directly bonded to an aromatic ring. | 2.17 | 1 | 0 | benzoic acids | algal metabolite; antimicrobial food preservative; drug allergen; EC 1.13.11.33 (arachidonate 15-lipoxygenase) inhibitor; EC 3.1.1.3 (triacylglycerol lipase) inhibitor; human xenobiotic metabolite; plant metabolite |
| betaine glycine betaine : The amino acid betaine derived from glycine. | 3.12 | 5 | 0 | amino-acid betaine; glycine derivative | fundamental metabolite |
| bis(4-nitrophenyl)phosphate bis(4-nitrophenyl)phosphate: RN given refers to parent cpd | 2.42 | 2 | 0 | aryl phosphate | |
| bromide Bromides: Salts of hydrobromic acid, HBr, with the bromine atom in the 1- oxidation state. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed) | 2.91 | 4 | 0 | halide anion; monoatomic bromine | |
| hydrobromic acid Hydrobromic Acid: Hydrobromic acid (HBr). A solution of hydrogen bromide gas in water.. hydrobromide : Salts formally resulting from the reaction of hydrobromic acid with an organic base.. hydrogen bromide : A diatomic molecule containing covalently bonded hydrogen and bromine atoms. | 2.04 | 1 | 0 | gas molecular entity; hydrogen halide; mononuclear parent hydride | mouse metabolite |
| 1-butanol 1-Butanol: A four carbon linear hydrocarbon that has a hydroxy group at position 1.. butan-1-ol : A primary alcohol that is butane in which a hydrogen of one of the methyl groups is substituted by a hydroxy group. It it produced in small amounts in humans by the gut microbes. | 4.06 | 4 | 0 | alkyl alcohol; primary alcohol; short-chain primary fatty alcohol | human metabolite; mouse metabolite; protic solvent |
| butyric acid Butyric Acid: A four carbon acid, CH3CH2CH2COOH, with an unpleasant odor that occurs in butter and animal fat as the glycerol ester.. butyrate : A short-chain fatty acid anion that is the conjugate base of butyric acid, obtained by deprotonation of the carboxy group.. butyric acid : A straight-chain saturated fatty acid that is butane in which one of the terminal methyl groups has been oxidised to a carboxy group. | 2.02 | 1 | 0 | fatty acid 4:0; straight-chain saturated fatty acid | human urinary metabolite; Mycoplasma genitalium metabolite |
| cadaverine [no description available] | 2.42 | 2 | 0 | alkane-alpha,omega-diamine | Daphnia magna metabolite; Escherichia coli metabolite; mouse metabolite; plant metabolite |
| carbamates [no description available] | 8.16 | 18 | 1 | amino-acid anion | |
| carbamyl phosphate Carbamyl Phosphate: The monoanhydride of carbamic acid with PHOSPHORIC ACID. It is an important intermediate metabolite and is synthesized enzymatically by CARBAMYL-PHOSPHATE SYNTHASE (AMMONIA) and CARBAMOYL-PHOSPHATE SYNTHASE (GLUTAMINE-HYDROLYZING). | 1.98 | 1 | 0 | acyl monophosphate; one-carbon compound | Escherichia coli metabolite; mouse metabolite |
| carbon monoxide Carbon Monoxide: Carbon monoxide (CO). A poisonous colorless, odorless, tasteless gas. It combines with hemoglobin to form carboxyhemoglobin, which has no oxygen carrying capacity. The resultant oxygen deprivation causes headache, dizziness, decreased pulse and respiratory rates, unconsciousness, and death. (From Merck Index, 11th ed). carbon monoxide : A one-carbon compound in which the carbon is joined only to a single oxygen. It is a colourless, odourless, tasteless, toxic gas. | 2.71 | 3 | 0 | carbon oxide; gas molecular entity; one-carbon compound | biomarker; EC 1.9.3.1 (cytochrome c oxidase) inhibitor; human metabolite; ligand; metabolite; mitochondrial respiratory-chain inhibitor; mouse metabolite; neurotoxin; neurotransmitter; P450 inhibitor; probe; signalling molecule; vasodilator agent |
| formic acid formic acid: RN given refers to parent cpd. formic acid : The simplest carboxylic acid, containing a single carbon. Occurs naturally in various sources including the venom of bee and ant stings, and is a useful organic synthetic reagent. Principally used as a preservative and antibacterial agent in livestock feed. Induces severe metabolic acidosis and ocular injury in human subjects. | 2.73 | 3 | 0 | monocarboxylic acid | antibacterial agent; astringent; metabolite; protic solvent; solvent |
| catechol [no description available] | 2.47 | 2 | 0 | catechols | allelochemical; genotoxin; plant metabolite |
| methane Methane: The simplest saturated hydrocarbon. It is a colorless, flammable gas, slightly soluble in water. It is one of the chief constituents of natural gas and is formed in the decomposition of organic matter. (Grant & Hackh's Chemical Dictionary, 5th ed). methane : A one-carbon compound in which the carbon is attached by single bonds to four hydrogen atoms. It is a colourless, odourless, non-toxic but flammable gas (b.p. -161degreeC). | 7.8 | 55 | 0 | alkane; gas molecular entity; mononuclear parent hydride; one-carbon compound | bacterial metabolite; fossil fuel; greenhouse gas |
| chloroacetic acid chloroacetic acid: urinary metabolite of vinyl chloride; RN given refers to parent cpd; structure. chloroacetic acid : A chlorocarboxylic acid that is acetic acid carrying a 2-chloro substituent. | 2.04 | 1 | 0 | chlorocarboxylic acid; haloacetic acid | alkylating agent; herbicide |
| choline [no description available] | 2.73 | 3 | 0 | cholines | allergen; Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; neurotransmitter; nutrient; plant metabolite; Saccharomyces cerevisiae metabolite |
| citric acid, anhydrous Citric Acid: A key intermediate in metabolism. It is an acid compound found in citrus fruits. The salts of citric acid (citrates) can be used as anticoagulants due to their calcium chelating ability.. citric acid : A tricarboxylic acid that is propane-1,2,3-tricarboxylic acid bearing a hydroxy substituent at position 2. It is an important metabolite in the pathway of all aerobic organisms. | 3.43 | 7 | 0 | tricarboxylic acid | antimicrobial agent; chelator; food acidity regulator; fundamental metabolite |
| chlorine chloride : A halide anion formed when chlorine picks up an electron to form an an anion. | 4.42 | 21 | 0 | halide anion; monoatomic chlorine | cofactor; Escherichia coli metabolite; human metabolite |
| hydrochloric acid Hydrochloric Acid: A strong corrosive acid that is commonly used as a laboratory reagent. It is formed by dissolving hydrogen chloride in water. GASTRIC ACID is the hydrochloric acid component of GASTRIC JUICE.. hydrogen chloride : A mononuclear parent hydride consisting of covalently bonded hydrogen and chlorine atoms. | 2.71 | 3 | 0 | chlorine molecular entity; gas molecular entity; hydrogen halide; mononuclear parent hydride | mouse metabolite |
| coumarin 2H-chromen-2-one: coumarin derivative | 3.45 | 7 | 0 | coumarins | fluorescent dye; human metabolite; plant metabolite |
| salicylic acid Scalp: The outer covering of the calvaria. It is composed of several layers: SKIN; subcutaneous connective tissue; the occipitofrontal muscle which includes the tendinous galea aponeurotica; loose connective tissue; and the pericranium (the PERIOSTEUM of the SKULL). | 3.13 | 5 | 0 | monohydroxybenzoic acid | algal metabolite; antifungal agent; antiinfective agent; EC 1.11.1.11 (L-ascorbate peroxidase) inhibitor; keratolytic drug; plant hormone; plant metabolite |
| octane Octanes: Eight-carbon saturated hydrocarbon group of the methane series. Include isomers and derivatives.. octane : A straight chain alkane composed of 8 carbon atoms. | 2.02 | 1 | 0 | alkane | xenobiotic |
| 4-nitrophenylphosphate nitrophenylphosphate: RN given refers to mono(4-nitrophenyl) ester of phosphoric acid. 4-nitrophenyl phosphate : An aryl phosphate resulting from the mono-esterification of phosphoric acid with 4-nitrophenol. | 1.98 | 1 | 0 | aryl phosphate | mouse metabolite |
| octanoic acid octanoic acid: RN given refers to parent cpd; structure in Merck Index, 9th ed, #1764. octanoic acid : A straight-chain saturated fatty acid that is heptane in which one of the hydrogens of a terminal methyl group has been replaced by a carboxy group. Octanoic acid is also known as caprylic acid. | 2.45 | 2 | 0 | medium-chain fatty acid; straight-chain saturated fatty acid | antibacterial agent; Escherichia coli metabolite; human metabolite |
| trimethylenediamine trimethylenediamine: RN given refers to parent cpd; structure. trimethylenediamine : An alkane-alpha,omega-diamine comprising a propane skeleton with amino substituents at positions 1 and 3. | 2.4 | 2 | 0 | alkane-alpha,omega-diamine | human metabolite; mouse metabolite; reagent |
| sorbitol [no description available] | 3.73 | 9 | 0 | hexitol | |
| oxaluric acid oxaluric acid : A 2-oxo monocarboxylic acid that is amino(oxo)acetic acid substituted by a carbamoylamino group at the nitrogen atom. | 2.41 | 2 | 0 | 2-oxo monocarboxylic acid; ureas | Escherichia coli metabolite |
| guaiacol Guaiacol: An agent thought to have disinfectant properties and used as an expectorant. (From Martindale, The Extra Pharmacopoeia, 30th ed, p747). methylcatechol : Any member of the class of catechols carrying one or more methyl substituents.. guaiacol : A monomethoxybenzene that consists of phenol with a methoxy substituent at the ortho position. | 2.42 | 2 | 0 | guaiacols | disinfectant; EC 1.1.1.25 (shikimate dehydrogenase) inhibitor; expectorant; plant metabolite |
| malic acid malic acid : A 2-hydroxydicarboxylic acid that is succinic acid in which one of the hydrogens attached to a carbon is replaced by a hydroxy group.. 2-hydroxydicarboxylic acid : Any dicarboxylic acid carrying a hydroxy group on the carbon atom at position alpha to the carboxy group. | 2.07 | 1 | 0 | 2-hydroxydicarboxylic acid; C4-dicarboxylic acid | food acidity regulator; fundamental metabolite |
| phosphoglycolate phosphoglycolate: RN given refers to parent acid. 2-phosphoglycolic acid : The O-phospho derivative of glycolic acid. | 8.11 | 5 | 0 | carboxyalkyl phosphate | Escherichia coli metabolite; mouse metabolite |
| phosphonoacetic acid Phosphonoacetic Acid: A simple organophosphorus compound that inhibits DNA polymerase, especially in viruses and is used as an antiviral agent.. phosphonoacetic acid : A member of the class of phosphonic acids that is phosphonic acid in which the hydrogen attached to the phosphorous is replaced by a carboxymethyl group. | 2.94 | 4 | 0 | monocarboxylic acid; phosphonic acids | antiviral agent; EC 2.7.7.7 (DNA-directed DNA polymerase) inhibitor |
| aminocaproic acid Aminocaproic Acid: An antifibrinolytic agent that acts by inhibiting plasminogen activators which have fibrinolytic properties.. 6-aminohexanoic acid : An epsilon-amino acid comprising hexanoic acid carrying an amino substituent at position C-6. Used to control postoperative bleeding, and to treat overdose effects of the thrombolytic agents streptokinase and tissue plasminogen activator. | 2.04 | 1 | 0 | amino acid zwitterion; epsilon-amino acid; omega-amino fatty acid | antifibrinolytic drug; hematologic agent; metabolite |
| cytosine [no description available] | 10.21 | 265 | 0 | aminopyrimidine; pyrimidine nucleobase; pyrimidone | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| lactic acid Lactic Acid: A normal intermediate in the fermentation (oxidation, metabolism) of sugar. The concentrated form is used internally to prevent gastrointestinal fermentation. (From Stedman, 26th ed). 2-hydroxypropanoic acid : A 2-hydroxy monocarboxylic acid that is propanoic acid in which one of the alpha-hydrogens is replaced by a hydroxy group. | 9.56 | 24 | 0 | 2-hydroxy monocarboxylic acid | algal metabolite; Daphnia magna metabolite |
| dihydrouracil hexahydropyrimidine-2,4-dione: structure in first source. 5,6-dihydrouracil : A pyrimidine obtained by formal addition of hydrogen across the 5,6-position of uracil. | 2.39 | 2 | 0 | pyrimidone | Escherichia coli metabolite; human metabolite; metabolite; mouse metabolite |
| dimethylamine [no description available] | 1.96 | 1 | 0 | methylamines; secondary aliphatic amine | metabolite |
| dimethyl sulfoxide Dimethyl Sulfoxide: A highly polar organic liquid, that is used widely as a chemical solvent. Because of its ability to penetrate biological membranes, it is used as a vehicle for topical application of pharmaceuticals. It is also used to protect tissue during CRYOPRESERVATION. Dimethyl sulfoxide shows a range of pharmacological activity including analgesia and anti-inflammation.. dimethyl sulfoxide : A 2-carbon sulfoxide in which the sulfur atom has two methyl substituents. | 4.12 | 16 | 0 | sulfoxide; volatile organic compound | alkylating agent; antidote; Escherichia coli metabolite; geroprotector; MRI contrast agent; non-narcotic analgesic; polar aprotic solvent; radical scavenger |
| ethanolamine [no description available] | 2.38 | 2 | 0 | ethanolamines; primary alcohol; primary amine | Escherichia coli metabolite; human metabolite; mouse metabolite |
| formaldehyde paraform: polymerized formaldehyde; RN given refers to parent cpd; used in root canal therapy | 5.71 | 26 | 0 | aldehyde; one-carbon compound | allergen; carcinogenic agent; disinfectant; EC 3.5.1.4 (amidase) inhibitor; environmental contaminant; Escherichia coli metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| formamide formimidic acid : A carboximidic acid that is formic acid in which the carbonyl oxygen is replaced by an imino group.. primary carboxamide : A carboxamide resulting from the formal condensation of a carboxylic acid with ammonia; formula RC(=O)NH2. | 3.89 | 12 | 0 | carboximidic acid; formamides; monocarboxylic acid amide; one-carbon compound | solvent |
| glycine [no description available] | 11.77 | 46 | 0 | alpha-amino acid; amino acid zwitterion; proteinogenic amino acid; serine family amino acid | EC 2.1.2.1 (glycine hydroxymethyltransferase) inhibitor; fundamental metabolite; hepatoprotective agent; micronutrient; neurotransmitter; NMDA receptor agonist; nutraceutical |
| glyceric acid glyceric acid: found in urine of patient with D-glyceric acidemia & hyperglycinaemia; RN given refers to parent cpd without isomeric designation. glycerol ether : Any ether having glyceryl as at least one of the O-substituents.. glyceric acid : A trionic acid that consists of propionic acid substituted at positions 2 and 3 by hydroxy groups. | 7.06 | 1 | 0 | trionic acid | fundamental metabolite |
| glycerol Moon: The natural satellite of the planet Earth. It includes the lunar cycles or phases, the lunar month, lunar landscapes, geography, and soil. | 4.62 | 26 | 0 | alditol; triol | algal metabolite; detergent; Escherichia coli metabolite; geroprotector; human metabolite; mouse metabolite; osmolyte; Saccharomyces cerevisiae metabolite; solvent |
| glycolaldehyde [no description available] | 2.01 | 1 | 0 | glycolaldehydes | fundamental metabolite; human metabolite |
| hydrogen carbonate Bicarbonates: Inorganic salts that contain the -HCO3 radical. They are an important factor in determining the pH of the blood and the concentration of bicarbonate ions is regulated by the kidney. Levels in the blood are an index of the alkali reserve or buffering capacity.. hydrogencarbonate : The carbon oxoanion resulting from the removal of a proton from carbonic acid. | 2.69 | 3 | 0 | carbon oxoanion | cofactor; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| dalteparin Dalteparin: A low-molecular-weight fragment of heparin, prepared by nitrous acid depolymerization of porcine mucosal heparin. The mean molecular weight is 4000-6000 daltons. It is used therapeutically as an antithrombotic agent. (From Merck Index, 11th ed) | 4.41 | 1 | 1 | ||
| histamine [no description available] | 3.52 | 8 | 0 | aralkylamino compound; imidazoles | human metabolite; mouse metabolite; neurotransmitter |
| homogentisic acid Homogentisic Acid: Dihydroxyphenylacetic acid with hydroxyls at the 2 and 5 positions of the phenyl ring.. homogentisic acid : A dihydroxyphenylacetic acid having the two hydroxy substituents at the 2- and 5-positions. | 2.31 | 1 | 0 | dihydroxyphenylacetic acid; hydroquinones | human metabolite; plant metabolite |
| hydrogen Hydrogen: The first chemical element in the periodic table with atomic symbol H, and atomic number 1. Protium (atomic weight 1) is by far the most common hydrogen isotope. Hydrogen also exists as the stable isotope DEUTERIUM (atomic weight 2) and the radioactive isotope TRITIUM (atomic weight 3). Hydrogen forms into a diatomic molecule at room temperature and appears as a highly flammable colorless and odorless gas.. dihydrogen : An elemental molecule consisting of two hydrogens joined by a single bond. | 5 | 39 | 0 | elemental hydrogen; elemental molecule; gas molecular entity | antioxidant; electron donor; food packaging gas; fuel; human metabolite |
| hydroquinone [no description available] | 2.05 | 1 | 0 | benzenediol; hydroquinones | antioxidant; carcinogenic agent; cofactor; Escherichia coli metabolite; human xenobiotic metabolite; mouse metabolite; skin lightening agent |
| hydroxylamine amino alcohol : An alcohol containing an amino functional group in addition to the alcohol-defining hydroxy group. | 3.1 | 5 | 0 | hydroxylamines | algal metabolite; bacterial xenobiotic metabolite; EC 1.1.3.13 (alcohol oxidase) inhibitor; EC 4.2.1.22 (cystathionine beta-synthase) inhibitor; EC 4.3.1.10 (serine-sulfate ammonia-lyase) inhibitor; nitric oxide donor; nucleophilic reagent |
| imidazole imidazole: RN given refers to parent cpd. 1H-imidazole : An imidazole tautomer which has the migrating hydrogen at position 1. | 5.13 | 14 | 0 | imidazole | |
| indole [no description available] | 2.02 | 1 | 0 | indole; polycyclic heteroarene | Escherichia coli metabolite |
| indoleacetic acid indoleacetic acid: RN given refers to unlabeled parent cpd; structure in Merck Index, 9th ed, #4841. auxin : Any of a group of compounds, both naturally occurring and synthetic, that induce cell elongation in plant stems (from Greek alphaupsilonxialphanuomega, "to grow").. indole-3-acetic acid : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens has been replaced by a 1H-indol-3-yl group. | 2.45 | 2 | 0 | indole-3-acetic acids; monocarboxylic acid | auxin; human metabolite; mouse metabolite; plant hormone; plant metabolite |
| iodine Iodine: A nonmetallic element of the halogen group that is represented by the atomic symbol I, atomic number 53, and atomic weight of 126.90. It is a nutritionally essential element, especially important in thyroid hormone synthesis. In solution, it has anti-infective properties and is used topically.. diiodine : Molecule comprising two covalently bonded iodine atoms with overall zero charge.. | 3.95 | 13 | 0 | diatomic iodine | nutrient |
| kynurenine Kynurenine: A metabolite of the essential amino acid tryptophan metabolized via the tryptophan-kynurenine pathway.. kynurenine : A ketone that is alanine in which one of the methyl hydrogens is substituted by a 2-aminobenzoyl group. | 2.25 | 1 | 0 | aromatic ketone; non-proteinogenic alpha-amino acid; substituted aniline | human metabolite |
| thioctic acid Thioctic Acid: An octanoic acid bridged with two sulfurs so that it is sometimes also called a pentanoic acid in some naming schemes. It is biosynthesized by cleavage of LINOLEIC ACID and is a coenzyme of oxoglutarate dehydrogenase (KETOGLUTARATE DEHYDROGENASE COMPLEX). It is used in DIETARY SUPPLEMENTS. | 2.95 | 4 | 0 | dithiolanes; heterocyclic fatty acid; thia fatty acid | fundamental metabolite; geroprotector |
| endolysin lysine-4,4,5,5-d4 : A deuterated compound that is lysne in which the methylene hydrogens at positions 4, 4, 5 and 5 have been replaced by deuterium. | 2.1 | 1 | 0 | alpha-amino acid; diamino acid; polar amino acid | Daphnia magna metabolite |
| methanol Methanol: A colorless, flammable liquid used in the manufacture of FORMALDEHYDE and ACETIC ACID, in chemical synthesis, antifreeze, and as a solvent. Ingestion of methanol is toxic and may cause blindness.. primary alcohol : A primary alcohol is a compound in which a hydroxy group, -OH, is attached to a saturated carbon atom which has either three hydrogen atoms attached to it or only one other carbon atom and two hydrogen atoms attached to it.. methanol : The primary alcohol that is the simplest aliphatic alcohol, comprising a methyl and an alcohol group. | 4.13 | 16 | 0 | alkyl alcohol; one-carbon compound; primary alcohol; volatile organic compound | amphiprotic solvent; Escherichia coli metabolite; fuel; human metabolite; mouse metabolite; Mycoplasma genitalium metabolite |
| phytic acid Phytic Acid: Complexing agent for removal of traces of heavy metal ions. It acts also as a hypocalcemic agent.. myo-inositol hexakisphosphate : A myo-inositol hexakisphosphate in which each hydroxy group of myo-inositol is monophosphorylated. | 6.99 | 1 | 0 | inositol phosphate | |
| inositol Inositol: An isomer of glucose that has traditionally been considered to be a B vitamin although it has an uncertain status as a vitamin and a deficiency syndrome has not been identified in man. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1379) Inositol phospholipids are important in signal transduction.. inositol : Any cyclohexane-1,2,3,4,5,6-hexol.. 1D-chiro-inositol : Belonging to the inositol family of compounds, D-chiro-inositol (DCI) is an isomer of glucose. It is an important secondary messenger in insulin signal transduction.. muco-inositol : An inositol that is cyclohexane-1,2,3,4,5,6-hexol having a (1R,2R,3r,4R,5S,6r)-configuration. | 2.4 | 2 | 0 | cyclitol; hexol | |
| melatonin [no description available] | 7.93 | 4 | 0 | acetamides; tryptamines | anticonvulsant; central nervous system depressant; geroprotector; hormone; human metabolite; immunological adjuvant; mouse metabolite; radical scavenger |
| naphthalene [no description available] | 7.73 | 3 | 0 | naphthalenes; ortho-fused bicyclic arene | apoptosis inhibitor; carcinogenic agent; environmental contaminant; mouse metabolite; plant metabolite; volatile oil component |
| nickel Nickel: A trace element with the atomic symbol Ni, atomic number 28, and atomic weight 58.69. It is a cofactor of the enzyme UREASE.. nickel ion : A nickel atom having a net electric charge.. nickel atom : Chemical element (nickel group element atom) with atomic number 28. | 9.66 | 27 | 0 | metal allergen; nickel group element atom | epitope; micronutrient |
| niacinamide nicotinamide : A pyridinecarboxamide that is pyridine in which the hydrogen at position 3 is replaced by a carboxamide group. | 18.07 | 103 | 34 | pyridine alkaloid; pyridinecarboxamide; vitamin B3 | anti-inflammatory agent; antioxidant; cofactor; EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor; EC 3.5.1.98 (histone deacetylase) inhibitor; Escherichia coli metabolite; geroprotector; human urinary metabolite; metabolite; mouse metabolite; neuroprotective agent; Saccharomyces cerevisiae metabolite; Sir2 inhibitor |
| niacin Niacin: A water-soluble vitamin of the B complex occurring in various animal and plant tissues. It is required by the body for the formation of coenzymes NAD and NADP. It has PELLAGRA-curative, vasodilating, and antilipemic properties.. vitamin B3 : Any member of a group of vitamers that belong to the chemical structural class called pyridines that exhibit biological activity against vitamin B3 deficiency. Vitamin B3 deficiency causes a condition known as pellagra whose symptoms include depression, dermatitis and diarrhea. The vitamers include nicotinic acid and nicotinamide (and their ionized and salt forms).. nicotinic acid : A pyridinemonocarboxylic acid that is pyridine in which the hydrogen at position 3 is replaced by a carboxy group. | 4.95 | 4 | 0 | pyridine alkaloid; pyridinemonocarboxylic acid; vitamin B3 | antidote; antilipemic drug; EC 3.5.1.19 (nicotinamidase) inhibitor; Escherichia coli metabolite; human urinary metabolite; metabolite; mouse metabolite; plant metabolite; vasodilator agent |
| nitrates Nitrates: Inorganic or organic salts and esters of nitric acid. These compounds contain the NO3- radical. | 3.51 | 8 | 0 | monovalent inorganic anion; nitrogen oxoanion; reactive nitrogen species | |
| nitric acid Nitric Acid: Nitric acid (HNO3). A colorless liquid that is used in the manufacture of inorganic and organic nitrates and nitro compounds for fertilizers, dye intermediates, explosives, and many different organic chemicals. Continued exposure to vapor may cause chronic bronchitis; chemical pneumonitis may occur. (From Merck Index, 11th ed). nitric acid : A nitrogen oxoacid of formula HNO3 in which the nitrogen atom is bonded to a hydroxy group and by equivalent bonds to the remaining two oxygen atoms. | 2.03 | 1 | 0 | nitrogen oxoacid | protic solvent; reagent |
| nitroxyl nitroxyl: hydroxamic acid oxidized to nitroxyl free radical. nitroxyl : A nitrogen oxoacid consisting of an oxygen atom double-bonded to an NH group. | 3.19 | 5 | 0 | nitrogen oxoacid | |
| nitrites Nitrites: Salts of nitrous acid or compounds containing the group NO2-. The inorganic nitrites of the type MNO2 (where M=metal) are all insoluble, except the alkali nitrites. The organic nitrites may be isomeric, but not identical with the corresponding nitro compounds. (Grant & Hackh's Chemical Dictionary, 5th ed) | 3.73 | 10 | 0 | monovalent inorganic anion; nitrogen oxoanion; reactive nitrogen species | human metabolite |
| nitrous oxide Nitrous Oxide: Nitrogen oxide (N2O). A colorless, odorless gas that is used as an anesthetic and analgesic. High concentrations cause a narcotic effect and may replace oxygen, causing death by asphyxia. It is also used as a food aerosol in the preparation of whipping cream.. dinitrogen oxide : A nitrogen oxide consisting of linear unsymmetrical molecules with formula N2O. While it is the most used gaseous anaesthetic in the world, its major commercial use, due to its solubility under pressure in vegetable fats combined with its non-toxicity in low concentrations, is as an aerosol spray propellant and aerating agent for canisters of 'whipped' cream. | 2.13 | 1 | 0 | gas molecular entity; nitrogen oxide | analgesic; bacterial metabolite; food packaging gas; food propellant; general anaesthetic; greenhouse gas; inhalation anaesthetic; NMDA receptor antagonist; raising agent; refrigerant; vasodilator agent |
| n,n-dimethylaniline N,N-dimethylaniline: RN given refers to parent cpd; structure. dimethylaniline : A methylaniline carrying at least two methyl groups.. N,N-dimethylaniline : A tertiary amine that is aniline in which the amino hydrogens are replaced by two methyl groups. | 2.02 | 1 | 0 | dimethylaniline; tertiary amine | |
| hydroxide ion [no description available] | 2.94 | 4 | 0 | oxygen hydride | mouse metabolite |
| orotic acid Orotic Acid: An intermediate product in PYRIMIDINE synthesis which plays a role in chemical conversions between DIHYDROFOLATE and TETRAHYDROFOLATE.. orotic acid : A pyrimidinemonocarboxylic acid that is uracil bearing a carboxy substituent at position C-6. | 2.44 | 2 | 0 | pyrimidinemonocarboxylic acid | Escherichia coli metabolite; metabolite; mouse metabolite |
| oxalic acid Oxalic Acid: A strong dicarboxylic acid occurring in many plants and vegetables. It is produced in the body by metabolism of glyoxylic acid or ascorbic acid. It is not metabolized but excreted in the urine. It is used as an analytical reagent and general reducing agent.. oxalic acid : An alpha,omega-dicarboxylic acid that is ethane substituted by carboxyl groups at positions 1 and 2. | 2.39 | 2 | 0 | alpha,omega-dicarboxylic acid | algal metabolite; human metabolite; plant metabolite |
| oxamic acid Oxamic Acid: Amino-substituted glyoxylic acid derivative.. oxamic acid : A dicarboxylic acid monoamide resulting from the formal condensation of one of the carboxy groups of oxalic acid with ammonia. | 2.41 | 2 | 0 | dicarboxylic acid monoamide | Escherichia coli metabolite |
| 4-aminobenzoic acid 4-Aminobenzoic Acid: An aminobenzoic acid isomer that combines with pteridine and GLUTAMIC ACID to form FOLIC ACID. The fact that 4-aminobenzoic acid absorbs light throughout the UVB range has also resulted in its use as an ingredient in SUNSCREENS.. 4-ammoniobenzoate : A zwitterion obtained by transfer of a proton from the carboxy to the amino group of 4-aminobenzoic acid.. 4-aminobenzoic acid : An aminobenzoic acid in which the amino group is para to the carboxy group. | 2.01 | 1 | 0 | aminobenzoic acid; aromatic amino-acid zwitterion | allergen; Escherichia coli metabolite; plant metabolite |
| 4-nitrophenol 4-nitrophenol: RN given refers to parent cpd. mononitrophenol : A nitrophenol that is phenol carrying a single nitro substituent at unspecified position.. 4-nitrophenol : A member of the class of 4-nitrophenols that is phenol in which the hydrogen that is para to the hydroxy group has been replaced by a nitro group. | 2.03 | 1 | 0 | 4-nitrophenols | human xenobiotic metabolite; mouse metabolite |
| triphosphoric acid triphosphoric acid: used as water softener, peptizing agent, emulsifier & dispersing agent; ingredient of cleansers; meat preservative; RN given refers to parent cpd; structure | 4.22 | 16 | 0 | acyclic phosphorus acid anhydride; phosphorus oxoacid | |
| palmitic acid Palmitic Acid: A common saturated fatty acid found in fats and waxes including olive oil, palm oil, and body lipids.. hexadecanoic acid : A straight-chain, sixteen-carbon, saturated long-chain fatty acid. | 2.94 | 4 | 0 | long-chain fatty acid; straight-chain saturated fatty acid | algal metabolite; Daphnia magna metabolite; EC 1.1.1.189 (prostaglandin-E2 9-reductase) inhibitor; plant metabolite |
| parathion [no description available] | 2.25 | 1 | 0 | C-nitro compound; organic thiophosphate; organothiophosphate insecticide | acaricide; agrochemical; avicide; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; mouse metabolite |
| pentachlorophenol PENTA: structure given in first source | 1.97 | 1 | 0 | aromatic fungicide; chlorophenol; organochlorine pesticide; pentachlorobenzenes | human xenobiotic metabolite |
| phenanthrene phenanthrene : A polycyclic aromatic hydrocarbon composed of three fused benzene rings which takes its name from the two terms 'phenyl' and 'anthracene.' | 2.76 | 3 | 0 | ortho-fused polycyclic arene; ortho-fused tricyclic hydrocarbon; phenanthrenes | environmental contaminant; mouse metabolite |
| phenol [no description available] | 4.39 | 6 | 0 | phenols | antiseptic drug; disinfectant; human xenobiotic metabolite; mouse metabolite |
| phosphoric acid phosphoric acid: concise etchant is 37% H3PO4. phosphoric acid : A phosphorus oxoacid that consists of one oxo and three hydroxy groups joined covalently to a central phosphorus atom. | 2.71 | 3 | 0 | phosphoric acids | algal metabolite; fertilizer; human metabolite; NMR chemical shift reference compound; solvent |
| phosphorylcholine Phosphorylcholine: Calcium and magnesium salts used therapeutically in hepatobiliary dysfunction.. phosphocholine : The phosphate of choline; and the parent compound of the phosphocholine family. | 2.97 | 4 | 0 | phosphocholines | allergen; epitope; hapten; human metabolite; mouse metabolite |
| phosphorylethanolamine phosphorylethanolamine: RN given refers to parent cpd; structure. O-phosphoethanolamine : The ethanolamine mono-ester of phosphoric acid, and a metabolite of phospholipid metabolism. This phosphomonoester shows strong structural similarity to the inhibitory neurotransmitter GABA, and is decreased in post-mortem Alzheimer's disease brain. | 2.02 | 1 | 0 | phosphoethanolamine; primary amino compound | algal metabolite; human metabolite; mouse metabolite |
| phthalic acid phthalic acid: RN given refers to parent cpd; structure in Merck Index, 9th ed, #7178. phthalic acid : A benzenedicarboxylic acid cosisting of two carboxy groups at ortho positions. | 2.01 | 1 | 0 | benzenedicarboxylic acid | human xenobiotic metabolite |
| picolinic acid picolinic acid: iron-chelating agent that inhibits DNA synthesis; may interfere with iron-dependent production of stable free organic radical which is essential for ribonucleotide reductase formation of deoxyribonucleotides; RN given refers to parent cpd; structure in Merck Index, 9th ed, #7206. picolinic acid : A pyridinemonocarboxylic acid in which the carboxy group is located at position 2. It is an intermediate in the metabolism of tryptophan. | 2.75 | 3 | 0 | pyridinemonocarboxylic acid | human metabolite; MALDI matrix material |
| diphosphoric acid diphosphoric acid : An acyclic phosphorus acid anhydride obtained by condensation of two molecules of phosphoric acid. | 2.49 | 2 | 0 | acyclic phosphorus acid anhydride; phosphorus oxoacid | Escherichia coli metabolite |
| pqq cofactor PQQ Cofactor: A pyrrolo-quinoline having two adjacent keto-groups at the 4 and 5 positions and three acidic carboxyl groups. It is a coenzyme of some DEHYDROGENASES.. pyrroloquinoline quinone : A pyrroloquinoline having oxo groups at the 4- and 5-positions and carboxy groups at the 2-, 7- and 9-positions. | 2.11 | 1 | 0 | orthoquinones; pyrroloquinoline cofactor; tricarboxylic acid | anti-inflammatory agent; antioxidant; cofactor; water-soluble vitamin (role) |
| propylene glycol Propylene Glycol: A clear, colorless, viscous organic solvent and diluent used in pharmaceutical preparations.. propane-1,2-diol : The simplest member of the class of propane-1,2-diols, consisting of propane in which a hydrogen at position 1 and a hydrogen at position 2 are substituted by hydroxy groups. A colourless, viscous, hygroscopic, low-melting (-59degreeC) and high-boiling (188degreeC) liquid with low toxicity, it is used as a solvent, emulsifying agent, and antifreeze. | 2.4 | 2 | 0 | glycol; propane-1,2-diols | allergen; human xenobiotic metabolite; mouse metabolite; protic solvent |
| 1-propanol 1-Propanol: A colorless liquid made by oxidation of aliphatic hydrocarbons that is used as a solvent and chemical intermediate.. propan-1-ol : The parent member of the class of propan-1-ols that is propane in which a hydrogen of one of the methyl groups is replaced by a hydroxy group. | 2.38 | 2 | 0 | propan-1-ols; short-chain primary fatty alcohol | metabolite; protic solvent |
| propionic acid propionic acid : A short-chain saturated fatty acid comprising ethane attached to the carbon of a carboxy group. | 2.07 | 1 | 0 | saturated fatty acid; short-chain fatty acid | antifungal drug |
| pteridines [no description available] | 4.35 | 6 | 0 | azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; pteridines | |
| purine 1H-purine : The 1H-tautomer of purine.. 3H-purine : The 3H-tautomer of purine.. 9H-purine : The 9H-tautomer of purine.. 7H-purine : The 7H-tautomer of purine. | 5.7 | 25 | 0 | purine | |
| putrescine [no description available] | 3.25 | 6 | 0 | alkane-alpha,omega-diamine | antioxidant; fundamental metabolite |
| pyrazinamide pyrazinecarboxamide : A monocarboxylic acid amide resulting from the formal condensation of the carboxy group of pyrazinoic acid (pyrazine-2-carboxylic acid) with ammonia. A prodrug for pyrazinoic acid, pyrazinecarboxamide is used as part of multidrug regimens for the treatment of tuberculosis. | 2.73 | 3 | 0 | monocarboxylic acid amide; N-acylammonia; pyrazines | antitubercular agent; prodrug |
| pyrazole 1H-pyrazole : The 1H-tautomer of pyrazole. | 2.11 | 1 | 0 | pyrazole | |
| pyridine azine : An organonitrogen compound of general structure RCH=N-N=CHR or RR'C=N-N=CRR'. | 5.36 | 10 | 0 | azaarene; mancude organic heteromonocyclic parent; monocyclic heteroarene; pyridines | environmental contaminant; NMR chemical shift reference compound |
| pyridoxal phosphate Pyridoxal Phosphate: This is the active form of VITAMIN B 6 serving as a coenzyme for synthesis of amino acids, neurotransmitters (serotonin, norepinephrine), sphingolipids, aminolevulinic acid. During transamination of amino acids, pyridoxal phosphate is transiently converted into pyridoxamine phosphate (PYRIDOXAMINE).. pyridoxal 5'-phosphate : The monophosphate ester obtained by condensation of phosphoric acid with the primary hydroxy group of pyridoxal. | 3.24 | 6 | 0 | methylpyridines; monohydroxypyridine; pyridinecarbaldehyde; vitamin B6 phosphate | coenzyme; cofactor; EC 2.7.7.7 (DNA-directed DNA polymerase) inhibitor; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| pyridoxamine [no description available] | 1.99 | 1 | 0 | aminoalkylpyridine; hydroxymethylpyridine; monohydroxypyridine; vitamin B6 | Escherichia coli metabolite; human metabolite; iron chelator; mouse metabolite; nephroprotective agent; plant metabolite; Saccharomyces cerevisiae metabolite |
| pyridoxine 4,5-bis(hydroxymethyl)-2-methylpyridin-3-ol: structure in first source. vitamin B6 : Any member of the group of pyridines that exhibit biological activity against vitamin B6 deficiency. Vitamin B6 deficiency is associated with microcytic anemia, electroencephalographic abnormalities, dermatitis with cheilosis (scaling on the lips and cracks at the corners of the mouth) and glossitis (swollen tongue), depression and confusion, and weakened immune function. Vitamin B6 consists of the vitamers pyridoxine, pyridoxal, and pyridoxamine and their respective 5'-phosphate esters (and includes their corresponding ionized and salt forms). | 1.99 | 1 | 0 | hydroxymethylpyridine; methylpyridines; monohydroxypyridine; vitamin B6 | cofactor; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| pyruvic acid Pyruvic Acid: An intermediate compound in the metabolism of carbohydrates, proteins, and fats. In thiamine deficiency, its oxidation is retarded and it accumulates in the tissues, especially in nervous structures. (From Stedman, 26th ed). pyruvic acid : A 2-oxo monocarboxylic acid that is the 2-keto derivative of propionic acid. It is a metabolite obtained during glycolysis. | 2.15 | 1 | 0 | 2-oxo monocarboxylic acid | cofactor; fundamental metabolite |
| thiosulfates Thiosulfates: Inorganic salts of thiosulfuric acid possessing the general formula R2S2O3.. thiosulfate(2-) : A divalent inorganic anion obtained by removal of both protons from thiosulfuric acid. | 1.97 | 1 | 0 | divalent inorganic anion; sulfur oxide; sulfur oxoanion | human metabolite |
| dithionite Dithionite: Dithionite. The dithionous acid ion and its salts. | 2.04 | 1 | 0 | sulfur oxide; sulfur oxoanion | |
| sarcosine cocobetaine: N-alkyl-betaine; cause of shampoo dermatitis | 1.97 | 1 | 0 | N-alkylglycine zwitterion; N-alkylglycine; N-methyl-amino acid; N-methylglycines | Escherichia coli metabolite; glycine receptor agonist; glycine transporter 1 inhibitor; human metabolite; mouse metabolite |
| sulfites Sulfites: Inorganic salts of sulfurous acid.. sulfites : Any sulfurous acid derivative that is a salt or an ester of sulfurous acid.. organosulfonate oxoanion : An organic anion obtained by deprotonation of the sufonate group(s) of any organosulfonic acid.. sulfite : A sulfur oxoanion that is the conjugate base of hydrogen sulfite (H2SO3). | 5.73 | 27 | 0 | divalent inorganic anion; sulfur oxide; sulfur oxoanion | |
| spermidine [no description available] | 9.29 | 19 | 0 | polyazaalkane; triamine | autophagy inducer; fundamental metabolite; geroprotector |
| spermine [no description available] | 5.17 | 46 | 0 | polyazaalkane; tetramine | antioxidant; fundamental metabolite; immunosuppressive agent |
| succinic acid Succinic Acid: A water-soluble, colorless crystal with an acid taste that is used as a chemical intermediate, in medicine, the manufacture of lacquers, and to make perfume esters. It is also used in foods as a sequestrant, buffer, and a neutralizing agent. (Hawley's Condensed Chemical Dictionary, 12th ed, p1099; McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1851). succinic acid : An alpha,omega-dicarboxylic acid resulting from the formal oxidation of each of the terminal methyl groups of butane to the corresponding carboxy group. It is an intermediate metabolite in the citric acid cycle. | 2.73 | 3 | 0 | alpha,omega-dicarboxylic acid; C4-dicarboxylic acid | anti-ulcer drug; fundamental metabolite; micronutrient; nutraceutical; radiation protective agent |
| taurine [no description available] | 2.05 | 1 | 0 | amino sulfonic acid; zwitterion | antioxidant; Escherichia coli metabolite; glycine receptor agonist; human metabolite; mouse metabolite; nutrient; radical scavenger; Saccharomyces cerevisiae metabolite |
| thiamine thiamine(1+) : A primary alcohol that is 1,3-thiazol-3-ium substituted by (4-amino-2-methylpyrimidin-5-yl)methyl, methyl and 2-hydroxyethyl groups at positions 3, 4 and 5, respectively. | 2 | 1 | 0 | primary alcohol; vitamin B1 | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| thymine [no description available] | 8.63 | 212 | 0 | pyrimidine nucleobase; pyrimidone | Escherichia coli metabolite; human metabolite; mouse metabolite |
| toluene methylbenzene : Any alkylbenzene that is benzene substituted with one or more methyl groups. | 3.41 | 7 | 0 | methylbenzene; toluenes; volatile organic compound | cholinergic antagonist; fuel additive; neurotoxin; non-polar solvent |
| uracil 2,4-dihydroxypyrimidine: a urinary biomarker for bipolar disorder | 7.12 | 111 | 0 | pyrimidine nucleobase; pyrimidone | allergen; Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; prodrug; Saccharomyces cerevisiae metabolite |
| urea pseudourea: clinical use; structure. isourea : A carboximidic acid that is the imidic acid tautomer of urea, H2NC(=NH)OH, and its hydrocarbyl derivatives. | 5.04 | 41 | 0 | isourea; monocarboxylic acid amide; one-carbon compound | Daphnia magna metabolite; Escherichia coli metabolite; fertilizer; flour treatment agent; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| vanillin Vanilla: A plant genus of the family ORCHIDACEAE that is the source of the familiar flavoring used in foods and medicines (FLAVORING AGENTS). | 2.02 | 1 | 0 | benzaldehydes; monomethoxybenzene; phenols | anti-inflammatory agent; anticonvulsant; antioxidant; flavouring agent; plant metabolite |
| xanthine 7H-xanthine : An oxopurine in which the purine ring is substituted by oxo groups at positions 2 and 6 and N-7 is protonated.. 9H-xanthine : An oxopurine in which the purine ring is substituted by oxo groups at positions 2 and 6 and N-9 is protonated. | 3.09 | 5 | 0 | xanthine | Saccharomyces cerevisiae metabolite |
| isocitric acid isocitric acid: RN given refers to unlabeled parent cpd. isocitric acid : A tricarboxylic acid that is propan-1-ol with a hydrogen at each of the 3 carbon positions replaced by a carboxy group. | 2.02 | 1 | 0 | secondary alcohol; tricarboxylic acid | fundamental metabolite |
| 2-amino-5-phosphonovalerate 2-Amino-5-phosphonovalerate: The D-enantiomer is a potent and specific antagonist of NMDA glutamate receptors (RECEPTORS, N-METHYL-D-ASPARTATE). The L form is inactive at NMDA receptors but may affect the AP4 (2-amino-4-phosphonobutyrate; APB) excitatory amino acid receptors. | 2.06 | 1 | 0 | non-proteinogenic alpha-amino acid | NMDA receptor antagonist |
| 3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid 3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid: structure given in first source; NMDA receptor antagonist | 2.05 | 1 | 0 | ||
| 1,10-phenanthroline 1,10-phenanthroline: RN given refers to parent cpd; inhibits Zn-dependent metalloproteinases | 3.95 | 13 | 0 | phenanthroline | EC 2.7.1.1 (hexokinase) inhibitor; EC 3.4.19.3 (pyroglutamyl-peptidase I) inhibitor |
| 1,2-dioctanoylglycerol 1,2-dioctanoylglycerol: functions as bioregulator of protein kinase C in human platelets | 1.97 | 1 | 0 | ||
| 1-anilino-8-naphthalenesulfonate 1-anilino-8-naphthalenesulfonate: RN given refers to parent cpd. 8-anilinonaphthalene-1-sulfonic acid : A naphthalenesulfonic acid that is naphthalene-1-sulfonic acid substituted by a phenylamino group at position 8. | 4.73 | 11 | 0 | aminonaphthalene; naphthalenesulfonic acid | fluorescent probe |
| 1-methylimidazole 1-methyl-1H-imidazole : A 1H-imidazole having a methyl substituent at the N-1 position. | 3.08 | 5 | 0 | imidazoles | |
| 2,2'-dipyridyl 2,2'-Dipyridyl: A reagent used for the determination of iron.. 2,2'-bipyridine : A bipyridine in which the two pyridine moieties are linked by a bond between positions C-2 and C-2'. | 4.42 | 21 | 0 | bipyridine | chelator; ferroptosis inhibitor |
| 2,4-dichlorophenoxyacetic acid 2,4-Dichlorophenoxyacetic Acid: An herbicide with irritant effects on the eye and the gastrointestinal system.. 2,4-D : A chlorophenoxyacetic acid that is phenoxyacetic acid in which the ring hydrogens at postions 2 and 4 are substituted by chlorines. | 2.42 | 2 | 0 | chlorophenoxyacetic acid; dichlorobenzene | agrochemical; defoliant; EC 1.1.1.25 (shikimate dehydrogenase) inhibitor; environmental contaminant; phenoxy herbicide; synthetic auxin |
| 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine: mutagen from fried ground beef; structure given in first source. PhIP : An imidazopyridine that is 1H--imidazo[4,5-b]pyridine which is substituted at positions 1, 2, and 6 by methyl, amino, and phenyl groups, respectively. It is the most abundant of the mutagenic heterocyclic amines found in cooked meat and fish. | 3.14 | 5 | 0 | imidazopyridine; primary amino compound | carcinogenic agent; mutagen |
| 2-aminofluorene [no description available] | 8.08 | 5 | 0 | ||
| mercaptoethanol Mercaptoethanol: A water-soluble thiol derived from hydrogen sulfide and ethanol. It is used as a reducing agent for disulfide bonds and to protect sulfhydryl groups from oxidation. | 4.05 | 15 | 0 | alkanethiol; primary alcohol | geroprotector |
| 3-aminobenzamide [no description available] | 1.98 | 1 | 0 | benzamides; substituted aniline | EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor |
| 3-methylcholanthrene Methylcholanthrene: A carcinogen that is often used in experimental cancer studies.. 3-methylcholanthrene : A pentacyclic ortho- and peri-fused polycyclic arene consisting of a dihydrocyclopenta[ij]tetraphene ring system with a methyl substituent at the 3-position. | 1.96 | 1 | 0 | ortho- and peri-fused polycyclic arene | aryl hydrocarbon receptor agonist; carcinogenic agent |
| 3-nitrobenzeneboronic acid [no description available] | 2.04 | 1 | 0 | ||
| 4-(2-aminoethyl)benzenesulfonylfluoride [no description available] | 2.04 | 1 | 0 | ||
| 4-aminopyridine [no description available] | 2.7 | 3 | 0 | aminopyridine; aromatic amine | avicide; orphan drug; potassium channel blocker |
| 5,5-dimethyl-1-pyrroline-1-oxide 5,5-dimethyl-1-pyrroline-1-oxide: do not confuse with DMPO (4',5'-dihydroxy-7-methoxy-4-phenyl-5,2'-oxidocoumarin). 5,5-dimethyl-1-pyrroline N-oxide : A member of the class of 1-pyrroline nitrones (1-pyrroline N-oxides) resulting from the formal N-oxidation of 5,5-dimethyl-1-pyrroline. Used as a spin trap for the study of radicals formed by enzymatic acetaldehyde oxidation. | 1.97 | 1 | 0 | 1-pyrroline nitrones | neuroprotective agent; spin trapping reagent |
| 6-nitroso-1,2-benzopyrone [no description available] | 1.97 | 1 | 0 | ||
| oxyquinoline Oxyquinoline: An antiseptic with mild fungistatic, bacteriostatic, anthelmintic, and amebicidal action. It is also used as a reagent and metal chelator, as a carrier for radio-indium for diagnostic purposes, and its halogenated derivatives are used in addition as topical anti-infective agents and oral antiamebics.. quinolin-8-ol : A monohydroxyquinoline that is quinoline substituted by a hydroxy group at position 8. Its fungicidal properties are used for the control of grey mould on vines and tomatoes. | 2.02 | 1 | 0 | monohydroxyquinoline | antibacterial agent; antifungal agrochemical; antiseptic drug; iron chelator |
| tacrine Tacrine: A cholinesterase inhibitor that crosses the blood-brain barrier. Tacrine has been used to counter the effects of muscle relaxants, as a respiratory stimulant, and in the treatment of Alzheimer's disease and other central nervous system disorders.. tacrine : A member of the class of acridines that is 1,2,3,4-tetrahydroacridine substituted by an amino group at position 9. It is used in the treatment of Alzheimer's disease. | 2.77 | 3 | 0 | acridines; aromatic amine | EC 3.1.1.7 (acetylcholinesterase) inhibitor |
| acetaminophen Acetaminophen: Analgesic antipyretic derivative of acetanilide. It has weak anti-inflammatory properties and is used as a common analgesic, but may cause liver, blood cell, and kidney damage.. paracetamol : A member of the class of phenols that is 4-aminophenol in which one of the hydrogens attached to the amino group has been replaced by an acetyl group. | 6.98 | 1 | 0 | acetamides; phenols | antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; cyclooxygenase 3 inhibitor; environmental contaminant; ferroptosis inducer; geroprotector; hepatotoxic agent; human blood serum metabolite; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic |
| salophen salophen: structure given in first source | 2.07 | 1 | 0 | carbonyl compound | |
| acetazolamide Acetazolamide: One of the CARBONIC ANHYDRASE INHIBITORS that is sometimes effective against absence seizures. It is sometimes useful also as an adjunct in the treatment of tonic-clonic, myoclonic, and atonic seizures, particularly in women whose seizures occur or are exacerbated at specific times in the menstrual cycle. However, its usefulness is transient often because of rapid development of tolerance. Its antiepileptic effect may be due to its inhibitory effect on brain carbonic anhydrase, which leads to an increased transneuronal chloride gradient, increased chloride current, and increased inhibition. (From Smith and Reynard, Textbook of Pharmacology, 1991, p337) | 2.54 | 2 | 0 | monocarboxylic acid amide; sulfonamide; thiadiazoles | anticonvulsant; diuretic; EC 4.2.1.1 (carbonic anhydrase) inhibitor |
| alpha-cyano-4-hydroxycinnamate alpha-cyano-4-hydroxycinnamate: specific inhibitor of pyruvate transport in rat liver mitochondria & human erythrocytes; structure | 2 | 1 | 0 | ||
| ametantrone ametantrone: RN given refers to parent cpd; structure | 2 | 1 | 0 | ||
| theophylline [no description available] | 3.43 | 7 | 0 | dimethylxanthine | adenosine receptor antagonist; anti-asthmatic drug; anti-inflammatory agent; bronchodilator agent; drug metabolite; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; fungal metabolite; human blood serum metabolite; immunomodulator; muscle relaxant; vasodilator agent |
| amsacrine Amsacrine: An aminoacridine derivative that intercalates into DNA and is used as an antineoplastic agent.. amsacrine : A sulfonamide that is N-phenylmethanesulfonamide substituted by a methoxy group at position 3 and an acridin-9-ylamino group at position 4. It exhibits antineoplastic activity. | 2.39 | 2 | 0 | acridines; aromatic ether; sulfonamide | antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor |
| antipyrine Antipyrine: An analgesic and antipyretic that has been given by mouth and as ear drops. Antipyrine is often used in testing the effects of other drugs or diseases on drug-metabolizing enzymes in the liver. (From Martindale, The Extra Pharmacopoeia, 30th ed, p29). antipyrine : A pyrazolone derivative that is 1,2-dihydropyrazol-3-one substituted with methyl groups at N-1 and C-5 and with a phenyl group at N-2. | 2.25 | 1 | 0 | pyrazolone | antipyretic; cyclooxygenase 3 inhibitor; environmental contaminant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic |
| aristolochic acid i aristolochic acid I: phospholipase A inhibitor. aristolochic acid A : An aristolochic acid that is phenanthrene-1-carboxylic acid that is substituted by a methylenedioxy group at the 3,4 positions, by a methoxy group at position 8, and by a nitro group at position 10. It is the most abundant of the aristolochic acids and is found in almost all Aristolochia (birthworts or pipevines) species. It has been tried in a number of treatments for inflammatory disorders, mainly in Chinese and folk medicine. However, there is concern over their use as aristolochic acid is both carcinogenic and nephrotoxic. | 2.41 | 2 | 0 | aristolochic acids; aromatic ether; C-nitro compound; cyclic acetal; monocarboxylic acid; organic heterotetracyclic compound | carcinogenic agent; metabolite; mutagen; nephrotoxin; toxin |
| aspirin Aspirin: The prototypical analgesic used in the treatment of mild to moderate pain. It has anti-inflammatory and antipyretic properties and acts as an inhibitor of cyclooxygenase which results in the inhibition of the biosynthesis of prostaglandins. Aspirin also inhibits platelet aggregation and is used in the prevention of arterial and venous thrombosis. (From Martindale, The Extra Pharmacopoeia, 30th ed, p5). acetylsalicylate : A benzoate that is the conjugate base of acetylsalicylic acid, arising from deprotonation of the carboxy group.. acetylsalicylic acid : A member of the class of benzoic acids that is salicylic acid in which the hydrogen that is attached to the phenolic hydroxy group has been replaced by an acetoxy group. A non-steroidal anti-inflammatory drug with cyclooxygenase inhibitor activity. | 5.76 | 3 | 1 | benzoic acids; phenyl acetates; salicylates | anticoagulant; antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; drug allergen; EC 1.1.1.188 (prostaglandin-F synthase) inhibitor; geroprotector; non-narcotic analgesic; non-steroidal anti-inflammatory drug; plant activator; platelet aggregation inhibitor; prostaglandin antagonist; teratogenic agent |
| atenolol Atenolol: A cardioselective beta-1 adrenergic blocker possessing properties and potency similar to PROPRANOLOL, but without a negative inotropic effect.. atenolol : An ethanolamine compound having a (4-carbamoylmethylphenoxy)methyl group at the 1-position and an N-isopropyl substituent. | 2.01 | 1 | 0 | ethanolamines; monocarboxylic acid amide; propanolamine | anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; environmental contaminant; sympatholytic agent; xenobiotic |
| atrazine [no description available] | 2.96 | 4 | 0 | chloro-1,3,5-triazine; diamino-1,3,5-triazine | environmental contaminant; herbicide; xenobiotic |
| aurintricarboxylic acid Aurintricarboxylic Acid: A dye which inhibits protein biosynthesis at the initial stages. The ammonium salt (aluminon) is a reagent for the colorimetric estimation of aluminum in water, foods, and tissues.. aurintricarboxylic acid : A member of the class of quinomethanes that is 3-methylidene-6-oxocyclohexa-1,4-diene-1-carboxylic acid in which the methylidene hydrogens are replaced by 4-carboxy-3-hydroxyphenyl groups. The trisodium salt is the biological stain 'chrome violet CG' while the triammonium salt is 'aluminon'. | 2.44 | 2 | 0 | monohydroxybenzoic acid; quinomethanes; tricarboxylic acid | fluorochrome; histological dye; insulin-like growth factor receptor 1 antagonist |
| azathioprine Azathioprine: An immunosuppressive agent used in combination with cyclophosphamide and hydroxychloroquine in the treatment of rheumatoid arthritis. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), this substance has been listed as a known carcinogen. (Merck Index, 11th ed). azathioprine : A thiopurine that is 6-mercaptopurine in which the mercapto hydrogen is replaced by a 1-methyl-4-nitroimidazol-5-yl group. It is a prodrug for mercaptopurine and is used as an immunosuppressant, prescribed for the treatment of inflammatory conditions and after organ transplantation and also for treatment of Crohn's didease and MS. | 3.14 | 1 | 0 | aryl sulfide; C-nitro compound; imidazoles; thiopurine | antimetabolite; antineoplastic agent; carcinogenic agent; DNA synthesis inhibitor; hepatotoxic agent; immunosuppressive agent; prodrug |
| azelastine azelastine: azeptin is azelastine hydrochloride; structure; eye drop formulation effective in relieving symptoms of allergic conjunctivitis; do not confuse with 5-loxin which is an extract of Boswellia. azelastine : A phthalazine compound having an oxo substituent at the 1-position, a 1-methylazepan-4-yl group at the 2-position and a 4-chlorobenzyl substituent at the 4-position. | 2.03 | 1 | 0 | monochlorobenzenes; phthalazines; tertiary amino compound | anti-allergic agent; anti-asthmatic drug; bronchodilator agent; EC 1.13.11.34 (arachidonate 5-lipoxygenase) inhibitor; H1-receptor antagonist; platelet aggregation inhibitor |
| azobenzene azobenzene: photosensor molecule known to undergo reversible isomerization from trans to cis on illumination with photons of appropriate wavelength; RN given refers to cpd without isomeric designation; structure. (E)-azobenzene : The (E)-isomer of azobenzene.. (Z)-azobenzene : The (Z)-isomer of azobenzene.. azobenzene : A molecule whose structure comprises two phenyl rings linked by a N=N double bond; the parent compound of the azobenzene class of compounds. | 5.63 | 22 | 0 | azobenzenes | |
| benzamidine benzamidine: RN given refers to parent cpd. benzamidine : A carboxamidine that is benzene carrying an amidino group. | 2.04 | 1 | 0 | benzenes; carboxamidine | serine protease inhibitor |
| benzo(a)pyrene Benzo(a)pyrene: A potent mutagen and carcinogen. It is a public health concern because of its possible effects on industrial workers, as an environmental pollutant, an as a component of tobacco smoke.. benzo[a]pyrene : An ortho- and peri-fused polycyclic arene consisting of five fused benzene rings. | 4.37 | 20 | 0 | ortho- and peri-fused polycyclic arene | carcinogenic agent; mouse metabolite |
| benzothiazide benzothiazide: structure. benzthiazide : 7-Sulfamoyl-1,2,4-benzothiadiazine 1,1-dioxide in which the hydrogen at position 6 is substituted by chlorine and that at position 3 is substituted by a benzylsulfanylmethyl group. A diuretic, it is used to treat hypertension and edema. | 2.95 | 4 | 0 | benzothiadiazine; sulfonamide | antihypertensive agent; diuretic |
| berberine [no description available] | 2.01 | 1 | 0 | alkaloid antibiotic; berberine alkaloid; botanical anti-fungal agent; organic heteropentacyclic compound | antilipemic drug; antineoplastic agent; antioxidant; EC 1.1.1.141 [15-hydroxyprostaglandin dehydrogenase (NAD(+))] inhibitor; EC 1.1.1.21 (aldehyde reductase) inhibitor; EC 1.13.11.52 (indoleamine 2,3-dioxygenase) inhibitor; EC 1.21.3.3 (reticuline oxidase) inhibitor; EC 2.1.1.116 [3'-hydroxy-N-methyl-(S)-coclaurine 4'-O-methyltransferase] inhibitor; EC 2.1.1.122 [(S)-tetrahydroprotoberberine N-methyltransferase] inhibitor; EC 2.7.11.10 (IkappaB kinase) inhibitor; EC 3.1.1.4 (phospholipase A2) inhibitor; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; EC 3.1.3.48 (protein-tyrosine-phosphatase) inhibitor; EC 3.4.14.5 (dipeptidyl-peptidase IV) inhibitor; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; geroprotector; hypoglycemic agent; metabolite; potassium channel blocker |
| diminazene Diminazene: An effective trypanocidal agent.. diminazene : A triazene derivative that is triazene in which each of the terminal nitrogens is substituted by a 4-carbamimidoylphenyl group. | 2.39 | 2 | 0 | carboxamidine; triazene derivative | antiparasitic agent; trypanocidal drug |
| beta-naphthoflavone beta-Naphthoflavone: A polyaromatic hydrocarbon inducer of P4501A1 and P4501A2 cytochromes. (Proc Soc Exp Biol Med 1994 Dec:207(3):302-308). beta-naphthoflavone : An extended flavonoid resulting from the formal fusion of a benzene ring with the f side of flavone. | 2.4 | 2 | 0 | extended flavonoid; naphtho-gamma-pyrone; organic heterotricyclic compound | aryl hydrocarbon receptor agonist |
| betaxolol [no description available] | 7.03 | 1 | 0 | propanolamine | antihypertensive agent; beta-adrenergic antagonist; sympatholytic agent |
| bisbenzimidazole Bisbenzimidazole: A benzimidazole antifilarial agent; it is fluorescent when it binds to certain nucleotides in DNA, thus providing a tool for the study of DNA replication; it also interferes with mitosis. | 5.3 | 17 | 0 | bibenzimidazole; N-methylpiperazine | anthelminthic drug; fluorochrome |
| bisindolylmaleimide i bisindolylmaleimide I: a bis(indolyl)maleimide | 2.93 | 4 | 0 | ||
| cacodylic acid dimethylarsinic acid : The organoarsenic compound that is arsenic acid substituted on the central arsenic atom with two methyl groups. | 2.68 | 3 | 0 | organoarsenic compound | xenobiotic metabolite |
| caffeine [no description available] | 3.52 | 8 | 0 | purine alkaloid; trimethylxanthine | adenosine A2A receptor antagonist; adenosine receptor antagonist; adjuvant; central nervous system stimulant; diuretic; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; environmental contaminant; food additive; fungal metabolite; geroprotector; human blood serum metabolite; mouse metabolite; mutagen; plant metabolite; psychotropic drug; ryanodine receptor agonist; xenobiotic |
| camphor, (+-)-isomer [no description available] | 2.41 | 1 | 0 | bornane monoterpenoid; cyclic monoterpene ketone | plant metabolite |
| carbamazepine Carbamazepine: A dibenzazepine that acts as a sodium channel blocker. It is used as an anticonvulsant for the treatment of grand mal and psychomotor or focal SEIZURES. It may also be used in the management of BIPOLAR DISORDER, and has analgesic properties.. carbamazepine : A dibenzoazepine that is 5H-dibenzo[b,f]azepine carrying a carbamoyl substituent at the azepine nitrogen, used as an anticonvulsant. | 2.15 | 1 | 0 | dibenzoazepine; ureas | analgesic; anticonvulsant; antimanic drug; drug allergen; EC 3.5.1.98 (histone deacetylase) inhibitor; environmental contaminant; glutamate transporter activator; mitogen; non-narcotic analgesic; sodium channel blocker; xenobiotic |
| carmustine Carmustine: A cell-cycle phase nonspecific alkylating antineoplastic agent. It is used in the treatment of brain tumors and various other malignant neoplasms. (From Martindale, The Extra Pharmacopoeia, 30th ed, p462) This substance may reasonably be anticipated to be a carcinogen according to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985). (From Merck Index, 11th ed). carmustine : A member of the class of N-nitrosoureas that is 1,3-bis(2-chloroethyl)urea in which one of the nitrogens is substituted by a nitroso group. | 3.25 | 6 | 0 | N-nitrosoureas; organochlorine compound | alkylating agent; antineoplastic agent |
| carvedilol [no description available] | 2.17 | 1 | 0 | carbazoles; secondary alcohol; secondary amino compound | alpha-adrenergic antagonist; antihypertensive agent; beta-adrenergic antagonist; cardiovascular drug; vasodilator agent |
| celecoxib [no description available] | 7.45 | 2 | 0 | organofluorine compound; pyrazoles; sulfonamide; toluenes | cyclooxygenase 2 inhibitor; geroprotector; non-narcotic analgesic; non-steroidal anti-inflammatory drug |
| cetyltrimethylammonium ion Cetrimonium: Cetyltrimethylammonium compound whose salts and derivatives are used primarily as topical antiseptics.. cetyltrimethylammonium ion : A quaternary ammonium ion in which the substituents on nitrogen are one hexadecyl and three methyl groups. | 3.65 | 9 | 0 | quaternary ammonium ion | |
| cetylpyridinium Cetylpyridinium: Cationic bactericidal surfactant used as a topical antiseptic for skin, wounds, mucous membranes, instruments, etc.; and also as a component in mouthwash and lozenges. | 7.43 | 2 | 0 | pyridinium ion | |
| chelerythrine chelerythrine : A benzophenanthridine alkaloid isolated from the root of Zanthoxylum simulans, Chelidonium majus L., and other Papaveraceae. | 2.44 | 2 | 0 | benzophenanthridine alkaloid; organic cation | antibacterial agent; antineoplastic agent; EC 2.7.11.13 (protein kinase C) inhibitor |
| chloral hydrate [no description available] | 2.02 | 1 | 0 | aldehyde hydrate; ethanediol; organochlorine compound | general anaesthetic; mouse metabolite; sedative; xenobiotic |
| chlorambucil Chlorambucil: A nitrogen mustard alkylating agent used as antineoplastic for chronic lymphocytic leukemia, Hodgkin's disease, and others. Although it is less toxic than most other nitrogen mustards, it has been listed as a known carcinogen in the Fourth Annual Report on Carcinogens (NTP 85-002, 1985). (Merck Index, 11th ed). chlorambucil : A monocarboxylic acid that is butanoic acid substituted at position 4 by a 4-[bis(2-chloroethyl)amino]phenyl group. A chemotherapy drug that can be used in combination with the antibody obinutuzumab for the treatment of chronic lymphocytic leukemia. | 2.05 | 1 | 0 | aromatic amine; monocarboxylic acid; nitrogen mustard; organochlorine compound; tertiary amino compound | alkylating agent; antineoplastic agent; carcinogenic agent; drug allergen; immunosuppressive agent |
| chloroquine Chloroquine: The prototypical antimalarial agent with a mechanism that is not well understood. It has also been used to treat rheumatoid arthritis, systemic lupus erythematosus, and in the systemic therapy of amebic liver abscesses.. chloroquine : An aminoquinoline that is quinoline which is substituted at position 4 by a [5-(diethylamino)pentan-2-yl]amino group at at position 7 by chlorine. It is used for the treatment of malaria, hepatic amoebiasis, lupus erythematosus, light-sensitive skin eruptions, and rheumatoid arthritis. | 4.03 | 14 | 0 | aminoquinoline; organochlorine compound; secondary amino compound; tertiary amino compound | anticoronaviral agent; antimalarial; antirheumatic drug; autophagy inhibitor; dermatologic drug |
| chlorpyrifos Chlorpyrifos: An organothiophosphate cholinesterase inhibitor that is used as an insecticide and as an acaricide.. chlorpyrifos : An organic thiophosphate that is O,O-diethyl hydrogen phosphorothioate in which the hydrogen of the hydroxy group has been replaced by a 3,5,6-trichloropyridin-2-yl group. | 2.25 | 1 | 0 | chloropyridine; organic thiophosphate | acaricide; agrochemical; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; environmental contaminant; insecticide; xenobiotic |
| ciglitazone ciglitazone: structure given in second source; PPAR agonist used for type II diabetes. ciglitazone : An aromatic ether that consists of 1,3-thiazolidine-2,4-dione with position 5 substituted by a 4-[(1-methylcyclohexyl)methoxy]benzyl group. A selective PPARgamma agonist. | 2.01 | 1 | 0 | aromatic ether; thiazolidinone | antineoplastic agent; insulin-sensitizing drug |
| cimetidine Cimetidine: A histamine congener, it competitively inhibits HISTAMINE binding to HISTAMINE H2 RECEPTORS. Cimetidine has a range of pharmacological actions. It inhibits GASTRIC ACID secretion, as well as PEPSIN and GASTRIN output.. cimetidine : A member of the class of guanidines that consists of guanidine carrying a methyl substituent at position 1, a cyano group at position 2 and a 2-{[(5-methyl-1H-imidazol-4-yl)methyl]sulfanyl}ethyl group at position 3. It is a H2-receptor antagonist that inhibits the production of acid in stomach. | 1.99 | 1 | 0 | aliphatic sulfide; guanidines; imidazoles; nitrile | adjuvant; analgesic; anti-ulcer drug; H2-receptor antagonist; P450 inhibitor |
| ciprofloxacin Ciprofloxacin: A broad-spectrum antimicrobial carboxyfluoroquinoline.. ciprofloxacin : A quinolone that is quinolin-4(1H)-one bearing cyclopropyl, carboxylic acid, fluoro and piperazin-1-yl substituents at positions 1, 3, 6 and 7, respectively. | 2.94 | 4 | 0 | aminoquinoline; cyclopropanes; fluoroquinolone antibiotic; N-arylpiperazine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone; zwitterion | antibacterial drug; antiinfective agent; antimicrobial agent; DNA synthesis inhibitor; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; environmental contaminant; topoisomerase IV inhibitor; xenobiotic |
| clonidine Clonidine: An imidazoline sympatholytic agent that stimulates ALPHA-2 ADRENERGIC RECEPTORS and central IMIDAZOLINE RECEPTORS. It is commonly used in the management of HYPERTENSION.. clonidine (amino form) : A clonidine that is 4,5-dihydro-1H-imidazol-2-amine in which one of the amino hydrogens is replaced by a 2,6-dichlorophenyl group. | 1.97 | 1 | 0 | clonidine; imidazoline | |
| conduritol epoxide conduritol epoxide: conduritol C epoxide refers to the (epi & neo)-isomers; structure. conduritol epoxide : An epoxide resulting from the epoxidation of the double bond of a conduritol. | 1.97 | 1 | 0 | cyclitol; epoxide; tetrol | |
| coumaphos Coumaphos: A organothiophosphorus cholinesterase inhibitor that is used as an anthelmintic, insecticide, and as a nematocide. | 2.07 | 1 | 0 | organic thiophosphate; organochlorine compound; organothiophosphate insecticide | acaricide; agrochemical; antinematodal drug; avicide; EC 3.1.1.8 (cholinesterase) inhibitor |
| cystamine [no description available] | 2.91 | 4 | 0 | organic disulfide; primary amino compound | EC 2.3.2.13 (protein-glutamine gamma-glutamyltransferase) inhibitor |
| dapi DAPI: RN given refers to parent cpd. | 3.51 | 8 | 0 | indoles | fluorochrome |
| deferoxamine Deferoxamine: Natural product isolated from Streptomyces pilosus. It forms iron complexes and is used as a chelating agent, particularly in the mesylate form.. desferrioxamine B : An acyclic desferrioxamine that is butanedioic acid in which one of the carboxy groups undergoes formal condensation with the primary amino group of N-(5-aminopentyl)-N-hydroxyacetamide and the second carboxy group undergoes formal condensation with the hydroxyamino group of N(1)-(5-aminopentyl)-N(1)-hydroxy-N(4)-[5-(hydroxyamino)pentyl]butanediamide. It is a siderophore native to Streptomyces pilosus biosynthesised by the DesABCD enzyme cluster as a high affinity Fe(III) chelator. | 3.12 | 5 | 0 | acyclic desferrioxamine | bacterial metabolite; ferroptosis inhibitor; iron chelator; siderophore |
| dequalinium Dequalinium: A topical bacteriostat that is available as various salts. It is used in wound dressings and mouth infections and may also have antifungal action, but may cause skin ulceration.. dequalinium : A quinolinium ion comprising decane in which one methyl hydrogen at each end of the molecule has been replaced by a 4-amino-2-methylquinolin-1-yl group. | 2.44 | 2 | 0 | quinolinium ion | antifungal agent; antineoplastic agent; antiseptic drug; mitochondrial NADH:ubiquinone reductase inhibitor |
| amphetamine Amphetamine: A powerful central nervous system stimulant and sympathomimetic. Amphetamine has multiple mechanisms of action including blocking uptake of adrenergics and dopamine, stimulation of release of monamines, and inhibiting monoamine oxidase. Amphetamine is also a drug of abuse and a psychotomimetic. The l- and the d,l-forms are included here. The l-form has less central nervous system activity but stronger cardiovascular effects. The d-form is DEXTROAMPHETAMINE.. 1-phenylpropan-2-amine : A primary amine that is isopropylamine in which a hydrogen attached to one of the methyl groups has been replaced by a phenyl group.. amphetamine : A racemate comprising equimolar amounts of (R)-amphetamine (also known as levamphetamine or levoamphetamine) and (S)-amphetamine (also known as dexamfetamine or dextroamphetamine. | 1.99 | 1 | 0 | primary amine | |
| diethyl pyrocarbonate Diethyl Pyrocarbonate: Preservative for wines, soft drinks, and fruit juices and a gentle esterifying agent.. diethyl pyrocarbonate : The diethyl ester of dicarbonic acid. | 3.48 | 8 | 0 | acyclic carboxylic anhydride | |
| diethylcarbamazine Diethylcarbamazine: An anthelmintic used primarily as the citrate in the treatment of filariasis, particularly infestations with Wucheria bancrofti or Loa loa. | 2.02 | 1 | 0 | N-carbamoylpiperazine; N-methylpiperazine | |
| pentetic acid Pentetic Acid: An iron chelating agent with properties like EDETIC ACID. DTPA has also been used as a chelator for other metals, such as plutonium. | 4.63 | 8 | 0 | pentacarboxylic acid | copper chelator |
| diflunisal Diflunisal: A salicylate derivative and anti-inflammatory analgesic with actions and side effects similar to those of ASPIRIN.. diflunisal : An organofluorine compound comprising salicylic acid having a 2,4-difluorophenyl group at the 5-position. | 6.67 | 5 | 0 | monohydroxybenzoic acid; organofluorine compound | non-narcotic analgesic; non-steroidal anti-inflammatory drug |
| 3,3'-diindolylmethane 3,3'-diindolylmethane: anti-inflammatory from edible cruciferous vegetables; a cytochrome P-450 antagonist | 2.08 | 1 | 0 | indoles | antineoplastic agent; P450 inhibitor |
| diphenhydramine Diphenhydramine: A histamine H1 antagonist used as an antiemetic, antitussive, for dermatoses and pruritus, for hypersensitivity reactions, as a hypnotic, an antiparkinson, and as an ingredient in common cold preparations. It has some undesired antimuscarinic and sedative effects.. diphenhydramine : An ether that is the benzhydryl ether of 2-(dimethylamino)ethanol. It is a H1-receptor antagonist used as a antipruritic and antitussive drug.. antitussive : An agent that suppresses cough. Antitussives have a central or a peripheral action on the cough reflex, or a combination of both. Compare with expectorants, which are considered to increase the volume of secretions in the respiratory tract, so facilitating their removal by ciliary action and coughing, and mucolytics, which decrease the viscosity of mucus, facilitating its removal by ciliary action and expectoration. | 3.47 | 1 | 1 | ether; tertiary amino compound | anti-allergic agent; antidyskinesia agent; antiemetic; antiparkinson drug; antipruritic drug; antitussive; H1-receptor antagonist; local anaesthetic; muscarinic antagonist; oneirogen; sedative |
| diphenyleneiodonium diphenyleneiodonium: structure in first source; NADPH oxidase inhibitor. dibenziodolium : An organic cation that is fluorene in which the methylene group is replaced by a positively charged iodine. | 2.41 | 2 | 0 | organic cation | |
| benzophenone benzophenone : The simplest member of the class of benzophenones, being formaldehyde in which both hydrogens are replaced by phenyl groups. | 2.42 | 2 | 0 | benzophenones | photosensitizing agent; plant metabolite |
| stallimycin [no description available] | 4.97 | 12 | 0 | ||
| valproic acid Valproic Acid: A fatty acid with anticonvulsant and anti-manic properties that is used in the treatment of EPILEPSY and BIPOLAR DISORDER. The mechanisms of its therapeutic actions are not well understood. It may act by increasing GAMMA-AMINOBUTYRIC ACID levels in the brain or by altering the properties of VOLTAGE-GATED SODIUM CHANNELS.. valproic acid : A branched-chain saturated fatty acid that comprises of a propyl substituent on a pentanoic acid stem. | 3.88 | 3 | 0 | branched-chain fatty acid; branched-chain saturated fatty acid | anticonvulsant; antimanic drug; EC 3.5.1.98 (histone deacetylase) inhibitor; GABA agent; neuroprotective agent; psychotropic drug; teratogenic agent |
| thiorphan Thiorphan: A potent inhibitor of membrane metalloendopeptidase (ENKEPHALINASE). Thiorphan potentiates morphine-induced ANALGESIA and attenuates naloxone-precipitated withdrawal symptoms. | 2.04 | 1 | 0 | N-acyl-amino acid | |
| dup 697 DuP 697: structure given in first source | 2.13 | 1 | 0 | thiophenes | |
| ellipticine ellipticine : A organic heterotetracyclic compound that is pyrido[4,3-b]carbazole carrying two methyl substituents at positions 5 and 11. | 3.39 | 7 | 0 | indole alkaloid; organic heterotetracyclic compound; organonitrogen heterocyclic compound; polycyclic heteroarene | antineoplastic agent; plant metabolite |
| epinastine epinastine: RN given refers parent cpd. epinastine : A benzazepine that is 6,11-dihydro-5H-dibenzo[b,e]azepine in which the azepine ring is fused to the e side of 4,5-dihydro-1H-imidazol-2-amine. | 2.03 | 1 | 0 | benzazepine; guanidines | anti-allergic agent; H1-receptor antagonist; histamine antagonist; ophthalmology drug |
| erythrosine Fluoresceins: A family of spiro(isobenzofuran-1(3H),9'-(9H)xanthen)-3-one derivatives. These are used as dyes, as indicators for various metals, and as fluorescent labels in immunoassays. | 6.77 | 77 | 0 | ||
| eicosapentaenoic acid ethyl ester [no description available] | 3.64 | 2 | 0 | ||
| ethylenediamine ethylenediamine: RN given refers to parent cpd; edamine is the recommended contraction for the ethylenediamine radical. ethylenediamine : An alkane-alpha,omega-diamine in which the alkane is ethane. | 3.38 | 7 | 0 | alkane-alpha,omega-diamine | GABA agonist |
| brl 42810 [no description available] | 3.12 | 1 | 0 | 2-aminopurines; acetate ester | antiviral drug; prodrug |
| fipronil fipronil: has low mammalian toxicity; structure given in first source. fipronil : A racemate comprising equimolar amounts of (R)- and (S)-fipronil.. 5-amino-1-[2,6-dichloro-4-(trifluoromethyl)phenyl]-4-[(trifluoromethyl)sulfinyl]-1H-pyrazole-3-carbonitrile : A member of the class of pyrazoles that is 1H-pyrazole that is substituted at positions 1, 3, 4, and 5 by 2,6-dichloro-4-(trifluoromethyl)phenyl, cyano, (trifluoromethyl)sulfinyl, and amino groups, respectively. | 2.6 | 1 | 0 | (trifluoromethyl)benzenes; dichlorobenzene; nitrile; primary amino compound; pyrazoles; sulfoxide | |
| flucytosine Flucytosine: A fluorinated cytosine analog that is used as an antifungal agent.. flucytosine : An organofluorine compound that is cytosine that is substituted at position 5 by a fluorine. A prodrug for the antifungal 5-fluorouracil, it is used for the treatment of systemic fungal infections. | 2.71 | 3 | 0 | aminopyrimidine; nucleoside analogue; organofluorine compound; pyrimidine antifungal drug; pyrimidone | prodrug |
| flumazenil Flumazenil: A potent benzodiazepine receptor antagonist. Since it reverses the sedative and other actions of benzodiazepines, it has been suggested as an antidote to benzodiazepine overdoses.. flumazenil : An organic heterotricyclic compound that is 5,6-dihydro-4H-imidazo[1,5-a][1,4]benzodiazepine which is substituted at positions 3, 5, 6, and 8 by ethoxycarbonyl, methyl, oxo, and fluoro groups, respectively. It is used as an antidote to benzodiazepine overdose. | 1.98 | 1 | 0 | ethyl ester; imidazobenzodiazepine; organofluorine compound | antidote to benzodiazepine poisoning; GABA antagonist |
| fluorouracil Fluorouracil: A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the THYMIDYLATE SYNTHETASE conversion of deoxyuridylic acid to thymidylic acid.. 5-fluorouracil : A nucleobase analogue that is uracil in which the hydrogen at position 5 is replaced by fluorine. It is an antineoplastic agent which acts as an antimetabolite - following conversion to the active deoxynucleotide, it inhibits DNA synthesis (by blocking the conversion of deoxyuridylic acid to thymidylic acid by the cellular enzyme thymidylate synthetase) and so slows tumour growth. | 9.43 | 20 | 4 | nucleobase analogue; organofluorine compound | antimetabolite; antineoplastic agent; environmental contaminant; immunosuppressive agent; radiosensitizing agent; xenobiotic |
| flutamide Flutamide: An antiandrogen with about the same potency as cyproterone in rodent and canine species. | 2.05 | 1 | 0 | (trifluoromethyl)benzenes; monocarboxylic acid amide | androgen antagonist; antineoplastic agent |
| foscarnet Foscarnet: An antiviral agent used in the treatment of cytomegalovirus retinitis. Foscarnet also shows activity against human herpesviruses and HIV.. phosphonoformic acid : Phosphoric acid in which one of the hydroxy groups is replaced by a carboxylic acid group. It is used as the trisodium salt as an antiviral agent in the treatment of cytomegalovirus retinitis (CMV retinitis, an inflamation of the retina that can lead to blindness) and as an alternative to ganciclovir for AIDS patients who require concurrent antiretroviral therapy but are unable to tolerate ganciclovir due to haematological toxicity. | 3.58 | 2 | 0 | carboxylic acid; one-carbon compound; phosphonic acids | antiviral drug; geroprotector; HIV-1 reverse transcriptase inhibitor; sodium-dependent Pi-transporter inhibitor |
| furosemide Furosemide: A benzoic-sulfonamide-furan. It is a diuretic with fast onset and short duration that is used for EDEMA and chronic RENAL INSUFFICIENCY.. furosemide : A chlorobenzoic acid that is 4-chlorobenzoic acid substituted by a (furan-2-ylmethyl)amino and a sulfamoyl group at position 2 and 5 respectively. It is a diuretic used in the treatment of congestive heart failure. | 2.41 | 1 | 0 | chlorobenzoic acid; furans; sulfonamide | environmental contaminant; loop diuretic; xenobiotic |
| gentamicin Gentamicins: A complex of closely related aminoglycosides obtained from MICROMONOSPORA purpurea and related species. They are broad-spectrum antibiotics, but may cause ear and kidney damage. They act to inhibit PROTEIN BIOSYNTHESIS. | 3.41 | 7 | 0 | ||
| 2,5-dihydroxybenzoic acid 2,5-dihydroxybenzoic acid: RN given refers to parent cpd; a oxidative product of saligenin. 2,5-dihydroxybenzoic acid : A dihydroxybenzoic acid having the two hydroxy groups at the 2- and 5-positions. | 2 | 1 | 0 | dihydroxybenzoic acid | EC 1.13.11.33 (arachidonate 15-lipoxygenase) inhibitor; fungal metabolite; human metabolite; MALDI matrix material; mouse metabolite |
| glutaral Glutaral: One of the protein CROSS-LINKING REAGENTS that is used as a disinfectant for sterilization of heat-sensitive equipment and as a laboratory reagent, especially as a fixative.. glutaraldehyde : A dialdehyde comprised of pentane with aldehyde functions at C-1 and C-5. | 3.6 | 9 | 0 | dialdehyde | cross-linking reagent; disinfectant; fixative |
| glyphosate glyphosate: active cpd in herbicidal formulation Roundup; inhibits EC 2.5.1.19, 5-enolpyruvylshikimate-3-phosphate synthase; structure. glyphosate : A phosphonic acid resulting from the formal oxidative coupling of the methyl group of methylphosphonic acid with the amino group of glycine. It is one of the most commonly used herbicides worldwide, and the only one to target the enzyme 5-enolpyruvyl-3-shikimate phosphate synthase (EPSPS). | 2.52 | 2 | 0 | glycine derivative; phosphonic acid | agrochemical; EC 2.5.1.19 (3-phosphoshikimate 1-carboxyvinyltransferase) inhibitor; herbicide |
| gossypol Gossypol: A dimeric sesquiterpene found in cottonseed (GOSSYPIUM). The (-) isomer is active as a male contraceptive (CONTRACEPTIVE AGENTS, MALE) whereas toxic symptoms are associated with the (+) isomer. | 1.98 | 1 | 0 | ||
| guaifenesin Guaifenesin: An expectorant that also has some muscle relaxing action. It is used in many cough preparations. | 2.15 | 1 | 0 | methoxybenzenes | |
| guanidine Guanidine: A strong organic base existing primarily as guanidium ions at physiological pH. It is found in the urine as a normal product of protein metabolism. It is also used in laboratory research as a protein denaturant. (From Martindale, the Extra Pharmacopoeia, 30th ed and Merck Index, 12th ed) It is also used in the treatment of myasthenia and as a fluorescent probe in HPLC.. guanidine : An aminocarboxamidine, the parent compound of the guanidines. | 5.82 | 28 | 0 | carboxamidine; guanidines; one-carbon compound | |
| n-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide [no description available] | 1.97 | 1 | 0 | isoquinolines; sulfonamide | |
| 1-(5-isoquinolinesulfonyl)-2-methylpiperazine 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine: A specific protein kinase C inhibitor, which inhibits superoxide release from human neutrophils (PMN) stimulated with phorbol myristate acetate or synthetic diacylglycerol.. 1-(5-isoquinolinesulfonyl)-2-methylpiperazine : A member of the class of N-sulfonylpiperazines that is 2-methylpiperazine substituted at position 1 by a 5-isoquinolinesulfonyl group. | 2.4 | 2 | 0 | isoquinolines; N-sulfonylpiperazine | EC 2.7.11.13 (protein kinase C) inhibitor |
| ha 1004 N-(2-guanidinoethyl)-5-isoquinolinesulfonamide: structure given in first source | 2.02 | 1 | 0 | isoquinolines | |
| haloperidol Haloperidol: A phenyl-piperidinyl-butyrophenone that is used primarily to treat SCHIZOPHRENIA and other PSYCHOSES. It is also used in schizoaffective disorder, DELUSIONAL DISORDERS, ballism, and TOURETTE SYNDROME (a drug of choice) and occasionally as adjunctive therapy in INTELLECTUAL DISABILITY and the chorea of HUNTINGTON DISEASE. It is a potent antiemetic and is used in the treatment of intractable HICCUPS. (From AMA Drug Evaluations Annual, 1994, p279). haloperidol : A compound composed of a central piperidine structure with hydroxy and p-chlorophenyl substituents at position 4 and an N-linked p-fluorobutyrophenone moiety. | 3.61 | 9 | 0 | aromatic ketone; hydroxypiperidine; monochlorobenzenes; organofluorine compound; tertiary alcohol | antidyskinesia agent; antiemetic; dopaminergic antagonist; first generation antipsychotic; serotonergic antagonist |
| halothane [no description available] | 2.03 | 1 | 0 | haloalkane; organobromine compound; organochlorine compound; organofluorine compound | inhalation anaesthetic |
| ethidium Ethidium: A trypanocidal agent and possible antiviral agent that is widely used in experimental cell biology and biochemistry. Ethidium has several experimentally useful properties including binding to nucleic acids, noncompetitive inhibition of nicotinic acetylcholine receptors, and fluorescence among others. It is most commonly used as the bromide.. ethidium : The fluorescent compound widely used in experimental cell biology and biochemistry to reveal double-stranded DNA and RNA. | 5.5 | 67 | 0 | phenanthridines | fluorochrome; intercalator |
| hydroxychloroquine Hydroxychloroquine: A chemotherapeutic agent that acts against erythrocytic forms of malarial parasites. Hydroxychloroquine appears to concentrate in food vacuoles of affected protozoa. It inhibits plasmodial heme polymerase. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p970). hydroxychloroquine : An aminoquinoline that is chloroquine in which one of the N-ethyl groups is hydroxylated at position 2. An antimalarial with properties similar to chloroquine that acts against erythrocytic forms of malarial parasites, it is mainly used as the sulfate salt for the treatment of lupus erythematosus, rheumatoid arthritis, and light-sensitive skin eruptions. | 4.61 | 4 | 0 | aminoquinoline; organochlorine compound; primary alcohol; secondary amino compound; tertiary amino compound | anticoronaviral agent; antimalarial; antirheumatic drug; dermatologic drug |
| hydroxyurea [no description available] | 3.49 | 8 | 0 | one-carbon compound; ureas | antimetabolite; antimitotic; antineoplastic agent; DNA synthesis inhibitor; EC 1.17.4.1 (ribonucleoside-diphosphate reductase) inhibitor; genotoxin; immunomodulator; radical scavenger; teratogenic agent |
| ibuprofen Midol: combination of cinnamedrine, phenacetin, aspirin & caffeine | 2.05 | 1 | 0 | monocarboxylic acid | antipyretic; cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; drug allergen; environmental contaminant; geroprotector; non-narcotic analgesic; non-steroidal anti-inflammatory drug; radical scavenger; xenobiotic |
| phenelzine Phenelzine: One of the MONOAMINE OXIDASE INHIBITORS used to treat DEPRESSION; PHOBIC DISORDERS; and PANIC. | 2.01 | 1 | 0 | primary amine | |
| idebenone [no description available] | 2.11 | 1 | 0 | 1,4-benzoquinones; primary alcohol | antioxidant; ferroptosis inhibitor |
| ifosfamide [no description available] | 2.03 | 1 | 0 | ifosfamides | alkylating agent; antineoplastic agent; environmental contaminant; immunosuppressive agent; xenobiotic |
| indomethacin Indomethacin: A non-steroidal anti-inflammatory agent (NSAID) that inhibits CYCLOOXYGENASE, which is necessary for the formation of PROSTAGLANDINS and other AUTACOIDS. It also inhibits the motility of POLYMORPHONUCLEAR LEUKOCYTES.. indometacin : A member of the class of indole-3-acetic acids that is indole-3-acetic acid in which the indole ring is substituted at positions 1, 2 and 5 by p-chlorobenzoyl, methyl, and methoxy groups, respectively. A non-steroidal anti-inflammatory drug, it is used in the treatment of musculoskeletal and joint disorders including osteoarthritis, rheumatoid arthritis, gout, bursitis and tendinitis. | 2.68 | 3 | 0 | aromatic ether; indole-3-acetic acids; monochlorobenzenes; N-acylindole | analgesic; drug metabolite; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; environmental contaminant; gout suppressant; non-steroidal anti-inflammatory drug; xenobiotic metabolite; xenobiotic |
| iodoacetamide [no description available] | 2.9 | 4 | 0 | ||
| avapro Irbesartan: A spiro compound, biphenyl and tetrazole derivative that acts as an angiotensin II type 1 receptor antagonist. It is used in the management of HYPERTENSION, and in the treatment of kidney disease.. irbesartan : A biphenylyltetrazole that is an angiotensin II receptor antagonist used mainly for the treatment of hypertension. | 2.02 | 1 | 0 | azaspiro compound; biphenylyltetrazole | angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic |
| 1-methyl-3-isobutylxanthine 1-Methyl-3-isobutylxanthine: A potent cyclic nucleotide phosphodiesterase inhibitor; due to this action, the compound increases cyclic AMP and cyclic GMP in tissue and thereby activates CYCLIC NUCLEOTIDE-REGULATED PROTEIN KINASES. 3-isobutyl-1-methylxanthine : An oxopurine that is xanthine which is substituted at positions 1 and 3 by methyl and isobutyl groups, respectively. | 2.38 | 2 | 0 | 3-isobutyl-1-methylxanthine | |
| isoflurane Isoflurane: A stable, non-explosive inhalation anesthetic, relatively free from significant side effects. | 2.03 | 1 | 0 | organofluorine compound | inhalation anaesthetic |
| isoniazid Hydra: A genus of freshwater polyps in the family Hydridae, order Hydroida, class HYDROZOA. They are of special interest because of their complex organization and because their adult organization corresponds roughly to the gastrula of higher animals.. hydrazide : Compounds derived from oxoacids RkE(=O)l(OH)m (l =/= 0) by replacing -OH by -NRNR2 (R groups are commonly H). (IUPAC). | 3.49 | 8 | 0 | carbohydrazide | antitubercular agent; drug allergen |
| 2-propanol 2-Propanol: An isomer of 1-PROPANOL. It is a colorless liquid having disinfectant properties. It is used in the manufacture of acetone and its derivatives and as a solvent. Topically, it is used as an antiseptic.. propan-2-ol : A secondary alcohol that is propane in which one of the hydrogens attached to the central carbon is substituted by a hydroxy group. | 3.8 | 3 | 0 | secondary alcohol; secondary fatty alcohol | protic solvent |
| isoproterenol Isoproterenol: Isopropyl analog of EPINEPHRINE; beta-sympathomimetic that acts on the heart, bronchi, skeletal muscle, alimentary tract, etc. It is used mainly as bronchodilator and heart stimulant.. isoprenaline : A secondary amino compound that is noradrenaline in which one of the hydrogens attached to the nitrogen is replaced by an isopropyl group. A sympathomimetic acting almost exclusively on beta-adrenergic receptors, it is used (mainly as the hydrochloride salt) as a bronghodilator and heart stimulant for the management of a variety of cardiac disorders. | 2.43 | 2 | 0 | catechols; secondary alcohol; secondary amino compound | beta-adrenergic agonist; bronchodilator agent; cardiotonic drug; sympathomimetic agent |
| staurosporine aglycone staurosporine aglycone: metabolite from culture broth of Nocardiopsis sp.; a neurotrophin antag; inhibits BDNF TrkB receptor | 2.11 | 1 | 0 | ||
| ketamine Ketamine: A cyclohexanone derivative used for induction of anesthesia. Its mechanism of action is not well understood, but ketamine can block NMDA receptors (RECEPTORS, N-METHYL-D-ASPARTATE) and may interact with sigma receptors.. ketamine : A member of the class of cyclohexanones in which one of the hydrogens at position 2 is substituted by a 2-chlorophenyl group, while the other is substituted by a methylamino group. | 2.1 | 1 | 0 | cyclohexanones; monochlorobenzenes; secondary amino compound | analgesic; environmental contaminant; intravenous anaesthetic; neurotoxin; NMDA receptor antagonist; xenobiotic |
| ketoconazole 1-acetyl-4-(4-{[2-(2,4-dichlorophenyl)-2-(1H-imidazol-1-ylmethyl)-1,3-dioxolan-4-yl]methoxy}phenyl)piperazine : A dioxolane that is 1,3-dioxolane which is substituted at positions 2, 2, and 4 by imidazol-1-ylmethyl, 2,4-dichlorophenyl, and [para-(4-acetylpiperazin-1-yl)phenoxy]methyl groups, respectively. | 3.43 | 1 | 1 | dichlorobenzene; dioxolane; ether; imidazoles; N-acylpiperazine; N-arylpiperazine | |
| khellin Khellin: A vasodilator that also has bronchodilatory action. It has been employed in the treatment of angina pectoris, in the treatment of asthma, and in conjunction with ultraviolet light A, has been tried in the treatment of vitiligo. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1024). khellin : A furanochrome in which the basic tricyclic skeleton is substituted at positions 4 and 9 with methoxy groups and at position 7 with a methyl group. A major constituent of the plant Ammi visnaga it is a herbal folk medicine used for various illnesses, its main effect being as a vasodilator. | 3.18 | 1 | 0 | furanochromone; organic heterotricyclic compound; oxacycle | anti-asthmatic agent; bronchodilator agent; cardiovascular drug; vasodilator agent |
| kinetin Kinetin: A furanyl adenine found in PLANTS and FUNGI. It has plant growth regulation effects.. cytokinin : A phytohormone that promote cell division, or cytokinesis, in plant roots and shoots.. kinetin : A member of the class of 6-aminopurines that is adenine carrying a (furan-2-ylmethyl) substituent at the exocyclic amino group. | 2.45 | 2 | 0 | 6-aminopurines; furans | cytokinin; geroprotector |
| lamotrigine [no description available] | 2.02 | 1 | 0 | 1,2,4-triazines; dichlorobenzene; primary arylamine | anticonvulsant; antidepressant; antimanic drug; calcium channel blocker; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; environmental contaminant; excitatory amino acid antagonist; geroprotector; non-narcotic analgesic; xenobiotic |
| leflunomide Leflunomide: An isoxazole derivative that inhibits dihydroorotate dehydrogenase, the fourth enzyme in the pyrimidine biosynthetic pathway. It is used an immunosuppressive agent in the treatment of RHEUMATOID ARTHRITIS and PSORIATIC ARTHRITIS.. leflunomide : A monocarboxylic acid amide obtained by formal condensation of the carboxy group of 5-methyl-1,2-oxazole-4-carboxylic acid with the anilino group of 4-(trifluoromethyl)aniline. The prodrug of teriflunomide. | 4.05 | 2 | 0 | (trifluoromethyl)benzenes; isoxazoles; monocarboxylic acid amide | antineoplastic agent; antiparasitic agent; EC 1.3.98.1 [dihydroorotate oxidase (fumarate)] inhibitor; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; hepatotoxic agent; immunosuppressive agent; non-steroidal anti-inflammatory drug; prodrug; pyrimidine synthesis inhibitor; tyrosine kinase inhibitor |
| loratadine Loratadine: A second-generation histamine H1 receptor antagonist used in the treatment of allergic rhinitis and urticaria. Unlike most classical antihistamines (HISTAMINE H1 ANTAGONISTS) it lacks central nervous system depressing effects such as drowsiness.. loratadine : A benzocycloheptapyridine that is 6,11-dihydro-5H-benzo[5,6]cyclohepta[1,2-b]pyridine substituted by a chloro group at position 8 and a 1-(ethoxycarbonyl)piperidin-4-ylidene group at position 11. It is a H1-receptor antagonist commonly employed in the treatment of allergic disorders. | 2.17 | 1 | 0 | benzocycloheptapyridine; ethyl ester; N-acylpiperidine; organochlorine compound; tertiary carboxamide | anti-allergic agent; cholinergic antagonist; geroprotector; H1-receptor antagonist |
| losartan Losartan: An antagonist of ANGIOTENSIN TYPE 1 RECEPTOR with antihypertensive activity due to the reduced pressor effect of ANGIOTENSIN II.. losartan : A biphenylyltetrazole where a 1,1'-biphenyl group is attached at the 5-position and has an additional trisubstituted imidazol-1-ylmethyl group at the 4'-position | 2 | 1 | 0 | biphenylyltetrazole; imidazoles | angiotensin receptor antagonist; anti-arrhythmia drug; antihypertensive agent; endothelin receptor antagonist |
| loxapine Loxapine: An antipsychotic agent used in SCHIZOPHRENIA. | 1.98 | 1 | 0 | dibenzooxazepine | antipsychotic agent; dopaminergic antagonist |
| 2-(4-morpholinyl)-8-phenyl-4h-1-benzopyran-4-one 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one: specific inhibitor of phosphatidylinositol 3-kinase; structure in first source | 3.43 | 7 | 0 | chromones; morpholines; organochlorine compound | autophagy inhibitor; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; geroprotector |
| 6-anilino-5,8-quinolinedione 6-anilino-5,8-quinolinedione: structure given in first source; SRS-A & guanylate cyclase antagonist. 6-anilino-5,8-quinolinedione : A quinolone that is quinoline-5,8-dione in which the hydrogen at position 6 is replaced by an anilino group. | 1.99 | 1 | 0 | aminoquinoline; aromatic amine; p-quinones; quinolone | antineoplastic agent; EC 4.6.1.2 (guanylate cyclase) inhibitor |
| malathion Malathion: A wide spectrum aliphatic organophosphate insecticide widely used for both domestic and commercial agricultural purposes.. malathion : A racemate comprising equimolar amounts of (R) and (S)-malathion. It is a broad spectrum organophosphate proinsecticide used to control a wide range of pests including Coleoptera, Diptera, fruit flies, mosquitos and spider mites.. diethyl 2-[(dimethoxyphosphorothioyl)thio]succinate : A diester that is diethyl succinate in which position 2 is substituted by a (dimethoxyphosphorothioyl)thio group. | 2.21 | 1 | 0 | diester; ethyl ester; organic thiophosphate | |
| edaravone [no description available] | 2.96 | 3 | 0 | pyrazolone | antioxidant; radical scavenger |
| mechlorethamine nitrogen mustard : Compounds having two beta-haloalkyl groups bound to a nitrogen atom, as in (X-CH2-CH2)2NR. | 3.29 | 6 | 0 | nitrogen mustard; organochlorine compound | alkylating agent |
| vitamin k 3 Vitamin K 3: A synthetic naphthoquinone without the isoprenoid side chain and biological activity, but can be converted to active vitamin K2, menaquinone, after alkylation in vivo. | 2.72 | 3 | 0 | 1,4-naphthoquinones; vitamin K | angiogenesis inhibitor; antineoplastic agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor; human urinary metabolite; nutraceutical |
| methoxyamine methoxyamine: analytical reagent for aldehydes and ketones; strong irritant, can probably produce methemoglobinemia; RN given refers to parent cpd; structure | 2.68 | 3 | 0 | organooxygen compound | |
| methoxsalen Methoxsalen: A naturally occurring furocoumarin compound found in several species of plants, including Psoralea corylifolia. It is a photoactive substance that forms DNA ADDUCTS in the presence of ultraviolet A irradiation.. methoxsalen : A member of the class of psoralens that is 7H-furo[3,2-g]chromen-7-one in which the 9 position is substituted by a methoxy group. It is a constituent of the fruits of Ammi majus. Like other psoralens, trioxsalen causes photosensitization of the skin. It is administered topically or orally in conjunction with UV-A for phototherapy treatment of vitiligo and severe psoriasis. | 1.98 | 1 | 0 | aromatic ether; psoralens | antineoplastic agent; cross-linking reagent; dermatologic drug; photosensitizing agent; plant metabolite |
| nocodazole [no description available] | 3.27 | 6 | 0 | aromatic ketone; benzimidazoles; carbamate ester; thiophenes | antimitotic; antineoplastic agent; microtubule-destabilising agent; tubulin modulator |
| methyl methanesulfonate [no description available] | 2.92 | 4 | 0 | methanesulfonate ester | alkylating agent; apoptosis inducer; carcinogenic agent; genotoxin; mutagen |
| metoprolol Metoprolol: A selective adrenergic beta-1 blocking agent that is commonly used to treat ANGINA PECTORIS; HYPERTENSION; and CARDIAC ARRHYTHMIAS.. metoprolol : A propanolamine that is 1-(propan-2-ylamino)propan-2-ol substituted by a 4-(2-methoxyethyl)phenoxy group at position 1. | 7.03 | 1 | 0 | aromatic ether; propanolamine; secondary alcohol; secondary amino compound | antihypertensive agent; beta-adrenergic antagonist; environmental contaminant; geroprotector; xenobiotic |
| metronidazole Metronidazole: A nitroimidazole used to treat AMEBIASIS; VAGINITIS; TRICHOMONAS INFECTIONS; GIARDIASIS; ANAEROBIC BACTERIA; and TREPONEMAL INFECTIONS.. metronidazole : A member of the class of imidazoles substituted at C-1, -2 and -5 with 2-hydroxyethyl, nitro and methyl groups respectively. It has activity against anaerobic bacteria and protozoa, and has a radiosensitising effect on hypoxic tumour cells. It may be given by mouth in tablets, or as the benzoate in an oral suspension. The hydrochloride salt can be used in intravenous infusions. Metronidazole is a prodrug and is selective for anaerobic bacteria due to their ability to intracellularly reduce the nitro group of metronidazole to give nitroso-containing intermediates. These can covalently bind to DNA, disrupting its helical structure, inducing DNA strand breaks and inhibiting bacterial nucleic acid synthesis, ultimately resulting in bacterial cell death. | 3.36 | 2 | 0 | C-nitro compound; imidazoles; primary alcohol | antiamoebic agent; antibacterial drug; antimicrobial agent; antiparasitic agent; antitrichomonal drug; environmental contaminant; prodrug; radiosensitizing agent; xenobiotic |
| metyrapone Metyrapone: An inhibitor of the enzyme STEROID 11-BETA-MONOOXYGENASE. It is used as a test of the feedback hypothalamic-pituitary mechanism in the diagnosis of CUSHING SYNDROME.. metyrapone : An aromatic ketone that is 3,3-dimethylbutan-2-one in which the methyl groups at positions 1 and 4 are replaced by pyridin-3-yl groups. A steroid 11beta-monooxygenase (EC 1.14.15.4) inhibitor, it is used in the diagnosis of adrenal insufficiency. | 1.98 | 1 | 0 | aromatic ketone | antimetabolite; diagnostic agent; EC 1.14.15.4 (steroid 11beta-monooxygenase) inhibitor |
| mexiletine Mexiletine: Antiarrhythmic agent pharmacologically similar to LIDOCAINE. It may have some anticonvulsant properties.. mexiletine : An aromatic ether which is 2,6-dimethylphenyl ether of 2-aminopropan-1-ol. | 2.02 | 1 | 0 | aromatic ether; primary amino compound | anti-arrhythmia drug |
| 2,7-diaminomitosene [no description available] | 2.02 | 1 | 0 | ||
| mitoxantrone Mitoxantrone: An anthracenedione-derived antineoplastic agent.. mitoxantrone : A dihydroxyanthraquinone that is 1,4-dihydroxy-9,10-anthraquinone which is substituted by 6-hydroxy-1,4-diazahexyl groups at positions 5 and 8. | 3.43 | 7 | 0 | dihydroxyanthraquinone | analgesic; antineoplastic agent |
| molsidomine Molsidomine: A morpholinyl sydnone imine ethyl ester, having a nitrogen in place of the keto oxygen. It acts as NITRIC OXIDE DONORS and is a vasodilator that has been used in ANGINA PECTORIS.. molsidomine : A member of the class of oxadiazoles that is 1,2,3-oxadiazole substituted by morpholin-4-yl and (ethoxycarbonyl)azanidyl groups at positions 3 and 5, respectively. It is used as a vasodilator drug for the treatment of myocardial ischemic syndrome and congestive heart failure. | 2 | 1 | 0 | ethyl ester; morpholines; oxadiazole; zwitterion | antioxidant; apoptosis inhibitor; cardioprotective agent; nitric oxide donor; vasodilator agent |
| monodansylcadaverine monodansylcadaverine: inhibits cross linkage of fibrin. monodansylcadaverine : A sulfonamide obtained by formal condensation of the sulfo group of 5-(dimethylamino)naphthalene-1-sulfonic acid with one of the amino groups of cadaverine. | 1.99 | 1 | 0 | aminonaphthalene; primary amino compound; sulfonamide; tertiary amino compound | EC 2.3.2.13 (protein-glutamine gamma-glutamyltransferase) inhibitor; fluorochrome; protective agent |
| ethylmaleimide Ethylmaleimide: A sulfhydryl reagent that is widely used in experimental biochemical studies. | 3.91 | 13 | 0 | maleimides | anticoronaviral agent; EC 1.3.1.8 [acyl-CoA dehydrogenase (NADP(+))] inhibitor; EC 2.1.1.122 [(S)-tetrahydroprotoberberine N-methyltransferase] inhibitor; EC 2.7.1.1 (hexokinase) inhibitor |
| nalidixic acid [no description available] | 2.42 | 2 | 0 | 1,8-naphthyridine derivative; monocarboxylic acid; quinolone antibiotic | antibacterial drug; antimicrobial agent; DNA synthesis inhibitor |
| activins Activins: Activins are produced in the pituitary, gonads, and other tissues. By acting locally, they stimulate pituitary FSH secretion and have diverse effects on cell differentiation and embryonic development. Activins are glycoproteins that are hetero- or homodimers of INHIBIN-BETA SUBUNITS. | 3.28 | 6 | 0 | ||
| neostigmine Neostigmine: A cholinesterase inhibitor used in the treatment of myasthenia gravis and to reverse the effects of muscle relaxants such as gallamine and tubocurarine. Neostigmine, unlike PHYSOSTIGMINE, does not cross the blood-brain barrier.. neostigmine : A quaternary ammonium ion comprising an anilinium ion core having three methyl substituents on the aniline nitrogen, and a 3-[(dimethylcarbamoyl)oxy] substituent at position 3. It is a parasympathomimetic which acts as a reversible acetylcholinesterase inhibitor. | 2.02 | 1 | 0 | quaternary ammonium ion | antidote to curare poisoning; EC 3.1.1.7 (acetylcholinesterase) inhibitor |
| netropsin Netropsin: A basic polypeptide isolated from Streptomyces netropsis. It is cytotoxic and its strong, specific binding to A-T areas of DNA is useful to genetics research. | 4.66 | 28 | 0 | ||
| nevirapine Nevirapine: A potent, non-nucleoside reverse transcriptase inhibitor used in combination with nucleoside analogues for treatment of HIV INFECTIONS and AIDS.. nevirapine : A dipyridodiazepine that is 5,11-dihydro-6H-dipyrido[3,2-b:2',3'-e][1,4]diazepine which is substituted by methyl, oxo, and cyclopropyl groups at positions 4, 6, and 11, respectively. A non-nucleoside reverse transcriptase inhibitor with activity against HIV-1, it is used in combination with other antiretrovirals for the treatment of HIV infection. | 2.95 | 4 | 0 | cyclopropanes; dipyridodiazepine | antiviral drug; HIV-1 reverse transcriptase inhibitor |
| nicardipine Nicardipine: A potent calcium channel blockader with marked vasodilator action. It has antihypertensive properties and is effective in the treatment of angina and coronary spasms without showing cardiodepressant effects. It has also been used in the treatment of asthma and enhances the action of specific antineoplastic agents.. nicardipine : A racemate comprising equimolar amounts of (R)- and (S)-nicardipine. It is a calcium channel blocker which is used to treat hypertension.. 2-[benzyl(methyl)amino]ethyl methyl 2,6-dimethyl-4-(3-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxylate : A dihydropyridine that is 1,4-dihydropyridine substituted by a methyl, {2-[benzyl(methyl)amino]ethoxy}carbonyl, 3-nitrophenyl, methoxycarbonyl and methyl groups at positions 2, 3, 4, 5 and 6, respectively. | 2.06 | 1 | 0 | benzenes; C-nitro compound; diester; dihydropyridine; methyl ester; tertiary amino compound | |
| nifedipine Nifedipine: A potent vasodilator agent with calcium antagonistic action. It is a useful anti-anginal agent that also lowers blood pressure. | 2.03 | 1 | 0 | C-nitro compound; dihydropyridine; methyl ester | calcium channel blocker; human metabolite; tocolytic agent; vasodilator agent |
| nifenazone nifenazone: RN given refers to parent cpd; structure | 2.25 | 1 | 0 | pyrazoles; ring assembly | |
| nimodipine Nimodipine: A calcium channel blockader with preferential cerebrovascular activity. It has marked cerebrovascular dilating effects and lowers blood pressure.. nimodipine : A dihydropyridine that is 1,4-dihydropyridine which is substituted by methyl groups at positions 2 and 6, a (2-methoxyethoxy)carbonyl group at position 3, a m-nitrophenyl group at position 4, and an isopropoxycarbonyl group at position 5. An L-type calcium channel blocker, it acts particularly on cerebral circulation, and is used both orally and intravenously for the prevention and treatment of subarachnoid hemorrhage from ruptured intracranial aneurysm. | 2.02 | 1 | 0 | 2-methoxyethyl ester; C-nitro compound; dicarboxylic acids and O-substituted derivatives; diester; dihydropyridine; isopropyl ester | antihypertensive agent; calcium channel blocker; cardiovascular drug; vasodilator agent |
| nortriptyline Nortriptyline: A metabolite of AMITRIPTYLINE that is also used as an antidepressive agent. Nortriptyline is used in major depression, dysthymia, and atypical depressions.. nortriptyline : An organic tricyclic compound that is 10,11-dihydro-5H-dibenzo[a,d][7]annulene substituted by a 3-(methylamino)propylidene group at position 5. It is an active metabolite of amitriptyline. | 3.84 | 2 | 1 | organic tricyclic compound; secondary amine | adrenergic uptake inhibitor; analgesic; antidepressant; antineoplastic agent; apoptosis inducer; drug metabolite |
| o(6)-benzylguanine O(6)-benzylguanine: a suicide inhibitor of O(6)-methylguanine-DNA methyltransferase activity | 2.4 | 2 | 0 | ||
| octopamine Octopamine: An alpha-adrenergic sympathomimetic amine, biosynthesized from tyramine in the CNS and platelets and also in invertebrate nervous systems. It is used to treat hypotension and as a cardiotonic. The natural D(-) form is more potent than the L(+) form in producing cardiovascular adrenergic responses. It is also a neurotransmitter in some invertebrates.. octopamine : A member of the class of phenylethanolamines that is phenol which is substituted at the para- position by a 2-amino-1-hydroxyethyl group. A biogenic phenylethanolamine which has been found to act as a neurotransmitter, neurohormone or neuromodulator in invertebrates. | 2.74 | 3 | 0 | phenylethanolamines; tyramines | neurotransmitter |
| ofloxacin Ofloxacin: A synthetic fluoroquinolone antibacterial agent that inhibits the supercoiling activity of bacterial DNA GYRASE, halting DNA REPLICATION.. 9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid : An oxazinoquinoline that is 2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinolin-7-one substituted by methyl, carboxy, fluoro, and 4-methylpiperazin-1-yl groups at positions 3, 6, 9, and 10, respectively.. ofloxacin : A racemate comprising equimolar amounts of levofloxacin and dextrofloxacin. It is a synthetic fluoroquinolone antibacterial agent which inhibits the supercoiling activity of bacterial DNA gyrase, halting DNA replication. | 7.75 | 3 | 0 | 3-oxo monocarboxylic acid; N-arylpiperazine; N-methylpiperazine; organofluorine compound; oxazinoquinoline | |
| omeprazole Omeprazole: A 4-methoxy-3,5-dimethylpyridyl, 5-methoxybenzimidazole derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits an H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.. omeprazole : A racemate comprising equimolar amounts of (R)- and (S)-omeprazole.. 5-methoxy-2-{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl}-1H-benzimidazole : A member of the class of benzimidazoles that is 1H-benzimidazole which is substituted by a [4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl group at position 2 and a methoxy group at position 5. | 2.97 | 1 | 0 | aromatic ether; benzimidazoles; pyridines; sulfoxide | |
| 1,2-cyclohexanediamine 1,2-cyclohexanediamine: RN given refers to cpd without isomeric designation | 1.97 | 1 | 0 | primary aliphatic amine | |
| oxidopamine Oxidopamine: A neurotransmitter analogue that depletes noradrenergic stores in nerve endings and induces a reduction of dopamine levels in the brain. Its mechanism of action is related to the production of cytolytic free-radicals.. oxidopamine : A benzenetriol that is phenethylamine in which the hydrogens at positions 2, 4, and 5 on the phenyl ring are replaced by hydroxy groups. It occurs naturally in human urine, but is also produced as a metabolite of the drug DOPA (used for the treatment of Parkinson's disease). | 2.39 | 2 | 0 | benzenetriol; catecholamine; primary amino compound | drug metabolite; human metabolite; neurotoxin |
| oxolinic acid quinolone antibiotic : An organonitrogen heterocyclic antibiotic whose structure contains a quinolone or quinolone-related skeleton. | 2.01 | 1 | 0 | aromatic carboxylic acid; organic heterotricyclic compound; oxacycle; quinolinemonocarboxylic acid; quinolone antibiotic | antibacterial drug; antifungal agent; antiinfective agent; antimicrobial agent; enzyme inhibitor |
| oxotremorine Oxotremorine: A non-hydrolyzed muscarinic agonist used as a research tool. | 2.11 | 1 | 0 | N-alkylpyrrolidine | |
| quinone benzoquinone : The simplest members of the class of benzoquinones, consisting of cyclohexadiene which is substituted by two oxo groups.. 1,4-benzoquinone : The simplest member of the class of 1,4-benzoquinones, obtained by the formal oxidation of hydroquinone to the corresponding diketone. It is a metabolite of benzene.. quinone : Compounds having a fully conjugated cyclic dione structure, such as that of benzoquinones, derived from aromatic compounds by conversion of an even number of -CH= groups into -C(=O)- groups with any necessary rearrangement of double bonds (polycyclic and heterocyclic analogues are included). | 7.4 | 2 | 0 | 1,4-benzoquinones | cofactor; human xenobiotic metabolite; mouse metabolite |
| pargyline Pargyline: A monoamine oxidase inhibitor with antihypertensive properties. | 3.18 | 5 | 0 | aromatic amine | |
| patulin Patulin: 4-Hydroxy-4H-furo(3,2-c)pyran-2(6H)-one. A mycotoxin produced by several species of Aspergillus and Penicillium. It is found in unfermented apple and grape juice and field crops. It has antibiotic properties and has been shown to be carcinogenic and mutagenic and causes chromosome damage in biological systems.. patulin : A furopyran and lactone that is (2H-pyran-3(6H)-ylidene)acetic acid which is substituted by hydroxy groups at positions 2 and 4 and in which the hydroxy group at position 4 has condensed with the carboxy group to give the corresponding bicyclic lactone. A mycotoxin produced by several species of Aspergillus and Penicillium, it has antibiotic properties but has been shown to be carcinogenic and mutagenic. | 2.52 | 2 | 0 | furopyran; gamma-lactone; lactol | antimicrobial agent; Aspergillus metabolite; carcinogenic agent; mutagen; mycotoxin; Penicillium metabolite |
| pd 98059 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one: inhibits MAP kinase kinase (MEK) activity, p42 MAPK and p44 MAPK; structure in first source. 2-(2-amino-3-methoxyphenyl)chromen-4-one : A member of the class of monomethoxyflavones that is 3'-methoxyflavone bearing an additional amino substituent at position 2'. | 3.63 | 9 | 0 | aromatic amine; monomethoxyflavone | EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; geroprotector |
| pentamidine Pentamidine: Antiprotozoal agent effective in trypanosomiasis, leishmaniasis, and some fungal infections; used in treatment of PNEUMOCYSTIS pneumonia in HIV-infected patients. It may cause diabetes mellitus, central nervous system damage, and other toxic effects.. pentamidine : A diether consisting of pentane-1,5-diol in which both hydroxyl hydrogens have been replaced by 4-amidinophenyl groups. A trypanocidal drug that is used for treatment of cutaneous leishmaniasis and Chagas disease. | 1.98 | 1 | 0 | aromatic ether; carboxamidine; diether | anti-inflammatory agent; antifungal agent; calmodulin antagonist; chemokine receptor 5 antagonist; EC 2.3.1.48 (histone acetyltransferase) inhibitor; NMDA receptor antagonist; S100 calcium-binding protein B inhibitor; trypanocidal drug; xenobiotic |
| pentoxifylline [no description available] | 2.39 | 2 | 0 | oxopurine | |
| phenobarbital Phenobarbital: A barbituric acid derivative that acts as a nonselective central nervous system depressant. It potentiates GAMMA-AMINOBUTYRIC ACID action on GABA-A RECEPTORS, and modulates chloride currents through receptor channels. It also inhibits glutamate induced depolarizations.. phenobarbital : A member of the class of barbiturates, the structure of which is that of barbituric acid substituted at C-5 by ethyl and phenyl groups. | 2.93 | 4 | 0 | barbiturates | anticonvulsant; drug allergen; excitatory amino acid antagonist; sedative |
| 4-phenylbutyric acid 4-phenylbutyric acid: RN refers to the parent cpd. 4-phenylbutyric acid : A monocarboxylic acid the structure of which is that of butyric acid substituted with a phenyl group at C-4. It is a histone deacetylase inhibitor that displays anticancer activity. It inhibits cell proliferation, invasion and migration and induces apoptosis in glioma cells. It also inhibits protein isoprenylation, depletes plasma glutamine, increases production of foetal haemoglobin through transcriptional activation of the gamma-globin gene and affects hPPARgamma activation. | 2.31 | 1 | 0 | monocarboxylic acid | antineoplastic agent; apoptosis inducer; EC 3.5.1.98 (histone deacetylase) inhibitor; prodrug |
| phenylmethylsulfonyl fluoride Phenylmethylsulfonyl Fluoride: An enzyme inhibitor that inactivates IRC-50 arvin, subtilisin, and the fatty acid synthetase complex.. phenylmethanesulfonyl fluoride : An acyl fluoride with phenylmethanesulfonyl as the acyl group. | 1.96 | 1 | 0 | acyl fluoride | serine proteinase inhibitor |
| pifithrin pifithrin: a tetrahydrobenzothiazol; inhibitor of P53 that protects mice from the side effects of cancer therapy; structure in first source | 2.44 | 2 | 0 | aromatic ketone | |
| pioglitazone Pioglitazone: A thiazolidinedione and PPAR GAMMA agonist that is used in the treatment of TYPE 2 DIABETES MELLITUS.. pioglitazone : A member of the class of thiazolidenediones that is 1,3-thiazolidine-2,4-dione substituted by a benzyl group at position 5 which in turn is substituted by a 2-(5-ethylpyridin-2-yl)ethoxy group at position 4 of the phenyl ring. It exhibits hypoglycemic activity. | 4.11 | 3 | 1 | aromatic ether; pyridines; thiazolidinediones | antidepressant; cardioprotective agent; EC 2.7.1.33 (pantothenate kinase) inhibitor; EC 6.2.1.3 (long-chain-fatty-acid--CoA ligase) inhibitor; ferroptosis inhibitor; geroprotector; hypoglycemic agent; insulin-sensitizing drug; PPARgamma agonist; xenobiotic |
| piperazine [no description available] | 7.95 | 4 | 0 | azacycloalkane; piperazines; saturated organic heteromonocyclic parent | anthelminthic drug |
| potassium chloride Potassium Chloride: A white crystal or crystalline powder used in BUFFERS; FERTILIZERS; and EXPLOSIVES. It can be used to replenish ELECTROLYTES and restore WATER-ELECTROLYTE BALANCE in treating HYPOKALEMIA.. potassium chloride : A metal chloride salt with a K(+) counterion. | 4.38 | 21 | 0 | inorganic chloride; inorganic potassium salt; potassium salt | fertilizer |
| potassium iodide Potassium Iodide: An inorganic compound that is used as a source of iodine in thyrotoxic crisis and in the preparation of thyrotoxic patients for thyroidectomy. (From Dorland, 27th ed). potassium iodide : A metal iodide salt with a K(+) counterion. It is a scavenger of hydroxyl radicals. | 2.01 | 1 | 0 | potassium salt | expectorant; radical scavenger |
| 4-aminobenzoic acid para-Aminobenzoates: Benzoic acids, salts, or esters that contain an amino group attached to carbon number 4 of the benzene ring structure.. 4-aminobenzoate : An aromatic amino-acid anion that is the conjugate base of 4-aminobenzoic acid. | 2.15 | 1 | 0 | aminobenzoate; aromatic amino-acid anion | Escherichia coli metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| ag 1879 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo(3,4-d)pyrimidin-4-amine: Fyn kinase inhibitor | 2.43 | 2 | 0 | aromatic amine; monochlorobenzenes; pyrazolopyrimidine | beta-adrenergic antagonist; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor; geroprotector |
| pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid: a novel antagonist that selectively blocks P2 purinoceptor receptors; a useful tool to study co-transmission in tissues when ATP and coexisting neurotransmitters act in concert. 5'-phosphopyridoxal-6-azobenzene-2,4-disulfonic acid : An arenesulfonic acid that is pyridoxal 5'-phosphate carrying an additional 2,4-disulfophenylazo substituent at position 6. | 1.99 | 1 | 0 | arenesulfonic acid; azobenzenes; methylpyridines; monohydroxypyridine; organic phosphate; pyridinecarbaldehyde | purinergic receptor P2X antagonist |
| propidium Propidium: Quaternary ammonium analog of ethidium; an intercalating dye with a specific affinity to certain forms of DNA and, used as diiodide, to separate them in density gradients; also forms fluorescent complexes with cholinesterase which it inhibits. | 8.73 | 10 | 0 | phenanthridines; quaternary ammonium ion | fluorochrome; intercalator |
| protoporphyrin ix protoporphyrin IX: RN given refers to parent cpd; structure in Merck Index, 9th ed, #7685. protoporphyrin : A cyclic tetrapyrrole that consists of porphyrin bearing four methyl substituents at positions 3, 8, 13 and 17, two vinyl substituents at positions 7 and 12 and two 2-carboxyethyl substituents at positions 2 and 18. The parent of the class of protoporphyrins. | 2.74 | 3 | 0 | ||
| pyrimethamine Maloprim: contains above 2 cpds | 2.06 | 1 | 0 | aminopyrimidine; monochlorobenzenes | antimalarial; antiprotozoal drug; EC 1.5.1.3 (dihydrofolate reductase) inhibitor |
| riluzole Riluzole: A glutamate antagonist (RECEPTORS, GLUTAMATE) used as an anticonvulsant (ANTICONVULSANTS) and to prolong the survival of patients with AMYOTROPHIC LATERAL SCLEROSIS. | 2.25 | 1 | 0 | benzothiazoles | |
| risperidone Risperidone: A selective blocker of DOPAMINE D2 RECEPTORS and SEROTONIN 5-HT2 RECEPTORS that acts as an atypical antipsychotic agent. It has been shown to improve both positive and negative symptoms in the treatment of SCHIZOPHRENIA.. risperidone : A member of the class of pyridopyrimidines that is 2-methyl-6,7,8,9-tetrahydropyrido[1,2-a]pyrimidin-4-one carrying an additional 2-[4-(6-fluoro-1,2-benzoxazol-3-yl)piperidin-1-yl]ethyl group at position 2. | 2.6 | 1 | 0 | 1,2-benzoxazoles; heteroarylpiperidine; organofluorine compound; pyridopyrimidine | alpha-adrenergic antagonist; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; H1-receptor antagonist; psychotropic drug; second generation antipsychotic; serotonergic antagonist |
| ro 31-8220 Ro 31-8220: a protein kinase C inhibitor | 2.41 | 2 | 0 | imidothiocarbamic ester; indoles; maleimides | EC 2.7.11.13 (protein kinase C) inhibitor |
| saccharin Saccharin: Flavoring agent and non-nutritive sweetener.. saccharin : A 1,2-benzisothiazole having a keto-group at the 3-position and two oxo substituents at the 1-position. It is used as an artificial sweetening agent. | 7.03 | 1 | 0 | 1,2-benzisothiazole; N-sulfonylcarboxamide | environmental contaminant; sweetening agent; xenobiotic |
| sb 202190 4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole: structure given in first source; inhibits p38 MAP kinase | 2.4 | 2 | 0 | imidazoles; organofluorine compound; phenols; pyridines | apoptosis inducer; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor |
| linsidomine linsidomine: RN given refers to parent cpd; structure | 2 | 1 | 0 | morpholines | |
| sodium fluoride [no description available] | 2.02 | 1 | 0 | fluoride salt | mutagen |
| sodium iodide Sodium Iodide: A compound forming white, odorless deliquescent crystals and used as iodine supplement, expectorant or in its radioactive (I-131) form as an diagnostic aid, particularly for thyroid function tests.. sodium iodide : A metal iodide salt with a Na(+) counterion. | 2.45 | 2 | 0 | inorganic sodium salt; iodide salt | |
| iodoacetic acid Iodoacetic Acid: A derivative of ACETIC ACID that contains one IODINE atom attached to its methyl group.. iodoacetic acid : A haloacetic acid that is acetic acid in which one of the hydrogens of the methyl group is replaced by an iodine atom. | 1.98 | 1 | 0 | haloacetic acid; organoiodine compound | alkylating agent |
| stearic acid octadecanoic acid : A C18 straight-chain saturated fatty acid component of many animal and vegetable lipids. As well as in the diet, it is used in hardening soaps, softening plastics and in making cosmetics, candles and plastics. | 2.48 | 2 | 0 | long-chain fatty acid; saturated fatty acid; straight-chain saturated fatty acid | algal metabolite; Daphnia magna metabolite; human metabolite; plant metabolite |
| streptonigrin [no description available] | 6.99 | 1 | 0 | pyridines; quinolone | antimicrobial agent; antineoplastic agent |
| vorinostat Vorinostat: A hydroxamic acid and anilide derivative that acts as a HISTONE DEACETYLASE inhibitor. It is used in the treatment of CUTANEOUS T-CELL LYMPHOMA and SEZARY SYNDROME.. vorinostat : A dicarboxylic acid diamide comprising suberic (octanedioic) acid coupled to aniline and hydroxylamine. A histone deacetylase inhibitor, it is marketed under the name Zolinza for the treatment of cutaneous T cell lymphoma (CTCL). | 3.17 | 1 | 0 | dicarboxylic acid diamide; hydroxamic acid | antineoplastic agent; apoptosis inducer; EC 3.5.1.98 (histone deacetylase) inhibitor |
| sulfadimethoxine Sulfadimethoxine: A sulfanilamide that is used as an anti-infective agent.. sulfadimethoxine : A sulfonamide consisting of pyrimidine having methoxy substituents at the 2- and 6-positions and a 4-aminobenzenesulfonamido group at the 4-position. | 3.41 | 3 | 0 | aromatic ether; pyrimidines; substituted aniline; sulfonamide antibiotic; sulfonamide | antiinfective agent; antimicrobial agent; drug allergen; environmental contaminant; xenobiotic |
| sulfamethoxazole Sulfamethoxazole: A bacteriostatic antibacterial agent that interferes with folic acid synthesis in susceptible bacteria. Its broad spectrum of activity has been limited by the development of resistance. (From Martindale, The Extra Pharmacopoeia, 30th ed, p208). sulfamethoxazole : An isoxazole (1,2-oxazole) compound having a methyl substituent at the 5-position and a 4-aminobenzenesulfonamido group at the 3-position. | 2.01 | 1 | 0 | isoxazoles; substituted aniline; sulfonamide antibiotic; sulfonamide | antibacterial agent; antiinfective agent; antimicrobial agent; drug allergen; EC 1.1.1.153 [sepiapterin reductase (L-erythro-7,8-dihydrobiopterin forming)] inhibitor; EC 2.5.1.15 (dihydropteroate synthase) inhibitor; environmental contaminant; epitope; P450 inhibitor; xenobiotic |
| sulforaphane sulforaphane: from Cardaria draba L.. sulforaphane : An isothiocyanate having a 4-(methylsulfinyl)butyl group attached to the nitrogen. | 2.48 | 2 | 0 | isothiocyanate; sulfoxide | antineoplastic agent; antioxidant; EC 3.5.1.98 (histone deacetylase) inhibitor; plant metabolite |
| sulpiride Sulpiride: A dopamine D2-receptor antagonist. It has been used therapeutically as an antidepressant, antipsychotic, and as a digestive aid. (From Merck Index, 11th ed). sulpiride : A member of the class of benzamides obtained from formal condensation between the carboxy group of 2-methoxy-5-sulfamoylbenzoic acid and the primary amino group of (1-ethylpyrrolidin-2-yl)methylamine. | 1.98 | 1 | 0 | benzamides; N-alkylpyrrolidine; sulfonamide | antidepressant; antiemetic; antipsychotic agent; dopaminergic antagonist |
| suprofen Suprofen: An IBUPROFEN-type anti-inflammatory analgesic and antipyretic. It inhibits prostaglandin synthesis and has been proposed as an anti-arthritic.. suprofen : An aromatic ketone that is thiophene substituted at C-2 by a 4-(1-carboxyethyl)benzoyl group. | 2 | 1 | 0 | aromatic ketone; monocarboxylic acid; thiophenes | antirheumatic drug; drug allergen; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; peripheral nervous system drug |
| suramin Suramin: A polyanionic compound with an unknown mechanism of action. It is used parenterally in the treatment of African trypanosomiasis and it has been used clinically with diethylcarbamazine to kill the adult Onchocerca. (From AMA Drug Evaluations Annual, 1992, p1643) It has also been shown to have potent antineoplastic properties.. suramin : A member of the class of phenylureas that is urea in which each of the amino groups has been substituted by a 3-({2-methyl-5-[(4,6,8-trisulfo-1-naphthyl)carbamoyl]phenyl}carbamoyl)phenyl group. An activator of both the rabbit skeletal muscle RyR1 and sheep cardiac RyR2 isoform ryanodine receptor channels, it has been used for the treatment of human African trypanosomiasis for over 100 years. | 7.7 | 3 | 0 | naphthalenesulfonic acid; phenylureas; secondary carboxamide | angiogenesis inhibitor; antinematodal drug; antineoplastic agent; apoptosis inhibitor; EC 2.7.11.13 (protein kinase C) inhibitor; GABA antagonist; GABA-gated chloride channel antagonist; purinergic receptor P2 antagonist; ryanodine receptor agonist; trypanocidal drug |
| temozolomide [no description available] | 3.15 | 5 | 0 | imidazotetrazine; monocarboxylic acid amide; triazene derivative | alkylating agent; antineoplastic agent; prodrug |
| tetraethylammonium Tetraethylammonium: A potassium-selective ion channel blocker. (From J Gen Phys 1994;104(1):173-90) | 2.69 | 3 | 0 | quaternary ammonium ion | |
| thalidomide Thalidomide: A piperidinyl isoindole originally introduced as a non-barbiturate hypnotic, but withdrawn from the market due to teratogenic effects. It has been reintroduced and used for a number of immunological and inflammatory disorders. Thalidomide displays immunosuppressive and anti-angiogenic activity. It inhibits release of TUMOR NECROSIS FACTOR-ALPHA from monocytes, and modulates other cytokine action.. thalidomide : A racemate comprising equimolar amounts of R- and S-thalidomide.. 2-(2,6-dioxopiperidin-3-yl)-1H-isoindole-1,3(2H)-dione : A dicarboximide that is isoindole-1,3(2H)-dione in which the hydrogen attached to the nitrogen is substituted by a 2,6-dioxopiperidin-3-yl group. | 5.91 | 4 | 0 | phthalimides; piperidones | |
| theobromine Theobromine: 3,7-Dimethylxanthine. The principle alkaloid in Theobroma cacao (the cacao bean) and other plants. A xanthine alkaloid that is used as a bronchodilator and as a vasodilator. It has a weaker diuretic activity than THEOPHYLLINE and is also a less powerful stimulant of smooth muscle. It has practically no stimulant effect on the central nervous system. It was formerly used as a diuretic and in the treatment of angina pectoris and hypertension. (From Martindale, The Extra Pharmacopoeia, 30th ed, pp1318-9). theobromine : A dimethylxanthine having the two methyl groups located at positions 3 and 7. A purine alkaloid derived from the cacao plant, it is found in chocolate, as well as in a number of other foods, and is a vasodilator, diuretic and heart stimulator. | 2.41 | 1 | 0 | dimethylxanthine | adenosine receptor antagonist; bronchodilator agent; food component; human blood serum metabolite; mouse metabolite; plant metabolite; vasodilator agent |
| thiotepa Thiotepa: A very toxic alkylating antineoplastic agent also used as an insect sterilant. It causes skin, gastrointestinal, CNS, and bone marrow damage. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), thiotepa may reasonably be anticipated to be a carcinogen (Merck Index, 11th ed). | 3.05 | 1 | 0 | aziridines | |
| ticlopidine Ticlopidine: An effective inhibitor of platelet aggregation commonly used in the placement of STENTS in CORONARY ARTERIES.. ticlopidine : A thienopyridine that is 4,5,6,7-tetrahydrothieno[3,2-c]pyridine in which the hydrogen attached to the nitrogen is replaced by an o-chlorobenzyl group. | 3.43 | 1 | 1 | monochlorobenzenes; thienopyridine | anticoagulant; fibrin modulating drug; hematologic agent; P2Y12 receptor antagonist; platelet aggregation inhibitor |
| tilorone Tilorone: An antiviral agent used as its hydrochloride. It is the first recognized synthetic, low-molecular-weight compound that is an orally active interferon inducer, and is also reported to have antineoplastic and anti-inflammatory actions.. tilorone : A member of the class of fluoren-9-ones that is 9H-fluoren-9-one which is substituted by a 2-(diethylamino)ethoxy group at positions 2 and 7. It is an interferon inducer and a selective alpha7 nicotinic acetylcholine receptor (alpha7 nAChR) agonist. Its hydrochloride salt is used as an antiviral drug. | 1.97 | 1 | 0 | aromatic ether; diether; fluoren-9-ones; tertiary amino compound | anti-inflammatory agent; antineoplastic agent; antiviral agent; interferon inducer; nicotinic acetylcholine receptor agonist |
| tiopronin Tiopronin: Sulfhydryl acylated derivative of GLYCINE. | 2.96 | 4 | 0 | N-acyl-amino acid | |
| trifluoperazine [no description available] | 2.08 | 1 | 0 | N-alkylpiperazine; N-methylpiperazine; organofluorine compound; phenothiazines | antiemetic; calmodulin antagonist; dopaminergic antagonist; EC 1.8.1.12 (trypanothione-disulfide reductase) inhibitor; EC 5.3.3.5 (cholestenol Delta-isomerase) inhibitor; phenothiazine antipsychotic drug |
| trioxsalen Trioxsalen: Pigmenting photosensitizing agent obtained from several plants, mainly Psoralea corylifolia. It is administered either topically or orally in conjunction with ultraviolet light in the treatment of vitiligo.. lactone : Any cyclic carboxylic ester containing a 1-oxacycloalkan-2-one structure, or an analogue having unsaturation or heteroatoms replacing one or more carbon atoms of the ring.. antipsoriatic : A drug used to treat psoriasis.. trioxsalen : 7H-Furo[3,2-g]chromen-7-one in which positions 2, 5, and 9 are substituted by methyl groups. Like other psoralens, trioxsalen causes photosensitization of the skin. It is administered orally in conjunction with UV-A for phototherapy treatment of vitiligo. After photoactivation it creates interstrand cross-links in DNA, inhibiting DNA synthesis and cell division, and can lead to cell injury; recovery from the cell injury may be followed by increased melanisation of the epidermis. | 4.8 | 10 | 0 | psoralens | dermatologic drug; photosensitizing agent |
| troglitazone Troglitazone: A chroman and thiazolidinedione derivative that acts as a PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORS (PPAR) agonist. It was formerly used in the treatment of TYPE 2 DIABETES MELLITUS, but has been withdrawn due to hepatotoxicity. | 2.7 | 3 | 0 | chromanes; thiazolidinone | anticoagulant; anticonvulsant; antineoplastic agent; antioxidant; EC 6.2.1.3 (long-chain-fatty-acid--CoA ligase) inhibitor; ferroptosis inhibitor; hypoglycemic agent; platelet aggregation inhibitor; vasodilator agent |
| tyramine [no description available] | 3.14 | 5 | 0 | monoamine molecular messenger; primary amino compound; tyramines | EC 3.1.1.8 (cholinesterase) inhibitor; Escherichia coli metabolite; human metabolite; mouse metabolite; neurotransmitter |
| urethane [no description available] | 2.37 | 2 | 0 | carbamate ester | fungal metabolite; mutagen |
| pirinixic acid pirinixic acid: structure | 2.01 | 1 | 0 | aryl sulfide; organochlorine compound; pyrimidines | |
| zinc chloride zinc chloride: RN given refers to parent cpd. zinc dichloride : A compound of zinc and chloride ions in the ratio 1:2. It exists in four crystalline forms, in each of which the Zn(2+) ions are trigonal planar coordinated to four chloride ions. | 2.72 | 3 | 0 | inorganic chloride; zinc molecular entity | astringent; disinfectant; EC 5.3.3.5 (cholestenol Delta-isomerase) inhibitor; Lewis acid |
| zolpidem Zolpidem: An imidazopyridine derivative and short-acting GABA-A receptor agonist that is used for the treatment of INSOMNIA.. zolpidem : An imidazo[1,2-a]pyridine compound having a 4-tolyl group at the 2-position, an N,N-dimethylcarbamoylmethyl group at the 3-position and a methyl substituent at the 6-position. | 2.31 | 1 | 0 | imidazopyridine | central nervous system depressant; GABA agonist; sedative |
| zopiclone zopiclone: S(+)-enantiomer of racemic zopiclone; azabicyclo(4.3.0)nonane; a nonbenzodiazepine; one of the so-called of Z drugs (zopiclone, eszopiclone, zolpidem, and zaleplon) for which there is some correlation with tumors; was term of zopiclone 2004-2007. zopiclone : A pyrrolo[3,4-b]pyrazine compound having a 4-methylpiperazine-1-carboxyl group at the 5-position, a 5-chloropyridin-2-yl group at the 6-position and an oxo-substituent at the 7-position. | 2.02 | 1 | 0 | monochloropyridine; pyrrolopyrazine | central nervous system depressant; sedative |
| mitomycin Mitomycin: An antineoplastic antibiotic produced by Streptomyces caespitosus. It is one of the bi- or tri-functional ALKYLATING AGENTS causing cross-linking of DNA and inhibition of DNA synthesis.. mitomycin : A family of aziridine-containing natural products isolated from Streptomyces caespitosus or Streptomyces lavendulae. | 9.75 | 9 | 0 | mitomycin | alkylating agent; antineoplastic agent |
| corticosterone [no description available] | 2.4 | 2 | 0 | 11beta-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone | human metabolite; mouse metabolite |
| prednisolone Prednisolone: A glucocorticoid with the general properties of the corticosteroids. It is the drug of choice for all conditions in which routine systemic corticosteroid therapy is indicated, except adrenal deficiency states.. prednisolone : A glucocorticoid that is prednisone in which the oxo group at position 11 has been reduced to the corresponding beta-hydroxy group. It is a drug metabolite of prednisone. | 2.25 | 1 | 0 | 11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone | adrenergic agent; anti-inflammatory drug; antineoplastic agent; drug metabolite; environmental contaminant; immunosuppressive agent; xenobiotic |
| reserpine Reserpine: An alkaloid found in the roots of Rauwolfia serpentina and R. vomitoria. Reserpine inhibits the uptake of norepinephrine into storage vesicles resulting in depletion of catecholamines and serotonin from central and peripheral axon terminals. It has been used as an antihypertensive and an antipsychotic as well as a research tool, but its adverse effects limit its clinical use.. reserpine : An alkaloid found in the roots of Rauwolfia serpentina and R. vomitoria. | 2.39 | 2 | 0 | alkaloid ester; methyl ester; yohimban alkaloid | adrenergic uptake inhibitor; antihypertensive agent; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; environmental contaminant; first generation antipsychotic; plant metabolite; xenobiotic |
| sorbitol D-glucitol : The D-enantiomer of glucitol (also known as D-sorbitol). | 2.7 | 3 | 0 | glucitol | cathartic; Escherichia coli metabolite; food humectant; human metabolite; laxative; metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite; sweetening agent |
| thymidine [no description available] | 8.26 | 208 | 0 | pyrimidine 2'-deoxyribonucleoside | Escherichia coli metabolite; human metabolite; metabolite; mouse metabolite |
| floxuridine Floxuridine: An antineoplastic antimetabolite that is metabolized to fluorouracil when administered by rapid injection; when administered by slow, continuous, intra-arterial infusion, it is converted to floxuridine monophosphate. It has been used to treat hepatic metastases of gastrointestinal adenocarcinomas and for palliation in malignant neoplasms of the liver and gastrointestinal tract.. floxuridine : A pyrimidine 2'-deoxyribonucleoside compound having 5-fluorouracil as the nucleobase; used to treat hepatic metastases of gastrointestinal adenocarcinomas and for palliation in malignant neoplasms of the liver and gastrointestinal tract. | 8.41 | 7 | 0 | nucleoside analogue; organofluorine compound; pyrimidine 2'-deoxyribonucleoside | antimetabolite; antineoplastic agent; antiviral drug; radiosensitizing agent |
| benzimidazole 1H-benzimidazole : The 1H-tautomer of benzimidazole. | 2.1 | 1 | 0 | benzimidazole; polycyclic heteroarene | |
| 2-aminophenol [no description available] | 2.1 | 1 | 0 | aminophenol | bacterial metabolite |
| bromouracil Bromouracil: 5-Bromo-2,4(1H,3H)-pyrimidinedione. Brominated derivative of uracil that acts as an antimetabolite, substituting for thymine in DNA. It is used mainly as an experimental mutagen, but its deoxyriboside (BROMODEOXYURIDINE) is used to treat neoplasms.. 5-bromouracil : A pyrimidine having keto groups at the 2- and 4-positions and a bromo group at the 5-position. Used mainly as an experimental mutagen. | 5.12 | 14 | 0 | nucleobase analogue; pyrimidines | mutagen |
| hydroxyproline Hydroxyproline: A hydroxylated form of the imino acid proline. A deficiency in ASCORBIC ACID can result in impaired hydroxyproline formation.. hydroxyproline : A proline derivative that is proline substituted by at least one hydroxy group. | 2.72 | 3 | 0 | 4-hydroxyproline; L-alpha-amino acid zwitterion | human metabolite; mouse metabolite; plant metabolite |
| thyroxine Thyroxine: The major hormone derived from the thyroid gland. Thyroxine is synthesized via the iodination of tyrosines (MONOIODOTYROSINE) and the coupling of iodotyrosines (DIIODOTYROSINE) in the THYROGLOBULIN. Thyroxine is released from thyroglobulin by proteolysis and secreted into the blood. Thyroxine is peripherally deiodinated to form TRIIODOTHYRONINE which exerts a broad spectrum of stimulatory effects on cell metabolism.. thyroxine : An iodothyronine compound having iodo substituents at the 3-, 3'-, 5- and 5'-positions. | 7.68 | 3 | 0 | 2-halophenol; iodophenol; L-phenylalanine derivative; non-proteinogenic L-alpha-amino acid; thyroxine zwitterion; thyroxine | antithyroid drug; human metabolite; mouse metabolite; thyroid hormone |
| carbachol Carbachol: A slowly hydrolyzed CHOLINERGIC AGONIST that acts at both MUSCARINIC RECEPTORS and NICOTINIC RECEPTORS. | 2.04 | 1 | 0 | ammonium salt; carbamate ester | cardiotonic drug; miotic; muscarinic agonist; nicotinic acetylcholine receptor agonist; non-narcotic analgesic |
| spironolactone Spironolactone: A potassium sparing diuretic that acts by antagonism of aldosterone in the distal renal tubules. It is used mainly in the treatment of refractory edema in patients with congestive heart failure, nephrotic syndrome, or hepatic cirrhosis. Its effects on the endocrine system are utilized in the treatments of hirsutism and acne but they can lead to adverse effects. (From Martindale, The Extra Pharmacopoeia, 30th ed, p827). spironolactone : A steroid lactone that is 17alpha-pregn-4-ene-21,17-carbolactone substituted by an oxo group at position 3 and an alpha-acetylsulfanyl group at position 7. | 2.76 | 3 | 0 | 3-oxo-Delta(4) steroid; oxaspiro compound; steroid lactone; thioester | aldosterone antagonist; antihypertensive agent; diuretic; environmental contaminant; xenobiotic |
| aldosterone [no description available] | 2.42 | 2 | 0 | 11beta-hydroxy steroid; 18-oxo steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(4) steroid; C21-steroid hormone; mineralocorticoid; primary alpha-hydroxy ketone; steroid aldehyde | human metabolite; mouse metabolite |
| penicillamine Penicillamine: 3-Mercapto-D-valine. The most characteristic degradation product of the penicillin antibiotics. It is used as an antirheumatic and as a chelating agent in Wilson's disease.. penicillamine : An alpha-amino acid having the structure of valine substituted at the beta position with a sulfanyl group. | 2.7 | 3 | 0 | non-proteinogenic alpha-amino acid; penicillamine | antirheumatic drug; chelator; copper chelator; drug allergen |
| tetrahydrocortisol [no description available] | 2.01 | 1 | 0 | 11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3alpha-hydroxy steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone | |
| prednisone Prednisone: A synthetic anti-inflammatory glucocorticoid derived from CORTISONE. It is biologically inert and converted to PREDNISOLONE in the liver.. prednisone : A synthetic glucocorticoid drug that is particularly effective as an immunosuppressant, and affects virtually all of the immune system. Prednisone is a prodrug that is converted by the liver into prednisolone (a beta-hydroxy group instead of the oxo group at position 11), which is the active drug and also a steroid. | 6.82 | 6 | 2 | 11-oxo steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone | adrenergic agent; anti-inflammatory drug; antineoplastic agent; immunosuppressive agent; prodrug |
| estrone Hydroxyestrones: Estrone derivatives substituted with one or more hydroxyl groups in any position. They are important metabolites of estrone and other estrogens. | 2.39 | 2 | 0 | 17-oxo steroid; 3-hydroxy steroid; phenolic steroid; phenols | antineoplastic agent; bone density conservation agent; estrogen; human metabolite; mouse metabolite |
| dehydroepiandrosterone Dehydroepiandrosterone: A major C19 steroid produced by the ADRENAL CORTEX. It is also produced in small quantities in the TESTIS and the OVARY. Dehydroepiandrosterone (DHEA) can be converted to TESTOSTERONE; ANDROSTENEDIONE; ESTRADIOL; and ESTRONE. Most of DHEA is sulfated (DEHYDROEPIANDROSTERONE SULFATE) before secretion.. dehydroepiandrosterone : An androstanoid that is androst-5-ene substituted by a beta-hydroxy group at position 3 and an oxo group at position 17. It is a naturally occurring steroid hormone produced by the adrenal glands. | 4.02 | 2 | 0 | 17-oxo steroid; 3beta-hydroxy-Delta(5)-steroid; androstanoid | androgen; human metabolite; mouse metabolite |
| dichlororibofuranosylbenzimidazole Dichlororibofuranosylbenzimidazole: An RNA polymerase II transcriptional inhibitor. This compound terminates transcription prematurely by selective inhibition of RNA synthesis. It is used in research to study underlying mechanisms of cellular regulation. | 2.67 | 3 | 0 | ||
| 2-acetylaminofluorene 2-Acetylaminofluorene: A hepatic carcinogen whose mechanism of activation involves N-hydroxylation to the aryl hydroxamic acid followed by enzymatic sulfonation to sulfoxyfluorenylacetamide. It is used to study the carcinogenicity and mutagenicity of aromatic amines. | 3.76 | 11 | 0 | 2-acetamidofluorenes | antimitotic; carcinogenic agent; epitope; mutagen |
| azauridine Azauridine: A triazine nucleoside used as an antineoplastic antimetabolite. It interferes with pyrimidine biosynthesis thereby preventing formation of cellular nucleic acids. As the triacetate, it is also effective as an antipsoriatic. | 1.94 | 1 | 0 | N-glycosyl-1,2,4-triazine | antimetabolite; antineoplastic agent; drug metabolite |
| idoxuridine [no description available] | 4.93 | 11 | 0 | organoiodine compound; pyrimidine 2'-deoxyribonucleoside | antiviral drug; DNA synthesis inhibitor |
| pilocarpine Pilocarpine: A slowly hydrolyzed muscarinic agonist with no nicotinic effects. Pilocarpine is used as a miotic and in the treatment of glaucoma.. (+)-pilocarpine : The (+)-enantiomer of pilocarpine. | 2.49 | 2 | 0 | pilocarpine | antiglaucoma drug |
| triiodothyronine Triiodothyronine: A T3 thyroid hormone normally synthesized and secreted by the thyroid gland in much smaller quantities than thyroxine (T4). Most T3 is derived from peripheral monodeiodination of T4 at the 5' position of the outer ring of the iodothyronine nucleus. The hormone finally delivered and used by the tissues is mainly T3.. 3,3',5-triiodo-L-thyronine : An iodothyronine compound having iodo substituents at the 3-, 3'- and 5-positions. Although some is produced in the thyroid, most of the 3,3',5-triiodo-L-thyronine in the body is generated by mono-deiodination of L-thyroxine in the peripheral tissues. Its metabolic activity is about 3 to 5 times that of L-thyroxine. The sodium salt is used in the treatment of hypothyroidism. | 3.24 | 6 | 0 | 2-halophenol; amino acid zwitterion; iodophenol; iodothyronine | human metabolite; mouse metabolite; thyroid hormone |
| diethylnitrosamine Diethylnitrosamine: A nitrosamine derivative with alkylating, carcinogenic, and mutagenic properties.. N-nitrosodiethylamine : A nitrosamine that is N-ethylethanamine substituted by a nitroso group at the N-atom. | 2.11 | 1 | 0 | nitrosamine | carcinogenic agent; hepatotoxic agent; mutagen |
| carbon tetrachloride Carbon Tetrachloride: A solvent for oils, fats, lacquers, varnishes, rubber waxes, and resins, and a starting material in the manufacturing of organic compounds. Poisoning by inhalation, ingestion or skin absorption is possible and may be fatal. (Merck Index, 11th ed). tetrachloromethane : A chlorocarbon that is methane in which all the hydrogens have been replaced by chloro groups. | 2.98 | 4 | 0 | chlorocarbon; chloromethanes | hepatotoxic agent; refrigerant |
| cantharidin Cantharidin: A toxic compound, isolated from the Spanish fly or blistering beetle (Lytta (Cantharis) vesicatoria) and other insects. It is a potent and specific inhibitor of protein phosphatases 1 (PP1) and 2A (PP2A). This compound can produce severe skin inflammation, and is extremely toxic if ingested orally.. cantharidin : A monoterpenoid with an epoxy-bridged cyclic dicarboxylic anhydride structure secreted by many species of blister beetle, and most notably by the Spanish fly, Lytta vesicatoria. Natural toxin inhibitor of protein phosphatases 1 and 2A. | 2.03 | 1 | 0 | cyclic dicarboxylic anhydride; monoterpenoid | EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; herbicide |
| alanine Alanine: A non-essential amino acid that occurs in high levels in its free state in plasma. It is produced from pyruvate by transamination. It is involved in sugar and acid metabolism, increases IMMUNITY, and provides energy for muscle tissue, BRAIN, and the CENTRAL NERVOUS SYSTEM.. alanine : An alpha-amino acid that consists of propionic acid bearing an amino substituent at position 2. | 7.22 | 49 | 0 | alanine zwitterion; alanine; L-alpha-amino acid; proteinogenic amino acid; pyruvate family amino acid | EC 4.3.1.15 (diaminopropionate ammonia-lyase) inhibitor; fundamental metabolite |
| serine Serine: A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.. serine : An alpha-amino acid that is alanine substituted at position 3 by a hydroxy group. | 6.32 | 60 | 0 | L-alpha-amino acid; proteinogenic amino acid; serine family amino acid; serine zwitterion; serine | algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| benz(a)anthracene benz(a)anthracene: 4 fused rings of which one is angular in contrast to the linear NAPHTHACENES. tetraphene : An angular ortho-fused polycyclic arene consisting of four fused benzene rings. | 1.99 | 1 | 0 | ortho-fused polycyclic arene; tetraphenes | |
| 4-nitroquinoline-1-oxide 4-nitroquinoline N-oxide : A quinoline N-oxide carrying a nitro substituent at position 4. | 2.36 | 2 | 0 | C-nitro compound; quinoline N-oxide | carcinogenic agent |
| chloramphenicol Amphenicol: Chloramphenicol and its derivatives. | 9.23 | 18 | 0 | C-nitro compound; carboxamide; diol; organochlorine compound | antibacterial drug; antimicrobial agent; Escherichia coli metabolite; geroprotector; Mycoplasma genitalium metabolite; protein synthesis inhibitor |
| aspartic acid Aspartic Acid: One of the non-essential amino acids commonly occurring in the L-form. It is found in animals and plants, especially in sugar cane and sugar beets. It may be a neurotransmitter.. aspartic acid : An alpha-amino acid that consists of succinic acid bearing a single alpha-amino substituent. L-aspartic acid : The L-enantiomer of aspartic acid. | 4.67 | 28 | 0 | aspartate family amino acid; aspartic acid; L-alpha-amino acid; proteinogenic amino acid | Escherichia coli metabolite; mouse metabolite; neurotransmitter |
| glutamine Glutamine: A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.. L-glutamine : An optically active form of glutamine having L-configuration.. glutamine : An alpha-amino acid that consists of butyric acid bearing an amino substituent at position 2 and a carbamoyl substituent at position 4. | 4.06 | 15 | 0 | amino acid zwitterion; glutamine family amino acid; glutamine; L-alpha-amino acid; polar amino acid zwitterion; proteinogenic amino acid | EC 1.14.13.39 (nitric oxide synthase) inhibitor; Escherichia coli metabolite; human metabolite; metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite |
| lysine Lysine: An essential amino acid. It is often added to animal feed.. lysine : A diamino acid that is caproic (hexanoic) acid bearing two amino substituents at positions 2 and 6.. L-lysine : An L-alpha-amino acid; the L-isomer of lysine. | 11.6 | 79 | 0 | aspartate family amino acid; L-alpha-amino acid zwitterion; L-alpha-amino acid; lysine; organic molecular entity; proteinogenic amino acid | algal metabolite; anticonvulsant; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite |
| benzyltrimethylammonium benzyltrimethylammonium: RN given refers to parent cpd | 2.31 | 1 | 0 | ||
| cyanides Cyanides: Inorganic salts of HYDROGEN CYANIDE containing the -CN radical. The concept also includes isocyanides. It is distinguished from NITRILES, which denotes organic compounds containing the -CN radical.. cyanides : Salts and C-organyl derivatives of hydrogen cyanide, HC#N.. isocyanide : The isomer HN(+)#C(-) of hydrocyanic acid, HC#N, and its hydrocarbyl derivatives RNC (RN(+)#C(-)).. cyanide : A pseudohalide anion that is the conjugate base of hydrogen cyanide. | 3.36 | 7 | 0 | pseudohalide anion | EC 1.9.3.1 (cytochrome c oxidase) inhibitor |
| sucrose Saccharum: A plant genus of the family POACEAE widely cultivated in the tropics for the sweet cane that is processed into sugar. | 9.17 | 16 | 0 | glycosyl glycoside | algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; osmolyte; Saccharomyces cerevisiae metabolite; sweetening agent |
| ethinyl estradiol Ethinyl Estradiol: A semisynthetic alkylated ESTRADIOL with a 17-alpha-ethinyl substitution. It has high estrogenic potency when administered orally, and is often used as the estrogenic component in ORAL CONTRACEPTIVES.. 17alpha-ethynylestradiol : A 3-hydroxy steroid that is estradiol substituted by a ethynyl group at position 17. It is a xenoestrogen synthesized from estradiol and has been shown to exhibit high estrogenic potency on oral administration. | 2.15 | 1 | 0 | 17-hydroxy steroid; 3-hydroxy steroid; terminal acetylenic compound | xenoestrogen |
| 9,10-dimethyl-1,2-benzanthracene 9,10-Dimethyl-1,2-benzanthracene: Polycyclic aromatic hydrocarbon found in tobacco smoke that is a potent carcinogen.. 7,12-dimethyltetraphene : A tetraphene having methyl substituents at the 7- and 12-positions. It is a potent carcinogen and is present in tobacco smoke. | 1.97 | 1 | 0 | ortho-fused polycyclic arene; tetraphenes | carcinogenic agent |
| apomorphine Apomorphine: A derivative of morphine that is a dopamine D2 agonist. It is a powerful emetic and has been used for that effect in acute poisoning. It has also been used in the diagnosis and treatment of parkinsonism, but its adverse effects limit its use. | 2 | 1 | 0 | aporphine alkaloid | alpha-adrenergic drug; antidyskinesia agent; antiparkinson drug; dopamine agonist; emetic; serotonergic drug |
| aminopyrine Aminopyrine: A pyrazolone with analgesic, anti-inflammatory, and antipyretic properties but has risk of AGRANULOCYTOSIS. A breath test with 13C-labeled aminopyrine has been used as a non-invasive measure of CYTOCHROME P-450 metabolic activity in LIVER FUNCTION TESTS.. aminophenazone : A pyrazolone that is 1,2-dihydro-3H-pyrazol-3-one substituted by a dimethylamino group at position 4, methyl groups at positions 1 and 5 and a phenyl group at position 2. It exhibits analgesic, anti-inflammatory, and antipyretic properties. | 2.43 | 2 | 0 | pyrazolone; tertiary amino compound | antipyretic; environmental contaminant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic |
| puromycin aminonucleoside 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine: structure in first source. 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine : Puromycin derivative that lacks the methoxyphenylalanyl group on the amine of the sugar ring. | 2.48 | 2 | 0 | 3'-deoxyribonucleoside; adenosines | |
| adenosine diphosphate Adenosine Diphosphate: Adenosine 5'-(trihydrogen diphosphate). An adenine nucleotide containing two phosphate groups esterified to the sugar moiety at the 5'-position. | 4.57 | 26 | 0 | adenosine 5'-phosphate; purine ribonucleoside 5'-diphosphate | fundamental metabolite; human metabolite |
| uridine [no description available] | 7.82 | 135 | 0 | uridines | drug metabolite; fundamental metabolite; human metabolite |
| uridine monophosphate Uridine Monophosphate: 5'-Uridylic acid. A uracil nucleotide containing one phosphate group esterified to the sugar moiety in the 2', 3' or 5' position.. uridine 5'-monophosphate : A pyrimidine ribonucleoside 5'-monophosphate having uracil as the nucleobase. | 4.41 | 22 | 0 | pyrimidine ribonucleoside 5'-monophosphate; uridine 5'-phosphate | Escherichia coli metabolite; human metabolite; mouse metabolite |
| uridine diphosphate Uridine Diphosphate: A uracil nucleotide containing a pyrophosphate group esterified to C5 of the sugar moiety. | 2.89 | 4 | 0 | pyrimidine ribonucleoside 5'-diphosphate; uridine 5'-phosphate | Escherichia coli metabolite; mouse metabolite |
| kanamycin a Kanamycin: Antibiotic complex produced by Streptomyces kanamyceticus from Japanese soil. Comprises 3 components: kanamycin A, the major component, and kanamycins B and C, the minor components.. kanamycin : Kanamycin is a naturally occurring antibiotic complex from Streptomyces kanamyceticus that consists of several components: kanamycin A, the major component (also usually designated as kanamycin), and kanamycins B, C, D and X the minor components. | 4.19 | 15 | 0 | kanamycins | bacterial metabolite |
| bromodeoxyuridine Bromodeoxyuridine: A nucleoside that substitutes for thymidine in DNA and thus acts as an antimetabolite. It causes breaks in chromosomes and has been proposed as an antiviral and antineoplastic agent. It has been given orphan drug status for use in the treatment of primary brain tumors. | 7.37 | 34 | 1 | pyrimidine 2'-deoxyribonucleoside | antimetabolite; antineoplastic agent |
| galactose galactopyranose : The pyranose form of galactose. | 4.26 | 18 | 0 | D-galactose; galactopyranose | Escherichia coli metabolite; mouse metabolite |
| carbostyril Quinolones: A group of derivatives of naphthyridine carboxylic acid, quinoline carboxylic acid, or NALIDIXIC ACID.. quinolin-2(1H)-one : A quinolone that is 1,2-dihydroquinoline substituted by an oxo group at position 2. | 5.05 | 7 | 0 | monohydroxyquinoline; quinolone | bacterial xenobiotic metabolite |
| levodopa Levodopa: The naturally occurring form of DIHYDROXYPHENYLALANINE and the immediate precursor of DOPAMINE. Unlike dopamine itself, it can be taken orally and crosses the blood-brain barrier. It is rapidly taken up by dopaminergic neurons and converted to DOPAMINE. It is used for the treatment of PARKINSONIAN DISORDERS and is usually given with agents that inhibit its conversion to dopamine outside of the central nervous system.. L-dopa : An optically active form of dopa having L-configuration. Used to treat the stiffness, tremors, spasms, and poor muscle control of Parkinson's disease | 2.05 | 1 | 0 | amino acid zwitterion; dopa; L-tyrosine derivative; non-proteinogenic L-alpha-amino acid | allelochemical; antidyskinesia agent; antiparkinson drug; dopaminergic agent; hapten; human metabolite; mouse metabolite; neurotoxin; plant growth retardant; plant metabolite; prodrug |
| edetic acid Edetic Acid: A chelating agent that sequesters a variety of polyvalent cations such as CALCIUM. It is used in pharmaceutical manufacturing and as a food additive. | 7.69 | 47 | 0 | ethylenediamine derivative; polyamino carboxylic acid; tetracarboxylic acid | anticoagulant; antidote; chelator; copper chelator; geroprotector |
| p-dimethylaminoazobenzene p-Dimethylaminoazobenzene: A reagent used mainly to induce experimental liver cancer. According to the Fourth Annual Report on Carcinogens (NTP 85-002, p. 89) published in 1985, this compound may reasonably be anticipated to be a carcinogen. (Merck, 11th ed) | 2.97 | 4 | 0 | azobenzenes | |
| phenylethyl alcohol Phenylethyl Alcohol: An antimicrobial, antiseptic, and disinfectant that is used also as an aromatic essence and preservative in pharmaceutics and perfumery.. 2-phenylethanol : A primary alcohol that is ethanol substituted by a phenyl group at position 2. | 1.98 | 1 | 0 | benzenes; primary alcohol | Aspergillus metabolite; fragrance; plant growth retardant; plant metabolite; Saccharomyces cerevisiae metabolite |
| tyrosine Tyrosine: A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.. tyrosine : An alpha-amino acid that is phenylalanine bearing a hydroxy substituent at position 4 on the phenyl ring. | 7.41 | 90 | 0 | amino acid zwitterion; erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid; proteinogenic amino acid; tyrosine | EC 1.3.1.43 (arogenate dehydrogenase) inhibitor; fundamental metabolite; micronutrient; nutraceutical |
| cysteamine Cysteamine: A mercaptoethylamine compound that is endogenously derived from the COENZYME A degradative pathway. The fact that cysteamine is readily transported into LYSOSOMES where it reacts with CYSTINE to form cysteine-cysteamine disulfide and CYSTEINE has led to its use in CYSTINE DEPLETING AGENTS for the treatment of CYSTINOSIS.. cysteamine : An amine that consists of an ethane skeleton substituted with a thiol group at C-1 and an amino group at C-2. | 2.11 | 1 | 0 | amine; thiol | geroprotector; human metabolite; mouse metabolite; radiation protective agent |
| methoxamine Methoxamine: An alpha-1 adrenergic agonist that causes prolonged peripheral VASOCONSTRICTION.. methoxamine : An amphetamine in which the parent 1-phenylpropan-2-amine skeleton is substituted at position 1 with an hydroxy group and the phenyl ring is 2- and 5-substituted with methoxy groups. It is an antihypotensive agent (pressor), an agonist acting directly at alpha-adrenoceptors with selectivity for the alpha-1 adrenoceptor subtype similar to phenylephrine . | 2 | 1 | 0 | amphetamines | alpha-adrenergic agonist; antihypotensive agent |
| adenosine monophosphate Adenosine Monophosphate: Adenine nucleotide containing one phosphate group esterified to the sugar moiety in the 2'-, 3'-, or 5'-position. | 7.97 | 64 | 0 | adenosine 5'-phosphate; purine ribonucleoside 5'-monophosphate | adenosine A1 receptor agonist; cofactor; EC 3.1.3.1 (alkaline phosphatase) inhibitor; EC 3.1.3.11 (fructose-bisphosphatase) inhibitor; fundamental metabolite; micronutrient; nutraceutical |
| methicillin Methicillin: One of the PENICILLINS which is resistant to PENICILLINASE but susceptible to a penicillin-binding protein. It is inactivated by gastric acid so administered by injection.. methicillin : A penicillin that is 6-aminopenicillanic acid in which one of the amino hydrogens is replaced by a 2,6-dimethoxybenzoyl group. | 2.42 | 2 | 0 | penicillin allergen; penicillin | antibacterial drug |
| methylene blue Methylene Blue: A compound consisting of dark green crystals or crystalline powder, having a bronze-like luster. Solutions in water or alcohol have a deep blue color. Methylene blue is used as a bacteriologic stain and as an indicator. It inhibits GUANYLATE CYCLASE, and has been used to treat cyanide poisoning and to lower levels of METHEMOGLOBIN.. methylene blue : An organic chloride salt having 3,7-bis(dimethylamino)phenothiazin-5-ium as the counterion. A commonly used dye that also exhibits antioxidant, antimalarial, antidepressant and cardioprotective properties. | 4.31 | 18 | 0 | organic chloride salt | acid-base indicator; antidepressant; antimalarial; antimicrobial agent; antioxidant; cardioprotective agent; EC 1.4.3.4 (monoamine oxidase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; EC 4.6.1.2 (guanylate cyclase) inhibitor; fluorochrome; histological dye; neuroprotective agent; physical tracer |
| leucine Leucine: An essential branched-chain amino acid important for hemoglobin formation.. leucine : A branched-chain amino acid that consists of glycine in which one of the hydrogens attached to the alpha-carbon is substituted by an isobutyl group. | 4.71 | 30 | 0 | amino acid zwitterion; L-alpha-amino acid; leucine; proteinogenic amino acid; pyruvate family amino acid | algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| ethyl methanesulfonate Ethyl Methanesulfonate: An antineoplastic agent with alkylating properties. It also acts as a mutagen by damaging DNA and is used experimentally for that effect.. ethyl methanesulfonate : A methanesulfonate ester resulting from the formal condensation of methanesulfonic acid with ethanol. | 2.95 | 4 | 0 | methanesulfonate ester | alkylating agent; antineoplastic agent; carcinogenic agent; genotoxin; mutagen; teratogenic agent |
| aniline [no description available] | 2.71 | 3 | 0 | anilines; primary arylamine | |
| 2-aminoisobutyric acid 2-aminoisobutyric acid: RN given refers to unlabeled cpd. 2-aminoisobutyric acid : A rare, non-protein amino acid and end-product of pyrimidine metabolism, excreted in urine and found in some antibiotics of fungal origin. With the exception of a few bacteria, it is non-metabolisable, and therefore used in bioassays. | 2.81 | 3 | 0 | 2,2-dialkylglycine zwitterion; 2,2-dialkylglycine | |
| cytidine monophosphate Cytidine Monophosphate: Cytidine (dihydrogen phosphate). A cytosine nucleotide containing one phosphate group esterified to the sugar moiety in the 2', 3' or 5' position.. cytidine 5'-monophosphate : A pyrimidine ribonucleoside 5'-monophosphate having cytosine as the nucleobase. | 4.26 | 19 | 0 | cytidine 5'-phosphate; pyrimidine ribonucleoside 5'-monophosphate | Escherichia coli metabolite; human metabolite; mouse metabolite |
| cytidine diphosphate Cytidine Diphosphate: Cytidine 5'-(trihydrogen diphosphate). A cytosine nucleotide containing two phosphate groups esterified to the sugar moiety. Synonyms: CRPP; cytidine pyrophosphate. | 1.95 | 1 | 0 | cytidine 5'-phosphate; pyrimidine ribonucleoside 5'-diphosphate | Escherichia coli metabolite; mouse metabolite |
| uridine triphosphate Uridine Triphosphate: Uridine 5'-(tetrahydrogen triphosphate). A uracil nucleotide containing three phosphate groups esterified to the sugar moiety. | 4.09 | 15 | 0 | pyrimidine ribonucleoside 5'-triphosphate; uridine 5'-phosphate | Escherichia coli metabolite; mouse metabolite |
| lactose Lactose: A disaccharide of GLUCOSE and GALACTOSE in human and cow milk. It is used in pharmacy for tablets, in medicine as a nutrient, and in industry.. lactose : A glycosylglucose disaccharide, found most notably in milk, that consists of D-galactose and D-glucose fragments bonded through a beta-1->4 glycosidic linkage. The glucose fragment can be in either the alpha- or beta-pyranose form, whereas the galactose fragment can only have the beta-pyranose form.. beta-lactose : The beta-anomer of lactose. | 8.85 | 12 | 0 | lactose | |
| methionine Methionine: A sulfur-containing essential L-amino acid that is important in many body functions.. methionine : A sulfur-containing amino acid that is butyric acid bearing an amino substituent at position 2 and a methylthio substituent at position 4. | 7.08 | 66 | 0 | aspartate family amino acid; L-alpha-amino acid; methionine zwitterion; methionine; proteinogenic amino acid | antidote to paracetamol poisoning; human metabolite; micronutrient; mouse metabolite; nutraceutical |
| 1,2-dipalmitoylphosphatidylcholine 1,2-Dipalmitoylphosphatidylcholine: Synthetic phospholipid used in liposomes and lipid bilayers to study biological membranes. It is also a major constituent of PULMONARY SURFACTANTS. | 2.73 | 3 | 0 | ||
| phenylalanine Phenylalanine: An essential aromatic amino acid that is a precursor of MELANIN; DOPAMINE; noradrenalin (NOREPINEPHRINE), and THYROXINE.. L-phenylalanine : The L-enantiomer of phenylalanine.. phenylalanine : An aromatic amino acid that is alanine in which one of the methyl hydrogens is substituted by a phenyl group. | 11.78 | 82 | 0 | amino acid zwitterion; erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid; phenylalanine; proteinogenic amino acid | algal metabolite; EC 3.1.3.1 (alkaline phosphatase) inhibitor; Escherichia coli metabolite; human xenobiotic metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite |
| diethyl sulfate diethyl sulfate: RN given refers to parent cpd; structure. diethyl sulfate : The diethyl ester of sulfuric acid. | 2.03 | 1 | 0 | alkyl sulfate | alkylating agent; apoptosis inducer; carcinogenic agent; mutagen |
| colchicine (S)-colchicine : A colchicine that has (S)-configuration. It is a secondary metabolite, has anti-inflammatory properties and is used to treat gout, crystal-induced joint inflammation, familial Mediterranean fever, and many other conditions. | 2.39 | 2 | 0 | alkaloid; colchicine | anti-inflammatory agent; gout suppressant; mutagen |
| cytidine [no description available] | 7.69 | 79 | 0 | cytidines | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| cytidine triphosphate Cytidine Triphosphate: Cytidine 5'-(tetrahydrogen triphosphate). A cytosine nucleotide containing three phosphate groups esterified to the sugar moiety. | 3.37 | 7 | 0 | cytidine 5'-phosphate; pyrimidine ribonucleoside 5'-triphosphate | Escherichia coli metabolite; mouse metabolite |
| cycloheximide Cycloheximide: Antibiotic substance isolated from streptomycin-producing strains of Streptomyces griseus. It acts by inhibiting elongation during protein synthesis.. cycloheximide : A dicarboximide that is 4-(2-hydroxyethyl)piperidine-2,6-dione in which one of the hydrogens attached to the carbon bearing the hydroxy group is replaced by a 3,5-dimethyl-2-oxocyclohexyl group. It is an antibiotic produced by the bacterium Streptomyces griseus. | 4.5 | 24 | 0 | antibiotic fungicide; cyclic ketone; dicarboximide; piperidine antibiotic; piperidones; secondary alcohol | anticoronaviral agent; bacterial metabolite; ferroptosis inhibitor; neuroprotective agent; protein synthesis inhibitor |
| ficusin Ficusin: A naturally occurring furocoumarin, found in PSORALEA. After photoactivation with UV radiation, it binds DNA via single and double-stranded cross-linking.. psoralen : The simplest member of the class of psoralens that is 7H-furo[3,2-g]chromene having a keto group at position 7. It has been found in plants like Psoralea corylifolia and Ficus salicifolia. | 4.9 | 35 | 0 | psoralens | plant metabolite |
| egtazic acid Egtazic Acid: A chelating agent relatively more specific for calcium and less toxic than EDETIC ACID.. ethylene glycol bis(2-aminoethyl)tetraacetic acid : A diether that is ethylene glycol in which the hydrogens of the hydroxy groups have been replaced by 2-[bis(carboxymethyl)amino]ethyl group respectively. | 3.41 | 7 | 0 | diether; tertiary amino compound; tetracarboxylic acid | chelator |
| chloroform Chloroform: A commonly used laboratory solvent. It was previously used as an anesthetic, but was banned from use in the U.S. due to its suspected carcinogenicity.. chloroform : A one-carbon compound that is methane in which three of the hydrogens are replaced by chlorines. | 2.47 | 2 | 0 | chloromethanes; one-carbon compound | carcinogenic agent; central nervous system drug; inhalation anaesthetic; non-polar solvent; refrigerant |
| gliotoxin Gliotoxin: A fungal toxin produced by various species of Trichoderma, Gladiocladium fimbriatum, Aspergillus fumigatus, and Penicillium. It is used as an immunosuppressive agent.. gliotoxin : A pyrazinoindole with a disulfide bridge spanning a dioxo-substituted pyrazine ring; mycotoxin produced by several species of fungi. | 2.5 | 2 | 0 | dipeptide; organic disulfide; organic heterotetracyclic compound; pyrazinoindole | antifungal agent; EC 2.5.1.58 (protein farnesyltransferase) inhibitor; immunosuppressive agent; mycotoxin; proteasome inhibitor |
| sodium citrate, anhydrous Sodium Citrate: Sodium salts of citric acid that are used as buffers and food preservatives. They are used medically as anticoagulants in stored blood, and for urine alkalization in the prevention of KIDNEY STONES.. sodium citrate : The trisodium salt of citric acid. | 2 | 1 | 0 | organic sodium salt | anticoagulant; flavouring agent |
| bromoacetate [no description available] | 1.98 | 1 | 0 | carboxylic acid; organohalogen compound | |
| dimethylformamide Dimethylformamide: A formamide in which the amino hydrogens are replaced by methyl groups.. N,N-dimethylformamide : A member of the class of formamides that is formamide in which the amino hydrogens are replaced by methyl groups. | 2.15 | 1 | 0 | formamides; volatile organic compound | geroprotector; hepatotoxic agent; polar aprotic solvent |
| 17-alpha-hydroxyprogesterone 17alpha-hydroxyprogesterone : A 17alpha-hydroxy steroid that is the 17alpha-hydroxy derivative of progesterone. | 2.68 | 3 | 0 | 17alpha-hydroxy-C21-steroid; 17alpha-hydroxy steroid; tertiary alpha-hydroxy ketone | human metabolite; metabolite; mouse metabolite; progestin |
| tubercidin Tubercidin: An antibiotic purine ribonucleoside that readily substitutes for adenosine in the biological system, but its incorporation into DNA and RNA has an inhibitory effect on the metabolism of these nucleic acids.. tubercidin : An N-glycosylpyrrolopyrimidine that is adenosine in which the in the 5-membered ring that is not attached to the ribose moiety is replaced by a carbon. Tubercidin is produced in the culture broth of Streptomyces tubericidus. | 4.81 | 10 | 0 | antibiotic antifungal agent; N-glycosylpyrrolopyrimidine; ribonucleoside | antimetabolite; antineoplastic agent; bacterial metabolite |
| ampicillin Ampicillin: Semi-synthetic derivative of penicillin that functions as an orally active broad-spectrum antibiotic.. ampicillin : A penicillin in which the substituent at position 6 of the penam ring is a 2-amino-2-phenylacetamido group. | 2.42 | 2 | 0 | beta-lactam antibiotic; penicillin allergen; penicillin | antibacterial drug |
| mannitol [no description available] | 4.48 | 5 | 1 | mannitol | allergen; antiglaucoma drug; compatible osmolytes; Escherichia coli metabolite; food anticaking agent; food bulking agent; food humectant; food stabiliser; food thickening agent; hapten; metabolite; osmotic diuretic; sweetening agent |
| cytarabine [no description available] | 7.48 | 14 | 4 | beta-D-arabinoside; monosaccharide derivative; pyrimidine nucleoside | antimetabolite; antineoplastic agent; antiviral agent; immunosuppressive agent |
| dithionitrobenzoic acid Dithionitrobenzoic Acid: A standard reagent for the determination of reactive sulfhydryl groups by absorbance measurements. It is used primarily for the determination of sulfhydryl and disulfide groups in proteins. The color produced is due to the formation of a thio anion, 3-carboxyl-4-nitrothiophenolate.. dithionitrobenzoic acid : An organic disulfide that results from the formal oxidative dimerisation of 2-nitro-5-thiobenzoic acid. An indicator used to quantify the number or concentration of thiol groups. | 3.27 | 6 | 0 | nitrobenzoic acid; organic disulfide | indicator |
| trifluridine Trifluridine: An antiviral derivative of THYMIDINE used mainly in the treatment of primary keratoconjunctivitis and recurrent epithelial keratitis due to HERPES SIMPLEX virus. (From Martindale, The Extra Pharmacopoeia, 30th ed, p557). trifluridine : A pyrimidine 2'-deoxyribonucleoside compound having 5-trifluoromethyluracil as the nucleobase. An antiviral drug used mainly in the treatment of primary keratoconjunctivitis and recurrent epithelial keratitis. | 2.05 | 1 | 0 | nucleoside analogue; organofluorine compound; pyrimidine 2'-deoxyribonucleoside | antimetabolite; antineoplastic agent; antiviral drug; EC 2.1.1.45 (thymidylate synthase) inhibitor |
| ornithine Ornithine: An amino acid produced in the urea cycle by the splitting off of urea from arginine.. ornithine : An alpha-amino acid that is pentanoic acid bearing two amino substituents at positions 2 and 5. | 2.38 | 2 | 0 | non-proteinogenic L-alpha-amino acid; ornithine | algal metabolite; hepatoprotective agent; mouse metabolite |
| dinitrofluorobenzene Dinitrofluorobenzene: Irritants and reagents for labeling terminal amino acid groups.. 1-fluoro-2,4-dinitrobenzene : The organofluorine compound that is benzene with a fluoro substituent at the 1-position and two nitro substituents in the 2- and 4-positions. | 1.98 | 1 | 0 | C-nitro compound; organofluorine compound | agrochemical; allergen; chromatographic reagent; EC 2.7.3.2 (creatine kinase) inhibitor; protein-sequencing agent; spectrophotometric reagent |
| asparagine Asparagine: A non-essential amino acid that is involved in the metabolic control of cell functions in nerve and brain tissue. It is biosynthesized from ASPARTIC ACID and AMMONIA by asparagine synthetase. (From Concise Encyclopedia Biochemistry and Molecular Biology, 3rd ed). asparagine : An alpha-amino acid in which one of the hydrogens attached to the alpha-carbon of glycine is substituted by a 2-amino-2-oxoethyl group. | 4.14 | 16 | 0 | amino acid zwitterion; asparagine; aspartate family amino acid; L-alpha-amino acid; proteinogenic amino acid | Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite |
| histidine Histidine: An essential amino acid that is required for the production of HISTAMINE.. L-histidine : The L-enantiomer of the amino acid histidine.. histidine : An alpha-amino acid that is propanoic acid bearing an amino substituent at position 2 and a 1H-imidazol-4-yl group at position 3. | 12.23 | 73 | 0 | amino acid zwitterion; histidine; L-alpha-amino acid; polar amino acid zwitterion; proteinogenic amino acid | algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite |
| valine Valine: A branched-chain essential amino acid that has stimulant activity. It promotes muscle growth and tissue repair. It is a precursor in the penicillin biosynthetic pathway.. valine : A branched-chain amino acid that consists of glycine in which one of the hydrogens attached to the alpha-carbon is substituted by an isopropyl group.. L-valine : The L-enantiomer of valine. | 8.96 | 43 | 1 | L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid; pyruvate family amino acid; valine | algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite |
| threonine Threonine: An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.. threonine : An alpha-amino acid in which one of the hydrogens attached to the alpha-carbon of glycine is substituted by a 1-hydroxyethyl group. | 4.2 | 17 | 0 | amino acid zwitterion; aspartate family amino acid; L-alpha-amino acid; proteinogenic amino acid; threonine | algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite |
| alizarin [no description available] | 2.11 | 1 | 0 | dihydroxyanthraquinone | chromophore; dye; plant metabolite |
| cordycepin [no description available] | 1.99 | 1 | 0 | 3'-deoxyribonucleoside; adenosines | antimetabolite; nucleoside antibiotic |
| tryptophan Tryptophan: An essential amino acid that is necessary for normal growth in infants and for NITROGEN balance in adults. It is a precursor of INDOLE ALKALOIDS in plants. It is a precursor of SEROTONIN (hence its use as an antidepressant and sleep aid). It can be a precursor to NIACIN, albeit inefficiently, in mammals.. tryptophan : An alpha-amino acid that is alanine bearing an indol-3-yl substituent at position 3. | 6.43 | 56 | 0 | erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid; tryptophan zwitterion; tryptophan | antidepressant; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite |
| isoleucine Isoleucine: An essential branched-chain aliphatic amino acid found in many proteins. It is an isomer of LEUCINE. It is important in hemoglobin synthesis and regulation of blood sugar and energy levels.. isoleucine : A 2-amino-3-methylpentanoic acid having either (2R,3R)- or (2S,3S)-configuration.. L-isoleucine : The L-enantiomer of isoleucine. | 4.86 | 11 | 0 | aspartate family amino acid; isoleucine; L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid | algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| arginine Arginine: An essential amino acid that is physiologically active in the L-form.. arginine : An alpha-amino acid that is glycine in which the alpha-is substituted by a 3-guanidinopropyl group. | 7.79 | 59 | 0 | arginine; glutamine family amino acid; L-alpha-amino acid; proteinogenic amino acid | biomarker; Escherichia coli metabolite; micronutrient; mouse metabolite; nutraceutical |
| ethane Ethane: A two carbon alkane with the formula H3C-CH3.. ethane : An alkane comprising of two carbon atoms. | 2.71 | 3 | 0 | alkane; gas molecular entity | plant metabolite; refrigerant |
| ethylene Plastipore: high density polyethylene sponge biocompatible material; used as posts in dental bridges | 5 | 12 | 0 | alkene; gas molecular entity | plant hormone; refrigerant |
| acetylene [no description available] | 3.43 | 7 | 0 | alkyne; gas molecular entity; terminal acetylenic compound | |
| methylamine methyl group : An alkyl group that is the univalent group derived from methane by removal of a hydrogen atom. | 2.94 | 4 | 0 | methylamines; one-carbon compound; primary aliphatic amine | mouse metabolite |
| boranes Boranes: The collective name for the boron hydrides, which are analogous to the alkanes and silanes. Numerous boranes are known. Some have high calorific values and are used in high-energy fuels. (From Grant & Hackh's Chemical Dictionary, 5th ed). borane : The simplest borane, consisting of a single boron atom carrying three hydrogens.. boranes : The molecular hydrides of boron. | 5 | 12 | 0 | boranes; mononuclear parent hydride | |
| propane Propane: A three carbon alkane with the formula H3CCH2CH3. | 2.55 | 2 | 0 | alkane; gas molecular entity | food propellant |
| methylacetylene methylacetylene: structure | 2.01 | 1 | 0 | alkyne; gas molecular entity; terminal acetylenic compound | |
| vinyl chloride Vinyl Chloride: A gas that has been used as an aerosol propellant and is the starting material for polyvinyl resins. Toxicity studies have shown various adverse effects, particularly the occurrence of liver neoplasms.. chloroethene : A monohaloethene that is ethene in which one of the hydrogens has been replaced by a chloro group. | 7.42 | 2 | 0 | chloroethenes; gas molecular entity; monohaloethene | carcinogenic agent |
| acetonitrile acetonitrile: RN given refers to unlabeled cpd. acetonitrile : A nitrile that is hydrogen cyanide in which the hydrogen has been replaced by a methyl group. | 3.97 | 13 | 0 | aliphatic nitrile; volatile organic compound | EC 3.5.1.4 (amidase) inhibitor; NMR chemical shift reference compound; polar aprotic solvent |
| methylene chloride Methylene Chloride: A chlorinated hydrocarbon that has been used as an inhalation anesthetic and acts as a narcotic in high concentrations. Its primary use is as a solvent in manufacturing and food technology.. dichloromethane : A member of the class of chloromethanes that is methane in which two of the hydrogens have been replaced by chlorine. A dense, non-flammible colourless liquid at room temperature (b.p. 40degreeC, d = 1.33) which is immiscible with water, it is widely used as a solvent, a paint stripper, and for the removal of caffeine from coffee and tea. | 2.72 | 3 | 0 | chloromethanes; volatile organic compound | carcinogenic agent; polar aprotic solvent; refrigerant |
| cyclopropane cyclopropane : A cycloalkane composed of three carbon atoms to form a ring. | 3.82 | 3 | 0 | cycloalkane; cyclopropanes | inhalation anaesthetic |
| ethylene oxide Ethylene Oxide: A colorless and flammable gas at room temperature and pressure. Ethylene oxide is a bactericidal, fungicidal, and sporicidal disinfectant. It is effective against most micro-organisms, including viruses. It is used as a fumigant for foodstuffs and textiles and as an agent for the gaseous sterilization of heat-labile pharmaceutical and surgical materials. (From Reynolds, Martindale The Extra Pharmacopoeia, 30th ed, p794). oxirane : A saturated organic heteromonocyclic parent that is a three-membered heterocycle of two carbon atoms and one oxygen atom. | 2.71 | 3 | 0 | gas molecular entity; oxacycle; saturated organic heteromonocyclic parent | allergen; mouse metabolite; mutagen |
| propylene oxide propylene oxide: structure. 1,2-epoxypropane : An epoxide that is oxirane substituted by a methyl group at position 2. | 1.97 | 1 | 0 | epoxide | |
| tetramethylammonium tetramethylammonium: RN given refers to parent cpd. tetramethylammonium : The simplest quaternary ammonium cation, comprising a central nitrogen linked to four methyl groups. | 2.67 | 3 | 0 | quaternary ammonium ion | |
| tert-butyl alcohol tert-Butyl Alcohol: An isomer of butanol that contains a tertiary butyl group that consists of three methyl groups, each separately attached to a central (tertiary) carbon.. tert-butanol : A tertiary alcohol alcohol that is isobutane substituted by a hydroxy group at position 2. | 2.8 | 3 | 0 | tertiary alcohol | human xenobiotic metabolite |
| methanesulfonic acid [no description available] | 2.02 | 1 | 0 | alkanesulfonic acid; one-carbon compound | Escherichia coli metabolite |
| trichloroacetaldehyde trichloroacetaldehyde : An organochlorine compound that consists of acetaldehyde where all the methyl hydrogens are replaced by chloro groups. | 7.02 | 1 | 0 | aldehyde; organochlorine compound | mouse metabolite |
| trifluoroethanol Trifluoroethanol: A non-aqueous co-solvent that serves as tool to study protein folding. It is also used in various pharmaceutical, chemical and engineering applications. | 2.71 | 3 | 0 | fluoroalcohol | |
| tert-butylhydroperoxide tert-Butylhydroperoxide: A direct-acting oxidative stress-inducing agent used to examine the effects of oxidant stress on Ca(2+)-dependent signal transduction in vascular endothelial cells. It is also used as a catalyst in polymerization reactions and to introduce peroxy groups into organic molecules.. tert-butyl hydroperoxide : An alkyl hydroperoxide in which the alkyl group is tert-butyl. It is widely used in a variety of oxidation processes. | 2.1 | 1 | 0 | alkyl hydroperoxide | antibacterial agent; oxidising agent |
| trichloroacetic acid Trichloroacetic Acid: A strong acid used as a protein precipitant in clinical chemistry and also as a caustic for removing warts.. trichloroacetic acid : A monocarboxylic acid that is acetic acid in which all three methyl hydrogens are substituted by chlorine. | 2.69 | 3 | 0 | monocarboxylic acid; organochlorine compound | carcinogenic agent; metabolite; mouse metabolite |
| trifluoroacetic acid Trifluoroacetic Acid: A very strong halogenated derivative of acetic acid. It is used in acid catalyzed reactions, especially those where an ester is cleaved in peptide synthesis.. trifluoroacetic acid : A monocarboxylic acid that is the trifluoro derivative of acetic acid. | 2.71 | 3 | 0 | fluoroalkanoic acid | human xenobiotic metabolite; NMR chemical shift reference compound; reagent |
| phencyclidine Phencyclidine: A hallucinogen formerly used as a veterinary anesthetic, and briefly as a general anesthetic for humans. Phencyclidine is similar to KETAMINE in structure and in many of its effects. Like ketamine, it can produce a dissociative state. It exerts its pharmacological action through inhibition of NMDA receptors (RECEPTORS, N-METHYL-D-ASPARTATE). As a drug of abuse, it is known as PCP and Angel Dust.. phencyclidine : A member of the class of piperidines that is piperidine in which the nitrogen is substituted with a 1-phenylcyclohexyl group. Formerly used as an anaesthetic agent, it exhibits both hallucinogenic and neurotoxic effects. | 2 | 1 | 0 | benzenes; piperidines | anaesthetic; neurotoxin; NMDA receptor antagonist; psychotropic drug |
| divinyl sulfone divinyl sulfone: cross-linking reagent for agarose gels. divinyl sulfone : A sulfone compound having two S-vinyl substituents. | 2.07 | 1 | 0 | sulfone | cross-linking reagent |
| dimethyl sulfate dimethyl sulfate: RN given refers to unlabeled cpd; structure. dimethyl sulfate : The dimethyl ester of sulfuric acid. | 4.07 | 15 | 0 | alkyl sulfate | alkylating agent; immunosuppressive agent |
| tromethamine Tromethamine: An organic amine proton acceptor. It is used in the synthesis of surface-active agents and pharmaceuticals; as an emulsifying agent for cosmetic creams and lotions, mineral oil and paraffin wax emulsions, as a biological buffer, and used as an alkalizer. (From Merck, 11th ed; Martindale, The Extra Pharmacopoeia, 30th ed, p1424) | 3.52 | 8 | 0 | primary amino compound; triol | buffer |
| 3-mercaptopropionic acid 3-Mercaptopropionic Acid: An inhibitor of glutamate decarboxylase. It decreases the GAMMA-AMINOBUTYRIC ACID concentration in the brain, thereby causing convulsions.. 3-mercaptopropanoic acid : A mercaptopropanoic acid that is propanoic acid carrying a sulfanyl group at position 3. | 2.06 | 1 | 0 | mercaptopropanoic acid | algal metabolite |
| isoprene isoprene: used in manufacture of ''synthetic'' rubber, butyl rubber; copolymer in production of elastomers; structure. isoprene : A hemiterpene with the formula CH2=C(CH3)CH=CH2; the monomer of natural rubber and a common structure motif to the isoprenoids, a large class of other naturally occurring compounds. | 2.96 | 4 | 0 | alkadiene; hemiterpene; volatile organic compound | plant metabolite |
| isobutyl alcohol isobutyl alcohol: RN given refers to parent cpd | 2.1 | 1 | 0 | alkyl alcohol; primary alcohol | Saccharomyces cerevisiae metabolite |
| acrylamide [no description available] | 2.93 | 4 | 0 | acrylamides; N-acylammonia; primary carboxamide | alkylating agent; carcinogenic agent; Maillard reaction product; mutagen; neurotoxin |
| acrylic acid acrylic acid: RN given refers to parent cpd. acrylic acid : A alpha,beta-unsaturated monocarboxylic acid that is ethene substituted by a carboxy group. | 2.77 | 3 | 0 | alpha,beta-unsaturated monocarboxylic acid | metabolite |
| isobutyric acid isobutyric acid: RN given refers to parent cpd. isobutyric acid : A branched fatty acid comprising propanoic acid carrying a methyl branch at C-2. | 2.02 | 1 | 0 | branched-chain saturated fatty acid; fatty acid 4:0; methyl-branched fatty acid | Daphnia magna metabolite; plant metabolite; volatile oil component |
| methacrylamide [no description available] | 2.07 | 1 | 0 | acrylamides; primary carboxamide | |
| bisphenol a 4,4'-isopropylidene diphenol: stimulates proliferative responses and cytokine productions of murine spleen cells and thymus cells in vitro. bisphenol : By usage, the methylenediphenols, HOC6H4CH2C6H4OH, commonly p,p-methylenediphenol, and their substitution products (generally derived from condensation of two equivalent amounts of a phenol with an aldehyde or ketone). The term also includes analogues in the the methylene (or substituted methylene) group has been replaced by a heteroatom.. bisphenol A : A bisphenol that is 4,4'-methanediyldiphenol in which the methylene hydrogens are replaced by two methyl groups. | 3.36 | 5 | 0 | bisphenol | endocrine disruptor; environmental contaminant; xenobiotic; xenoestrogen |
| taurocholic acid Taurocholic Acid: The product of conjugation of cholic acid with taurine. Its sodium salt is the chief ingredient of the bile of carnivorous animals. It acts as a detergent to solubilize fats for absorption and is itself absorbed. It is used as a cholagogue and cholerectic.. taurocholate : An organosulfonate oxoanion that is the conjugate base of taurocholic acid.. taurocholic acid : A bile acid taurine conjugate of cholic acid that usually occurs as the sodium salt of bile in mammals. | 2.13 | 1 | 0 | amino sulfonic acid; bile acid taurine conjugate | human metabolite |
| rhodamine b rhodamine B: RN & N1 from 9th CI Form Index; RN given refers to parent cpd; structure in Merck Index, 9th ed, #7973; TETRAETHYLRHODAMINE was see RHODAMINES 1975-93; use RHODAMINES to search TETRAETHYLRHODAMINE 1975-93. rhodamine B : An organic chloride salt having N-[9-(2-carboxyphenyl)-6-(diethylamino)-3H-xanthen-3-ylidene]-N-ethylethanaminium as the counterion. An amphoteric dye commonly used as a fluorochrome. | 2.85 | 3 | 0 | organic chloride salt; xanthene dye | fluorescent probe; fluorochrome; histological dye |
| rotenone Derris: A plant genus of the family FABACEAE. The root is a source of rotenoids (ROTENONE) and flavonoids. Some species of Pongamia have been reclassified to this genus and some to MILLETTIA. Some species of Deguelia have been reclassified to this genus.. rotenoid : Members of the class of tetrahydrochromenochromene that consists of a cis-fused tetrahydrochromeno[3,4-b]chromene skeleton and its substituted derivatives. The term was originally restricted to natural products, but is now also used to describe semi-synthetic and fully synthetic compounds. | 2.02 | 1 | 0 | organic heteropentacyclic compound; rotenones | antineoplastic agent; metabolite; mitochondrial NADH:ubiquinone reductase inhibitor; phytogenic insecticide; piscicide; toxin |
| 9,10-phenanthrenequinone 9,10-phenanthrenequinone: structure | 1.98 | 1 | 0 | phenanthrenes | |
| 9,10-anthraquinone 9,10-anthraquinone : An anthraquinone that is anthracene in which positions 9 and 10 have been oxidised to carbonyls. | 7.05 | 1 | 0 | anthraquinone | |
| fluorene [no description available] | 2.03 | 1 | 0 | ortho-fused polycyclic arene; ortho-fused tricyclic hydrocarbon | |
| carbazole carbazole: structure in first source | 2.52 | 2 | 0 | carbazole | |
| 1-naphthaleneacetic acid 1-naphthaleneacetic acid: a plant growth regulator; RN given refers to parent cpd. naphthylacetic acid : A monocarboxylic acid that is naphthalene substituted by a carboxymethyl group at any position.. 1-naphthaleneacetic acid : A naphthylacetic acid substituted by a carboxymethyl group at position 1. | 2.02 | 1 | 0 | naphthylacetic acid | synthetic auxin |
| xylitol xylooligosaccharide: structure in first source. pentitol : An alditol obtained by reduction of any pentose.. xylooligosaccharide : An oligosaccharide comprised of xylose residues. | 1.99 | 1 | 0 | ||
| n-vinyl-2-pyrrolidinone N-vinyl-2-pyrrolidinone: monomer of POVIDONE; structure given in first source | 2.89 | 3 | 0 | pyrrolidin-2-ones | |
| picryl chloride Picryl Chloride: A hapten that generates suppressor cells capable of down-regulating the efferent phase of trinitrophenol-specific contact hypersensitivity. (Arthritis Rheum 1991 Feb;34(2):180).. 1-chloro-2,4,6-trinitrobenzene : The C-nitro compound that is chlorobenzene with three nitro substituents in the 2-, 4- and 6-positions. | 1.97 | 1 | 0 | C-nitro compound; monochlorobenzenes | allergen; epitope; explosive; hapten |
| salicylaldehyde o-hydroxybenzaldehyde: structure in first source | 2.71 | 3 | 0 | hydroxybenzaldehyde | nematicide; plant metabolite |
| aminacrine Aminacrine: A highly fluorescent anti-infective dye used clinically as a topical antiseptic and experimentally as a mutagen, due to its interaction with DNA. It is also used as an intracellular pH indicator.. 9-aminoacridine : An aminoacridine that is acridine in which the hydrogen at position 9 is replaced by an amino group. A fluorescent dyd and topical antiseptic agent, it is used (usually as the hydrochloride salt) in eye drops for the treatment of superficial eye infections. | 3.07 | 5 | 0 | aminoacridines; primary amino compound | acid-base indicator; antiinfective agent; antiseptic drug; fluorescent dye; MALDI matrix material; mutagen |
| quinoxalines quinoxaline : A naphthyridine in which the nitrogens are at positions 1 and 4. | 3.51 | 8 | 0 | mancude organic heterobicyclic parent; naphthyridine; ortho-fused heteroarene | |
| quinoline [no description available] | 3.1 | 5 | 0 | azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; quinolines | |
| 2-naphthylamine 2-Naphthylamine: A naphthalene derivative with carcinogenic action.. 2-naphthylamine : A naphthylamine carrying the amino group at position 2. | 2.94 | 4 | 0 | naphthylamine | carcinogenic agent |
| 3,3'-diaminobenzidine 3,3'-Diaminobenzidine: A chemically and thermodynamically stable derivative of BENZIDINE.. 3,3'-diaminobenzidine : A member of the class of biphenyls that is benzidine in which one of the hydrogens ortho to each of the amino groups has been replaced by an amino group. | 2.08 | 1 | 0 | biphenyls; substituted aniline | histological dye |
| diphenyl diphenyl: RN given refers to unlabeled cpd; structure | 2.51 | 2 | 0 | aromatic fungicide; benzenes; biphenyls | antifungal agrochemical; antimicrobial food preservative |
| proflavine Proflavine: Topical antiseptic used mainly in wound dressings.. 3,6-diaminoacridine : An aminoacridine that is acridine that is substituted by amino groups at positions 3 and 6. A slow-acting bacteriostat that is effective against many Gram-positive bacteria (but ineffective against spores), its salts were formerly used for treatment of burns and infected wounds. | 3.46 | 8 | 0 | aminoacridines | antibacterial agent; antiseptic drug; carcinogenic agent; chromophore; intercalator |
| 4-biphenylamine 4-biphenylamine: used in detection of sulfates, & as a carcinogen in cancer research; RN given refers to parent cpd; structure. biphenyl-4-amine : An aminobiphenyl that is biphenyl substituted by an amino group at position 4. | 2.21 | 1 | 0 | aminobiphenyl | carcinogenic agent |
| xanthenes Xanthenes: Compounds with three aromatic rings in linear arrangement with an OXYGEN in the center ring. | 3.9 | 12 | 0 | xanthene | |
| phenothiazine 10H-phenothiazine : The 10H-tautomer of phenothiazine. | 2.43 | 2 | 0 | phenothiazine | ferroptosis inhibitor; plant metabolite; radical scavenger |
| methyl benzoate methyl benzoate : A benzoate ester obtained by condensation of benzoic acid and methanol. | 2.11 | 1 | 0 | benzoate ester; methyl ester | insect attractant; metabolite |
| benzoyl peroxide Benzoyl Peroxide: A peroxide derivative that has been used topically for BURNS and as a dermatologic agent in the treatment of ACNE and POISON IVY DERMATITIS. It is used also as a bleach in the food industry. | 2.04 | 1 | 0 | carbonyl compound | |
| benzotriazole benzotriazole: inhibitor of atmospheric metal corrosion; also component of motion picture film & Neva brake fluid. benzotriazole : The simplest member of the class of benzotriazoles that consists of a benzene nucleus fused to a 1H-1,2,3-triazole ring. | 2.01 | 1 | 0 | benzotriazoles | environmental contaminant; xenobiotic |
| benzothiophene [no description available] | 2.41 | 1 | 0 | 1-benzothiophenes; benzothiophene | |
| benzothiazole benzothiazole: structure. benzothiazole : An organic heterobicyclic compound that is a fusion product between benzene and thiazole. The parent of the class of benzothiazoles. | 2.13 | 1 | 0 | benzothiazoles | environmental contaminant; plant metabolite; xenobiotic |
| styrene oxide styrene oxide: structure. styrene oxide : An epoxide that is oxirane in which one of the hydrogens has been replaced by a phenyl group. | 8.24 | 6 | 0 | epoxide | human xenobiotic metabolite |
| 4-butyrolactone 4-Butyrolactone: One of the FURANS with a carbonyl thereby forming a cyclic lactone. It is an endogenous compound made from gamma-aminobutyrate and is the precursor of gamma-hydroxybutyrate. It is also used as a pharmacological agent and solvent.. tetrahydrofuranone : Any oxolane having an oxo- substituent at any position on the tetrahydrofuran ring.. gamma-butyrolactone : A butan-4-olide that is tetrahydrofuran substituted by an oxo group at position 2. | 2.02 | 1 | 0 | butan-4-olide | metabolite; neurotoxin |
| n-methylpyrrole [no description available] | 2.94 | 4 | 0 | pyrroles | |
| ethylene dimethacrylate ethylene glycol dimethacrylate : The enoate ester that is the 1,2-bis(methacryloyl) derivative of ethylene glycol. | 2.07 | 1 | 0 | enoate ester | allergen; cross-linking reagent; polymerisation monomer |
| triethylborane triethylborane: used in the radical deuteration reaction of ribonucleoside derivatives | 1.98 | 1 | 0 | ||
| furaldehyde Furaldehyde: A heterocyclic compound consisting of a furan where the hydrogen at position 2 is substituted by a formyl group.. furfural : An aldehyde that is furan with the hydrogen at position 2 substituted by a formyl group. | 2.03 | 1 | 0 | aldehyde; furans | Maillard reaction product; metabolite |
| acetophenone acetophenone : A methyl ketone that is acetone in which one of the methyl groups has been replaced by a phenyl group. | 1.97 | 1 | 0 | acetophenones | animal metabolite; photosensitizing agent; xenobiotic |
| nitrobenzene nitrobenzene : A nitroarene consisting of benzene carrying a single nitro substituent. An industrial chemical used widely in the production of aniline. | 2.74 | 3 | 0 | nitroarene; nitrobenzenes | |
| 3-aminobenzoic acid 3-aminobenzoic acid: RN given refers to parent cpd. 3-aminobenzoic acid : An aminobenzoic acid carrying an amino group at position 3. | 2.02 | 1 | 0 | aminobenzoic acid | |
| 3-dimethylaminophenol [no description available] | 2.08 | 1 | 0 | ||
| trehalose alpha,alpha-trehalose : A trehalose in which both glucose residues have alpha-configuration at the anomeric carbon. | 2.75 | 3 | 0 | trehalose | Escherichia coli metabolite; geroprotector; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| sym-trinitrobenzene Trinitrobenzenes: Benzene derivatives which are substituted with three nitro groups in any position.. 1,3,5-trinitrobenzene : A trinitrobenzene in which each of the nitro groups is meta- to the other two. | 2.41 | 2 | 0 | trinitrobenzene | explosive |
| 4-cymene 4-cymene: structure. p-cymene : A monoterpene that is toluene substituted by an isopropyl group at position 4. | 2.6 | 1 | 0 | monoterpene; toluenes | human urinary metabolite; plant metabolite; volatile oil component |
| 2-diethylaminoethanol 2-diethylaminoethanol: RN given refers to unlabeled parent cpd. 2-diethylaminoethanol : A member of the class of ethanolamines that is aminoethanol in which the hydrogens of the amino group are replaced by ethyl groups. | 3.07 | 5 | 0 | ethanolamines; primary alcohol; tertiary amino compound | |
| benzyl bromide benzyl bromide: structure given in first source. benzyl bromide : A member of the class of benzyl bromides that is toluene substituted on the alpha-carbon with bromine. | 2 | 1 | 0 | benzyl bromides | lachrymator |
| styrene Styrene: A colorless, toxic liquid with a strong aromatic odor. It is used to make rubbers, polymers and copolymers, and polystyrene plastics.. styrene : A vinylarene that is benzene carrying a vinyl group. It has been isolated from the benzoin resin produced by Styrax species. | 9.01 | 4 | 0 | styrenes; vinylarene; volatile organic compound | mouse metabolite; mutagen; plant metabolite |
| benzylamine aminotoluene : Any member of the class of toluenes carrying one or more amino groups. | 2.11 | 1 | 0 | aralkylamine; primary amine | allergen; EC 3.5.5.1 (nitrilase) inhibitor; plant metabolite |
| 2,2-dimethyl-1,3-dioxolane-4-methanol 2,2-dimethyl-1,3-dioxolane-4-methanol: RN given refers to parent cpd; structure | 2.07 | 1 | 0 | ||
| triphenyl phosphite [no description available] | 1.95 | 1 | 0 | ||
| tributylamine tributylamine: RN given refers to parent cpd | 2.6 | 1 | 0 | tertiary amine | |
| phenyl isocyanate [no description available] | 1.96 | 1 | 0 | benzenes; isocyanates | allergen; hapten |
| ethyl bromoacetate [no description available] | 2.03 | 1 | 0 | ||
| 4-phenylenediamine 4-phenylenediamine: agent hair dye responsible for contact dermatitis; RN given refers to parent cpd. 1,4-phenylenediamine : A phenylenediamine in which the amino functions are at positions 1 and 4 of the benzene nucleus. | 2.06 | 1 | 0 | phenylenediamine | allergen; dye; hapten; reagent |
| glycidyl methacrylate glycidyl methacrylate: RN given refers to monomer. glycidyl methacrylate : An enoate ester obtained by formal condensation of the carboxy group of methacrylic acid with the hydroxy group of glycidol. | 2.45 | 2 | 0 | enoate ester; epoxide | |
| ethylene dibromide Ethylene Dibromide: An effective soil fumigant, insecticide, and nematocide. In humans, it causes severe burning of skin and irritation of the eyes and respiratory tract. Prolonged inhalation may cause liver necrosis. It is also used in gasoline. Members of this group have caused liver and lung cancers in rodents. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), 1,2-dibromoethane may reasonably be anticipated to be a carcinogen.. 1,2-dibromoethane : A bromoalkane that is ethane carrying bromo substituents at positions 1 and 2. It is produced by marine algae. | 6.99 | 1 | 0 | bromoalkane; bromohydrocarbon | algal metabolite; carcinogenic agent; fumigant; marine metabolite; mouse metabolite; mutagen |
| butane butane : A straight chain alkane composed of 4 carbon atoms. | 2.45 | 2 | 0 | alkane; gas molecular entity | food propellant; refrigerant |
| 1,3-butadiene buta-1,3-diene : A butadiene with unsaturation at positions 1 and 3. | 2.71 | 3 | 0 | butadiene | carcinogenic agent; mutagen |
| acrolein [no description available] | 10.65 | 14 | 0 | enal | herbicide; human xenobiotic metabolite; toxin |
| acrylonitrile [no description available] | 2.71 | 3 | 0 | aliphatic nitrile; volatile organic compound | antifungal agent; carcinogenic agent; fungal metabolite; mutagen; polar aprotic solvent |
| glyoxal [no description available] | 3.1 | 5 | 0 | dialdehyde | agrochemical; allergen; pesticide; plant growth regulator |
| hexylene glycol hexylene glycol: RN given refers to parent cpd. 2-methylpentane-2,4-diol : A glycol in which the two hydroxy groups are at positions 2 and 4 of 2-methylpentane (isopentane). | 2.02 | 1 | 0 | glycol | |
| dimethyldioctadecylammonium dimethyldioctadecylammonium: a cationic lipid analog; RN given refers to parent cpd | 2.49 | 2 | 0 | ||
| 2-methylpentane Hexanes: Six-carbon saturated hydrocarbon group of the methane series. Include isomers and derivatives. Various polyneuropathies are caused by hexane poisoning. | 2.43 | 2 | 0 | alkane | |
| 1,3-butylene glycol 1,3-butylene glycol: RN given refers to cpd without isomeric designation. butane-1,3-diol : A butanediol compound having two hydroxy groups in the 1- and 3-positions. | 2.01 | 1 | 0 | butanediol; glycol | |
| 3-hydroxybutanal [no description available] | 2.02 | 1 | 0 | ||
| diisopropylamine diisopropylamine: structure given in first source | 1.96 | 1 | 0 | ||
| acetic anhydride acetic anhydride: RN given refers to unlabeled cpd; structure. acetic anhydride : An acyclic carboxylic anhydride derived from acetic acid. | 1.97 | 1 | 0 | acyclic carboxylic anhydride | metabolite; reagent |
| glutaric anhydride glutaric anhydride: RN given in first source. glutaric anhydride : A cyclic dicarboxylic anhydride that is oxane which carries oxo groups at positions 2 and 6. It is used as an intermediate in the production of pharmaceuticals, corrosion inhibitors, and polymers (E.g. epoxy polyesters). | 2.08 | 1 | 0 | cyclic dicarboxylic anhydride; oxanes | |
| mesitylene mesitylene: structure. 1,3,5-trimethylbenzene : A trimethylbenzene carrying methyl substituents at positions 1, 3 and 5. | 1.97 | 1 | 0 | trimethylbenzene | |
| cyanuric chloride cyanuric chloride : A chloro-1,3,5-triazine in which the triazine ring is substituted on each carbon by chlorine. Its main use is in the preparation of the triazine-class pesticides. | 2.04 | 1 | 0 | chloro-1,3,5-triazine; organochlorine compound | cross-linking reagent |
| melamine melamine: RN given refers to parent cpd; structure. melamine : A trimer of cyanamide, with a 1,3,5-triazine skeleton. | 7.81 | 3 | 0 | triamino-1,3,5-triazine | xenobiotic metabolite |
| cyanuric acid cyanuric acid: RN given refers to parent cpd. isocyanuric acid : The keto tautomer of cyanuric acid.. cyanuric acid : The enol tautomer of isocyanuric acid. | 2.13 | 1 | 0 | 1,3,5-triazinanes; 1,3,5-triazines; heteroaryl hydroxy compound | xenobiotic |
| cyclohexanol Cyclohexanols: Monohydroxy derivatives of cyclohexanes that contain the general formula R-C6H11O. They have a camphorlike odor and are used in making soaps, insecticides, germicides, dry cleaning, and plasticizers.. cyclohexanols : An alcohol in which one or more hydroxy groups are attached to a cyclohexane skeleton. | 4.41 | 1 | 1 | cyclohexanols; secondary alcohol | solvent |
| thiophenol thiophenol : A thiol in which the sulfanyl group is attached to a phenyl group. | 7.01 | 1 | 0 | aryl thiol | |
| 2-aminopyrimidine pyrimidin-2-amine : An aminopyrimidine carrying an amino group at position 2.. aminopyrimidine : A member of the class of pyrimidines that is pyrimidine substituted by at least one amino group and its derivatives. | 2.17 | 1 | 0 | aminopyrimidine | |
| hydracrylonitrile hydracrylonitrile: structure | 1.95 | 1 | 0 | ||
| methyl cellosolve methyl cellosolve: widely used industrial solvent for resins, lacquers, dyes & inks; may cause anemia macrocytosis, appearance of young granulocytes in blood; RN given refers to parent cpd | 2.04 | 1 | 0 | glycol ether | protic solvent; solvent |
| ethyl formate ethyl formate : A formate ester resulting from the formal condensation of formic acid with ethanol.. ethoxycarbonyl group : An organyl group of formula -COOEt. | 2.03 | 1 | 0 | ethyl ester; formate ester | fumigant; plant metabolite |
| pyrroles 1H-pyrrole : A tautomer of pyrrole that has the double bonds at positions 2 and 4.. pyrrole : A five-membered monocyclic heteroarene comprising one NH and four CH units which forms the parent compound of the pyrrole group of compounds. Its five-membered ring structure has three tautomers. A 'closed class'.. azole : Any monocyclic heteroarene consisting of a five-membered ring containing nitrogen. Azoles can also contain one or more other non-carbon atoms, such as nitrogen, sulfur or oxygen. | 9.13 | 68 | 0 | pyrrole; secondary amine | |
| tetrahydrofuran oxolane : A cyclic ether that is butane in which one hydrogen from each methyl group is substituted by an oxygen. | 2.92 | 4 | 0 | cyclic ether; oxolanes; saturated organic heteromonocyclic parent; volatile organic compound | polar aprotic solvent |
| furan furan : A monocyclic heteroarene with a structure consisting of a 5-membered ring containing four carbons and one oxygen, with formula C4H4O. It is a toxic, flammable, low-boiling (31degreeC) colourless liquid. | 8.54 | 8 | 0 | furans; mancude organic heteromonocyclic parent; monocyclic heteroarene | carcinogenic agent; hepatotoxic agent; Maillard reaction product |
| thiophenes Thiophenes: A monocyclic heteroarene furan in which the oxygen atom is replaced by a sulfur.. thiophenes : Compounds containing at least one thiophene ring. | 6.68 | 19 | 1 | mancude organic heteromonocyclic parent; monocyclic heteroarene; thiophenes; volatile organic compound | non-polar solvent |
| succinamide [no description available] | 2.08 | 1 | 0 | ||
| n,n,n',n'-tetramethylethylenediamine N,N,N',N'-tetramethylethylenediamine: RN given refers to parent cpd; structure. N,N,N',N'-tetramethylethylenediamine : An ethylenediamine derivative in which each nitrogen carries two methyl substituents. It is widely employed both as a ligand for metal ions and as a catalyst in organic polymerisation. | 2 | 1 | 0 | ethylenediamine derivative | catalyst; chelator |
| 1,2-dimethoxyethane 1,2-dimethoxyethane: RN given refers to cpd with specified locants for methoxy moieties. 1,2-dimethoxyethane : A diether that is the 1,2-dimethyl ether of ethane-1,2-diol. | 2.04 | 1 | 0 | diether | non-polar solvent |
| cyclohexane Cyclohexane: C6H12. cyclohexane : An alicyclic hydrocarbon comprising a ring of six carbon atoms; the cyclic form of hexane, used as a raw material in the manufacture of nylon. | 2.44 | 2 | 0 | cycloalkane; volatile organic compound | non-polar solvent |
| cyclohexene cyclohexene : A cycloalkene that is cylohexane with a single double bond. | 7.93 | 4 | 0 | cycloalkene | |
| piperidine [no description available] | 3.38 | 7 | 0 | azacycloalkane; piperidines; saturated organic heteromonocyclic parent; secondary amine | base; catalyst; human metabolite; non-polar solvent; plant metabolite; protic solvent; reagent |
| morpholine [no description available] | 2.9 | 4 | 0 | morpholines; saturated organic heteromonocyclic parent | NMR chemical shift reference compound |
| hexylamine hexylamine: RN given refers to parent cpd; structure. 1-hexanamine : A 6-carbon primary aliphatic amine. | 2.52 | 2 | 0 | primary aliphatic amine | metabolite |
| 1-hexanol 1-hexanol: RN given refers to parent cpd. hexanol : A fatty alcohol consisting of a hydroxy function at any position of an unbranched saturated chain of six carbon atoms.. hexan-1-ol : A primary alcohol that is hexane substituted by a hydroxy group at position 1. | 2.7 | 3 | 0 | hexanol; primary alcohol | alarm pheromone; antibacterial agent; fragrance; plant metabolite |
| diethylenetriamine diethylenetriamine: RN given refers to parent cpd | 2.03 | 1 | 0 | polyazaalkane; triamine | |
| octylamine octylamine: RN given refers to 1-octylamine. octan-1-amine : An 8-carbon primary aliphatic amine. | 2.53 | 2 | 0 | primary aliphatic amine | metabolite |
| 3,3'-iminodipropionitrile 3,3'-iminodipropionitrile: lathyrogen; RN refers to parent cpd; blocks axoplasmic transport of neurofilament proteins with subsequent axon swelling typical of some motor neuron diseases | 2.01 | 1 | 0 | ||
| triethylene glycol triethylene glycol : A poly(ethylene glycol) that is octane-1,8-diol in which the carbon atoms at positions 3 and 6 have been replaced by oxygen atoms. | 2.44 | 2 | 0 | diol; poly(ethylene glycol); primary alcohol | plasticiser |
| undecanoic acid undecanoic acid : A straight-chain, eleven-carbon saturated medium-chain fatty acid found in body fluids; the most fungitoxic of the C7:0 - C18:0 fatty acid series.. undecanoate : A medium-chain fatty acid anion that is the conjugate base of undecanoic acid; used in tandem with testosterone cation in the treatment of male hypogonadism. Major species at pH 7.3. | 2.07 | 1 | 0 | medium-chain fatty acid; straight-chain saturated fatty acid | antifungal agent; human metabolite |
| n-dodecane dodecane : A straight-chain alkane with 12 carbon atoms. It has been isolated from the essential oils of various plants including Zingiber officinale (ginger). | 2.05 | 1 | 0 | alkane | plant metabolite |
| glycofurol [no description available] | 2.25 | 1 | 0 | poly(ethylene glycol) | |
| behenic acid behenic acid: RN given refers to parent cpd; structure. docosanoic acid : A straight-chain, C22, long-chain saturated fatty acid. | 2.31 | 1 | 0 | long-chain fatty acid; straight-chain saturated fatty acid | plant metabolite |
| linalyl acetate linalyl acetate: structure in first source; RN refers to cpd without isomeric designation. linalyl acetate : A racemate comprising equimolar amounts of (R)- and (S)-linalyl acetate. It forms a principal component of the essential oils from bergamot and lavender.. 3,7-dimethylocta-1,6-dien-3-yl acetate : A monoterpenoid that is the acetate ester of linalool. It forms a principal component of the essential oils from bergamot and lavender. | 2.06 | 1 | 0 | acetate ester; monoterpenoid | |
| diethylhexyl phthalate Diethylhexyl Phthalate: An ester of phthalic acid. It appears as a light-colored, odorless liquid and is used as a plasticizer for many resins and elastomers.. bis(2-ethylhexyl) phthalate : A phthalate ester that is the bis(2-ethylhexyl) ester of benzene-1,2-dicarboxylic acid. | 2.06 | 1 | 0 | diester; phthalate ester | androstane receptor agonist; apoptosis inhibitor; plasticiser |
| framycetin Framycetin: A component of NEOMYCIN that is produced by Streptomyces fradiae. On hydrolysis it yields neamine and neobiosamine B. (From Merck Index, 11th ed). framycetin : A tetracyclic antibacterial agent derived from neomycin, being a glycoside ester of neamine and neobiosamine B. | 3.91 | 12 | 0 | aminoglycoside | allergen; antibacterial drug; Escherichia coli metabolite |
| anthracene acene : A polycyclic aromatic hydrocarbon consisting of fused benzene rings in a rectilinear arrangement.. acenes : Polycyclic aromatic hydrocarbons consisting of fused benzene rings in a rectilinear arrangement and their substitution derivatives. | 7.48 | 2 | 0 | acene; anthracenes; ortho-fused tricyclic hydrocarbon | |
| triethylamine [no description available] | 8.56 | 8 | 0 | tertiary amine | |
| pyrazolanthrone pyrazolanthrone: JNK (c-Jun N-terminal kinase) inhibitor; structure in first source. anthra[1,9-cd]pyrazol-6(2H)-one : A member of the class of anthrapyrazoles that is anthra[1,9-cd]pyrazole substituted at position 6 by an oxo group. An inhibitor of c-Jun N-terminal kinase. | 2.42 | 2 | 0 | anthrapyrazole; aromatic ketone; cyclic ketone | antineoplastic agent; c-Jun N-terminal kinase inhibitor; geroprotector |
| meglumine Meglumine: 1-Deoxy-1-(methylamino)-D-glucitol. A derivative of sorbitol in which the hydroxyl group in position 1 is replaced by a methylamino group. Often used in conjunction with iodinated organic compounds as contrast medium.. N-methylglucamine : A hexosamine that is D-glucitol in which the hydroxy group at position 1 is substituted by the nitrogen of a methylamino group. A crystalline base, it is used in preparing salts of certain acids for use as diagnostic radiopaque media, while its antimonate is used as an antiprotozoal in the treatment of leishmaniasis. | 2.02 | 1 | 0 | hexosamine; secondary amino compound | |
| 1-naphthylamine 1-Naphthylamine: A suspected industrial carcinogen (and listed as such by OSHA). Its N-hydroxy metabolite is strongly carcinogenic and mutagenic.. naphthylamine : A primary arylamine that is naphthalene substituted by an amino group at unspecified position.. 1-naphthylamine : A naphthylamine that is naphthalene substituted by an amino group at position 1. | 2.02 | 1 | 0 | naphthylamine | human xenobiotic metabolite |
| fluorodeoxyuridylate Fluorodeoxyuridylate: 5-Fluoro-2'-deoxyuridylate. An inhibitor of thymidylate synthetase. Formed from 5-fluorouracil or 5-fluorodeoxyuridine. | 2.48 | 2 | 0 | pyrimidine 2'-deoxyribonucleoside 5'-monophosphate | |
| 2-naphthol 2-naphthol: RN given refers to parent cpd. 2-naphthol : A naphthol carrying a hydroxy group at position 2.. naphthols : Any hydroxynaphthalene derivative that has a single hydroxy substituent. | 2.01 | 1 | 0 | naphthol | antinematodal drug; genotoxin; human urinary metabolite; human xenobiotic metabolite; mouse metabolite; radical scavenger |
| nitrilotriacetic acid Nitrilotriacetic Acid: A derivative of acetic acid, N(CH2COOH)3. It is a complexing (sequestering) agent that forms stable complexes with Zn2+. (From Miall's Dictionary of Chemistry, 5th ed.) | 3.13 | 5 | 0 | NTA; tricarboxylic acid | carcinogenic agent; nephrotoxic agent |
| ethyl acetate ethyl acetate : The acetate ester formed between acetic acid and ethanol. | 2 | 1 | 0 | acetate ester; ethyl ester; volatile organic compound | EC 3.4.19.3 (pyroglutamyl-peptidase I) inhibitor; metabolite; polar aprotic solvent; Saccharomyces cerevisiae metabolite |
| 2-hydroxypyridine hydroxypyridine : Any member of the class of pyridines with at least one hydroxy substituent.. pyridin-2-ol : A monohydroxypyridine that is pyridine substituted by a hydroxy group at position 2. | 2.41 | 2 | 0 | monohydroxypyridine | plant metabolite |
| iminodiacetic acid iminodiacetic acid: used as hepatobiliary imaging agent when labeled with Tc; RN given refers to parent cpd; structure. iminodiacetic acid : An amino dicarboxylic acid that is glycine in which one of the hydrogens attached to the nitrogen is substituted by a carboxymethyl group. | 2.01 | 1 | 0 | amino dicarboxylic acid; glycine derivative; non-proteinogenic alpha-amino acid | chelator |
| n-heptane Heptanes: Seven-carbon alkanes with the formula C7H16.. heptane : A straight-chain alkane with seven carbon atoms. It has been found in Jeffrey pine (Pinus jeffreyi). | 2.03 | 1 | 0 | alkane; volatile organic compound | non-polar solvent; plant metabolite |
| pregnenolone [no description available] | 2.02 | 1 | 0 | 20-oxo steroid; 3beta-hydroxy-Delta(5)-steroid; C21-steroid | human metabolite; mouse metabolite |
| pentoxyl Pentoxyl: 5-Hydroxymethyl-6-methyl- 2,4-(1H,3H)-pyrimidinedione. Uracil derivative used in combination with toxic antibiotics to lessen their toxicity; also to stimulate leukopoiesis and immunity. Synonyms: pentoksil; hydroxymethylmethyluracil. | 3.4 | 7 | 0 | pyrimidone | |
| aziridine [no description available] | 3.5 | 2 | 0 | azacycloalkane; aziridines; saturated organic heteromonocyclic parent | alkylating agent |
| catechin Catechin: An antioxidant flavonoid, occurring especially in woody plants as both (+)-catechin and (-)-epicatechin (cis) forms.. catechin : Members of the class of hydroxyflavan that have a flavan-3-ol skeleton and its substituted derivatives.. rac-catechin : A racemate comprising equimolar amounts of (+)- and (-)-catechin. (+)-catechin : The (+)-enantiomer of catechin and a polyphenolic antioxidant plant metabolite. | 3.6 | 2 | 0 | catechin | antioxidant; plant metabolite |
| coronene coronene: structure. coronene : A ortho- and peri-fused polycyclic arene that consists of six peri-fused benzene rings. | 2.48 | 2 | 0 | ortho- and peri-fused polycyclic arene | |
| benzo(c)phenanthrene benzo[c]phenanthrene : An ortho-fused polycyclic arene resulting from the symmetrical fusion of the C1-C2 bonds of two naphthalene units. | 2.41 | 2 | 0 | benzenoid aromatic compound; ortho-fused polycyclic arene | |
| perylene Perylene: A 20-carbon dibenz(de,kl)anthracene that can be viewed as a naphthalene fused to a phenalene or as dinaphthalene. It is used as fluorescent lipid probe in the cytochemistry of membranes and is a polycyclic hydrocarbon pollutant in soil and water. Derivatives may be carcinogenic.. perylene : An ortho- and peri-fused polycyclic arene comprising of five benzene rings that is anthracene in which the d,e and k,l sides are fused to benzene rings. | 9.58 | 24 | 0 | ortho- and peri-fused polycyclic arene; perylenes | |
| phthalazine phthalazine : An azaarene that is the 2,3-diaza analogue of naphthalene. The parent of the class of phthalazines. | 2.04 | 1 | 0 | azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; phthalazines | |
| quinazolines Quinazolines: A group of aromatic heterocyclic compounds that contain a bicyclic structure with two fused six-membered aromatic rings, a benzene ring and a pyrimidine ring.. quinazoline : A mancude organic heterobicyclic parent that is naphthalene in which the carbon atoms at positions 1 and 3 have been replaced by nitrogen atoms.. quinazolines : Any organic heterobicyclic compound based on a quinazoline skeleton and its substituted derivatives. | 10.88 | 28 | 2 | azaarene; mancude organic heterobicyclic parent; ortho-fused heteroarene; quinazolines | |
| acridines Acridines: Compounds that include the structure of acridine.. acridine : A polycyclic heteroarene that is anthracene in which one of the central CH groups is replaced by a nitrogen atom. | 6.3 | 49 | 0 | acridines; mancude organic heterotricyclic parent; polycyclic heteroarene | genotoxin |
| indazoles Indazoles: A group of heterocyclic aromatic organic compounds consisting of the fusion of BENZENE and PYRAZOLES. | 7.14 | 13 | 0 | indazole | |
| benzofuran benzofuran: RN & structure given in first source. 1-benzofuran : A benzofuran consisting of fused benzene and furan rings. It is the parent compound of the class of 1-benzofurans. | 7.11 | 1 | 0 | 1-benzofurans; benzofuran | |
| benzoxazoles 1,3-benzoxazole : A benzoxazole in which the benzene ring is fused to a 1,3-oxazole ring across positions 4 and 5.. benzoxazole : Compounds based on a fused 1,2- or 1,3-oxazole and benzene bicyclic ring skeleton. | 9.13 | 21 | 0 | 1,3-benzoxazoles; mancude organic heterobicyclic parent | |
| adamantane Adamantane: A tricyclo bridged hydrocarbon. | 3.55 | 8 | 0 | adamantanes; polycyclic alkane | |
| cyclopentane Cyclopentanes: A group of alicyclic hydrocarbons with the general formula R-C5H9.. cyclopentanes : Cyclopentane and its derivatives formed by substitution. | 4.03 | 14 | 0 | cycloalkane; cyclopentanes; volatile organic compound | non-polar solvent |
| isoxazoles Isoxazoles: Azoles with an OXYGEN and a NITROGEN next to each other at the 1,2 positions, in contrast to OXAZOLES that have nitrogens at the 1,3 positions.. isoxazole : A monocyclic heteroarene with a structure consisting of a 5-membered ring containing three carbon atoms and an oxygen and nitrogen atom adjacent to each other. It is the parent of the class of isoxazoles.. isoxazoles : Oxazoles in which the N and O atoms are adjacent. | 4.9 | 4 | 0 | isoxazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene | |
| oxazoles Oxazoles: Five-membered heterocyclic ring structures containing an oxygen in the 1-position and a nitrogen in the 3-position, in distinction from ISOXAZOLES where they are at the 1,2 positions.. 1,3-oxazole : A five-membered monocyclic heteroarene that is an analogue of cyclopentadiene with O in place of CH2 at position 1 and N in place of CH at position 3.. oxazole : An azole based on a five-membered heterocyclic aromatic skeleton containing one N and one O atom. | 3.45 | 7 | 0 | 1,3-oxazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene | |
| thiazoles [no description available] | 9.54 | 51 | 1 | 1,3-thiazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene | |
| pyrimidine pyrimidine : The parent compound of the pyrimidines; a diazine having the two nitrogens at the 1- and 3-positions. | 5.94 | 33 | 0 | diazine; pyrimidines | Daphnia magna metabolite |
| pyrazines Pyrazines: A heterocyclic aromatic organic compound with the chemical formula C4H4N2.. pyrazine : A diazine that is benzene in which the carbon atoms at positions 1 and 4 have been replaced by nitrogen atoms. | 5.42 | 10 | 0 | diazine; pyrazines | Daphnia magna metabolite |
| nitroblue tetrazolium Nitroblue Tetrazolium: Colorless to yellow dye that is reducible to blue or black formazan crystals by certain cells; formerly used to distinguish between nonbacterial and bacterial diseases, the latter causing neutrophils to reduce the dye; used to confirm diagnosis of chronic granulomatous disease. | 2.38 | 2 | 0 | organic cation | |
| triphenyltetrazolium triphenyltetrazolium: RN given refers to parent cpd. 2,3,5-triphenyltetrazolium : An organic cation that is tetrazole carrying three phenyl substituents at positions 2, 3 and 5. | 2.06 | 1 | 0 | organic cation | |
| hydrazine diamine : Any polyamine that contains two amino groups. | 4.96 | 12 | 0 | azane; hydrazines | EC 4.3.1.10 (serine-sulfate ammonia-lyase) inhibitor |
| dexamethasone 21-phosphate dexamethasone 21-phosphate: has anti-inflammatory activity. dexamethasone phosphate : A steroid phosphate that is the 21-O-phospho derivative of dexamethasone. | 2.01 | 1 | 0 | 11beta-hydroxy steroid; 17-hydroxy steroid; 3-oxo-Delta(4) steroid; fluorinated steroid; steroid phosphate; tertiary alpha-hydroxy ketone | glucocorticoid receptor agonist |
| monocrotaline Monocrotaline: A pyrrolizidine alkaloid and a toxic plant constituent that poisons livestock and humans through the ingestion of contaminated grains and other foods. The alkaloid causes pulmonary artery hypertension, right ventricular hypertrophy, and pathological changes in the pulmonary vasculature. Significant attenuation of the cardiopulmonary changes are noted after oral magnesium treatment. | 2.46 | 2 | 0 | pyrrolizidine alkaloid | |
| 5-fluorouridine [no description available] | 7.73 | 3 | 0 | organofluorine compound; uridines | mutagen |
| azacitidine Azacitidine: A pyrimidine analogue that inhibits DNA methyltransferase, impairing DNA methylation. It is also an antimetabolite of cytidine, incorporated primarily into RNA. Azacytidine has been used as an antineoplastic agent.. 5-azacytidine : An N-glycosyl-1,3,5-triazine that is 4-amino-1,3,5-triazin-2(1H)-one substituted by a beta-D-ribofuranosyl residue via an N-glycosidic linkage. An antineoplastic agent, it is used in the treatment of myeloid leukaemia. | 4.99 | 12 | 0 | N-glycosyl-1,3,5-triazine; nucleoside analogue | antineoplastic agent |
| perfluorooctanoic acid perfluorooctanoic acid: RN given refers to parent cpd. perfluorooctanoic acid : A fluoroalkanoic acid that is perfluorinated octanoic acid. | 2.06 | 1 | 0 | fluoroalkanoic acid | carcinogenic agent; endocrine disruptor; environmental contaminant; surfactant; xenobiotic |
| methylthioinosine Methylthioinosine: 6-(Methylthio)-9-beta-D-ribofuranosylpurine. An analog of inosine with a methylthio group replacing the hydroxyl group in the 6-position. | 2.01 | 1 | 0 | purine ribonucleoside; thiopurine | |
| aminoimidazole carboxamide Aminoimidazole Carboxamide: An imidazole derivative which is a metabolite of the antineoplastic agents BIC and DIC. By itself, or as the ribonucleotide, it is used as a condensation agent in the preparation of nucleosides and nucleotides. Compounded with orotic acid, it is used to treat liver diseases.. 5-aminoimidazole-4-carboxamide : An aminoimidazole in which the amino group is at C-5 with a carboxamido group at C-4. | 2.89 | 4 | 0 | aminoimidazole; monocarboxylic acid amide | mouse metabolite |
| thymidine monophosphate Thymidine Monophosphate: 5-Thymidylic acid. A thymine nucleotide containing one phosphate group esterified to the deoxyribose moiety.. dTMP : The neutral species of thymidine 5'-monophosphate (2'-deoxythymidine 5'-monophosphate). | 4.81 | 33 | 0 | thymidine 5'-monophosphate | fundamental metabolite |
| citrulline citrulline : The parent compound of the citrulline class consisting of ornithine having a carbamoyl group at the N(5)-position. | 5.3 | 5 | 0 | amino acid zwitterion; citrulline | Daphnia magna metabolite; EC 1.14.13.39 (nitric oxide synthase) inhibitor; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; protective agent; Saccharomyces cerevisiae metabolite |
| trifluoroethylamine trifluoroethylamine: RN given refers to cpd with unspecified fluorine locants | 1.96 | 1 | 0 | ||
| cyanamide Cyanamide: A cyanide compound which has been used as a fertilizer, defoliant and in many manufacturing processes. It often occurs as the calcium salt, sometimes also referred to as cyanamide. The citrated calcium salt is used in the treatment of alcoholism.. cyanamide : A nitrile that is hydrogen cyanide in which the hydrogen has been replaced by an amino group. | 2.36 | 2 | 0 | nitrile; one-carbon compound | EC 1.2.1.3 [aldehyde dehydrogenase (NAD(+))] inhibitor |
| nandrolone Nandrolone: C18 steroid with androgenic and anabolic properties. It is generally prepared from alkyl ethers of ESTRADIOL to resemble TESTOSTERONE but less one carbon at the 19 position.. nandrolone : A 3-oxo Delta(4)-steroid that is estr-4-en-3-one substituted by a beta-hydroxy group at position 17. | 1.97 | 1 | 0 | 17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; anabolic androgenic steroid | human metabolite |
| 2-aminopurine 2-Aminopurine: A purine that is an isomer of ADENINE (6-aminopurine).. aminopurine : Any purine having at least one amino substituent.. 2-aminopurine : The parent compound of the 2-aminopurines, comprising a purine core carrying an amino substituent at the 2-position. | 6.64 | 66 | 0 | 2-aminopurines; nucleobase analogue | antimetabolite |
| cyanogen cyanogen: structure. oxalonitrile : A dinitrile that is ethane substituted by two cyano groups. | 2.11 | 1 | 0 | dinitrile; pseudohalogen | |
| hydantoins Hydantoins: Compounds based on imidazolidine dione. Some derivatives are ANTICONVULSANTS.. imidazolidine-2,4-dione : An imidazolidinone with oxo groups at position 2 and 4. | 2.76 | 3 | 0 | imidazolidine-2,4-dione | |
| fluorobenzenes Fluorobenzenes: Derivatives of BENZENE that contain FLUORINE.. monofluorobenzene : The simplest member of the class of monofluorobenzenes that is benzene carrying a single fluoro substituent.. fluorobenzenes : Any fluoroarene that is a benzene or a substituted benzene carrying at least one fluoro group. | 2.48 | 2 | 0 | monofluorobenzenes | NMR chemical shift reference compound |
| propadiene [no description available] | 2.25 | 1 | 0 | allenes | |
| methylguanidine Methylguanidine: A product of putrefaction. Poisonous.. methylguanidine : A guanidine in which one of the amino hydrogens of guanidine itself is substituted by a methyl group. | 7.6 | 1 | 0 | guanidines | EC 1.14.13.39 (nitric oxide synthase) inhibitor; metabolite; uremic toxin |
| limestone Calcium Carbonate: Carbonic acid calcium salt (CaCO3). An odorless, tasteless powder or crystal that occurs in nature. It is used therapeutically as a phosphate buffer in hemodialysis patients and as a calcium supplement.. calcium carbonate : A calcium salt with formula CCaO3. | 2.02 | 1 | 0 | calcium salt; carbonate salt; inorganic calcium salt; one-carbon compound | antacid; fertilizer; food colouring; food firming agent |
| chenodeoxycholic acid Chenodeoxycholic Acid: A bile acid, usually conjugated with either glycine or taurine. It acts as a detergent to solubilize fats for intestinal absorption and is reabsorbed by the small intestine. It is used as cholagogue, a choleretic laxative, and to prevent or dissolve gallstones.. chenodeoxycholic acid : A dihydroxy-5beta-cholanic acid that is (5beta)-cholan-24-oic acid substituted by hydroxy groups at positions 3 and 7 respectively.. chenodeoxycholate : Conjugate base of chenodeoxycholic acid; major species at pH 7.3. | 2.48 | 2 | 0 | bile acid; C24-steroid; dihydroxy-5beta-cholanic acid | human metabolite; mouse metabolite |
| fusarium Fusarium: A mitosporic Hypocreales fungal genus, various species of which are important parasitic pathogens of plants and a variety of vertebrates. Teleomorphs include GIBBERELLA. | 3.73 | 10 | 0 | ||
| phosphoadenosine phosphosulfate Phosphoadenosine Phosphosulfate: 3'-Phosphoadenosine-5'-phosphosulfate. Key intermediate in the formation by living cells of sulfate esters of phenols, alcohols, steroids, sulfated polysaccharides, and simple esters, such as choline sulfate. It is formed from sulfate ion and ATP in a two-step process. This compound also is an important step in the process of sulfur fixation in plants and microorganisms.. 3'-phospho-5'-adenylyl sulfate : An adenosine bisphosphate having monophosphate groups at the 3'- and 5'-positions and a sulfo group attached to the phosphate at position 5'. | 3.12 | 1 | 0 | acyl sulfate; adenosine bisphosphate; purine ribonucleoside bisphosphate | Escherichia coli metabolite; mouse metabolite |
| emetine Emetine: The principal alkaloid of ipecac, from the ground roots of Uragoga (or Cephaelis) ipecacuanha or U. acuminata, of the Rubiaceae. It is used as an amebicide in many different preparations and may cause serious cardiac, hepatic, or renal damage and violent diarrhea and vomiting. Emetine inhibits protein synthesis in EUKARYOTIC CELLS but not PROKARYOTIC CELLS.. emetine : A pyridoisoquinoline comprising emetam having methoxy substituents at the 6'-, 7'-, 10- and 11-positions. It is an antiprotozoal agent and emetic. It inhibits SARS-CoV2, Zika and Ebola virus replication and displays antimalarial, antineoplastic and antiamoebic properties. | 1.95 | 1 | 0 | isoquinoline alkaloid; pyridoisoquinoline | antiamoebic agent; anticoronaviral agent; antiinfective agent; antimalarial; antineoplastic agent; antiprotozoal drug; antiviral agent; autophagy inhibitor; emetic; expectorant; plant metabolite; protein synthesis inhibitor |
| retene retene: structure in first source | 2.06 | 1 | 0 | ||
| kainic acid Kainic Acid: (2S-(2 alpha,3 beta,4 beta))-2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic acid. Ascaricide obtained from the red alga Digenea simplex. It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose. | 2.78 | 3 | 0 | dicarboxylic acid; L-proline derivative; non-proteinogenic L-alpha-amino acid; pyrrolidinecarboxylic acid | antinematodal drug; excitatory amino acid agonist |
| isocarbostyril isoquinolinone : An isoquinoline containing one or more oxo groups. | 2 | 1 | 0 | isoquinolines | |
| methyl red methyl red: RN given refers to parent cpd; structure. methyl red : An azo dye consisting of benzoic acid substituted at position 2 by a 4-[(dimethylamino)phenyl]diazenyl group. | 2.42 | 2 | 0 | ||
| indoline indoline: structure given in first source | 2.25 | 1 | 0 | indoles | |
| sodium carbonate sodium carbonate: used topically for dermatitides, mouthwash, vaginal douche; veterinary use as emergency emetic; RN given refers to carbonic acid, di-Na salt; structure | 2.02 | 1 | 0 | carbonate salt; organic sodium salt | |
| dipicolinic acid dipicolinic acid : A pyridinedicarboxylic acid carrying two carboxy groups at positions 2 and 6. | 2.44 | 2 | 0 | pyridinedicarboxylic acid | bacterial metabolite |
| biphenylacetylene biphenylacetylene : An arylacetylene that is acetylene in which the hydrogens are replaced by phenyl groups. | 2.04 | 1 | 0 | arylacetylene; benzenes | fluorochrome |
| oxetane oxetane: structure. oxetane : A saturated organic heteromonocyclic parent that is a four-membered ring comprising of three carbon atoms and an oxygen atom. | 3.52 | 2 | 0 | oxetanes; saturated organic heteromonocyclic parent | |
| alpha-aminopyridine alpha-aminopyridine: RN given refers to parent cpd; structure in Merck Index, 9th ed, #485. aminopyridine : Compounds containing a pyridine skeleton substituted by one or more amine groups. | 3.33 | 6 | 0 | ||
| 1,3-propanediol propane-1,3-diol : The simplest member of the class of propane-1,3-diols, consisting of propane in which one hydrogen from each methyl group is substituted by a hydroxy group. A colourless, viscous, water-miscible liquid with a high (210degreeC) boiling point, it is used in the synthesis of certain polymers and as a solvent and antifreeze. | 2.68 | 3 | 0 | propane-1,3-diols | metabolite; protic solvent |
| thiazolidines Thiazolidines: Reduced (protonated) form of THIAZOLES. They can be oxidized to THIAZOLIDINEDIONES. | 2.02 | 1 | 0 | thiazolidine | |
| mustard gas Mustard Gas: Severe irritant and vesicant of skin, eyes, and lungs. It may cause blindness and lethal lung edema and was formerly used as a war gas. The substance has been proposed as a cytostatic and for treatment of psoriasis. It has been listed as a known carcinogen in the Fourth Annual Report on Carcinogens (NTP-85-002, 1985) (Merck, 11th ed).. bis(2-chloroethyl) sulfide : An ethyl sulfide that is diethyl sulfide in which a hydrogen from each of the terminal methyl groups is replaced by a chlorine. It is a powerful vesicant regulated under the Chemical Weapons Convention. | 2.92 | 4 | 0 | ethyl sulfide; organochlorine compound | alkylating agent; carcinogenic agent; vesicant |
| cyanogen bromide Cyanogen Bromide: Cyanogen bromide (CNBr). A compound used in molecular biology to digest some proteins and as a coupling reagent for phosphoroamidate or pyrophosphate internucleotide bonds in DNA duplexes. | 3.92 | 13 | 0 | ||
| oleanolic acid [no description available] | 2.07 | 1 | 0 | hydroxy monocarboxylic acid; pentacyclic triterpenoid | plant metabolite |
| trimethyl phosphate trimethyl phosphate: request from searcher; structure. trimethyl phosphate : A trialkyl phosphate that is the trimethyl ester of phosphoric acid. | 1.96 | 1 | 0 | trialkyl phosphate | insect attractant; NMR chemical shift reference compound |
| triphenylmethane triphenylmethane : A triarylmethane in which the three aryl groups are phenyl. It forms the basic skeleton of several synthetic dyes. | 2.05 | 1 | 0 | triarylmethane | environmental contaminant; xenobiotic |
| dihydrotestosterone Dihydrotestosterone: A potent androgenic metabolite of TESTOSTERONE. It is produced by the action of the enzyme 3-OXO-5-ALPHA-STEROID 4-DEHYDROGENASE.. 17beta-hydroxyandrostan-3-one : A 17beta-hydroxy steroid that is testosterone in which the 4-5 double bond has been reduced to a single bond with unspecified configuration at position 5.. 17beta-hydroxy-5alpha-androstan-3-one : A 17beta-hydroxy steroid that is testosterone in which the 4,5 double bond has been reduced to a single bond with alpha-configuration at position 5. | 4.34 | 6 | 0 | 17beta-hydroxy steroid; 17beta-hydroxyandrostan-3-one; 3-oxo-5alpha-steroid | androgen; Daphnia magna metabolite; human metabolite; mouse metabolite |
| luminol Luminol: 5-Amino-2,3-dihydro-1,4-phthalazinedione. Substance that emits light on oxidation. It is used in chemical determinations. | 3.05 | 4 | 0 | ||
| angelicin angelicin: used as tranquillizer; sedative; or anticonvulsant; structure | 1.97 | 1 | 0 | furanocoumarin | |
| azomycin azomycin: RN given refers to parent cpd with specified locant; structure | 2.72 | 3 | 0 | C-nitro compound; imidazoles | antitubercular agent |
| uridine diphosphate n-acetylglucosamine Uridine Diphosphate N-Acetylglucosamine: Serves as the biological precursor of insect chitin, of muramic acid in bacterial cell walls, and of sialic acids in mammalian glycoproteins. | 2.03 | 1 | 0 | ||
| cellobiose beta-cellobiose : A cellobiose with beta configuration at the reducing-end glucose residue. | 1.98 | 1 | 0 | cellobiose | epitope |
| coumarin-3-carboxylic acid coumarin-3-carboxylic acid: structure given in first source | 2.04 | 1 | 0 | coumarins | |
| phenylacetylene phenylacetylene: can polymerize into DENDRIMERS | 2.1 | 1 | 0 | benzenes | |
| dicyclohexylcarbodiimide 1,3-dicyclohexylcarbodiimide : A carbodiimide compound having a cyclohexyl substituent on both nitrogen atoms. | 2.35 | 2 | 0 | carbodiimide | ATP synthase inhibitor; cross-linking reagent; peptide coupling reagent |
| butyramide butanamide : A monocarboxylic acid amide obtained by formal condensation of butanoic acid and ammonia. | 7.01 | 1 | 0 | butanamides; primary fatty amide | |
| maleimide [no description available] | 3.99 | 13 | 0 | dicarboximide; maleimides | EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor |
| malondialdehyde Malondialdehyde: The dialdehyde of malonic acid.. malonaldehyde : A dialdehyde that is propane substituted by two oxo groups at the terminal carbon atoms respectively. A biomarker of oxidative damage to lipids caused by smoking, it exists in vivo mainly in the enol form. | 8.73 | 10 | 0 | dialdehyde | biomarker |
| 1-chlorohexane [no description available] | 2.06 | 1 | 0 | ||
| myristic acid Myristic Acid: A saturated 14-carbon fatty acid occurring in most animal and vegetable fats, particularly butterfat and coconut, palm, and nutmeg oils. It is used to synthesize flavor and as an ingredient in soaps and cosmetics. (From Dorland, 28th ed). tetradecanoic acid : A straight-chain, fourteen-carbon, long-chain saturated fatty acid mostly found in milk fat.. tetradecanoate : A long-chain fatty acid anion that is the conjugate base of myristic acid; major species at pH 7.3. | 2.7 | 3 | 0 | long-chain fatty acid; straight-chain saturated fatty acid | algal metabolite; Daphnia magna metabolite; EC 3.1.1.1 (carboxylesterase) inhibitor; human metabolite |
| triethylenephosphoramide Triethylenephosphoramide: An insect chemosterilant and an antineoplastic agent. | 3.05 | 1 | 0 | phosphoramide | |
| trinitrobenzenesulfonic acid Trinitrobenzenesulfonic Acid: A reagent that is used to neutralize peptide terminal amino groups.. 2,4,6-trinitrobenzenesulfonic acid : The arenesulfonic acid that is benzenesulfonic acid with three nitro substituents in the 2-, 4- and 6-positions. | 2.78 | 3 | 0 | arenesulfonic acid; C-nitro compound | epitope; explosive; reagent |
| eosine yellowish-(ys) Eosine Yellowish-(YS): A versatile red dye used in cosmetics, pharmaceuticals, textiles, etc., and as tissue stain, vital stain, and counterstain with HEMATOXYLIN. It is also used in special culture media.. eosin YS dye : An organic sodium salt that is 2',4',5',7'-tetrabromofluorescein in which the carboxy group and the phenolic hydroxy group have been deprotonated and the resulting charge is neutralised by two sodium ions. | 2.73 | 3 | 0 | organic sodium salt; organobromine compound | fluorochrome; histological dye |
| gentian violet Gentian Violet: A dye that is a mixture of violet rosanilinis with antibacterial, antifungal, and anthelmintic properties.. crystal violet : An organic chloride salt that is the monochloride salt of crystal violet cation. It has been used in creams for the topical treatment of bacterial and fungal infections, being effective against some Gram-positive bacteria (notably Staphylococcus species) and some pathogenic fungi (including Candida species) but use declined following reports of animal carcinogenicity. It has also been used for dying wood, silk, and paper, as well as a histological stain. | 3.31 | 6 | 0 | organic chloride salt | anthelminthic drug; antibacterial agent; antifungal agent; antiseptic drug; histological dye |
| neutral red Neutral Red: A vital dye used as an indicator and biological stain. Various adverse effects have been observed in biological systems.. neutral red : A hydrochloride obtained by combining the free base of neutral red with one equivalent of hydrochloric acid. Neutral red acts as a pH indicator, changing from red to yellow between pH 6.8 and 8.0. | 1.99 | 1 | 0 | hydrochloride | acid-base indicator; dye; two-colour indicator |
| 4,4'-bipyridyl 4,4'-bipyridine : A bipyridine in which the two pyridine moieties are linked by a bond between positions C-4 and C-4'. | 2.06 | 1 | 0 | bipyridine | |
| glycidol glycidol: structure given in first source | 2.02 | 1 | 0 | epoxide; primary alcohol | |
| glycerylphosphorylcholine Glycerylphosphorylcholine: A component of PHOSPHATIDYLCHOLINES or LECITHINS, in which the two hydroxy groups of GLYCEROL are esterified with fatty acids. (From Stedman, 26th ed) | 2.02 | 1 | 0 | glycerophosphocholine | |
| diepoxybutane diepoxybutane: difunctional alkylating agent; RN given refers to cpd with unspecified isomeric designation; structure | 2 | 1 | 0 | epoxide | mutagen |
| malachite green malachite green: RN given refers to parent cpd; structure. malachite green : An organic chloride salt that is the monochloride salt of malachite green cation. Used as a green-coloured dye, as a counter-stain in histology, and for its anti-fungal properties in aquaculture. | 3.15 | 5 | 0 | organic chloride salt | antibacterial agent; antifungal drug; carcinogenic agent; environmental contaminant; fluorochrome; histological dye; teratogenic agent |
| potassium carbonate potassium carbonate : A potassium salt that is the dipotassium salt of carbonic acid. | 2 | 1 | 0 | carbonate salt; potassium salt | catalyst; fertilizer; flame retardant |
| succinimide succinimide: RN given refers to parent cpd. succinimide : A dicarboximide that is pyrrolidine which is substituted by oxo groups at positions 2 and 5. | 2.08 | 1 | 0 | dicarboximide; pyrrolidinone | |
| diphenylamine Diphenylamine: In humans it may be irritating to mucous membranes. Methemoglobinemia has been produced experimentally. In veterinary use, it is one of active ingredients in topical agents for prevention and treatment of screwworm infestation. An indicator in tests for nitrate poisoning.. diphenylamine : An aromatic amine containing two phenyl substituents. It has been used as a fungicide for the treatment of superficial scald in apples and pears, but is no longer approved for this purpose within the European Union. | 1.95 | 1 | 0 | aromatic amine; bridged diphenyl fungicide; secondary amino compound | antifungal agrochemical; antioxidant; carotogenesis inhibitor; EC 1.3.99.29 [phytoene desaturase (zeta-carotene-forming)] inhibitor; ferroptosis inhibitor; radical scavenger |
| toyocamycin Toyocamycin: 4-Amino-5-cyano-7-(D-ribofuranosyl)-7H- pyrrolo(2,3-d)pyrimidine. Antibiotic antimetabolite isolated from Streptomyces toyocaensis cultures. It is an analog of adenosine, blocks RNA synthesis and ribosome function, and is used mainly as a tool in biochemistry.. toyocamycin : An N-glycosylpyrrolopyrimidine that is tubercidin in which the hydrogen at position 5 of the pyrrolopyrimidine moiety has been replaced by a cyano group. | 2.02 | 1 | 0 | antibiotic antifungal agent; N-glycosylpyrrolopyrimidine; nitrile; ribonucleoside | antimetabolite; antineoplastic agent; apoptosis inducer; bacterial metabolite |
| acetylcysteine N-acetyl-L-cysteine : An N-acetyl-L-amino acid that is the N-acetylated derivative of the natural amino acid L-cysteine. | 9.72 | 9 | 0 | acetylcysteine; L-cysteine derivative; N-acetyl-L-amino acid | antidote to paracetamol poisoning; antiinfective agent; antioxidant; antiviral drug; ferroptosis inhibitor; geroprotector; human metabolite; mucolytic; radical scavenger; vulnerary |
| 3,5-diaminobenzoic acid 3,5-diaminobenzoic acid: RN given refers to parent cpd | 2.01 | 1 | 0 | ||
| 2,5-dimethylfuran 2,5-dimethylfuran: metabolite of n-hexane. 2,5-dimethylfuran : A member of the class of furans that is furan in which the hydrogens at positions 2 and 5 are replaced by methyl groups. | 2.47 | 2 | 0 | furans | antifungal agent; bacterial metabolite; fuel; fumigant; human urinary metabolite; Maillard reaction product; plant metabolite |
| 1-octyne [no description available] | 2.06 | 1 | 0 | ||
| c.i. 42510 Rosaniline Dyes: Compounds that contain the triphenylmethane aniline structure found in rosaniline. Many of them have a characteristic magenta color and are used as COLORING AGENTS.. basic fuchsin : A four-component mixture of chemically related dyes comprising pararosanilin, rosanilin, magenta II and new fuchsin in varying amounts. rosanilin : A hydrochloride that is the monohydrochloride of 4-[(4-aminophenyl)(4-iminocyclohexa-2,5-dien-1-ylidene)methyl]-2-methylaniline. One of the major constituents of Basic fuchsin, together with pararosanilin, magenta II and new fuchsin. | 3.83 | 11 | 0 | ||
| brilliant green brilliant green: RN given refers to sulfate; structure in Merck Index, 9th ed, #1378. brilliant green : An organic hydrogensulfate salt having 4-{[4-(diethylamino)phenyl](phenyl)methylidene}-N,N-diethylcyclohexa-2,5-dien-1-iminium as the counterion. | 2.11 | 1 | 0 | organic hydrogensulfate salt | antibacterial agent; antiseptic drug; environmental contaminant; fluorochrome; histological dye; poison |
| erythromycin Erythromycin: A bacteriostatic antibiotic macrolide produced by Streptomyces erythreus. Erythromycin A is considered its major active component. In sensitive organisms, it inhibits protein synthesis by binding to 50S ribosomal subunits. This binding process inhibits peptidyl transferase activity and interferes with translocation of amino acids during translation and assembly of proteins.. erythromycin : Any of several wide-spectrum macrolide antibiotics obtained from actinomycete Saccharopolyspora erythraea (formerly known as Streptomyces erythraeus).. erythromycin A : An erythromycin that consists of erythronolide A having 2,6-dideoxy-3-C-methyl-3-O-methyl-alpha-L-ribo-hexopyranosyl and 3,4,6-trideoxy-3-(dimethylamino)-beta-D-xylo-hexopyranosyl residues attahced at positions 4 and 6 respectively. | 2.9 | 4 | 0 | cyclic ketone; erythromycin | |
| dehydroepiandrosterone sulfate Dehydroepiandrosterone Sulfate: The circulating form of a major C19 steroid produced primarily by the ADRENAL CORTEX. DHEA sulfate serves as a precursor for TESTOSTERONE; ANDROSTENEDIONE; ESTRADIOL; and ESTRONE.. dehydroepiandrosterone sulfate : A steroid sulfate that is the 3-sulfooxy derivative of dehydroepiandrosterone. | 2.01 | 1 | 0 | 17-oxo steroid; steroid sulfate | EC 2.7.1.33 (pantothenate kinase) inhibitor; human metabolite; mouse metabolite |
| 2'-deoxy-5'-adenosine monophosphate 2'-deoxy-5'-adenosine monophosphate: RN given refers to parent cpd. 2'-deoxyadenosine 5'-monophosphate : A purine 2'-deoxyribonucleoside 5'-monophosphate having adenine as the nucleobase. | 2.42 | 2 | 0 | 2'-deoxyadenosine 5'-phosphate; purine 2'-deoxyribonucleoside 5'-monophosphate | fundamental metabolite |
| homoserine homoserine : An alpha-amino acid that is glycine substituted at the alpha-position by a 2-hydroxyethyl group.. L-homoserine : The L-enantiomer of homoserine. | 2.94 | 4 | 0 | amino acid zwitterion; homoserine | algal metabolite; Escherichia coli metabolite; human metabolite; Saccharomyces cerevisiae metabolite |
| methylnitrosourea Methylnitrosourea: A nitrosourea compound with alkylating, carcinogenic, and mutagenic properties.. N-methyl-N-nitrosourea : A member of the class of N-nitrosoureas that is urea in which one of the nitrogens is substituted by methyl and nitroso groups. | 2.69 | 3 | 0 | N-nitrosoureas | alkylating agent; carcinogenic agent; mutagen; teratogenic agent |
| 2-chloroethyl ethyl sulfide [no description available] | 2.4 | 2 | 0 | ||
| 2-methylimidazole [no description available] | 2.21 | 1 | 0 | ||
| 2-phenylbenzimidazole 2-phenylbenzimidazole: structure in first source | 2 | 1 | 0 | ||
| ethylnitrosourea Ethylnitrosourea: A nitrosourea compound with alkylating, carcinogenic, and mutagenic properties.. N-ethyl-N-nitrosourea : A member of the class of N-nitrosoureas that is urea in which one of the nitrogens is substituted by ethyl and nitroso groups. | 2.03 | 1 | 0 | N-nitrosoureas | alkylating agent; carcinogenic agent; genotoxin; mutagen |
| 2-hydroxy-5-nitrobenzyl bromide 2-Hydroxy-5-nitrobenzyl Bromide: A chemical reagent that reacts with and modifies chemically the tryptophan portion of protein molecules. Used for 'active site' enzyme studies and other protein studies. Sometimes referred to as Koshland's reagent. | 2.06 | 1 | 0 | ||
| levonorgestrel Levonorgestrel: A synthetic progestational hormone with actions similar to those of PROGESTERONE and about twice as potent as its racemic or (+-)-isomer (NORGESTREL). It is used for contraception, control of menstrual disorders, and treatment of endometriosis. | 2.15 | 1 | 0 | 17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; terminal acetylenic compound | contraceptive drug; female contraceptive drug; progestin; synthetic oral contraceptive |
| methylphosphate methylphosphate: specifically and irreversibly inactivates inorganic pyrophosphatase; RN given refers to parent cpd. methyl dihydrogen phosphate : A monoalkyl phosphate having methyl as the alkyl group. | 3.52 | 2 | 0 | monoalkyl phosphate; one-carbon compound | algal metabolite; epitope; phosphoantigen |
| dimethyl phosphate dimethyl phosphate: excreted in urine after exposure to mevinphos; RN given refers to parent cpd; structure | 2.41 | 2 | 0 | dialkyl phosphate | |
| 2-hydroxyethyl acrylate [no description available] | 2.01 | 1 | 0 | ||
| 2-(2'-hydroxyphenyl)benzoxazole 2-(2'-hydroxyphenyl)benzoxazole: structure in first source. 2-(1,3-benzoxazol-2-yl)phenol : A member of the class of 1,3-benzoxazoles that is 1,3-benzoxazole substituted by a 2-hydroxyphenyl group at position 2. | 2 | 1 | 0 | 1,3-benzoxazoles; phenols | geroprotector |
| hydroxyethyl methacrylate hydroxyethyl methacrylate: many of cited refs are for gel which refers to polymeric form of above cpd: POLYHYDROXYETHYL METHACRYLATE. 2-hydroxyethyl methacrylate : An enoate ester that is the monomethacryloyl derivative of ethylene glycol. | 2.48 | 2 | 0 | enoate ester | allergen; polymerisation monomer |
| 3-hydroxypicolinic acid [no description available] | 8.24 | 6 | 0 | monocarboxylic acid; monohydroxypyridine | MALDI matrix material |
| amaranth dye Amaranth Dye: A sulfonic acid-based naphthylazo dye used as a coloring agent for foodstuffs and medicines and as a dye and chemical indicator. It was banned by the FDA in 1976 for use in foods, drugs, and cosmetics. (From Merck Index, 11th ed) | 2 | 1 | 0 | ||
| hexafluoroisopropanol 1,1,1,3,3,3-hexafluoropropan-2-ol : An organofluorine compound formed by substitution of all the methyl protons in propan-2-ol by fluorine. It is a metabolite of inhalation anesthetic sevoflurane. | 8.9 | 11 | 0 | organofluorine compound; secondary alcohol | drug metabolite |
| 3,4-epoxy-1-butene 3,4-epoxy-1-butene: RN given refers to monomer | 2.7 | 3 | 0 | ||
| 5-aminouracil [no description available] | 2 | 1 | 0 | ||
| 3-methoxycatechol 3-methoxycatechol : A member of the class of catechols that is catechol in which a hydrogen that is ortho to one of the hydroxy groups has been replaced by a methoxy group. It displays agonistic activity against G protein-coupled receptor 35 (GPR35). | 2.03 | 1 | 0 | aromatic ether; catechols | G-protein-coupled receptor agonist |
| 2-aminobenzimidazole 2-aminobenzimidazole: metabolite of benomyl; RN given refers to parent cpd. 2-aminobenzimidazole : A member of the class of benzimidazoles that is benzimidazole in which the hydrogen at position 2 is replaced by an amino group. | 2.63 | 2 | 0 | benzimidazoles | marine xenobiotic metabolite |
| deoxycytidine [no description available] | 10.62 | 69 | 4 | pyrimidine 2'-deoxyribonucleoside | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| deoxyuridine [no description available] | 6.76 | 75 | 0 | pyrimidine 2'-deoxyribonucleoside | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| 2'-deoxyadenosine 2'-deoxyformycin A: RN not in Chemline 9/85; RN and structure given in first source | 4.07 | 14 | 0 | purine 2'-deoxyribonucleoside; purines 2'-deoxy-D-ribonucleoside | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| rhodamine 6g rhodamine 6G: RN given refers to HCl | 2.42 | 2 | 0 | ||
| methylphosphonic acid methylphosphonic acid : A one-carbon compound that is phosphonic acid in which the hydrogen attached to the phosphorus is substituted by a methyl group. | 5.49 | 21 | 0 | one-carbon compound; phosphonic acids | |
| deoxycytidine monophosphate Deoxycytidine Monophosphate: Deoxycytidine (dihydrogen phosphate). A deoxycytosine nucleotide containing one phosphate group esterified to the deoxyribose moiety in the 2'-,3'- or 5- positions.. 2'-deoxycytosine 5'-monophosphate : A pyrimidine 2'-deoxyribonucleoside 5'-monophosphate having cytosine as the nucleobase. | 3.22 | 6 | 0 | 2'-deoxycytidine phosphate; pyrimidine 2'-deoxyribonucleoside 5'-monophosphate | Escherichia coli metabolite; mouse metabolite |
| ammonium bicarbonate ammonium bicarbonate: see also record for ammonium carbonate (di-NH4 salt) | 2.39 | 2 | 0 | organooxygen compound | |
| ethambutol Ethambutol: An antitubercular agent that inhibits the transfer of mycolic acids into the cell wall of the tubercle bacillus. It may also inhibit the synthesis of spermidine in mycobacteria. The action is usually bactericidal, and the drug can penetrate human cell membranes to exert its lethal effect. (From Smith and Reynard, Textbook of Pharmacology, 1992, p863). ethambutol : An ethylenediamine derivative that is ethane-1,2-diamine in which one hydrogen attached to each of the nitrogens is sutstituted by a 1-hydroxybutan-2-yl group (S,S-configuration). It is a bacteriostatic antimycobacterial drug, effective against Mycobacterium tuberculosis and some other mycobacteria. It is used (as the dihydrochloride salt) in combination with other antituberculous drugs in the treatment of pulmonary and extrapulmonary tuberculosis; resistant strains of M. tuberculosis are readily produced if ethambutol is used alone. | 2.02 | 1 | 0 | ethanolamines; ethylenediamine derivative | antitubercular agent; environmental contaminant; xenobiotic |
| nicotinamide mononucleotide Nicotinamide Mononucleotide: 3-Carbamoyl-1-beta-D-ribofuranosyl pyridinium hydroxide-5'phosphate, inner salt. A nucleotide in which the nitrogenous base, nicotinamide, is in beta-N-glycosidic linkage with the C-1 position of D-ribose. Synonyms: Nicotinamide Ribonucleotide; NMN. | 2.39 | 2 | 0 | nicotinamide mononucleotide | Escherichia coli metabolite; mouse metabolite |
| tetradecyltrimethylammonium tetradecyltrimethylammonium: cationic surfactant; used to determine thermal stability of DNA; Catrimox-14 is the tradename of the oxalate; Catrimox-14 lyses cells and simultaneously precipitates RNA and was demonstrated useful in isolating RNA from whole blood | 2.04 | 1 | 0 | ||
| 4-dimethylaminopyridine 4-dimethylaminopyridine: catalyst for acetylation of hydroxy cpds; structure | 2.06 | 1 | 0 | dialkylarylamine; tertiary amino compound | |
| 4-aminothiophenol [no description available] | 2.1 | 1 | 0 | ||
| 2-amino-7-nitrofluorene 2-amino-7-nitrofluorene: structure in first source | 2.04 | 1 | 0 | ||
| durapatite Durapatite: The mineral component of bones and teeth; it has been used therapeutically as a prosthetic aid and in the prevention and treatment of osteoporosis.. hydroxylapatite : A phosphate mineral with the formula Ca5(PO4)3(OH). | 3.26 | 6 | 0 | ||
| cadmium sulfide [no description available] | 2.45 | 2 | 0 | cadmium molecular entity | |
| sodium hydroxide Sodium Hydroxide: A highly caustic substance that is used to neutralize acids and make sodium salts. (From Merck Index, 11th ed) | 3.61 | 9 | 0 | alkali metal hydroxide | |
| manganese dioxide [no description available] | 2.1 | 1 | 0 | manganese molecular entity; metal oxide | |
| zinc oxide Zinc Oxide: A mild astringent and topical protectant with some antiseptic action. It is also used in bandages, pastes, ointments, dental cements, and as a sunblock. | 2.49 | 2 | 0 | zinc molecular entity | |
| lead sulfide lead sulfide: surma refers to fine powder-like mascara, applied to conjunctival surfaces of eyes; originally contained antimony sulfide (derived from Urdu word for antimony); recently lead sulfide has been used due to scarcity of antimony; RN given refers to cpd with MF of Pb-S; galena is the principal ore of lead sulfide. Black kohl stone and red-brown kohl stone are widely used in eye cosmetics in the Middle East, Asia and Africa | 2.04 | 1 | 0 | ||
| molybdenum disulfide [no description available] | 2.11 | 1 | 0 | sulfide salt | |
| cupric sulfide copper(II) sulfide : A copper sulfide in which the metal is in the +2 oxidation state. | 2.82 | 3 | 0 | ||
| arsenic trioxide Arsenic Trioxide: An inorganic compound with the chemical formula As2O3 that is used for the treatment of ACUTE PROMYELOCYTIC LEUKEMIA in patients who have relapsed from, or are resistant to, conventional drug therapy. | 2.5 | 2 | 0 | ||
| ammonium hydroxide Ammonium Hydroxide: The hydroxy salt of ammonium ion. It is formed when AMMONIA reacts with water molecules in solution.. ammonium hydroxide : A solution of ammonia in water. | 2.71 | 3 | 0 | inorganic hydroxy compound | food acidity regulator |
| ferrous oxide [no description available] | 2.02 | 1 | 0 | iron oxide | |
| vancomycin Vancomycin: Antibacterial obtained from Streptomyces orientalis. It is a glycopeptide related to RISTOCETIN that inhibits bacterial cell wall assembly and is toxic to kidneys and the inner ear.. vancomycin : A complex glycopeptide from Streptomyces orientalis. It inhibits a specific step in the synthesis of the peptidoglycan layer in the Gram-positive bacteria Staphylococcus aureus and Clostridium difficile. | 3.42 | 6 | 0 | glycopeptide | antibacterial drug; antimicrobial agent; bacterial metabolite |
| d-alpha tocopherol Vitamin E: A generic descriptor for all TOCOPHEROLS and TOCOTRIENOLS that exhibit ALPHA-TOCOPHEROL activity. By virtue of the phenolic hydrogen on the 2H-1-benzopyran-6-ol nucleus, these compounds exhibit varying degree of antioxidant activity, depending on the site and number of methyl groups and the type of ISOPRENOIDS.. tocopherol : A collective name for a group of closely related lipids that contain a chroman-6-ol nucleus substituted at position 2 by a methyl group and by a saturated hydrocarbon chain consisting of three isoprenoid units. They are designated as alpha-, beta-, gamma-, and delta-tocopherol depending on the number and position of additional methyl substituents on the aromatic ring. Tocopherols occur in vegetable oils and vegetable oil products, almost exclusively with R,R,R configuration. Tocotrienols differ from tocopherols only in having three double bonds in the hydrocarbon chain.. vitamin E : Any member of a group of fat-soluble chromanols that exhibit biological activity against vitamin E deficiency. The vitamers in this class consists of a chroman-6-ol core which is substituted at position 2 by a methyl group and (also at position 2) either a saturated or a triply-unsaturated hydrocarbon chain consisting of three isoprenoid units. The major function of vitamin E is to act as a natural antioxidant by scavenging free radicals and molecular oxygen.. (R,R,R)-alpha-tocopherol : An alpha-tocopherol that has R,R,R configuration. The naturally occurring stereoisomer of alpha-tocopherol, it is found particularly in sunflower and olive oils. | 2.76 | 3 | 0 | alpha-tocopherol | algal metabolite; antiatherogenic agent; anticoagulant; antioxidant; antiviral agent; EC 2.7.11.13 (protein kinase C) inhibitor; immunomodulator; micronutrient; nutraceutical; plant metabolite |
| pseudouridine [no description available] | 10.16 | 15 | 0 | pseudouridines | fundamental metabolite |
| selenomethionine [no description available] | 7.74 | 3 | 0 | selenoamino acid; selenomethionines | plant metabolite |
| 9,10-diphenylanthracene [no description available] | 2 | 1 | 0 | anthracenes | fluorochrome; photosensitizing agent |
| 1-aminopyrene [no description available] | 2.08 | 1 | 0 | ||
| digoxigenin Digoxigenin: 3 beta,12 beta,14-Trihydroxy-5 beta-card-20(22)-enolide. A cardenolide which is the aglycon of digoxin. Can be obtained by hydrolysis of digoxin or from Digitalis orientalis L. and Digitalis lanata Ehrh.. digoxigenin : A hydroxy steroid that consists of 5beta-cardanolide having a double bond at the 20(22)-position as well as hydroxy groups at the 3beta-, 12beta- and 14beta-positions. It has been isolated from the plant species of the genus Digitalis. | 5.52 | 21 | 0 | 12beta-hydroxy steroid; 14beta-hydroxy steroid; 3beta-hydroxy steroid; 3beta-sterol | hapten; plant metabolite |
| decane decane : A straight-chain alkane with 10 carbon atoms. | 7.41 | 1 | 0 | alkane | |
| 5-chlorouracil 5-chlorouracil : An organochlorine compound consisting of uracil having an chloro substituent at the 5-position. | 2.44 | 2 | 0 | organochlorine compound | |
| isopropyl methylphosphonic acid [no description available] | 2.6 | 1 | 0 | ||
| stearylamine stearylamine: RN given refers to parent cpd. octadecan-1-amine : An 18-carbon primary aliphatic amine. | 2.71 | 3 | 0 | primary aliphatic amine | film-forming compound |
| ethyldimethylaminopropyl carbodiimide Ethyldimethylaminopropyl Carbodiimide: Carbodiimide cross-linking reagent. | 3.5 | 8 | 0 | ||
| paraquat Paraquat: A poisonous dipyridilium compound used as contact herbicide. Contact with concentrated solutions causes irritation of the skin, cracking and shedding of the nails, and delayed healing of cuts and wounds.. paraquat : An organic cation that consists of 4,4'-bipyridine bearing two N-methyl substituents loctated at the 1- and 1'-positions. | 2.78 | 3 | 0 | organic cation | geroprotector; herbicide |
| pristane pristane: structure. pristane : A norterpene that is an acyclic saturated hydrocarbon derived from phytane by loss of its C-16 terminal methyl group. | 2.13 | 1 | 0 | long-chain alkane; norterpene | biomarker; immunological adjuvant |
| 2'-deoxyadenosine triphosphate 2'-deoxyadenosine triphosphate: RN given refers to unlabeled parent cpd | 3.87 | 12 | 0 | 2'-deoxyadenosine 5'-phosphate; purine 2'-deoxyribonucleoside 5'-triphosphate | Escherichia coli metabolite; mouse metabolite |
| s,n,n'-tripropylthiocarbamate Reward: An object or a situation that can serve to reinforce a response, to satisfy a motive, or to afford pleasure.. vernolate : A monounsaturated fatty acid anion that is the conjugate base of vernolic acid, obtained by deprotonation of the carboxy group; major species at pH 7.3. | 2.1 | 1 | 0 | tertiary amine | |
| tetrabutylammonium tetrabutylammonium: lipophilic probe; RN given refers to parent cpd | 2.11 | 1 | 0 | quaternary ammonium ion | |
| 2-tert-butylhydroquinone 2-tert-butylhydroquinone: an anticarcinogenic and chemopreventive agent. 2-tert-butylhydroquinone : A member of the class of hydroquinones in which one of the ring hydrogens of hydroquinone is replaced by a tert-butyl group. | 3.1 | 5 | 0 | hydroquinones | food antioxidant |
| amiloride Amiloride: A pyrazine compound inhibiting SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS. This inhibition creates a negative potential in the luminal membranes of principal cells, located in the distal convoluted tubule and collecting duct. Negative potential reduces secretion of potassium and hydrogen ions. Amiloride is used in conjunction with DIURETICS to spare POTASSIUM loss. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p705). amiloride : A member of the class of pyrazines resulting from the formal monoacylation of guanidine with the carboxy group of 3,5-diamino-6-chloropyrazine-2-carboxylic acid. | 2.1 | 1 | 0 | aromatic amine; guanidines; organochlorine compound; pyrazines | diuretic; sodium channel blocker |
| 1,6-diaminohexane 1,6-diaminohexane: Russian drug; RN given refers to parent cpd; structure. hexane-1,6-diamine : A C6 alkane-alpha,omega-diamine. | 1.99 | 1 | 0 | alkane-alpha,omega-diamine | human xenobiotic metabolite |
| (nitrilotris(methylene))triphosphonic acid (nitrilotris(methylene))triphosphonic acid: RN given refers to parent cpd; an antiscalant | 2.44 | 2 | 0 | phosphonoacetic acid | |
| 1,5-naphthalenediamine 1,5-diaminonaphthalene: structure in first source. naphthalene-1,5-diamine : A naphthalenediamine compound having amino substituents in the 1- and 5-positions. | 2.07 | 1 | 0 | naphthalenediamine | carcinogenic agent |
| fluorescein Fluorescein: A phthalic indicator dye that appears yellow-green in normal tear film and bright green in a more alkaline medium such as the aqueous humor.. fluorescein (lactone form) : A xanthene dye that is highly fluorescent, detectable even when present in minute quantities. Used forensically to detect traces of blood, in analytical chemistry as an indicator in silver nitrate titrations and in microscopy. | 5.57 | 69 | 0 | 2-benzofurans; gamma-lactone; organic heteropentacyclic compound; oxaspiro compound; polyphenol; xanthene dye | fluorescent dye; radioopaque medium |
| 6-methylbenzo(a)pyrene [no description available] | 2 | 1 | 0 | ||
| nile blue Nile Blue: RN given refers to chloride; structure. nile blue A : An organic chloride salt having 5-amino-9-(diethylamino)benzo[a]phenoxazin-7-ium as the couterion. fluorescent dye which is also a potent photosensitiser for photodynamic therapy. | 7.05 | 1 | 0 | ||
| thioflavin t thioflavin T: RN given refers to chloride; structure. thioflavine T : An organic chloride salt having 2-[4-(dimethylamino)phenyl]-3,6-dimethyl-1,3-benzothiazol-3-ium as the counterion. It is widely used to visualise and quantify the presence of amyloids, both in vitro and in vivo. | 3.5 | 7 | 0 | organic chloride salt | fluorochrome; geroprotector; histological dye |
| didecyldimethylammonium didecyldimethylammonium: RN given refers to parent cpd; deciquam 222 refers to bromide | 2.03 | 1 | 0 | quaternary ammonium salt | |
| 1,4-bis(2,3-epoxypropoxy)butane [no description available] | 1.96 | 1 | 0 | ||
| 1,2,7,8-diepoxyoctane 1,2,7,8-diepoxyoctane: difunctional alkylating agent; structure | 1.99 | 1 | 0 | epoxide | mutagen |
| alpha-terpineol terpineol : A family of monoterpenols that have a p-menthane skeleton containing one double bond and bearing a single hydroxy substituent. | 2.06 | 1 | 0 | terpineol | plant metabolite |
| fucose Fucose: A six-member ring deoxysugar with the chemical formula C6H12O5. It lacks a hydroxyl group on the carbon at position 6 of the molecule.. L-fucopyranose : The pyranose form of L-fucose.. fucose : Any deoxygalactose that is deoxygenated at the 6-position. | 7.69 | 3 | 0 | fucopyranose; L-fucose | Escherichia coli metabolite; mouse metabolite |
| cme-carbodiimide [no description available] | 1.96 | 1 | 0 | ||
| gamma-glycidoxypropyltrimethoxysilane 3-glycidyloxypropyltrimethoxysilane: used to immobilize carbonic anhydrase into mesoporous supports; structure in first source | 2.46 | 2 | 0 | ||
| polyethylene glycol 300 [no description available] | 3.43 | 7 | 0 | poly(ethylene glycol) | |
| n,n-dimethylacrylamide [no description available] | 2.72 | 3 | 0 | ||
| squaric acid [no description available] | 2.71 | 3 | 0 | alicyclic ketone; carbon oxoacid | metabolite |
| thymine glycol thymine glycol: forms photodimers (thymine dimers) under UV; RN given refers to cpd without isomeric designation | 9.1 | 15 | 0 | hydroxypyrimidine | |
| benzo(a)pyrene-6,12-quinone benzo(a)pyrene-6,12-quinone: tautomerizes to the diol; structure | 2.05 | 1 | 0 | ||
| didodecyldimethylammonium didodecyldimethylammonium: RN given refers to parent cpd | 2.39 | 2 | 0 | ||
| 2,2-bis(bromomethyl)-1,3-propanediol 2,2-bis(bromomethyl)-1,3-propanediol: structure given in first source | 2.93 | 3 | 0 | primary alcohol | |
| fluorescein-5-isothiocyanate Fluorescein-5-isothiocyanate: Fluorescent probe capable of being conjugated to tissue and proteins. It is used as a label in fluorescent antibody staining procedures as well as protein- and amino acid-binding techniques.. fluorescein 5-isothiocyanate : The 5-isomer of fluorescein isothiocyanate. Acts as a fluorescent probe capable of being conjugated to tissue and proteins; used as a label in fluorescent antibody staining procedures as well as protein- and amino acid-binding techniques. | 6.34 | 59 | 0 | fluorescein isothiocyanate | |
| sabinene sabinene: RN given refers to cpd without isomeric designation. sabinene : A thujene that is a bicyclic monoterpene isolated from the essential oils of various plant species. | 2.38 | 2 | 0 | thujene | plant metabolite |
| mannose mannopyranose : The pyranose form of mannose. | 4.76 | 9 | 0 | D-aldohexose; D-mannose; mannopyranose | metabolite |
| dithiothreitol 1,4-dimercaptobutane-2,3-diol : A glycol that is butane-2,3-diol in which a hydrogen from each of the methyl groups is replaced by a thiol group.. 1,4-dithiothreitol : The threo-diastereomer of 1,4-dimercaptobutane-2,3-diol. | 4.12 | 16 | 0 | 1,4-dimercaptobutane-2,3-diol; butanediols; dithiol; glycol; thiol | chelator; human metabolite; reducing agent |
| 9-amino-6-chloro-2-methoxyacridine [no description available] | 2.37 | 2 | 0 | ||
| ecdysone [no description available] | 2.4 | 2 | 0 | 14alpha-hydroxy steroid; 22-hydroxy steroid; 25-hydroxy steroid; 2beta-hydroxy steroid; 3beta-sterol; 6-oxo steroid; ecdysteroid | prohormone |
| streptomycin [no description available] | 3.38 | 7 | 0 | antibiotic antifungal drug; antibiotic fungicide; streptomycins | antibacterial drug; antifungal agrochemical; antimicrobial agent; antimicrobial drug; bacterial metabolite; protein synthesis inhibitor |
| carbonates Carbonates: Salts or ions of the theoretical carbonic acid, containing the radical CO2(3-). Carbonates are readily decomposed by acids. The carbonates of the alkali metals are water-soluble; all others are insoluble. (From Grant & Hackh's Chemical Dictionary, 5th ed). carbonates : Organooxygen compounds that are salts or esters of carbonic acid, H2CO3. | 3.4 | 7 | 0 | carbon oxoanion | |
| butylhydroxybutylnitrosamine Butylhydroxybutylnitrosamine: A substituted carcinogenic nitrosamine.. N-butyl-N-(4-hydroxybutyl)nitrosamine : A nitrosamine that has butyl and 4-hydroxybutyl substituents. In mice, it causes high-grade, invasive cancers in the urinary bladder, but not in any other tissues. | 1.97 | 1 | 0 | nitrosamine; primary alcohol | carcinogenic agent |
| n-methylacetamide-oxotremorine m N-methylacetamide-oxotremorine M: RN given refers to iodide; structure given in first source | 2.11 | 1 | 0 | ||
| l 451167 L 451167: structure given in first source | 2.73 | 3 | 0 | ||
| bitoscanate bitoscanate: anthelmintic; minor descriptor (75-83); on-line & Index Medicus search THIOCYANATES (75-83); structure | 2 | 1 | 0 | benzenes | |
| cladribine [no description available] | 2.38 | 2 | 0 | organochlorine compound; purine 2'-deoxyribonucleoside | antineoplastic agent; immunosuppressive agent |
| mono-(2-ethylhexyl)phthalate mono-(2-ethylhexyl)phthalate: RN given refers to parent cpd. mono(2-ethylhexyl) phthalate : The mono(2-ethylhexyl) ester of benzene-1,2-dicarboxylic acid. | 2.06 | 1 | 0 | phthalic acid monoester | |
| (3-mercaptopropyl)trimethoxysilane [no description available] | 2.44 | 2 | 0 | ||
| 1-nitropyrene [no description available] | 1.98 | 1 | 0 | nitroarene | carcinogenic agent |
| vidarabine adenine arabinoside : A purine nucleoside in which adenine is attached to arabinofuranose via a beta-N(9)-glycosidic bond. | 4.37 | 6 | 0 | beta-D-arabinoside; purine nucleoside | antineoplastic agent; bacterial metabolite; nucleoside antibiotic |
| diadenosine tetraphosphate P(1),P(4)-bis(5'-adenosyl) tetraphosphate : A diadenosyl tetraphosphate compound having the two 5'-adenosyl residues attached at the P(1)- and P(4)-positions. | 3.98 | 4 | 0 | diadenosyl tetraphosphate | Escherichia coli metabolite; mouse metabolite |
| acetoxyacetylaminofluorene Acetoxyacetylaminofluorene: An alkylating agent that forms DNA ADDUCTS at the C-8 position in GUANINE, resulting in single strand breaks. It has demonstrated carcinogenic action.. N-acetoxy-2-acetamidofluorene : A 2-acetamidofluorene compound in which the parent 2-acetamidofluorene is substituted on nitrogen by an acetoxy group. | 8.08 | 5 | 0 | 2-acetamidofluorenes | carcinogenic agent; mutagen |
| nsc 520594 [no description available] | 2.1 | 1 | 0 | ||
| 4-(4-dimethylaminophenylazo)benzoic acid 4-(4-dimethylaminophenylazo)benzoic acid: structure given in first source | 2.75 | 3 | 0 | ||
| n-methylaspartate N-Methylaspartate: An amino acid that, as the D-isomer, is the defining agonist for the NMDA receptor subtype of glutamate receptors (RECEPTORS, NMDA).. N-methyl-D-aspartic acid : An aspartic acid derivative having an N-methyl substituent and D-configuration. | 2.44 | 2 | 0 | amino dicarboxylic acid; D-alpha-amino acid; D-aspartic acid derivative; secondary amino compound | neurotransmitter agent |
| enbucrilate Enbucrilate: A tissue adhesive that is applied as a monomer to moist tissue and polymerizes to form a bond. It is slowly biodegradable and used in all kinds of surgery, including dental. | 2.95 | 4 | 0 | alpha,beta-unsaturated monocarboxylic acid; nitrile | |
| 2-hydroxy-7-nitrofluorene 2-hydroxy-7-nitrofluorene: structure in first source | 2.04 | 1 | 0 | ||
| 3-deazaadenosine 3-deazaadenosine: RN given refers to parent cpd. | 2.02 | 1 | 0 | ||
| coralyne coralyne: RN given refers to parent cpd; at this time it is not known for which salt NSC-154890 is synonym; structure; DNA topoisomerse antagonist | 3.16 | 5 | 0 | isoquinolines | |
| propargyl ether propargyl ether: structure in first source | 2.17 | 1 | 0 | ||
| p-azobenzenearsonate p-Azobenzenearsonate: A hapten capable of eliciting both antibody formation and delayed hypersensitivity when bound to aromatic amino acids, polypeptides or proteins. It is used as an immunologic research tool.. 4,4'-azodibenzenearsonic acid : The monoazo compound formed from arsanilic acid. It is used as an immunologic research tool. | 3.48 | 2 | 0 | ||
| hepes [no description available] | 1.95 | 1 | 0 | HEPES; organosulfonic acid | |
| iridium Iridium: A metallic element with the atomic symbol Ir, atomic number 77, and atomic weight 192.22. | 3.34 | 6 | 0 | cobalt group element atom; platinum group metal atom | |
| lanthanum [no description available] | 2.41 | 1 | 0 | f-block element atom; lanthanoid atom; scandium group element atom | |
| lutetium Lutetium: An element of the rare earth family of metals. It has the atomic symbol Lu, atomic number 71, and atomic weight 175. | 2.4 | 2 | 0 | d-block element atom; lanthanoid atom | |
| manganese Manganese: A trace element with atomic symbol Mn, atomic number 25, and atomic weight 54.94. It is concentrated in cell mitochondria, mostly in the pituitary gland, liver, pancreas, kidney, and bone, influences the synthesis of mucopolysaccharides, stimulates hepatic synthesis of cholesterol and fatty acids, and is a cofactor in many enzymes, including arginase and alkaline phosphatase in the liver. (From AMA Drug Evaluations Annual 1992, p2035). manganese(4+) : A manganese cation that is monoatomic and has a formal charge of +4. | 5.57 | 72 | 0 | elemental manganese; manganese group element atom | Escherichia coli metabolite; micronutrient |
| mercury Mercury: A silver metallic element that exists as a liquid at room temperature. It has the atomic symbol Hg (from hydrargyrum, liquid silver), atomic number 80, and atomic weight 200.59. Mercury is used in many industrial applications and its salts have been employed therapeutically as purgatives, antisyphilitics, disinfectants, and astringents. It can be absorbed through the skin and mucous membranes which leads to MERCURY POISONING. Because of its toxicity, the clinical use of mercury and mercurials is diminishing.. mercury(0) : Elemental mercury of oxidation state zero. | 7.4 | 82 | 0 | elemental mercury; zinc group element atom | neurotoxin |
| molybdenum Molybdenum: A metallic element with the atomic symbol Mo, atomic number 42, and atomic weight 95.95. It is an essential trace element, being a component of the enzymes xanthine oxidase, aldehyde oxidase, and nitrate reductase. | 3.44 | 7 | 0 | chromium group element atom | micronutrient |
| niobium Niobium: A metal element atomic number 41, atomic weight 92.906, symbol Nb. | 2.04 | 1 | 0 | vanadium group element atom | |
| osmium Osmium: A very hard, gray, toxic, and nearly infusible metal element, atomic number 76, atomic weight 190.2, symbol Os. | 3.87 | 12 | 0 | iron group element atom; platinum group metal atom | |
| palladium Palladium: A chemical element having an atomic weight of 106.4, atomic number of 46, and the symbol Pd. It is a white, ductile metal resembling platinum, and following it in abundance and importance of applications. It is used in dentistry in the form of gold, silver, and copper alloys.. palladium : Chemical element (nickel group element atom) with atomic number 46. | 5.65 | 23 | 0 | metal allergen; nickel group element atom; platinum group metal atom | |
| platinum Platinum: A heavy, soft, whitish metal, resembling tin, with atomic number 78, atomic weight 195.084, symbol Pt. It is used in manufacturing equipment for laboratory and industrial use. It occurs as a black powder (platinum black) and as a spongy substance (spongy platinum) and may have been known in Pliny's time as alutiae. | 4.83 | 31 | 0 | elemental platinum; nickel group element atom; platinum group metal atom | |
| praseodymium Praseodymium: An element of the rare earth family of metals. It has the atomic symbol Pr, atomic number 59, and atomic weight 140.91. | 7.03 | 1 | 0 | f-block element atom; lanthanoid atom | |
| rhenium Rhenium: A metal, atomic number 75, atomic weight 186.207, symbol Re. | 2.94 | 4 | 0 | manganese group element atom | |
| rhodium Rhodium: A hard and rare metal of the platinum group, atomic number 45, atomic weight 102.905, symbol Rh.. rhodium atom : A cobalt group element atom of atomic number 45. | 4.16 | 16 | 0 | cobalt group element atom | |
| ruthenium Ruthenium: A hard, brittle, grayish-white rare earth metal with an atomic symbol Ru, atomic number 44, and atomic weight 101.07. It is used as a catalyst and hardener for PLATINUM and PALLADIUM. | 7.09 | 61 | 0 | iron group element atom; platinum group metal atom | |
| samarium Samarium: An element of the rare earth family of metals. It has the atomic symbol Sm, atomic number 62, and atomic weight 150.36. The oxide is used in the control rods of some nuclear reactors. | 1.98 | 1 | 0 | f-block element atom; lanthanoid atom | |
| silver Silver: An element with the atomic symbol Ag, atomic number 47, and atomic weight 107.87. It is a soft metal that is used medically in surgical instruments, dental prostheses, and alloys. Long-continued use of silver salts can lead to a form of poisoning known as ARGYRIA. | 8.57 | 147 | 0 | copper group element atom; elemental silver | Escherichia coli metabolite |
| tantalum Tantalum: A rare metallic element, atomic number 73, atomic weight 180.948, symbol Ta. It is a noncorrosive and malleable metal that has been used for plates or disks to replace cranial defects, for wire sutures, and for making prosthetic devices. | 2.01 | 1 | 0 | vanadium group element atom | |
| technetium Technetium: The first artificially produced element and a radioactive fission product of URANIUM. Technetium has the atomic symbol Tc, and atomic number 43. All technetium isotopes are radioactive. Technetium 99m (m=metastable) which is the decay product of Molybdenum 99, has a half-life of about 6 hours and is used diagnostically as a radioactive imaging agent. Technetium 99 which is a decay product of technetium 99m, has a half-life of 210,000 years. | 4.5 | 7 | 0 | manganese group element atom | |
| terbium Terbium: An element of the rare earth family of metals. It has the atomic symbol Tb, atomic number 65, and atomic weight 158.92. | 3.29 | 6 | 0 | f-block element atom; lanthanoid atom | |
| thorium Thorium: A radioactive element of the actinide series of metals. It has an atomic symbol Th, atomic number 90, and atomic weight 232.04. It is used as fuel in nuclear reactors to produce fissionable uranium isotopes. Because of its radioopacity, various thorium compounds are used to facilitate visualization in roentgenography. | 2.13 | 1 | 0 | actinoid atom; f-block element atom | |
| titanium Titanium: A dark-gray, metallic element of widespread distribution but occurring in small amounts with atomic number, 22, atomic weight, 47.867 and symbol, Ti; specific gravity, 4.5; used for fixation of fractures. | 4.37 | 19 | 0 | titanium group element atom | |
| argon Argon: A noble gas with the atomic symbol Ar, atomic number 18, and atomic weight 39.948. It is used in fluorescent tubes and wherever an inert atmosphere is desired and nitrogen cannot be used. | 2.03 | 1 | 0 | monoatomic argon; noble gas atom; p-block element atom | food packaging gas; neuroprotective agent |
| cadmium Cadmium: An element with atomic symbol Cd, atomic number 48, and atomic weight 112.41. It is a metal and ingestion will lead to CADMIUM POISONING.. elemental cadmium : An element in the zinc group of the periodic table with atomic number 48, atomic mass 112, M.P. 321degreeC, and B.P. 765degreeC). An odourless, tasteless, and highly poisonous soft, ductile, lustrous metal with electropositive properties. It has eight stable isotopes: (106)Cd, (108)Cd,(110)Cd, (111)Cd, (112)Cd, (113)Cd, (114)Cd and (116)Cd, with (112)Cd and (114)Cd being the most common. | 4.04 | 14 | 0 | cadmium molecular entity; zinc group element atom | |
| cerium Cerium: An element of the rare earth family of metals. It has the atomic symbol Ce, atomic number 58, and atomic weight 140.12. Cerium is a malleable metal used in industrial applications. | 5.01 | 12 | 0 | f-block element atom; lanthanoid atom | |
| chromium Chromium: A trace element that plays a role in glucose metabolism. It has the atomic symbol Cr, atomic number 24, and atomic weight 52. According to the Fourth Annual Report on Carcinogens (NTP85-002,1985), chromium and some of its compounds have been listed as known carcinogens.. chromium ion : An chromium atom having a net electric charge.. chromium atom : A chromium group element atom that has atomic number 24. | 4.25 | 5 | 0 | chromium group element atom; metal allergen | micronutrient |
| europium Europium: An element of the rare earth family of metals. It has the atomic symbol Eu, atomic number 63, and atomic weight 152. Europium is used in the form of its salts as coatings for cathode ray tubes and in the form of its organic derivatives as shift reagents in NMR spectroscopy. | 8.63 | 9 | 0 | f-block element atom; lanthanoid atom | |
| gadolinium Gadolinium: An element of the rare earth family of metals. It has the atomic symbol Gd, atomic number 64, and atomic weight 157.25. Its oxide is used in the control rods of some nuclear reactors. | 3.77 | 10 | 0 | f-block element atom; lanthanoid atom | |
| gold Gold: A yellow metallic element with the atomic symbol Au, atomic number 79, and atomic weight 197. It is used in jewelry, goldplating of other metals, as currency, and in dental restoration. Many of its clinical applications, such as ANTIRHEUMATIC AGENTS, are in the form of its salts. | 10.38 | 423 | 0 | copper group element atom; elemental gold | |
| helium Helium: A noble gas with the atomic symbol He, atomic number 2, and atomic weight 4.003. It is a colorless, odorless, tasteless gas that is not combustible and does not support combustion. It was first detected in the sun and is now obtained from natural gas. Medically it is used as a diluent for other gases, being especially useful with oxygen in the treatment of certain cases of respiratory obstruction, and as a vehicle for general anesthetics. | 1.99 | 1 | 0 | monoatomic helium; noble gas atom; s-block element atom | food packaging gas |
| uranium Uranium: A radioactive element of the actinide series of metals. It has an atomic symbol U, atomic number 92, and atomic weight 238.03. U-235 is used as the fissionable fuel in nuclear weapons and as fuel in nuclear power reactors. | 2.41 | 2 | 0 | actinoid atom; f-block element atom; monoatomic uranium | |
| vanadium Vanadium: A metallic element with the atomic symbol V, atomic number 23, and atomic weight 50.94. It is used in the manufacture of vanadium steel. Prolonged exposure can lead to chronic intoxication caused by absorption usually via the lungs. | 1.99 | 1 | 0 | elemental vanadium; vanadium group element atom | micronutrient |
| xenon Xenon: A noble gas with the atomic symbol Xe, atomic number 54, and atomic weight 131.30. It is found in the earth's atmosphere and has been used as an anesthetic. | 1.99 | 1 | 0 | monoatomic xenon; noble gas atom; p-block element atom | |
| ytterbium Ytterbium: An element of the rare earth family of metals. It has the atomic symbol Yb, atomic number 70, and atomic weight 173. Ytterbium has been used in lasers and as a portable x-ray source. | 2.13 | 1 | 0 | f-block element atom; lanthanoid atom | |
| yttrium Yttrium: An element of the rare earth family of metals. It has the atomic symbol Y, atomic number 39, and atomic weight 88.91. In conjunction with other rare earths, yttrium is used as a phosphor in television receivers and is a component of the yttrium-aluminum garnet (YAG) lasers. | 2.5 | 2 | 0 | d-block element atom; rare earth metal atom; scandium group element atom | |
| zirconium Zirconium: A rather rare metallic element with atomic number 40, atomic weight 91.224, and symbol Zr. | 3.15 | 5 | 0 | titanium group element atom | |
| californium Californium: A man-made radioactive actinide with atomic symbol Cf, atomic number 98, and atomic weight 251. Its valence can be +2 or +3. Californium has medical use as a radiation source for radiotherapy. | 2.37 | 2 | 0 | actinoid atom; f-block element atom | |
| cupric chloride cupric chloride: RN given refers to unlabeled parent cpd. copper(II) chloride : An inorganic chloride of copper in which the metal is in the +2 oxidation state. | 2.49 | 2 | 0 | copper molecular entity; inorganic chloride | EC 5.3.3.5 (cholestenol Delta-isomerase) inhibitor |
| zalcitabine Zalcitabine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by a hydrogen. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication at low concentrations, acting as a chain-terminator of viral DNA by binding to reverse transcriptase. Its principal toxic side effect is axonal degeneration resulting in peripheral neuropathy.. zalcitabine : A pyrimidine 2',3'-dideoxyribonucleoside compound having cytosine as the nucleobase. | 2 | 1 | 0 | pyrimidine 2',3'-dideoxyribonucleoside | antimetabolite; antiviral drug; HIV-1 reverse transcriptase inhibitor |
| magnesium sulfate Magnesium Sulfate: A small colorless crystal used as an anticonvulsant, a cathartic, and an electrolyte replenisher in the treatment of pre-eclampsia and eclampsia. It causes direct inhibition of action potentials in myometrial muscle cells. Excitation and contraction are uncoupled, which decreases the frequency and force of contractions. (From AMA Drug Evaluations Annual, 1992, p1083). magnesium sulfate : A magnesium salt having sulfate as the counterion. | 2.42 | 2 | 0 | magnesium salt; metal sulfate; organic magnesium salt | anaesthetic; analgesic; anti-arrhythmia drug; anticonvulsant; calcium channel blocker; cardiovascular drug; fertilizer; tocolytic agent |
| 6-nitrochrysene 6-nitrochrysene: RN given refers to cpd with locant for nitro group in position 6 | 2.48 | 2 | 0 | carbopolycyclic compound | |
| acetylglucosamine Acetylglucosamine: The N-acetyl derivative of glucosamine.. N-acetyl-beta-D-glucosamine : An N-acetyl-D-glucosamine having beta-configuration at the anomeric centre. | 3.12 | 5 | 0 | N-acetyl-D-glucosamine | epitope |
| galactosamine 2-amino-2-deoxy-D-galactopyranose : The pyranose form of D-galactosamine.. D-galactosamine : The D-stereoisomer of galactosamine. | 2.42 | 2 | 0 | D-galactosamine; primary amino compound | toxin |
| phosphoric acid, trisodium salt [no description available] | 2.74 | 3 | 0 | sodium phosphate | |
| cesium chloride cesium chloride: RN given refers to unlabeled cpd. caesium chloride : The inorganic chloride salt of caesium; each caesium ion is coordinated by eight chlorine ions. | 2.44 | 2 | 0 | inorganic caesium salt; inorganic chloride | phase-transfer catalyst; vasoconstrictor agent |
| hypochlorous acid Hypochlorous Acid: An oxyacid of chlorine (HClO) containing monovalent chlorine that acts as an oxidizing or reducing agent.. hypochlorous acid : A chlorine oxoacid with formula HOCl; a weak, unstable acid, it is the active form of chlorine in water. | 2.72 | 3 | 0 | chlorine oxoacid; reactive oxygen species | EC 2.5.1.18 (glutathione transferase) inhibitor; EC 3.1.1.7 (acetylcholinesterase) inhibitor; human metabolite |
| camptothecin NSC 100880: carboxylate (opened lactone) form of camptothecin; RN refers to (S)-isomer; structure given in first source | 10.02 | 35 | 3 | delta-lactone; pyranoindolizinoquinoline; quinoline alkaloid; tertiary alcohol | antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor; genotoxin; plant metabolite |
| ferric chloride ferric chloride: RN given refers to cpd with MF of Fe-Cl3; used to induce experimental arterial thrombosis to evaluate antithrombotic agents | 2.74 | 3 | 0 | iron coordination entity | astringent; Lewis acid |
| nickel chloride nickel chloride: RN given refers to cpd with MF of Ni-Cl2. nickel dichloride : A compound of nickel and chloride in which the ratio of nickel (in the +2 oxidation state) to chloride is 1:2. | 2.02 | 1 | 0 | nickel coordination entity | calcium channel blocker; hapten |
| phosphine phosphane : The simplest phosphine, consisting of a single phosphorus atom with three hydrogens attached.. phosphine : Phosphane (PH3) and compounds derived from it by substituting one, two or three hydrogen atoms by hydrocarbyl groups: RPH2, R2PH, R3P (R =/= H) are called primary, secondary and tertiary phosphines, respectively. A specific phosphine is preferably named as a substituted phosphane. | 7.49 | 2 | 0 | mononuclear parent hydride; phosphanes; phosphine | carcinogenic agent; fumigant insecticide |
| bromine Bromine: A halogen with the atomic symbol Br, atomic number 35, and atomic weight 79.904. It is a volatile reddish-brown liquid that gives off suffocating vapors, is corrosive to the skin, and may cause severe gastroenteritis if ingested. | 3.6 | 9 | 0 | diatomic bromine | |
| zinc sulfate Zinc Sulfate: A compound given in the treatment of conditions associated with zinc deficiency such as acrodermatitis enteropathica. Externally, zinc sulfate is used as an astringent in lotions and eye drops. (Reynolds JEF(Ed): Martindale: The Extra Pharmacopoeia (electronic version). Micromedex, Inc, Englewood, CO, 1995). zinc sulfate : A metal sulfate compound having zinc(2+) as the counterion. | 2.44 | 2 | 0 | metal sulfate; zinc molecular entity | fertilizer |
| sodium sulfate [no description available] | 1.97 | 1 | 0 | inorganic sodium salt | |
| calcium phosphate, dibasic, anhydrous calcium phosphate, dibasic, anhydrous: molecular formula CaHPO(4), DCPA=dicalcium phosphate anhydrous; don't confuse with dichloropropionanilide which also is called DCPA; MW=136.06; has greater surface area and lower pH than DCPD (dicalcium phosphate dihydrate); occurs in nature as monetite; an intermediate in preparing hydroxyapatite | 2.39 | 2 | 0 | calcium phosphate | |
| calcium phosphate, monobasic, anhydrous calcium phosphate, monobasic: MW 234.05 | 2.39 | 2 | 0 | calcium phosphate | fertilizer |
| tricalcium phosphate tricalcium phosphate: a form of tricalcium phosphate used as bioceramic bone replacement material; see also records for alpha-tricalcium phosphate, beta-tricalcium phosphate, calcium phosphate; apatitic tricalcium phosphate Ca9(HPO4)(PO4)5(OH) is the calcium orthophosphate leading to beta tricalcium phosphate Ca3(PO4)2 (b-TCP). calcium phosphate : A calcium salt composed of calcium and phosphate/diphosphate ions; present in milk and used for the mineralisation of calcified tissues. | 3.38 | 7 | 0 | calcium phosphate | |
| copper sulfate Copper Sulfate: A sulfate salt of copper. It is a potent emetic and is used as an antidote for poisoning by phosphorus. It also can be used to prevent the growth of algae.. copper(II) sulfate : A metal sulfate compound having copper(2+) as the metal ion. | 2.13 | 1 | 0 | metal sulfate | emetic; fertilizer; sensitiser |
| silver nitrate Silver Nitrate: A silver salt with powerful germicidal activity. It has been used topically to prevent OPHTHALMIA NEONATORUM. | 2.79 | 3 | 0 | inorganic nitrate salt; silver salt | astringent |
| chloroethylene oxide chloroethylene oxide: postulated metabolite of vinyl chloride; structure | 2 | 1 | 0 | organochlorine compound | |
| calcium sulfate Calcium Sulfate: A calcium salt that is used for a variety of purposes including: building materials, as a desiccant, in dentistry as an impression material, cast, or die, and in medicine for immobilizing casts and as a tablet excipient. It exists in various forms and states of hydration. Plaster of Paris is a mixture of powdered and heat-treated gypsum. | 2.02 | 1 | 0 | calcium salt; inorganic calcium salt | |
| deuterium Deuterium: The stable isotope of hydrogen. It has one neutron and one proton in the nucleus. | 4.79 | 32 | 0 | dihydrogen | |
| fluorine Fluorine: A nonmetallic, diatomic gas that is a trace element and member of the halogen family. It is used in dentistry as fluoride (FLUORIDES) to prevent dental caries. | 11.47 | 22 | 0 | diatomic fluorine; gas molecular entity | NMR chemical shift reference compound |
| chlorine Chlorine: An element with atomic symbol Cl, atomic number 17, and atomic weight 35, and member of the halogen family. | 3.1 | 5 | 0 | diatomic chlorine; gas molecular entity | bleaching agent |
| nitrous acid Nitrous Acid: Nitrous acid (HNO2). A weak acid that exists only in solution. It can form water-soluble nitrites and stable esters. (From Merck Index, 11th ed) | 2.68 | 3 | 0 | nitrogen oxoacid | |
| silver chloride [no description available] | 2.11 | 1 | 0 | inorganic chloride; silver salt | |
| deuterium oxide Deuterium Oxide: The isotopic compound of hydrogen of mass 2 (deuterium) with oxygen. (From Grant & Hackh's Chemical Dictionary, 5th ed) It is used to study mechanisms and rates of chemical or nuclear reactions, as well as biological processes. | 2.9 | 4 | 0 | deuterated compound; water | NMR solvent |
| fluorosulfonic acid perfluorosulfonic acid: sulfonated tetrafluoroethylene-based fluoropolymer–copolymer | 1.98 | 1 | 0 | sulfur oxoacid | NMR solvent |
| galactose aldohexose : A hexose with a (potential) aldehyde group at one end. | 2.93 | 4 | 0 | ||
| vasotocin Vasotocin: A nonapeptide that contains the ring of OXYTOCIN and the side chain of ARG-VASOPRESSIN with the latter determining the specific recognition of hormone receptors. Vasotocin is the non-mammalian vasopressin-like hormone or antidiuretic hormone regulating water and salt metabolism.. vasotocin : A heterodetic cyclic peptide that is homologous to oxytocin and vasopressin. It is a pituitary hormone that acts as an endocrine regulator for water balance, osmotic homoeostasis and is involved in social and sexual behavior in non-mammalian vertebrates. | 2.02 | 1 | 0 | ||
| sizofiran Sizofiran: A beta-D-glucan obtained from the Aphyllophoral fungus Schizophyllum commune. It is used as an immunoadjuvant in the treatment of neoplasms, especially tumors found in the stomach. | 2.73 | 3 | 0 | ||
| trichlorosilane [no description available] | 2.02 | 1 | 0 | ||
| ozone Ozone: The unstable triatomic form of oxygen, O3. It is a powerful oxidant that is produced for various chemical and industrial uses. Its production is also catalyzed in the ATMOSPHERE by ULTRAVIOLET RAY irradiation of oxygen or other ozone precursors such as VOLATILE ORGANIC COMPOUNDS and NITROGEN OXIDES. About 90% of the ozone in the atmosphere exists in the stratosphere (STRATOSPHERIC OZONE).. ozone : An elemental molecule with formula O3. An explosive, pale blue gas (b.p. -112degreeC) that has a characteristic, pungent odour, it is continuously produced in the upper atmosphere by the action of solar ultraviolet radiation on atmospheric oxygen. It is an antimicrobial agent used in the production of bottled water, as well as in the treatment of meat, poultry and other foodstuffs. | 2.06 | 1 | 0 | elemental molecule; gas molecular entity; reactive oxygen species; triatomic oxygen | antiseptic drug; disinfectant; electrophilic reagent; greenhouse gas; mutagen; oxidising agent; tracer |
| aluminum sulfate aluminium sulfate (anhydrous) : An aluminium sulfate that contains no water of crystallisation. | 3.29 | 6 | 0 | aluminium sulfate | |
| cadmium chloride Cadmium Chloride: A cadmium halide in the form of colorless crystals, soluble in water, methanol, and ethanol. It is used in photography, in dyeing, and calico printing, and as a solution to precipitate sulfides. (McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed). cadmium dichloride : A cadmium coordination entity in which cadmium(2+) and Cl(-) ions are present in the ratio 2:1. Although considered to be ionic, it has considerable covalent character to its bonding. | 2.71 | 3 | 0 | cadmium coordination entity | |
| 4-chloro-7-nitrobenzofurazan 4-Chloro-7-nitrobenzofurazan: A benzofuran derivative used as a protein reagent since the terminal N-NBD-protein conjugate possesses interesting fluorescence and spectral properties. It has also been used as a covalent inhibitor of both beef heart mitochondrial ATPase and bacterial ATPase.. 4-chloro-7-nitrobenzofurazan : A benzoxadiazole that is 2,1,3-benzoxadiazole which is substituted at position 4 by chlorine and at position 7 by a nitro group. | 2.44 | 2 | 0 | benzoxadiazole; C-nitro compound; organochlorine compound | EC 1.4.3.4 (monoamine oxidase) inhibitor; EC 3.6.1.3 (adenosinetriphosphatase) inhibitor; fluorescent probe; fluorochrome |
| n-methylisatoic anhydride N-methylisatoic anhydride: structure given in first source; used to prepare N-methylanthranilyl (Mantyl) peptide derivatives. N-methylisatoic anhydride : A 3,1-benzoxazin-1,4-dione having an N-methyl substituent. | 2.04 | 1 | 0 | benzoxazine | |
| trolamine salicylate Arthritis: Acute or chronic inflammation of JOINTS. | 5.34 | 7 | 0 | ||
| stanozolol Stanozolol: A synthetic steroid that has anabolic and androgenic properties. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1194). stanozolol : An organic heteropentacyclic compound resulting from the formal condensation of the 3-keto-aldehyde moiety of oxymetholone with hydrazine. Like oxymetholone, it is a synthetic anabolic steroid. It has both anabolic and androgenic properties, and has been used to treat hereditary angioedema and various vascular disorders. It has also been widely abused by professional athletes. | 2.15 | 1 | 0 | 17beta-hydroxy steroid; anabolic androgenic steroid; organic heteropentacyclic compound; tertiary alcohol | anabolic agent; androgen |
| rhamnose [no description available] | 1.95 | 1 | 0 | L-rhamnose | |
| coformycin [no description available] | 1.96 | 1 | 0 | coformycins | EC 3.5.4.4 (adenosine deaminase) inhibitor |
| chrysotile Asbestos, Serpentine: A type of asbestos that occurs in nature as the dihydrate of magnesium silicate. It exists in two forms: antigorite, a plated variety, and chrysotile, a fibrous variety. The latter makes up 95% of all asbestos products. (From Merck Index, 11th ed, p.893) | 2.04 | 1 | 0 | ||
| ammonium chloride Ammonium Chloride: An acidifying agent that has expectorant and diuretic effects. Also used in etching and batteries and as a flux in electroplating.. ammonium chloride : An inorganic chloride having ammonium as the counterion. | 3.48 | 8 | 0 | ammonium salt; inorganic chloride | ferroptosis inhibitor |
| ethionine L-ethionine : An S-ethylhomocysteine that has S-configuration at the chiral centre. | 1.95 | 1 | 0 | S-ethylhomocysteine | antimetabolite; carcinogenic agent |
| cesium fluoride cesium fluoride: RN given refers to above cpd | 1.97 | 1 | 0 | ||
| titanium dioxide titanium dioxide: used medically as protectant against externally caused irritation & sunlight; high concentrations of dust may cause irritation to respiratory tract; RN given refers to titanium oxide (TiO2); structure. titanium dioxide : A titanium oxide with the formula TiO2. A naturally occurring oxide sourced from ilmenite, rutile and anatase, it has a wide range of applications. | 3.66 | 9 | 0 | titanium oxides | food colouring |
| salen disalicylaldehyde ethylenediamine: reagents for determination of iron | 2.42 | 2 | 0 | ||
| tiletamine hydrochloride Cyclohexanones: Cyclohexane ring substituted by one or more ketones in any position.. cyclohexanones : Any alicyclic ketone based on a cyclohexane skeleton and its substituted derivatives thereof. | 2.01 | 1 | 0 | ||
| 2-bromoacrolein [no description available] | 3.08 | 1 | 0 | ||
| 1-methyladenosine [no description available] | 2.49 | 2 | 0 | methyladenosine | human metabolite |
| tetradecanoylphorbol acetate Tetradecanoylphorbol Acetate: A phorbol ester found in CROTON OIL with very effective tumor promoting activity. It stimulates the synthesis of both DNA and RNA.. phorbol ester : Esters of phorbol, originally found in croton oil (from Croton tiglium, of the family Euphorbiaceae). A number of phorbol esters possess activity as tumour promoters and activate the mechanisms associated with cell growth. Some of these are used in experiments as activators of protein kinase C.. phorbol 13-acetate 12-myristate : A phorbol ester that is phorbol in which the hydroxy groups at the cyclopropane ring juction (position 13) and the adjacent carbon (position 12) have been converted into the corresponding acetate and myristate esters. It is a major active constituent of the seed oil of Croton tiglium. It has been used as a tumour promoting agent for skin carcinogenesis in rodents and is associated with increased cell proliferation of malignant cells. However its function is controversial since a decrease in cell proliferation has also been observed in several cancer cell types. | 4.97 | 38 | 0 | acetate ester; diester; phorbol ester; tertiary alpha-hydroxy ketone; tetradecanoate ester | antineoplastic agent; apoptosis inducer; carcinogenic agent; mitogen; plant metabolite; protein kinase C agonist; reactive oxygen species generator |
| ethephon (2-chloroethyl)phosphonic acid: structure in first source. (2-chloroethyl)phosphonic acid : A phosphonic acid compound having a 2-chloroethyl substituent attached to the P-atom. | 2.02 | 1 | 0 | phosphonic acids | plant growth regulator |
| trichloroepoxyethane trichloroepoxyethane: structure given in first source | 2 | 1 | 0 | epoxide | mouse metabolite |
| fluorides [no description available] | 3.96 | 13 | 0 | halide anion; monoatomic fluorine | |
| benomyl [no description available] | 2.01 | 1 | 0 | aromatic amide; benzimidazole fungicide; benzimidazoles; benzimidazolylcarbamate fungicide; carbamate ester | acaricide; anthelminthic drug; antifungal agrochemical; microtubule-destabilising agent; tubulin modulator |
| stannic oxide tin dioxide : A tin oxide compound consisting of tin(IV) covalently bound to two oxygen atoms. | 2.6 | 1 | 0 | tin oxide | |
| chromium chromium hexavalent ion: a human respiratory carcinogen | 2.01 | 1 | 0 | chromium cation; monoatomic hexacation | |
| iodine [no description available] | 2.99 | 4 | 0 | halide anion; monoatomic iodine | human metabolite |
| osmium tetroxide Osmium Tetroxide: (T-4)-Osmium oxide (OsO4). A highly toxic and volatile oxide of osmium used in industry as an oxidizing agent. It is also used as a histological fixative and stain and as a synovectomy agent in arthritic joints. Its vapor can cause eye, skin, and lung damage.. osmium tetroxide : An osmium coordination entity consisting of four oxygen atoms bound to a central osmium atom via covalent double bonds. | 7.7 | 3 | 0 | osmium coordination entity | fixative; histological dye; oxidising agent; poison |
| daunorubicin Daunorubicin: A very toxic anthracycline aminoglycoside antineoplastic isolated from Streptomyces peucetius and others, used in treatment of LEUKEMIA and other NEOPLASMS.. anthracycline : Anthracyclines are polyketides that have a tetrahydronaphthacenedione ring structure attached by a glycosidic linkage to the amino sugar daunosamine.. daunorubicin : A natural product found in Actinomadura roseola. | 4.51 | 24 | 0 | aminoglycoside antibiotic; anthracycline; p-quinones; tetracenequinones | antineoplastic agent; bacterial metabolite |
| phosphotyrosine Phosphotyrosine: An amino acid that occurs in endogenous proteins. Tyrosine phosphorylation and dephosphorylation plays a role in cellular signal transduction and possibly in cell growth control and carcinogenesis.. O(4)-phospho-L-tyrosine : A non-proteinogenic L-alpha-amino acid that is L-tyrosine phosphorylated at the phenolic hydroxy group. | 3.52 | 8 | 0 | L-tyrosine derivative; non-proteinogenic L-alpha-amino acid; O(4)-phosphotyrosine | Escherichia coli metabolite; immunogen |
| 2,6-diaminopurine 9H-purine-2,6-diamine : A member of the class of 2,6-diaminopurines that is 9H-purine in which the hydrogens at positions 2 and 6 are replaced by amino groups. | 4.29 | 18 | 0 | 2,6-diaminopurines; primary amino compound | antineoplastic agent |
| phenylglycidyl ether phenylglycidyl ether: structure | 2.02 | 1 | 0 | aromatic ether | |
| phenyl acetate phenyl acetate: The ester formed between phenol and acetic acid. Don't confuse with phenylacetic acid derivatives listed under PHENYLACETATES.. phenyl acetate : An acetate ester obtained by the formal condensation of phenol with acetic acid. | 4.79 | 32 | 0 | benzenes; phenyl acetates | |
| cetylpyridinium chloride anhydrous tserigel: according to first source contains polyvinylbutyral & cetylpyridinium chloride; UD only lists cetylpyridinium chloride as constituent. cetylpyridinium chloride : A pyridinium salt that has N-hexadecylpyridinium as the cation and chloride as the anion. It has antiseptic properties and is used in solutions or lozenges for the treatment of minor infections of the mouth and throat. | 2.06 | 1 | 0 | chloride salt; organic chloride salt | antiseptic drug; surfactant |
| methylformamide N-methylformamide : A member of the class of formamides having a N-methyl substituent. | 7.03 | 1 | 0 | formamides | |
| pyrrolidine [no description available] | 3.42 | 7 | 0 | azacycloalkane; pyrrolidines; saturated organic heteromonocyclic parent | |
| 1,4-dioxane 1,4-dioxane: dehydrating agent; polar solvent miscible both with water & most organic solvents. dioxane : Any member of the class of dioxanes that is a cyclohexane in which two carbon atoms are replaced by oxygen atoms.. 1,4-dioxane : A dioxane with oxygen atoms at positions 1 and 4. | 7.07 | 1 | 0 | dioxane; volatile organic compound | carcinogenic agent; metabolite; NMR chemical shift reference compound; non-polar solvent |
| tris(2,3-dibromopropyl)phosphate tris(2,3-dibromopropyl)phosphate: flame retardant | 3.08 | 1 | 0 | trialkyl phosphate | |
| n-chlorosuccinimide N-chlorosuccinimide : A five-membered cyclic dicarboximide compound having a chloro substituent on the nitrogen atom. | 1.97 | 1 | 0 | dicarboximide; pyrrolidinone | |
| ursodeoxycholic acid Ursodeoxycholic Acid: An epimer of chenodeoxycholic acid. It is a mammalian bile acid found first in the bear and is apparently either a precursor or a product of chenodeoxycholate. Its administration changes the composition of bile and may dissolve gallstones. It is used as a cholagogue and choleretic.. ursodeoxycholic acid : A bile acid found in the bile of bears (Ursidae) as a conjugate with taurine. Used therapeutically, it prevents the synthesis and absorption of cholesterol and can lead to the dissolution of gallstones.. ursodeoxycholate : A bile acid anion that is the conjugate base of ursodeoxycholic acid, obtained by deprotonation of the carboxy group; major species at pH 7.3. | 2.03 | 1 | 0 | bile acid; C24-steroid; dihydroxy-5beta-cholanic acid | human metabolite; mouse metabolite |
| 1,4-diaminoanthraquinone [no description available] | 2.01 | 1 | 0 | ||
| pyrene pyrene: structure in Merck Index, 9th ed, #7746. pyrene : An ortho- and peri-fused polycyclic arene consisting of four fused benzene rings, resulting in a flat aromatic system. | 6.21 | 41 | 0 | ortho- and peri-fused polycyclic arene | fluorescent probe; persistent organic pollutant |
| 8-bromo cyclic adenosine monophosphate 8-Bromo Cyclic Adenosine Monophosphate: A long-acting derivative of cyclic AMP. It is an activator of cyclic AMP-dependent protein kinase, but resistant to degradation by cyclic AMP phosphodiesterase.. 8-Br-cAMP : A 3',5'-cyclic purine nucleotide that is 3',5'-cyclic AMP bearing an additional bromo substituent at position 8 on the adenine ring. An activator of cyclic AMP-dependent protein kinase, but resistant to degradation by cyclic AMP phosphodiesterase. | 2.71 | 3 | 0 | 3',5'-cyclic purine nucleotide; adenyl ribonucleotide; organobromine compound | antidepressant; protein kinase agonist |
| triazophos triazophos: structure | 2.25 | 1 | 0 | organic thiophosphate; organothiophosphate insecticide | acaricide; agrochemical; EC 3.1.1.7 (acetylcholinesterase) inhibitor; nematicide |
| transferrin Transferrin: An iron-binding beta1-globulin that is synthesized in the LIVER and secreted into the blood. It plays a central role in the transport of IRON throughout the circulation. A variety of transferrin isoforms exist in humans, including some that are considered markers for specific disease states. | 4.83 | 10 | 0 | ||
| fanft FANFT: A potent nitrofuran derivative tumor initiator. It causes bladder tumors in all animals studied and is mutagenic to many bacteria. | 2.38 | 2 | 0 | ||
| alkenes [no description available] | 3.11 | 5 | 0 | ||
| glutamic acid Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.. glutamic acid : An alpha-amino acid that is glutaric acid bearing a single amino substituent at position 2. | 4.65 | 27 | 0 | glutamic acid; glutamine family amino acid; L-alpha-amino acid; proteinogenic amino acid | Escherichia coli metabolite; ferroptosis inducer; micronutrient; mouse metabolite; neurotransmitter; nutraceutical |
| ribostamycin Ribostamycin: A broad-spectrum antimicrobial isolated from Streptomyces ribosifidicus.. ribostamycin : An amino cyclitol glycoside that is 4,6-diaminocyclohexane-1,2,3-triol having a 2,6-diamino-2,6-dideoxy-alpha-D-glucosyl residue attached at position 1 and a beta-D-ribosyl residue attached at position 2. It is an antibiotic produced by Streptomyces ribosidificus (formerly S. thermoflavus). | 2.48 | 2 | 0 | amino cyclitol glycoside; aminoglycoside antibiotic | antibacterial drug; antimicrobial agent; metabolite |
| adenylyl imidodiphosphate Adenylyl Imidodiphosphate: 5'-Adenylic acid, monoanhydride with imidodiphosphoric acid. An analog of ATP, in which the oxygen atom bridging the beta to the gamma phosphate is replaced by a nitrogen atom. It is a potent competitive inhibitor of soluble and membrane-bound mitochondrial ATPase and also inhibits ATP-dependent reactions of oxidative phosphorylation. | 2.68 | 3 | 0 | adenosine 5'-phosphate | |
| azoxymethane Azoxymethane: A potent carcinogen and neurotoxic compound. It is particularly effective in inducing colon carcinomas. | 2.11 | 1 | 0 | ||
| torpedo Torpedo: A genus of the Torpedinidae family consisting of several species. Members of this family have powerful electric organs and are commonly called electric rays. | 2.66 | 3 | 0 | ||
| sodium azide Sodium Azide: A cytochrome oxidase inhibitor which is a nitridizing agent and an inhibitor of terminal oxidation. (From Merck Index, 12th ed). sodium azide : The sodium salt of hydrogen azide (hydrazoic acid). | 2.41 | 2 | 0 | inorganic sodium salt | antibacterial agent; explosive; mitochondrial respiratory-chain inhibitor; mutagen |
| azides Azides: Organic or inorganic compounds that contain the -N3 group.. azide : Any nitrogen molecular entity containing the group -N3. | 7.79 | 124 | 0 | pseudohalide anion | mitochondrial respiratory-chain inhibitor |
| adenosine diphosphate ribose Adenosine Diphosphate Ribose: An ester formed between the aldehydic carbon of RIBOSE and the terminal phosphate of ADENOSINE DIPHOSPHATE. It is produced by the hydrolysis of nicotinamide-adenine dinucleotide (NAD) by a variety of enzymes, some of which transfer an ADP-ribosyl group to target proteins. | 3.07 | 5 | 0 | ADP-sugar | Escherichia coli metabolite; mouse metabolite |
| amoxicillin Amoxicillin: A broad-spectrum semisynthetic antibiotic similar to AMPICILLIN except that its resistance to gastric acid permits higher serum levels with oral administration.. amoxicillin : A penicillin in which the substituent at position 6 of the penam ring is a 2-amino-2-(4-hydroxyphenyl)acetamido group. | 2.6 | 1 | 0 | penicillin allergen; penicillin | antibacterial drug |
| cyclopenta(c,d)pyrene cyclopenta(c,d)pyrene: structure | 2.45 | 2 | 0 | pyrenes | |
| ensulizole ensulizole: sunscreening agent; structure in first source | 2 | 1 | 0 | benzimidazoles | |
| kethoxal kethoxal: modifies guanine containing oligoribonucleotides by reacting selectively with guanine in polynucleotides. Drug is hydrate of 3-ethoxy-2-oxobutyraldehyde. 1,1-dihydroxy-3-ethoxy-2-butanone : A butanone derivative having two hydroxy substituents at the 1-position and an ethoxy substituent at the 3-position. | 7.64 | 3 | 0 | aldehyde hydrate; butanone | antiinfective agent |
| nigericin Nigericin: A polyether antibiotic which affects ion transport and ATPase activity in mitochondria. It is produced by Streptomyces hygroscopicus. (From Merck Index, 11th ed). nigericin : A polyether antibiotic which affects ion transport and ATPase activity in mitochondria. It is produced by Streptomyces hygroscopicus. | 2.08 | 1 | 0 | polycyclic ether | antibacterial agent; antimicrobial agent; bacterial metabolite; potassium ionophore |
| zidovudine Zidovudine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by an azido group. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA during reverse transcription. It improves immunologic function, partially reverses the HIV-induced neurological dysfunction, and improves certain other clinical abnormalities associated with AIDS. Its principal toxic effect is dose-dependent suppression of bone marrow, resulting in anemia and leukopenia.. zidovudine : A pyrimidine 2',3'-dideoxyribonucleoside compound having a 3'-azido substituent and thymine as the nucleobase. | 4.49 | 7 | 0 | azide; pyrimidine 2',3'-dideoxyribonucleoside | antimetabolite; antiviral drug; HIV-1 reverse transcriptase inhibitor |
| acetylgalactosamine Acetylgalactosamine: The N-acetyl derivative of galactosamine. | 9.7 | 21 | 3 | N-acetyl-D-hexosamine; N-acetylgalactosamine | Escherichia coli metabolite; human metabolite; mouse metabolite |
| sisomicin Sisomicin: Antibiotic produced by Micromonospora inyoensis. It is closely related to gentamicin C1A, one of the components of the gentamicin complex (GENTAMICINS). | 2.21 | 1 | 0 | amino cyclitol glycoside; aminoglycoside antibiotic; beta-L-arabinoside; monosaccharide derivative | |
| tobramycin Tobramycin: An aminoglycoside, broad-spectrum antibiotic produced by Streptomyces tenebrarius. It is effective against gram-negative bacteria, especially the PSEUDOMONAS species. It is a 10% component of the antibiotic complex, NEBRAMYCIN, produced by the same species.. tobramycin : A amino cyclitol glycoside that is kanamycin B lacking the 3-hydroxy substituent from the 2,6-diaminoglucose ring. | 4.22 | 5 | 0 | amino cyclitol glycoside | antibacterial agent; antimicrobial agent; toxin |
| paclitaxel Taxus: Genus of coniferous yew trees or shrubs, several species of which have medicinal uses. Notable is the Pacific yew, Taxus brevifolia, which is used to make the anti-neoplastic drug taxol (PACLITAXEL). | 13.2 | 32 | 11 | taxane diterpenoid; tetracyclic diterpenoid | antineoplastic agent; human metabolite; metabolite; microtubule-stabilising agent |
| etoposide [no description available] | 3.97 | 13 | 0 | beta-D-glucoside; furonaphthodioxole; organic heterotetracyclic compound | antineoplastic agent; DNA synthesis inhibitor |
| substance p [no description available] | 3.08 | 5 | 0 | peptide | neurokinin-1 receptor agonist; neurotransmitter; vasodilator agent |
| 2-amino-4,6-dinitrotoluene 2-amino-4,6-dinitrotoluene : An amino-nitrotoluene that is 4,6-dinitrotoluene substituted at position 2 by an amino group. | 2.01 | 1 | 0 | amino-nitrotoluene | explosive; fungal xenobiotic metabolite |
| ribavirin Rebetron: Rebetron is tradename | 2.02 | 1 | 0 | 1-ribosyltriazole; aromatic amide; monocarboxylic acid amide; primary carboxamide | anticoronaviral agent; antiinfective agent; antimetabolite; antiviral agent; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor |
| lentinan [no description available] | 2.03 | 1 | 0 | ||
| amikacin Amikacin: A broad-spectrum antibiotic derived from KANAMYCIN. It is reno- and oto-toxic like the other aminoglycoside antibiotics.. amikacin : An amino cyclitol glycoside that is kanamycin A acylated at the N-1 position by a 4-amino-2-hydroxybutyryl group. | 2.74 | 3 | 0 | alpha-D-glucoside; amino cyclitol glycoside; aminoglycoside; carboxamide | antibacterial drug; antimicrobial agent; nephrotoxin |
| phorbol 12,13-dibutyrate Phorbol 12,13-Dibutyrate: A phorbol ester found in CROTON OIL which, in addition to being a potent skin tumor promoter, is also an effective activator of calcium-activated, phospholipid-dependent protein kinase (protein kinase C). Due to its activation of this enzyme, phorbol 12,13-dibutyrate profoundly affects many different biological systems. | 1.97 | 1 | 0 | butyrate ester; phorbol ester; tertiary alpha-hydroxy ketone | |
| anft ANFT: RN given refers to unlabeled cpd | 1.98 | 1 | 0 | ||
| n-(2-hydroxypropyl)methacrylamide Duxon: RN given refers to unlabeled cpd | 2.05 | 1 | 0 | ||
| n-acetyl-4-benzoquinoneimine N-acetyl-4-benzoquinoneimine: reactive arylating intermediate from acetaminophen & N-hydroxyacetaminophen; structure given in first source | 1.98 | 1 | 0 | ketoimine; quinone imine | |
| ng-nitroarginine methyl ester NG-Nitroarginine Methyl Ester: A non-selective inhibitor of nitric oxide synthase. It has been used experimentally to induce hypertension. | 2.4 | 2 | 0 | alpha-amino acid ester; L-arginine derivative; methyl ester; N-nitro compound | EC 1.14.13.39 (nitric oxide synthase) inhibitor |
| deoxynivalenol deoxynivalenol : A trichothecene mycotoxin produced by Fusarium to which wheat, barley, maize (corn) and their products are susceptible to contamination. | 3.01 | 2 | 0 | cyclic ketone; enone; primary alcohol; secondary alpha-hydroxy ketone; trichothecene; triol | mycotoxin |
| decamethrin decamethrin: pyrethroid insecticide; RN given refers to cpd without isomeric designation; structure | 2.31 | 1 | 0 | aromatic ether; cyclopropanecarboxylate ester; nitrile; organobromine compound | agrochemical; antifeedant; calcium channel agonist; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; pyrethroid ester insecticide |
| 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid [no description available] | 2.44 | 2 | 0 | chromanol; monocarboxylic acid; phenols | antioxidant; ferroptosis inhibitor; neuroprotective agent; radical scavenger; Wnt signalling inhibitor |
| 7,8-dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide 7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide: 7,8,8a,9a-Tetrahydrobenzo(10,11)chryseno (3,4-b)oxirene-7,8-diol. A benzopyrene derivative with carcinogenic and mutagenic activity. | 4.64 | 27 | 0 | epoxide | intercalator |
| epirubicin Epirubicin: An anthracycline which is the 4'-epi-isomer of doxorubicin. The compound exerts its antitumor effects by interference with the synthesis and function of DNA. | 3.12 | 5 | 0 | aminoglycoside; anthracycline antibiotic; anthracycline; deoxy hexoside; monosaccharide derivative; p-quinones; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone | antimicrobial agent; antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor |
| elliptinium elliptinium: synthetic ellipticine deriv; RN given refers to parent cpd; structure given in first source | 2.37 | 2 | 0 | carbazoles | |
| enkephalin, methionine Enkephalin, Methionine: One of the endogenous pentapeptides with morphine-like activity. It differs from LEU-ENKEPHALIN by the amino acid METHIONINE in position 5. Its first four amino acid sequence is identical to the tetrapeptide sequence at the N-terminal of BETA-ENDORPHIN. | 2.02 | 1 | 0 | ||
| idarubicin Idarubicin: An orally administered anthracycline antineoplastic. The compound has shown activity against BREAST NEOPLASMS; LYMPHOMA; and LEUKEMIA. | 6.65 | 5 | 4 | anthracycline antibiotic; deoxy hexoside; monosaccharide derivative | |
| 2,4,5,2',4',5'-hexabromobiphenyl 2,4,5,2',4',5'-hexabromobiphenyl: RN given refers to parent cpd. 2,2',4,4',5,5'-hexabromobiphenyl : A polybromobiphenyl that is biphenyl in which the hydrogens at positions 2, 2', 4, 4', 5, and 5' have been replace by bromines. | 2.02 | 1 | 0 | brominated flame retardant; polybromobiphenyl | |
| triciribine phosphate [no description available] | 2.01 | 1 | 0 | ||
| 4-(n-methyl-n-nitrosamino)-1-(3-pyridyl)-1-butanone 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone: structure; from tobacco smoke | 2.03 | 1 | 0 | nitrosamine; pyridines | |
| chlorsulfuron chlorsulfuron: RN given refers to parent cpd; structure given in first source. chlorsulfuron : An N-sulfonylurea that is N-carbamoyl-2-chlorobenzenesulfonamide in which one of the hydrogens attached to the non-sulfonylated nitrogen has been replaced by a 4-methoxy-6-methyl-1,3,5-triazin-2-yl group. A herbicide used for the control of broadleaf weeds in wheat, barley and oats. | 2.41 | 2 | 0 | methoxy-1,3,5-triazine; monochlorobenzenes; N-sulfonylurea | agrochemical; EC 2.2.1.6 (acetolactate synthase) inhibitor; herbicide |
| colforsin Colforsin: Potent activator of the adenylate cyclase system and the biosynthesis of cyclic AMP. From the plant COLEUS FORSKOHLII. Has antihypertensive, positive inotropic, platelet aggregation inhibitory, and smooth muscle relaxant activities; also lowers intraocular pressure and promotes release of hormones from the pituitary gland. | 4.25 | 18 | 0 | acetate ester; cyclic ketone; labdane diterpenoid; organic heterotricyclic compound; tertiary alpha-hydroxy ketone; triol | adenylate cyclase agonist; anti-HIV agent; antihypertensive agent; plant metabolite; platelet aggregation inhibitor; protein kinase A agonist |
| tiotidine tiotidine: UD gives slightly different structure for this cpd; RN given refers to parent cpd; structure in first source | 1.99 | 1 | 0 | thiazoles | |
| fomesafen fomesafen: a protoporphyrinogen oxidase-inhibiting herbicide. fomesafen : An N-sulfonylcarboxamide that is N-(methylsulfonyl)benzamide in which the phenyl ring is substituted by a nitro group at position 2 and a 2-chloro-4-(trifluoromethyl)phenoxy group at position 5. A protoporphyrinogen oxidase inhibitor, it was specially developed for use (generally as the corresponding sodium salt, fomesafen-sodium) for post-emergence control of broad-leaf weeds in soya. | 4.55 | 1 | 1 | aromatic ether; C-nitro compound; monochlorobenzenes; N-sulfonylcarboxamide; organofluorine compound; phenols | agrochemical; EC 1.3.3.4 (protoporphyrinogen oxidase) inhibitor; herbicide |
| fenoxycarb fenoxycarb: used against mosquitoes (Diptera:Culicidae); structure given in first source. fenoxycarb : A carbamate ester that is the O-ethyl carbamate of 2-(4-phenoxyphenoxy)ethylamine. | 5.07 | 12 | 0 | aromatic ether; carbamate ester | environmental contaminant; insecticide; juvenile hormone mimic; xenobiotic |
| lovastatin Lovastatin: A fungal metabolite isolated from cultures of Aspergillus terreus. The compound is a potent anticholesteremic agent. It inhibits 3-hydroxy-3-methylglutaryl coenzyme A reductase (HYDROXYMETHYLGLUTARYL COA REDUCTASES), which is the rate-limiting enzyme in cholesterol biosynthesis. It also stimulates the production of low-density lipoprotein receptors in the liver.. lovastatin : A fatty acid ester that is mevastatin carrying an additional methyl group on the carbobicyclic skeleton. It is used in as an anticholesteremic drug and has been found in fungal species such as Aspergillus terreus and Pleurotus ostreatus (oyster mushroom). | 2.71 | 3 | 0 | delta-lactone; fatty acid ester; hexahydronaphthalenes; polyketide; statin (naturally occurring) | anticholesteremic drug; antineoplastic agent; Aspergillus metabolite; prodrug |
| 2-amino-3-methylimidazo(4,5-f)quinoline 2-amino-3-methylimidazo(4,5-f)quinoline: mutagen found in broiled food; RN given refers to parent cpd; structure given in first source; frequently abbreviated as IQ in the literature. 3-methyl-3H-imidazo[4,5-f]quinolin-2-amine : An imidazoquinoline that is 3H-imidazo[4,5-f]quinoline substituted by a methyl group at position 3 and an amino group at position 2. | 2.94 | 4 | 0 | imidazoquinoline | carcinogenic agent |
| castanospermine castanospermine: indolizidine alkaloid from seeds of Australian legume, Castanospermum australe. castanospermine : A tetrahydroxyindolizidine alkaloid that consists of octahydroindolizine having four hydroxy substituents located at positions 1, 6, 7 and 8 (the 1S,6S,7R,8R,8aR-diastereomer). | 1.97 | 1 | 0 | indolizidine alkaloid | anti-HIV-1 agent; anti-inflammatory agent; EC 3.2.1.* (glycosidase) inhibitor; metabolite |
| simvastatin Simvastatin: A derivative of LOVASTATIN and potent competitive inhibitor of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HYDROXYMETHYLGLUTARYL COA REDUCTASES), which is the rate-limiting enzyme in cholesterol biosynthesis. It may also interfere with steroid hormone production. Due to the induction of hepatic LDL RECEPTORS, it increases breakdown of LDL CHOLESTEROL.. simvastatin : A member of the class of hexahydronaphthalenes that is lovastatin in which the 2-methylbutyrate ester moiety has been replaced by a 2,2-dimethylbutyrate ester group. It is used as a cholesterol-lowering and anti-cardiovascular disease drug. | 3.43 | 1 | 1 | delta-lactone; fatty acid ester; hexahydronaphthalenes; statin (semi-synthetic) | EC 1.1.1.34/EC 1.1.1.88 (hydroxymethylglutaryl-CoA reductase) inhibitor; EC 3.4.24.83 (anthrax lethal factor endopeptidase) inhibitor; ferroptosis inducer; geroprotector; prodrug |
| raloxifene hydrochloride Raloxifene Hydrochloride: A second generation selective estrogen receptor modulator (SERM) used to prevent osteoporosis in postmenopausal women. It has estrogen agonist effects on bone and cholesterol metabolism but behaves as a complete estrogen antagonist on mammary gland and uterine tissue.. raloxifene hydrochloride : A hydrochloride salt resulting from the reaction of equimolar amounts of raloxifene and hydrogen chloride. | 2.02 | 1 | 0 | hydrochloride | bone density conservation agent; estrogen antagonist; estrogen receptor modulator |
| mifepristone Mifepristone: A progestational and glucocorticoid hormone antagonist. Its inhibition of progesterone induces bleeding during the luteal phase and in early pregnancy by releasing endogenous prostaglandins from the endometrium or decidua. As a glucocorticoid receptor antagonist, the drug has been used to treat hypercortisolism in patients with nonpituitary CUSHING SYNDROME. | 2.41 | 2 | 0 | 3-oxo-Delta(4) steroid; acetylenic compound; tertiary amino compound | abortifacient; contraceptive drug; hormone antagonist; synthetic oral contraceptive |
| 3-deazaguanine 3-deazaguanine: structure | 2.21 | 1 | 0 | ||
| benzo(c)phenanthrene 3,4-dihydrodiol benzo(c)phenanthrene 3,4-dihydrodiol: RN given refers to (trans)-isomer; structure in first source | 2.01 | 1 | 0 | ||
| salmeterol xinafoate Salmeterol Xinafoate: A selective ADRENERGIC BETA-2 RECEPTOR agonist that functions as a BRONCHODILATOR when administered by inhalation. It is used to manage the symptoms of ASTHMA and CHRONIC OBSTRUCTIVE PULMONARY DISEASE. | 2.17 | 1 | 0 | naphthoic acid | |
| fura-2 Fura-2: A fluorescent calcium chelating agent which is used to study intracellular calcium in tissues. | 2.42 | 2 | 0 | ||
| 1,2-dihydroxy-epoxy-1,2,3,4-tetrahydro-5-methylchrysene 1,2-dihydroxy-epoxy-1,2,3,4-tetrahydro-5-methylchrysene: 5-methyl group increases its carcinogenic activity | 2 | 1 | 0 | ||
| 1-nitrosoindole-3-acetonitrile 1-nitrosoindole-3-acetonitrile: induces ornithine decarboxylase activity in rats | 7 | 1 | 0 | ||
| finasteride Finasteride: An orally active 3-OXO-5-ALPHA-STEROID 4-DEHYDROGENASE inhibitor. It is used as a surgical alternative for treatment of benign PROSTATIC HYPERPLASIA.. finasteride : An aza-steroid that is a synthetic drug for the treatment of benign prostatic hyperplasia. | 1.99 | 1 | 0 | 3-oxo steroid; aza-steroid; delta-lactam | androgen antagonist; antihyperplasia drug; EC 1.3.1.22 [3-oxo-5alpha-steroid 4-dehydrogenase (NADP(+))] inhibitor |
| imiquimod Imiquimod: A topically-applied aminoquinoline immune modulator that induces interferon production. It is used in the treatment of external genital and perianal warts, superficial CARCINOMA, BASAL CELL; and ACTINIC KERATOSIS.. imiquimod : An imidazoquinoline fused [4,5-c] carrying isobutyl and amino substituents at N-1 and C-4 respectively. A prescription medication, it acts as an immune response modifier and is used to treat genital warts, superficial basal cell carcinoma, and actinic keratosis. | 2.8 | 3 | 0 | imidazoquinoline | antineoplastic agent; interferon inducer |
| adefovir adefovir: inhibitor of African swine fever virus. adefovir(1-) : A organophosphonate oxoanion obtained by removal of a proton from the phosphonate group of adefovir, a nucleoside reverse transcriptase inhibitor. It is the major microspecies at pH 7.3 (according to Marvin v 6.2.0.).. adefovir : A member of the class of phosphonic acids that is methylphosphonic acid in which one of the methyl hydrogens has been replaced by a 2-(6-amino-9H-purin-9-yl)ethoxy group. An inhibitor of HIV-1 reverse transcriptase, the bis(t-butoxycarbonyloxymethyl) ester (dipivoxil ester) prodrug is used to treat chronic hepatitis B viral infection. | 3.81 | 2 | 1 | 6-aminopurines; ether; phosphonic acids | antiviral drug; DNA synthesis inhibitor; drug metabolite; HIV-1 reverse transcriptase inhibitor; nephrotoxic agent |
| clopidogrel Clopidogrel: A ticlopidine analog and platelet purinergic P2Y receptor antagonist that inhibits adenosine diphosphate-mediated PLATELET AGGREGATION. It is used to prevent THROMBOEMBOLISM in patients with ARTERIAL OCCLUSIVE DISEASES; MYOCARDIAL INFARCTION; STROKE; or ATRIAL FIBRILLATION.. clopidogrel : A thienopyridine that is 4,5,6,7-tetrahydrothieno[3,2-c]pyridine in which the hydrogen attached to the nitrogen is replaced by an o-chlorobenzyl group, the methylene hydrogen of which is replaced by a methoxycarbonyl group (the S enantiomer). A P2Y12 receptor antagonist, it is used to inhibit blood clots and prevent heart attacks. | 3.43 | 1 | 1 | methyl ester; monochlorobenzenes; thienopyridine | anticoagulant; P2Y12 receptor antagonist; platelet aggregation inhibitor |
| cidofovir anhydrous Cidofovir: An acyclic nucleoside phosphonate that acts as a competitive inhibitor of viral DNA polymerases. It is used in the treatment of RETINITIS caused by CYTOMEGALOVIRUS INFECTIONS and may also be useful for treating HERPESVIRUS INFECTIONS.. cidofovir anhydrous : Cytosine substituted at the 1 position by a 3-hydroxy-2-(phosphonomethoxy)propyl group (S configuration). A nucleoside analogue, it is an injectable antiviral used for the treatment of cytomegalovirus (CMV) retinitis in AIDS patients. | 3.53 | 2 | 0 | phosphonic acids; pyrimidone | anti-HIV agent; antineoplastic agent; antiviral drug; photosensitizing agent |
| topotecan Topotecan: An antineoplastic agent used to treat ovarian cancer. It works by inhibiting DNA TOPOISOMERASES, TYPE I.. topotecan : A pyranoindolizinoquinoline used as an antineoplastic agent. It is a derivative of camptothecin and works by binding to the topoisomerase I-DNA complex and preventing religation of these 328 single strand breaks. | 2.75 | 3 | 0 | pyranoindolizinoquinoline | antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor |
| gemcitabine gemcitabine : A 2'-deoxycytidine having geminal fluoro substituents in the 2'-position. An inhibitor of ribonucleotide reductase, gemcitabine is used in the treatment of various carcinomas, particularly non-small cell lung cancer, pancreatic cancer, bladder cancer and breast cancer. | 12.53 | 14 | 4 | organofluorine compound; pyrimidine 2'-deoxyribonucleoside | antimetabolite; antineoplastic agent; antiviral drug; DNA synthesis inhibitor; EC 1.17.4.1 (ribonucleoside-diphosphate reductase) inhibitor; environmental contaminant; immunosuppressive agent; photosensitizing agent; prodrug; radiosensitizing agent; xenobiotic |
| technetium tc 99m mertiatide Technetium Tc 99m Mertiatide: A technetium diagnostic aid used in renal function determination. | 2.42 | 2 | 0 | ||
| u 77779 bizelesin: structure given in first source | 1.97 | 1 | 0 | ||
| atorvastatin [no description available] | 2.75 | 3 | 0 | aromatic amide; dihydroxy monocarboxylic acid; monofluorobenzenes; pyrroles; statin (synthetic) | environmental contaminant; xenobiotic |
| lamivudine [no description available] | 4.7 | 6 | 1 | monothioacetal; nucleoside analogue; oxacycle; primary alcohol | allergen; anti-HBV agent; antiviral drug; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor; HIV-1 reverse transcriptase inhibitor; prodrug |
| l 697639 L 697639: structure given in first source | 1.97 | 1 | 0 | ||
| irinotecan [no description available] | 7.31 | 12 | 1 | carbamate ester; delta-lactone; N-acylpiperidine; pyranoindolizinoquinoline; ring assembly; tertiary alcohol; tertiary amino compound | antineoplastic agent; apoptosis inducer; EC 5.99.1.2 (DNA topoisomerase) inhibitor; prodrug |
| valsartan Valsartan: A tetrazole derivative and ANGIOTENSIN II TYPE 1 RECEPTOR BLOCKER that is used to treat HYPERTENSION.. valsartan : A monocarboxylic acid amide consisting of L-valine in which the amino hydrogens have been replaced by a pentanoyl and a [2'-(1H-tetrazol-5-yl)biphenyl]-4-yl]methyl group. It exhibits antihypertensive activity. | 2.11 | 1 | 0 | biphenylyltetrazole; monocarboxylic acid amide; monocarboxylic acid | angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic |
| adefovir dipivoxil bis(pivaloyloxymethyl)-9-(2-phosphonylmethoxyethyl)adenine: structure given in first source. adefovir pivoxil : An organic phosphonate that is the dipivoxil ester of adefovir. A prodrug for adefovir, an HIV-1 reverse transcriptase inhibitor, adefovir pivoxil is used to treat chronic hepatitis B viral infection. | 2.1 | 1 | 0 | 6-aminopurines; carbonate ester; ether; organic phosphonate | antiviral drug; DNA synthesis inhibitor; HIV-1 reverse transcriptase inhibitor; nephrotoxic agent; prodrug |
| capecitabine Capecitabine: A deoxycytidine derivative and fluorouracil PRODRUG that is used as an ANTINEOPLASTIC ANTIMETABOLITE in the treatment of COLON CANCER; BREAST CANCER and GASTRIC CANCER.. capecitabine : A carbamate ester that is cytidine in which the hydrogen at position 5 is replaced by fluorine and in which the amino group attached to position 4 is converted into its N-(penyloxy)carbonyl derivative. Capecitabine is a antineoplastic agent used in the treatment of cancers. | 3.19 | 1 | 0 | carbamate ester; cytidines; organofluorine compound | antimetabolite; antineoplastic agent; prodrug |
| adenosine quinquefolan B: isolated from roots of Panax quinquefolium L.; RN not in Chemline 10/87; RN from Toxlit | 9.04 | 132 | 0 | adenosines; purines D-ribonucleoside | analgesic; anti-arrhythmia drug; fundamental metabolite; human metabolite; vasodilator agent |
| n,n-diethylethylenediamine N,N-diethylethylenediamine: structure in first source | 2.02 | 1 | 0 | ||
| safranal safranal: a monoterpene aldehyde; one of the main components responsible for the aroma of saffron; structure given in first source. safranal : A monoterpenoid formally derived from beta-cyclocitral by dehydrogenation. | 7.04 | 1 | 0 | monoterpenoid | |
| sodium molybdate(vi) sodium molybdate(VI): RN given refers to molybdic acid, di-Na salt. sodium molybdate (anhydrous) : An inorganic sodium salt having molybdate as the counterion. | 2.37 | 2 | 0 | inorganic sodium salt | poison |
| vanadates Vanadates: Oxyvanadium ions in various states of oxidation. They act primarily as ion transport inhibitors due to their inhibition of Na(+)-, K(+)-, and Ca(+)-ATPase transport systems. They also have insulin-like action, positive inotropic action on cardiac ventricular muscle, and other metabolic effects.. vanadate(3-) : A vanadium oxoanion that is a trianion with formula VO4 in which the vanadium is in the +5 oxidation state and is attached to four oxygen atoms. | 3.26 | 6 | 0 | trivalent inorganic anion; vanadium oxoanion | EC 3.1.3.1 (alkaline phosphatase) inhibitor; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; EC 3.1.3.41 (4-nitrophenylphosphatase) inhibitor; EC 3.1.3.48 (protein-tyrosine-phosphatase) inhibitor |
| tantalum oxide tantalum oxide: RN given refers to cpd with unknown MF; used for surgical implants | 2.01 | 1 | 0 | ||
| 2-amino-3,4-dimethylimidazo(4,5-f)quinoline 2-amino-3,4-dimethylimidazo(4,5-f)quinoline: strong mutagens found in broiled food; structure given in first source | 2.04 | 1 | 0 | aminoquinoline | |
| acridine orange Acridine Orange: A cationic cytochemical stain specific for cell nuclei, especially DNA. It is used as a supravital stain and in fluorescence cytochemistry. It may cause mutations in microorganisms.. acridine orange : Fluorescent dye useful for cell cycle determination. It is cell-permeable, and interacts with DNA and RNA by intercalation or electrostatic attractions respectively.. acridine orange free base : A member of the class of aminoacridines that is acridine carrying two dimethylamino substituents at positions 3 and 6. The hydrochloride salt is the fluorescent dye 'acridine orange', used for cell cycle determination. | 3.39 | 7 | 0 | aminoacridines; aromatic amine; tertiary amino compound | fluorochrome; histological dye |
| trifluoromethanesulfonic acid trifluoromethanesulfonic acid: deblocking reagent for peptide synthesis; RN given refers to parent cpd. triflic acid : A one-carbon compound that is methanesulfonic acid in which the hydrogens attached to the methyl carbon have been replaced by fluorines. | 2.01 | 1 | 0 | one-carbon compound; perfluoroalkanesulfonic acid | |
| isothiocyanic acid [no description available] | 2 | 1 | 0 | hydracid; one-carbon compound | |
| pivaloyl chloride [no description available] | 2.01 | 1 | 0 | ||
| potassium phosphate potassium phosphate: used in dental materials and to treat hypophosphatemia; RN given refers to cpd with unspecified MF. tripotassium phosphate : An inorganic potassium salt that is the tripotassium salt of phosphoric acid. | 1.99 | 1 | 0 | inorganic phosphate salt; inorganic potassium salt | |
| colestipol Colestipol: Highly crosslinked and insoluble basic anion exchange resin used as anticholesteremic. It may also may reduce triglyceride levels.. colestipol : A high molecular weight copolymer of diethylenetriamine and epichlorohydrin (hydrochloride), with approximately 1 out of 5 amine nitrogens protonated. Due to the highly cross-linked and insoluble nature of the material, no structural formula has been assigned and no specific molecular weight information is available. A basic anion exchange resin, it is used as its hydrochloride for binding bile acids in the intestine, inhibiting their reabsorption. | 2.47 | 2 | 0 | ||
| trazodone hydrochloride Triticum: A plant genus of the family POACEAE that is the source of EDIBLE GRAIN. A hybrid with rye (SECALE CEREALE) is called TRITICALE. The seed is ground into FLOUR and used to make BREAD, and is the source of WHEAT GERM AGGLUTININS.. trazodone hydrochloride : A hydrochloride salt prepared from equimolar amounts of trazodone and hydrogen chloride. | 5.06 | 42 | 0 | hydrochloride | adrenergic antagonist; antidepressant; H1-receptor antagonist; sedative; serotonin uptake inhibitor |
| 3,4,5,3',4'-pentachlorobiphenyl 3,3',4,4',5-pentachlorobiphenyl : A pentachlorobiphenyl in which the chlorines are located at the 3, 4, 5, 3', and 4' positions. | 2.42 | 2 | 0 | pentachlorobiphenyl; trichlorobenzene | |
| 2,4(1h,3h)-quinazolinedione 2,4(1H,3H)-quinazolinedione: structure given in first source | 2.39 | 2 | 0 | ||
| 3-(2'-spiroadamantane)-4-methoxy-4-(3''-phosphoryloxy)phenyl-1,2-dioxetane 3-(2'-spiroadamantane)-4-methoxy-4-(3''-phosphoryloxy)phenyl-1,2-dioxetane: chemiluminescent substrate for alkaline phosphatase | 1.98 | 1 | 0 | ||
| aluminum phosphate aluminum phosphate: gel used as immunologic adjuvent; RN given refers to Al salt | 2.01 | 1 | 0 | ||
| glucose, (beta-d)-isomer beta-D-glucose : D-Glucopyranose with beta configuration at the anomeric centre.. (1->4)-beta-D-glucan : A beta-D-glucan in which the glucose units are connected by (1->4) linkages.. (1->3)-beta-D-glucan : A beta-D-glucan in which the glucose units are connected by (1->3) linkages. | 4.39 | 6 | 0 | D-glucopyranose | epitope; mouse metabolite |
| mevastatin mevastatin: antifungal metabolite from Penicillium brevicopactum; potent inhibitory activity to sterol synthesis; structure. mevastatin : A carboxylic ester that is pravastatin that is lacking the allylic hydroxy group. A hydroxymethylglutaryl-CoA reductase inhibitor (statin) isolated from Penicillium citrinum and from Penicillium brevicompactum, its clinical use as a lipid-regulating drug ceased following reports of toxicity in animals. | 2.05 | 1 | 0 | 2-pyranones; carboxylic ester; hexahydronaphthalenes; polyketide; statin (naturally occurring) | antifungal agent; apoptosis inducer; EC 3.4.24.83 (anthrax lethal factor endopeptidase) inhibitor; fungal metabolite; Penicillium metabolite |
| lanthanum chloride lanthanum chloride: RN given refers to parent cpd | 2.41 | 1 | 0 | ||
| ursolic acid [no description available] | 2.43 | 2 | 0 | hydroxy monocarboxylic acid; pentacyclic triterpenoid | geroprotector; plant metabolite |
| 3-aminoisobutyric acid 3-aminoisobutyric acid: RN given refers to cpd without isomeric designation. 3-aminoisobutyric acid : A beta-amino-acid that is isobutyric acid in which one of the methyl hydrogens is substituted by an amino group. | 3.59 | 1 | 1 | amino acid zwitterion; beta-amino acid | metabolite |
| xanthosine [no description available] | 7.47 | 2 | 0 | purines D-ribonucleoside; xanthosines | Escherichia coli metabolite; human metabolite; mouse metabolite |
| cyclen cyclen: macrocyclic polyamine metal-complexing agent. 1,4,7,10-tetraazacyclododecane : An azacycloalkane that is cyclododecane in which the carbon atoms at positions 1, 4, 7 and 10 are replaced by nitrogen atoms. | 2.45 | 2 | 0 | azacycloalkane; crown amine; saturated organic heteromonocyclic parent | |
| cyclam cyclam: RN given refers to parent cpd; structure given in first source | 2.02 | 1 | 0 | azacycloalkane; crown amine; saturated organic heteromonocyclic parent | |
| thiazolyl blue thiazolyl blue: RN & II refers to bromide. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide : The bromide salt of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium. | 4.05 | 14 | 0 | organic bromide salt | colorimetric reagent; dye |
| thymidine 5'-triphosphate thymidine 5'-triphosphate: RN given refers to parent cpd. dTTP : A thymidine phosphate having a triphosphate group at the 5'-position. | 4.25 | 18 | 0 | pyrimidine 2'-deoxyribonucleoside 5'-triphosphate; thymidine phosphate | Escherichia coli metabolite; mouse metabolite |
| dexelvucitabine dexelvucitabine: inhibits human hepatitis B virus (HBV) and human immunodeficiency virus (HIV) in vitro | 2 | 1 | 0 | ||
| l 693593 L 693593: structure given in first source | 1.97 | 1 | 0 | ||
| oseltamivir Oseltamivir: An acetamido cyclohexene that is a structural homolog of SIALIC ACID and inhibits NEURAMINIDASE.. oseltamivir : A cyclohexenecarboxylate ester that is the ethyl ester of oseltamivir acid. An antiviral prodrug (it is hydrolysed to the active free carboxylic acid in the liver), it is used to slow the spread of influenza. | 2.08 | 1 | 0 | acetamides; amino acid ester; cyclohexenecarboxylate ester; primary amino compound | antiviral drug; EC 3.2.1.18 (exo-alpha-sialidase) inhibitor; environmental contaminant; prodrug; xenobiotic |
| isocytidine [no description available] | 2.01 | 1 | 0 | ||
| 5-methylcytosine 5-Methylcytosine: A methylated nucleotide base found in eukaryotic DNA. In ANIMALS, the DNA METHYLATION of CYTOSINE to form 5-methylcytosine is found primarily in the palindromic sequence CpG. In PLANTS, the methylated sequence is CpNpGp, where N can be any base.. 5-methylcytosine : A pyrimidine that is a derivative of cytosine, having a methyl group at the 5-position. | 5.28 | 51 | 0 | methylcytosine; pyrimidines | human metabolite |
| guanidine thiocyanate guanidine thiocyanate: a powerful chaotropic agent | 2.02 | 1 | 0 | ||
| thymine arabinoside thymine arabinoside: selectively inhibits replication of herpes simplex virus | 1.99 | 1 | 0 | N-glycosyl compound | |
| 2',3'-dideoxythymidine triphosphate ddTTP : A pyrimidine 2',3'-dideoxyribonucleoside 5'-triphosphate having thymine as the nucleobase. | 2.38 | 2 | 0 | pyrimidine 2',3'-dideoxyribonucleoside 5'-triphosphate; thymidine phosphate | |
| methylthymidine methylthymidine: RN given refers to N-3-methylthymidine | 2.01 | 1 | 0 | ||
| 2'-deoxyuridylic acid 2'-deoxyuridylic acid: RN given refers to parent cpd | 2.91 | 4 | 0 | deoxyuridine phosphate; pyrimidine 2'-deoxyribonucleoside 5'-monophosphate | Escherichia coli metabolite; metabolite; mouse metabolite |
| epigallocatechin gallate epigallocatechin gallate: a steroid 5alpha-reductase inhibitor and antimutagen in green tea (Camellia sinensis). (-)-epigallocatechin 3-gallate : A gallate ester obtained by the formal condensation of gallic acid with the (3R)-hydroxy group of (-)-epigallocatechin. | 2.21 | 1 | 0 | flavans; gallate ester; polyphenol | antineoplastic agent; antioxidant; apoptosis inducer; geroprotector; Hsp90 inhibitor; neuroprotective agent; plant metabolite |
| alpha-terthienyl [no description available] | 2.05 | 1 | 0 | terthiophene | |
| deoxyuridine triphosphate [no description available] | 3.12 | 5 | 0 | deoxyuridine phosphate; pyrimidine 2'-deoxyribonucleoside 5'-triphosphate | Arabidopsis thaliana metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite |
| 2-phenyloxazolone 2-phenyloxazolone: RN given refers to 2-phenyl-5-oxazolone. 2-phenyloxazol-5(4H)-one : A 1,3-oxazole having a phenyl substituent at the 2-position and an oxo group at the 5-position. Note that phenyloxazolone is commonly used as a synonym for 4-(ethoxymethylene)-2-phenyloxazol-5-one (PhOx). | 1.97 | 1 | 0 | 1,3-oxazoles | |
| cholesteryl sulfate cholesteryl sulfate: component of human seminal plasma & spermatozoa; RN given refers to (3beta)-isomer. cholesterol sulfate : A steroid sulfate that is cholesterol substituted by a sulfoxy group at position 3. | 2.06 | 1 | 0 | steroid sulfate | human metabolite |
| fluorexon fluorexon: structure | 2.43 | 2 | 0 | xanthene dye | fluorochrome |
| 2'-deoxycytidine 5'-triphosphate 2'-deoxycytidine 5'-triphosphate: RN given refers to unlabeled parent cpd | 3.71 | 10 | 0 | 2'-deoxycytidine phosphate; pyrimidine 2'-deoxyribonucleoside 5'-triphosphate | Escherichia coli metabolite; human metabolite; mouse metabolite |
| 2,2'-dipyridyl disulfide 2,2'-dipyridyl disulfide: disulfide is an important moiety in this cpd. aldrithiol : A member of the class of pyridines that is pyridine which is substituted by a pyridin-2-yldisulfanediyl group at position 2. It is a reagent used in molecular biology as an oxidizing agent. Also used in peptide synthesis and for detecting thiols. | 2.02 | 1 | 0 | organic disulfide; pyridines | oxidising agent |
| 25-hydroxycholesterol [no description available] | 2.1 | 1 | 0 | 25-hydroxy steroid; oxysterol | human metabolite |
| phenylalanylphenylalanine phenylalanylphenylalanine: RN given refers to (L,L)-isomer | 2.07 | 1 | 0 | ||
| chlorin chlorin: RN given refers to parent cpd; structure. chlorin : A tetrapyrrole fundamental parent that is obtained by formal hydrogenation across the 2,3-double bond of porphyrin. | 2.44 | 2 | 0 | ||
| phosphoramidic acid phosphoramidic acid: urease inhibitor; RN given refers to parent cpd; structure; do not confuse with phosphoramidites, which are organophosphorus compounds | 8.24 | 76 | 0 | phosphoric acid derivative | |
| 1,2-dipalmitoyl-3-phosphatidylethanolamine 1,2-dipalmitoyl-3-phosphatidylethanolamine: RN given refers to parent cpd without isomeric designation | 2.01 | 1 | 0 | ||
| aica ribonucleotide AICA ribonucleotide: purine precursor that has antineoplastic activity. AICA ribonucleotide : A 1-(phosphoribosyl)imidazolecarboxamide that is acadesine in which the hydroxy group at the 5' position has been converted to its monophosphate derivative. | 2.01 | 1 | 0 | 1-(phosphoribosyl)imidazolecarboxamide; aminoimidazole | cardiovascular drug; Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| 2',3'-dideoxythymidine [no description available] | 2.41 | 2 | 0 | ||
| depsidone depsidone: a dibenzo dioxepin with a lactone formed by one of the oxygens and a carbonyl between the two benzyl rings; some derivatives are found in GARCINIA plants. depsidone : The simplest member of the class of depsidones comprising of a heterotricyclic system that is 11H-dibenzo[b,e][1,4]dioxepine substituted by an oxo group at position 11. | 3.11 | 1 | 0 | depsidones; organic heterotricyclic compound | |
| 1,2-dipalmitoylphosphatidylglycerol dipalmitoyl phosphatidylglycerol : A phosphatidylglycerol in which the phosphatidyl acyl groups are both palmitoyl. | 2.05 | 1 | 0 | phosphatidylglycerol | |
| 2'-deoxynebularine 2'-deoxynebularine: structure given in first source. purine 2'-deoxyribonucleoside : A 2'-deoxyribonucleoside that has a purine moiety as the nucleobase (the R group in the illustration).. purine deoxyribonucleoside : A deoxyribonucleoside containing a purine base.. 2'-deoxynebularine : A purine 2'-deoxyribonucleoside in which a 2-deoxy-beta-D-ribofuranosyl residue is attached at position 9 of 9H-purine via a glycosidic linkage. | 2.9 | 2 | 0 | purine 2'-deoxyribonucleoside; purines 2'-deoxy-D-ribonucleoside | |
| bathocuproine bathocuproine: reagent for copper; RN given refers to parent cpd | 2.05 | 1 | 0 | ||
| 5-bromo-4-chloro-3-indolyl beta-galactoside 5-bromo-4-chloro-3-indolyl beta-galactoside: enzyme substrate for beta-galactosidase. 5-bromo-4-chloro-3-indolyl beta-D-galactoside : An indolyl carbohydrate that is the beta-D-galactoside of 3-hydroxy-1H-indole in which the indole moiety is substituted at positions 4 and 5 by chlorine and bromine, respectively. It is used to test for the presence of an enzyme, beta-galactosidase, which cleaved the glycosidic bond to give 5-bromo-4-chloro-3-hydroxy-1H-indole, which immediately dimerises to give an intensely blue product. | 2.97 | 4 | 0 | beta-D-galactoside; D-aldohexose derivative; indolyl carbohydrate; organobromine compound; organochlorine compound | chromogenic compound |
| nile red nile red : An organic heterotetracyclic compound that is 5H-benzo[a]phenoxazin-5-one substituted at position 9 by a diethylamino group. | 2.97 | 4 | 0 | aromatic amine; cyclic ketone; organic heterotetracyclic compound; tertiary amino compound | fluorochrome; histological dye |
| metaperiodate Periodic Acid: A strong oxidizing agent. | 5.53 | 13 | 0 | iodine oxoacid | |
| lissamine rhodamine b lissamine rhodamine B: RN given refers to parent cpd; Lissamine Rhodamine B refers to Na salt | 2.46 | 2 | 0 | ||
| fluorophosphate fluorophosphate: inhibits Phosphorylas phosphatase irreversibly; RN given refers to parent cpd | 2.11 | 1 | 0 | fluorine molecular entity; phosphoric acid derivative | |
| n-acetylserine acetyl-L-serine : An acetyl-amino acid in which the amino acid specified is L-serine.. N-acetyl-L-serine : An N-acetyl-L-amino acid in which the amino acid specified is L-serine. Metabolite observed in cancer metabolism. | 1.97 | 1 | 0 | acetyl-L-serine; N-acetyl-L-amino acid | human metabolite |
| o-(6)-methylguanine O-(6)-methylguanine: structure. 6-O-methylguanine : A methylguanine in which the methyl group is positioned on the oxygen at position 6. Formed in DNA by alkylation of the oxygen atom of guanine, most often by N-nitroso compounds and sometimes due to methylation by other compounds such as endogenous S-adenosylmethionine, it base-pairs to thymine rather than cytidine, causing a G:C to A:T transition in DNA.. methylguanine : A 2-aminopurine that is guanine bearing a single methyl substituent. | 3.86 | 12 | 0 | methylguanine | mutagen |
| 2',3'-dideoxyadenosine triphosphate [no description available] | 2.41 | 2 | 0 | purine deoxyribonucleoside triphosphate | |
| pyrrolidine dithiocarbamate pyrrolidine dithiocarbamic acid: spelled pyrolidine in J Nutr 1979 reference; RN given refers to parent cpd. pyrrolidine dithiocarbamate : A member of the class of dithiocarbamic acids that is the N-dithiocarboxy derivative of pyrrolidine. | 2.42 | 2 | 0 | dithiocarbamic acids; pyrrolidines | anticonvulsant; antineoplastic agent; geroprotector; neuroprotective agent; NF-kappaB inhibitor; radical scavenger |
| o-4-methylthymine O(4)-methylthymine : A methylthymine in which the methyl group is located at the O4-position. | 7.4 | 2 | 0 | aromatic ether; methylthymine | human metabolite |
| peroxynitric acid [no description available] | 3.1 | 5 | 0 | nitrogen oxoacid | |
| 2'-deoxyxanthosine [no description available] | 7.39 | 2 | 0 | purines 2'-deoxy-D-ribonucleoside | |
| 5-bromo-4-chloro-3-indoxyl phosphate 5-bromo-4-chloro-3-indoxyl phosphate: substrate for demonstration of activity of alkaline phosphatase; structure given in first source. 5-bromo-4-chloro-3-indolyl phosphate : An aryl phosphate that is indoxyl phopshate in which the indole moiety is substituted at positions 4 and 5 by chlorine and bromine, respectively. It is used to test for the presence of an enzyme, alkaline phosphatase, which cleaves the phosphate group to give 5-bromo-4-chloroindoxyl, which immediately dimerises to give an intensely blue product. | 1.98 | 1 | 0 | aryl phosphate; indoles; organobromine compound; organochlorine compound | chromogenic compound |
| sinefungin [no description available] | 2.02 | 1 | 0 | adenosines; non-proteinogenic alpha-amino acid | antifungal agent; antimicrobial agent |
| cephalosporin c cephalosporin C: RN given refers to parent cpd; structure in Merck, 9th ed, #1937. cephalosporin C : A cephalosporin antibiotic carrying a 3-acetoxymethyl substituent and a 6-oxo-N(6)-L-lysino group at position 7. | 2.42 | 2 | 0 | cephalosporin | fungal metabolite |
| 3'-deoxyadenosine 5'-triphosphate [no description available] | 1.96 | 1 | 0 | purine ribonucleoside 5'-triphosphate | antifungal agent; antimetabolite; antineoplastic agent; antiviral agent |
| 5-(2-propenyl)-2'-deoxyuridine [no description available] | 2 | 1 | 0 | ||
| methoxy-morpholinyl-doxorubicin methoxy-morpholinyl-doxorubicin: structure in first source | 1.98 | 1 | 0 | anthracycline antibiotic; morpholines; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone | |
| boron nitride [no description available] | 2.15 | 1 | 0 | nitride | |
| estradiol-2,3-o-quinone [no description available] | 2.01 | 1 | 0 | ||
| perylenediimide perylenediimide: structure in first source. perylenediimide : The 3,4,9,10-tetracarboxylic diimide derivative of perylene. | 2.45 | 2 | 0 | dicarboximide; organic heteropolycyclic compound | fluorochrome |
| naphthalimides Naphthalimides: Compounds with three fused rings that appear like a naphthalene fused to piperidone or like a benz(de)isoquinoline-1,3-dione (not to be confused with BENZYLISOQUINOLINES which have a methyl separating the naphthyl from the benzyl rings). Members are CYTOTOXINS. | 3.05 | 4 | 0 | ||
| divinyl benzene [no description available] | 4.01 | 4 | 0 | styrenes | |
| isocytosine 2-amino-4-hydroxypyrimidine : An aminopyrimidine in which the pyrimidine ring bears amino and hydroxy substituents at positions 2 and 4, respectively. | 7.72 | 3 | 0 | aminopyrimidine; pyrimidine nucleobase; pyrimidone | |
| phenoxazine phenoxazine: RN given refers to 10H-phenoxazine. 10H-phenoxazine : A member of the class of phenoxazines that is morpholine which is ortho-fused to two benzene rings at positions 2-3 and 5-6. | 3.18 | 5 | 0 | phenoxazine | ferroptosis inhibitor; radical scavenger |
| 1,7-phenanthroline [no description available] | 4.92 | 36 | 0 | phenanthroline | |
| pyrazolo(3,4-d)pyrimidine [no description available] | 2.43 | 2 | 0 | ||
| 1h-imidazo(4,5-b)pyridine 1H-imidazo(4,5-b)pyridine: structure given in first source. 4-azabenzimidazole : The [4,5-b]-fused isomer of imidazopyridine. | 2.52 | 2 | 0 | imidazopyridine | |
| triazoles Triazoles: Heterocyclic compounds containing a five-membered ring with two carbon atoms and three nitrogen atoms with the molecular formula C2H3N3.. triazoles : An azole in which the five-membered heterocyclic aromatic skeleton contains three N atoms and two C atoms. | 7.33 | 56 | 0 | 1,2,3-triazole | |
| 1h-tetrazole tetrazole : An azaarene that is a five-membered ring composed of 4 nitrogen and 1 carbon atom.. 2H-tetrazole : A tetrazole tautomer where the proton is located on the 2 position. | 2.9 | 4 | 0 | one-carbon compound; tetrazole | |
| 6-methyladenine 6-methyladenine: structure. 6-methyladenine : A methyladenine that is 9H-purin-6-amine substituted by a methyl group at the amino nitrogen. | 2.66 | 3 | 0 | 6-alkylaminopurine; methyladenine | human metabolite |
| difluorotoluene difluorotoluene: structure in first source | 2.71 | 3 | 0 | ||
| azauracil azauracil: minor descriptor (64-72); major descriptor (73-86); on line search URACIL (66-74); URACIL/AA (75-86); INDEX MEDICUS search URACIL (64-72); AZAURACIL (73-86). 6-azauracil : A 1,2,4-triazine compound having oxo-substituents at the 3- and 5-positions. | 7.04 | 1 | 0 | 1,2,4-triazines; nucleobase analogue | antimetabolite |
| 2,4,6-trihydroxyacetophenone monoacetylphloroglucinol: structure in first source. 2',4',6'-trihydroxyacetophenone : A benzenetriol that is acetophenone in which the hydrogens at positions 2, 4, and 6 on the phenyl group are replaced by hydroxy groups. It is used as a matrix in matrix-assisted laser desorption/ionization (MALDI) mass spectrometry for the analysis of acidic glycans and glycopeptides. | 2.42 | 2 | 0 | aromatic ketone; benzenetriol; methyl ketone | MALDI matrix material; plant metabolite |
| diethylmalonic acid diethylmalonic acid: isomer of diethyl malonate which is a di-ester | 2.01 | 1 | 0 | ||
| delphinidin Paraffin: A mixture of solid hydrocarbons obtained from petroleum. It has a wide range of uses including as a stiffening agent in ointments, as a lubricant, and as a topical anti-inflammatory. It is also commonly used as an embedding material in histology.. delphinidin chloride : An anthocyanidin chloride that has delphinidin as the cationic counterpart. | 3.49 | 8 | 0 | anthocyanidin chloride | |
| n,n-carbonyldiimidazole [no description available] | 1.98 | 1 | 0 | ||
| serinol serinol: RN given refers to cpd without isomeric designation | 3.04 | 4 | 0 | ||
| silver [no description available] | 2.13 | 1 | 0 | ||
| zoledronic acid Zoledronic Acid: An imidobisphosphonate inhibitor of BONE RESORPTION that is used for the treatment of malignancy-related HYPERCALCEMIA; OSTEITIS DEFORMANS; and OSTEOPOROSIS.. zoledronic acid : An imidazole compound having a 2,2-bis(phosphono)-2-hydroxyethane-1-yl substituent at the 1-position. | 2.11 | 1 | 0 | 1,1-bis(phosphonic acid); imidazoles | bone density conservation agent |
| epristeride epristeride: structure given in first source | 1.99 | 1 | 0 | steroid acid | |
| artemisinin (+)-artemisinin : A sesquiterpene lactone obtained from sweet wormwood, Artemisia annua, which is used as an antimalarial for the treatment of multi-drug resistant strains of falciparum malaria. | 2.05 | 1 | 0 | organic peroxide; sesquiterpene lactone | antimalarial; plant metabolite |
| cifostodine cifostodine: INN; was 2',3'-cyclic CMP 1979-93; CYTIDINE CYCLIC-2',3'-MONOPHOSPHATE was see CYTIDINE CYCLIC MONOPHOSPHATE 1980-93; use CYCLIC CMP to search 1980-93 | 1.99 | 1 | 0 | 2',3'-cyclic pyrimidine nucleotide | Escherichia coli metabolite; mouse metabolite; Mycoplasma genitalium metabolite |
| 3,4-diaminobenzoic acid 3,4-diaminobenzoic acid: RN given refers to parent cpd | 2.01 | 1 | 0 | ||
| 5-iodouracil 5-iodouracil: RN given refers to parent cpd. 5-iodouracil : An organoiodine compound consisting of uracil having an iodo substituent at the 5-position. | 2.93 | 4 | 0 | organoiodine compound | antimetabolite |
| 1-methylguanine [no description available] | 2.05 | 1 | 0 | methylguanine | |
| 4,5-dicyanoimidazole imidazole-4,5-dicarbonitrile: structure in first source | 1.99 | 1 | 0 | ||
| 5-hydroxymethylcytosine 5-(hydroxymethyl)cytosine : A nucleobase analogue that is cytosine in which the hydrogen at position 5 is replaced by a hydroxymethyl group. | 4.17 | 15 | 0 | aminopyrimidine; aromatic primary alcohol; nucleobase analogue; pyrimidone | human metabolite; mouse metabolite |
| morpholinopropane sulfonic acid 3-(N-morpholino)propanesulfonic acid : A Good's buffer substance, pKa = 7.2 at 20 degreeC. | 2.03 | 1 | 0 | MOPS; morpholines; organosulfonic acid | |
| bindarit [no description available] | 3.1 | 1 | 0 | ||
| tyloxapol tyloxapol: non-ionic detergent with surface-active properties; incompatible with metals; surfactant also used in inhalation therapy; N1 is from CA Vol 90 Form Index; N1 in Chemline is same as synonym 8. tyloxapol : A polymeric compound resulting from the reaction of 4-(1,1,3,3-tetramethylbutyl)phenol with formaldehyde to give a chain in which 6-8 molecules are linked together by CH2 groups ortho to the phenolic hydroxy groups, which have then undergone reaction with oxirane to give polyoxyethyleneoxy moieties, Ar(OCH2CH2)xOH, where x = 8-10. A nonionic liquic polymer, it inhibits lipoprotein lipase and hence clearance of triglyceride from the plasma, so is used to induce hyperlipidaemia in test animals. Also used as a surfactant to aid liquefaction and removal of mucus- and pus-containing bronchopulmonary secretions. | 1.96 | 1 | 0 | ||
| mitozolomide mitozolomide: RN & structure given in first source | 2.01 | 1 | 0 | ||
| zidovudine triphosphate [no description available] | 2.4 | 2 | 0 | ||
| 2-aminoadenosine [no description available] | 7.4 | 2 | 0 | purine nucleoside | |
| 2',3'-dideoxyuridine-5'-triphosphate 2',3'-dideoxyuridine-5'-triphosphate: inhibits HIV reverse transcriptase & has potent DNA chain termination activity | 2.15 | 1 | 0 | ||
| neamine neamine: fragment of NEOMYCIN B; structure in first source. neamine : 2-Deoxy-D-streptamine glycosylated at the 4-oxygen with a 6-amino-alpha-D-glucosaminyl group. | 2.45 | 2 | 0 | 2,6-dideoxy-alpha-D-glucoside; aminoglycoside | antibacterial agent |
| lividomycin [no description available] | 2.03 | 1 | 0 | lividomycins | metabolite |
| 9-aminocamptothecin [no description available] | 2.03 | 1 | 0 | pyranoindolizinoquinoline | |
| mesoporphyrin ix mesoporphyrin IX: RN given refers to parent cpd; mesoheme is the iron salt of mesoporphyrin IX. mesoporphyrin IX : A member of the class of mesoporphyrins obtained by formal hydrogenation of the two vinyl groups in protoporphyrin. | 2.01 | 1 | 0 | ||
| 1,10-phenanthroline-5,6-dione 1,10-phenanthroline-5,6-dione: has antineoplastic, intercalating, and trypanocidal activities; structure given in first source | 2.02 | 1 | 0 | ||
| 3-nitrodibenzofuran 3-nitrodibenzofuran: structure given in first source | 2.06 | 1 | 0 | ||
| rebeccamycin rebeccamycin: from actinomycete strain C-38,383; structure given in first source. rebeccamycin : An N-glycosyl compound consisting of a heteropolycyclic ring system with a glucosyl group attached to one of the indolic nitrogens. | 7 | 1 | 0 | indolocarbazole; N-glycosyl compound; organic heterohexacyclic compound; organochlorine compound | |
| 5-hydroxyuracil 5-hydroxyuracil: used in treatment of colonic adenocarcinoma | 8.12 | 5 | 0 | hydroxypyrimidine | |
| xanthosine 5'-triphosphate xanthosine 5'-phosphate : xanthosine phosphate compounds having phosphate groups at position 5'.. 5'-xanthylic acid : A purine ribonucleoside 5'-monophosphate having xanthine as the nucleobase. | 1.97 | 1 | 0 | purine ribonucleoside 5'-monophosphate; xanthosine 5'-phosphate | Escherichia coli metabolite; metabolite; mouse metabolite |
| glucosaminic acid glucosaminic acid: RN given refers to cpd with unspecified isomeric designation. 2-amino-2-deoxy-D-gluconic acid : Hexanoic acid with four hydroxy groups at C-3, C-4, C-5, C-6, and an amino group at C-2. | 2.04 | 1 | 0 | amino acid zwitterion; gluconic acid derivative | bacterial metabolite |
| gallein gallein: do not confuse with gallin; structure. gallein : A xanthene dye that is fluoran carrying four hydroxy substituents at positions 3', 4', 5' and 6'. | 2.01 | 1 | 0 | 2-benzofurans; gamma-lactone; organic heteropentacyclic compound; oxaspiro compound; polyphenol; xanthene dye | fluorochrome; G-protein-coupled receptor antagonist; histological dye |
| 2,2'-dipicolylamine 2,2'-dipicolylamine: structure in first source | 2.06 | 1 | 0 | ||
| 3-aminopicolinic acid [no description available] | 1.98 | 1 | 0 | ||
| trifluoromethanol trifluoromethanol: structure in first source | 2.25 | 1 | 0 | ||
| oxazolidin-2-one Oxazolidinones: Derivatives of oxazolidin-2-one. They represent an important class of synthetic antibiotic agents.. oxazolidin-2-one : An oxazolidinone that is 1,3-oxazolidine with an oxo substituent at position 2.. oxazolidinone : An oxazolidine containing one or more oxo groups. | 5.2 | 4 | 0 | carbamate ester; oxazolidinone | metabolite |
| ceric oxide ceric oxide: RN given refers to cpd with MF CeO2. ceric oxide : A metal oxide with formula CeO2. It is used for polishing glass, in coatings for infra-red filters to prevent reflection, and as an oxidant and catalyst in organic synthesis. | 2.58 | 2 | 0 | cerium molecular entity; metal oxide | |
| perfluorooctane sulfonic acid perfluorooctane-1-sulfonic acid : A perfluoroalkanesulfonic acid that is octane-1-sulfonic acid in which all seventeen of the hydrogens that are attached to carbons hvae been replaced by fluorines. | 2.06 | 1 | 0 | perfluoroalkanesulfonic acid | antilipemic drug; persistent organic pollutant |
| tetramethylrhodamine iodoacetamide tetramethylrhodamine iodoacetamide: fluorescent sulfhydryl reagent | 2 | 1 | 0 | ||
| 5-bromocytosine [no description available] | 2.74 | 3 | 0 | ||
| 4-aminopyrazolo(3,4-d)pyrimidine 4-aminopyrazolo(3,4-d)pyrimidine: adenine analog which suppresses growth of E coli & Bacillus cereus; inhibits cell growth & purine biosynthesis in rat hepatoma | 2.99 | 4 | 0 | ||
| 1-hydroxybenzotriazole 1-hydroxybenzotriazole: RN given refers to parent cpd | 2.36 | 2 | 0 | benzotriazoles | |
| 5-methoxysalicylic acid 5-methoxysalicylic acid: enhances intestinal absorption of insulin in rats; RN given refers to parent cpd. 5-methoxysalicylic acid : A methoxysalicylic acid that is salicylic acid which is carrying a methoxy group at position 5. | 7.42 | 2 | 0 | methoxysalicylic acid | bacterial metabolite; human urinary metabolite |
| 1,5-diazabicyclo(4.3.0)non-5-ene 1,5-diazabicyclo(4.3.0)non-5-ene: inhibitor of indolamine-N-methyltransferase; RN given refers to parent cpd; structure | 1.95 | 1 | 0 | pyrrolopyrimidine | |
| n-octadecyltrimethoxysilane n-octadecyltrimethoxysilane: used to form self-assembled monolayers for high contrast patterned adsorption of bovine serum albumin and deriviatives | 2.1 | 1 | 0 | ||
| 6-carboxyfluorescein 6-carboxyfluorescein: originally sold as 6-carboxyfluorescein, but commercial product is a mixture of two isomers; correct name is 5(6)-carboxyfluorescein | 4.45 | 21 | 0 | monocarboxylic acid | |
| isoguanine isoguanine: structure. isoguanine : An oxopurine that is 3,7-dihydro-purin-2-one in which the hydrogen at position 6 is substituted by an amino group. | 3.64 | 9 | 0 | oxopurine | |
| 1-pyrenebutyrate 1-pyrenebutyrate: fluorescent probe; RN given refers to 1-pyrenebutyrate | 2.08 | 1 | 0 | ||
| sofosbuvir 5-carboxycytosine: a 5-formylcystosine oxidation product; structure in first source. 5-carboxycytosine : A nucleobase analogue that is cytosine in which the hydrogen at position 5 is replaced by a carboxy group. | 2.52 | 2 | 0 | aminopyrimidine; aromatic carboxylic acid; nucleobase analogue; pyrimidone | metabolite |
| rivastigmine [no description available] | 2.02 | 1 | 0 | carbamate ester; tertiary amino compound | cholinergic drug; EC 3.1.1.8 (cholinesterase) inhibitor; neuroprotective agent |
| rosiglitazone [no description available] | 2.44 | 2 | 0 | aminopyridine; thiazolidinediones | EC 6.2.1.3 (long-chain-fatty-acid--CoA ligase) inhibitor; ferroptosis inhibitor; insulin-sensitizing drug |
| 2-(n-morpholino)ethanesulfonic acid 2-(N-morpholino)ethanesulfonic acid: RN given refers to parent cpd. 2-(N-morpholino)ethanesulfonic acid : A Good's buffer substance, pKa = 6.15 at 20 degreeC. | 2.02 | 1 | 0 | MES; organosulfonic acid; zwitterion | |
| 5-hydroxymethyluracil [no description available] | 8.4 | 7 | 0 | primary alcohol; pyrimidone | human metabolite |
| imidazo(1,2-a)pyridine imidazo(1,2-a)pyridine: structure | 2 | 1 | 0 | ||
| 1-methylcytosine 1-methylcytosine: RN given refers to parent cpd. 1-methylcytosine : A pyrimidone that is cytosine in which the hydrogen attached to the nitrogen at position 1 is substituted by a methyl group. | 2.42 | 2 | 0 | aminopyrimidine; methylcytosine; pyrimidone | metabolite |
| n-hydroxysuccinimide N-hydroxysuccinimide: structure | 8.18 | 5 | 0 | ||
| 2,4,6-triisopropylbenzenesulfonyl chloride [no description available] | 1.95 | 1 | 0 | ||
| 1,8-diazabicyclo(5.4.0)undec-7-ene [no description available] | 2.36 | 2 | 0 | ||
| n,n-diisopropylethylamine N,N-diisopropylethylamine: RN given refers to parent cpd | 2.8 | 3 | 0 | tertiary amino compound | |
| 4,4'-dimethoxytrityl cation 4,4'-dimethoxytrityl cation: RN given refers to non-ionic form; structure in first source | 2.4 | 2 | 0 | ||
| cryptolepine cryptolepine: fused indole-quinoline; structure in first source; from CRYPTOLEPIS sanguinolenta. cryptolepine : An organic heterotetracyclic compound that is 5H-indolo[3,2-b]quinoline in which the hydrogen at position N-5 is replaced by a methyl group. | 7.44 | 2 | 0 | indole alkaloid; organic heterotetracyclic compound; organonitrogen heterocyclic compound | anti-inflammatory agent; antimalarial; antineoplastic agent; cysteine protease inhibitor; plant metabolite |
| hypobromous acid [no description available] | 2.02 | 1 | 0 | bromine oxoacid | |
| 3-(trimethoxysilyl)propylamine 3-(trimethoxysilyl)propylamine: reagent for making polymers; structure in first source | 2.75 | 3 | 0 | ||
| d-biotin-d-sulfoxide biotin sulfoxide : A sulfoxide that is the S-oxide of biotin. | 2.02 | 1 | 0 | biotins; sulfoxide | metabolite |
| clarithromycin Clarithromycin: A semisynthetic macrolide antibiotic derived from ERYTHROMYCIN that is active against a variety of microorganisms. It can inhibit PROTEIN SYNTHESIS in BACTERIA by reversibly binding to the 50S ribosomal subunits. This inhibits the translocation of aminoacyl transfer-RNA and prevents peptide chain elongation.. clarithromycin : The 6-O-methyl ether of erythromycin A, clarithromycin is a macrolide antibiotic used in the treatment of respiratory-tract, skin and soft-tissue infections. It is also used to eradicate Helicobacter pylori in the treatment of peptic ulcer disease. It prevents bacteria from growing by interfering with their protein synthesis. | 4.16 | 5 | 0 | macrolide antibiotic | antibacterial drug; environmental contaminant; protein synthesis inhibitor; xenobiotic |
| bromates Bromates: Negative ions or salts derived from bromic acid, HBrO3. | 2.42 | 2 | 0 | bromine oxoanion; monovalent inorganic anion | |
| coenzyme a [no description available] | 1.97 | 1 | 0 | adenosine 3',5'-bisphosphate | coenzyme; Escherichia coli metabolite; mouse metabolite |
| hydroxymethylmethacrylate [no description available] | 2.03 | 1 | 0 | ||
| nicotine (S)-nicotine : A 3-(1-methylpyrrolidin-2-yl)pyridine in which the chiral centre has S-configuration. The naturally occurring and most active enantiomer of nicotine, isolated from Nicotiana tabacum. | 3.37 | 2 | 0 | 3-(1-methylpyrrolidin-2-yl)pyridine | anxiolytic drug; biomarker; immunomodulator; mitogen; neurotoxin; nicotinic acetylcholine receptor agonist; peripheral nervous system drug; phytogenic insecticide; plant metabolite; psychotropic drug; teratogenic agent; xenobiotic |
| bay 93820 isocarbophos: an organophosphorus insecticide | 2.21 | 1 | 0 | isopropyl ester; organic phosphonate; organothiophosphate insecticide; phosphonic ester; salicylates | agrochemical; avicide; EC 3.1.1.7 (acetylcholinesterase) inhibitor |
| fibrinogen Fibrinogen: Plasma glycoprotein clotted by thrombin, composed of a dimer of three non-identical pairs of polypeptide chains (alpha, beta, gamma) held together by disulfide bonds. Fibrinogen clotting is a sol-gel change involving complex molecular arrangements: whereas fibrinogen is cleaved by thrombin to form polypeptides A and B, the proteolytic action of other enzymes yields different fibrinogen degradation products.. D-iditol : The D-enantiomer of iditol. | 3.81 | 11 | 0 | iditol | fungal metabolite |
| 7-bromomethylbenzanthracene [no description available] | 1.97 | 1 | 0 | ||
| 5-bromouridine 5-bromouridine : A uridine having a bromo substituent at the 5-position. | 2.46 | 2 | 0 | uridines | mutagen |
| cadmium telluride cadmium telluride: used in radiation monitoring device | 3.01 | 4 | 0 | ||
| 5'-adenylyl (beta,gamma-methylene)diphosphonate 5'-adenylyl (beta,gamma-methylene)diphosphonate: do not confuse with alpha,beta-methyleneadenosine 5'-triphosphate | 2 | 1 | 0 | nucleoside triphosphate analogue | |
| homocysteine Homocysteine: A thiol-containing amino acid formed by a demethylation of METHIONINE.. homocysteine : A sulfur-containing amino acid consisting of a glycine core with a 2-mercaptoethyl side-chain.. L-homocysteine : A homocysteine that has L configuration. | 2.46 | 2 | 0 | amino acid zwitterion; homocysteine; serine family amino acid | fundamental metabolite; mouse metabolite |
| 2-methoxyacetaldehyde 2-methoxyacetaldehyde: shows testicular toxicity; structure given in first source | 2.01 | 1 | 0 | ||
| 1,5-i-aedans 1,5-I-AEDANS: fluorescent probes which are sulfhydryl reagents; combine reactivity of iodoacetamide toward sulfhydryl groups with spectral properties of naphthalenesulfonic acids; structure. 5-{[2-(iodoacetamido)ethyl]amino}naphthalene-1-sulfonic acid : An aminonaphthalenesulfonic acid fluorophore with a structure consisting of ethylenediamine substituted on the nitrogens with iodoacetyl and 5-sulfonyl-1-naphthyl groups. | 2.37 | 2 | 0 | aminonaphthalenesulfonic acid | fluorescent probe |
| succinyl-coenzyme a [no description available] | 1.97 | 1 | 0 | omega-carboxyacyl-CoA | Escherichia coli metabolite; inhibitor; mouse metabolite |
| n(6)-benzyladenosine N(6)-benzyladenosine: RN given refers to parent cpd | 1.96 | 1 | 0 | ||
| 7-amino-4-methylcoumarin 7-amino-4-methylcoumarin: RN given refers to parent cpd | 2.03 | 1 | 0 | 7-aminocoumarins | fluorochrome |
| 3-aminobenzeneboronic acid [no description available] | 2.04 | 1 | 0 | ||
| n-(3-pyrene)maleimide N-(3-pyrene)maleimide: structure in first source | 1.97 | 1 | 0 | ||
| 5-methylcytidine [no description available] | 2.95 | 4 | 0 | methylcytidine | |
| glycidyl nitrate glycidyl nitrate: a nitric oxide donor; structure in first source. peptidoglycan : A peptidoglycosaminoglycan formed by alternating residues of beta-(1->4)-linked N-acetylglucosamine and N-acetylmuramic acid {2-amino-3-O-[(S)-1-carboxyethyl]-2-deoxy-D-glucose} residues. Attached to the carboxy group of the muramic acid is a peptide chain of three to five amino acids. | 3.73 | 10 | 0 | ||
| dithiobis(succinimidylpropionate) dithiobis(succinimidylpropionate): used to study interactions of structural proteins; RN given refers to unlabeled cpd | 2.02 | 1 | 0 | ||
| 5,6-dihydrothymine 5,6-dihydrothymine: RN given refers to parent cpd. 5,6-dihydrothymine : A pyrimidone obtained by formal addition of hydrogen across the 5,6-position of thymine. | 2.73 | 3 | 0 | pyrimidone | human metabolite; metabolite; mouse metabolite |
| erythrose D-erythrose : The D-enantiomer of erythrose. | 4.14 | 15 | 0 | erythrose | plant metabolite |
| adenylyl-(3'-5')-adenosine adenylyl-(3'-5')-adenosine: structure | 1.96 | 1 | 0 | ||
| pyrimidine dimers Pyrimidine Dimers: Dimers found in DNA chains damaged by ULTRAVIOLET RAYS. They consist of two adjacent PYRIMIDINE NUCLEOTIDES, usually THYMINE nucleotides, in which the pyrimidine residues are covalently joined by a cyclobutane ring. These dimers block DNA REPLICATION. | 6.29 | 47 | 0 | ||
| 5,6-dihydrouridine dihydrouridine : The uridine derivative obtained by formal hydrogenation of the endocyclic double bond in the uracil ring. | 2.43 | 2 | 0 | uridines | biomarker |
| glucuronic acid Glucuronic Acid: A sugar acid formed by the oxidation of the C-6 carbon of GLUCOSE. In addition to being a key intermediate metabolite of the uronic acid pathway, glucuronic acid also plays a role in the detoxification of certain drugs and toxins by conjugating with them to form GLUCURONIDES.. D-glucuronic acid : The D-enantiomer of glucuronic acid.. D-glucopyranuronic acid : A D-glucuronic acid in cyclic pyranose form. | 2.45 | 2 | 0 | D-glucuronic acid | algal metabolite |
| 1-phenazinecarboxylic acid 1-phenazinecarboxylic acid: from Streptomyces cinnamonensis; RN given refers to parent cpd; structure given in first source. phenazine-1-carboxylic acid : An aromatic carboxylic acid that is phenazine substituted at C-1 with a carboxy group. | 2.02 | 1 | 0 | aromatic carboxylic acid; monocarboxylic acid; phenazines | antifungal agent; antimicrobial agent; bacterial metabolite |
| 4-mercaptobenzoate 4-mercaptobenzoate: substrate for 4-hydroxybenzoate hydroxylase | 2.08 | 1 | 0 | ||
| 6-ethylguanine 6-ethylguanine: found in rat brain DNA | 1.97 | 1 | 0 | ||
| 6-n-propyluracil [no description available] | 2 | 1 | 0 | ||
| 3-(2,4-dihydroxyphenyl)propionic acid 3-(2,4-dihydroxyphenyl)propionic acid: structure in first source | 2.06 | 1 | 0 | ||
| 8-bromoadenosine [no description available] | 1.97 | 1 | 0 | purine nucleoside | |
| 8-bromo-2'-deoxyadenosine [no description available] | 2.79 | 3 | 0 | ||
| 5-hydroxy-2'-deoxyuridine 5-hydroxy-2'-deoxyuridine: a major oxidation product of 2'-deoxycytidine | 6.99 | 1 | 0 | ||
| aristolactam i aristolactam I: metabolite of aristolochic acid; forms DNA adducts; | 2.03 | 1 | 0 | ||
| n-(2-methoxyphenyl)maleimide N-(2-methoxyphenyl)maleimide: structure given in first source | 2.01 | 1 | 0 | ||
| hedamycin [no description available] | 1.98 | 1 | 0 | ||
| 5-formyl-2'-deoxyuridine 5-formyl-2'-deoxyuridine: structure given in first source | 2.93 | 4 | 0 | ||
| quindoline quindoline: a fused indole-quinoline alkaloid from CRYPTOLEPIS sanguinolenta; structure | 7.47 | 2 | 0 | ||
| 9-aminoellipticine 9-aminoellipticine: structure in first source | 1.97 | 1 | 0 | ||
| tetrathiafulvalene tetrathiafulvalene: used in carbon paste amperometric enzyme electrode for the determination of glucose in flowing systems. tetrathiafulvalene : A member of the class of fulvalenes that is ethene substituted by 1,3-dithiol-2-ylidene groups at positions 1 and 2. | 2.04 | 1 | 0 | fulvalenes; organosulfur heterocyclic compound | |
| propynyloxy-2'-deoxyuridine propynyloxy-2'-deoxyuridine: RN given refers to parent cpd | 2.41 | 2 | 0 | ||
| phorbolol myristate acetate [no description available] | 2.03 | 1 | 0 | ||
| pyrimidin-2-one beta-ribofuranoside pyrimidin-2-one beta-ribofuranoside: RN given refers to (D)-isomer; structure | 2.04 | 1 | 0 | pyrimidine ribonucleosides | |
| foxes Foxes: Any of several carnivores in the family CANIDAE, that possess erect ears and long bushy tails and are smaller than WOLVES. They are classified in several genera and found on all continents except Antarctica. | 2.73 | 3 | 0 | ||
| kemptide [no description available] | 2.25 | 1 | 0 | ||
| combretastatin combretastatin: cytotoxic principle from South African tree COMBRETUM caffrum; structure given in first source; acts at COLCHICINE site of TUBULIN | 3.17 | 1 | 0 | ||
| 2'-fluoro-2'-deoxyadenosine [no description available] | 2.36 | 2 | 0 | ||
| saframycin a saframycin A: structure given in first source | 2.39 | 2 | 0 | ||
| n-hydroxysuccinimide suberic acid ester disuccinimidyl suberate: used as protein cross-linking agent | 2.74 | 3 | 0 | ||
| 2'-fluoro-2'-deoxycytidine [no description available] | 2.15 | 1 | 0 | ||
| 3'-uridylic acid 3'-uridylic acid: structure in first source; main heading URIDINE MONOPHOSPHATE refers to 5'-uridylic acid. 3'-UMP : A pyrimidine ribonucleoside 3'-monophosphate having uracil as the nucleobase. | 7.65 | 3 | 0 | pyrimidine ribonucleoside 3'-monophosphate; uridine phosphate | Escherichia coli metabolite |
| 2'-o-methyluridine [no description available] | 2.1 | 1 | 0 | methyluridine | |
| 2'-o-methyladenosine cordysinin B : A member of the class of adenosines that is adenosine in which the hydroxy group at position 2' is replaced by a methoxy group. It has been isolated from the mycelia of Cordyceps sinensis. | 2.91 | 4 | 0 | adenosines; ether | fungal metabolite |
| uridine monophosphate-uridine uridine monophosphate-uridine: dinucleoside monophosphate | 2.08 | 1 | 0 | nucleobase-containing molecular entity | |
| deoxy-5-methylcytidylic acid 2'-deoxy-5-methyl-5'-cytidylic acid : A pyrimidine 2'-deoxyribonucleoside 5'-monophosphate having 5-methylcytidine as the nucleobase. | 2.01 | 1 | 0 | 2'-deoxycytidine phosphate; pyrimidine 2'-deoxyribonucleoside 5'-monophosphate | |
| 1,2-distearoylphosphatidylethanolamine 1,2-distearoylphosphatidylethanolamine: RN given refers to cpd without isomeric designation. 1,2-distearoylphosphatidylethanolamine : A phosphatidylethanolamine in which the phosphatidyl acyl group at C-1 and C-2 is stearoyl. | 2.8 | 3 | 0 | phosphatidylethanolamine zwitterion; phosphatidylethanolamine | human metabolite |
| cobalt Cobalt: A trace element that is a component of vitamin B12. It has the atomic symbol Co, atomic number 27, and atomic weight 58.93. It is used in nuclear weapons, alloys, and pigments. Deficiency in animals leads to anemia; its excess in humans can lead to erythrocytosis.. cobalt(1+) : A monovalent inorganic cation obtained from cobalt.. cobalt atom : A cobalt group element atom that has atomic number 27. | 9.65 | 27 | 0 | cobalt group element atom; metal allergen | micronutrient |
| fulvestrant Fulvestrant: An estradiol derivative and estrogen receptor antagonist that is used for the treatment of estrogen receptor-positive, locally advanced or metastatic breast cancer.. fulvestrant : A 3-hydroxy steroid that is 17beta-estradiol in which the 7alpha hydrogen has been replaced by a nonyl group in which one of the hydrogens of the terminal methyl has been replaced by a (4,4,5,5,5-pentafluoropentyl)sulfinyl group. An estrogen receptor antagonist, it is used in the treatment of breast cancer. | 2.72 | 3 | 0 | 17beta-hydroxy steroid; 3-hydroxy steroid; organofluorine compound; sulfoxide | antineoplastic agent; estrogen antagonist; estrogen receptor antagonist |
| hydrogen sulfite [no description available] | 3.71 | 9 | 0 | sulfur oxoanion | human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| 1,2-bis(2-aminophenoxy)ethane-n,n,n',n'-tetraacetic acid 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid: structure in first source | 2.74 | 3 | 0 | polyamino carboxylic acid; tetracarboxylic acid | chelator |
| aflatoxin b1-2,3-oxide [no description available] | 2.45 | 2 | 0 | aflatoxin | human metabolite |
| yttrium radioisotopes Yttrium Radioisotopes: Unstable isotopes of yttrium that decay or disintegrate emitting radiation. Y atoms with atomic weights 82-88 and 90-96 are radioactive yttrium isotopes. | 2.94 | 4 | 0 | ||
| monocrotaline pyrrole monocrotaline pyrrole: RN given refers to (13alpha,14alpha)-isomer | 2.02 | 1 | 0 | ||
| enkephalin, d-penicillamine (2,5)- Enkephalin, D-Penicillamine (2,5)-: A disulfide opioid pentapeptide that selectively binds to the DELTA OPIOID RECEPTOR. It possesses antinociceptive activity.. DPDPE : A heterodetic cyclic peptide that is a cyclic enkephalin analogue, having D-penicillaminyl residues located at positions 2 and 5, which form the heterocycle via a disulfide bond. | 1.99 | 1 | 0 | heterodetic cyclic peptide | delta-opioid receptor agonist |
| u 73122 1-(6-((3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-2,5-dione: structure given in first source. U-73122 : An aza-steroid that is 3-O-methyl-17beta-estradiol in which the 17beta-hydroxy group is replaced by a 6-(maleimid-1-yl)hexylamino group. An inibitor of phospholipase C. | 2.43 | 2 | 0 | aromatic ether; aza-steroid; maleimides | EC 3.1.4.11 (phosphoinositide phospholipase C) inhibitor |
| arginyl-glycyl-aspartic acid arginyl-glycyl-aspartic acid: amino acid sequence of basic unit of widespread cellular recognition system | 4.85 | 10 | 0 | oligopeptide | |
| vitamin b 6 Vitamin B 6: VITAMIN B 6 refers to several PICOLINES (especially PYRIDOXINE; PYRIDOXAL; & PYRIDOXAMINE) that are efficiently converted by the body to PYRIDOXAL PHOSPHATE which is a coenzyme for synthesis of amino acids, neurotransmitters (serotonin, norepinephrine), sphingolipids, and aminolevulinic acid. During transamination of amino acids, pyridoxal phosphate is transiently converted into PYRIDOXAMINE phosphate. Although pyridoxine and Vitamin B 6 are still frequently used as synonyms, especially by medical researchers, this practice is erroneous and sometimes misleading (EE Snell; Ann NY Acad Sci, vol 585 pg 1, 1990). Most of vitamin B6 is eventually degraded to PYRIDOXIC ACID and excreted in the urine. | 2.44 | 2 | 0 | ||
| hydroxymethyltrioxsalen [no description available] | 2.68 | 3 | 0 | ||
| laurdan laurdan: RN from CA Index Guide | 2 | 1 | 0 | ||
| 1,n(6)-ethenoadenine 1,N(6)-ethenoadenine: biologically active fluorescent derivatives of this cpd potentially valuable in studies concerning interactions between adenine cpds & various enzymes for which they serve as substrates or co-factors; structure | 8.62 | 9 | 0 | imidazo[2,1-i]purine | mutagen |
| paxilline paxilline: structure given in first source; RN given refers to (2R-(2alpha,4bbeta,6aalpha,12bbeta,12calpha,14abeta))-isomer. paxilline : An indole diterpene alkaloid with formula C27H33NO4 isolated from Penicillium paxilli. It is a potent inhibitor of large conductance Ca2(+)- and voltage-activated K(+) (BK)-type channels. | 2.43 | 2 | 0 | diterpene alkaloid; enone; organic heterohexacyclic compound; terpenoid indole alkaloid; tertiary alcohol | anticonvulsant; Aspergillus metabolite; EC 3.6.3.8 (Ca(2+)-transporting ATPase) inhibitor; genotoxin; geroprotector; mycotoxin; Penicillium metabolite; potassium channel blocker |
| prolinedithiocarbamate prolinedithiocarbamate: do not confuse with pyrrolidine dithiocarbamate which is also abbreviated PDTC | 2.44 | 2 | 0 | ||
| beauvericin beauvericin: 18-membered cyclodepsipeptides. beauvericin : A trimeric cyclodepsipeptide composed from alternating methylphenylalanyl and hydroxyvaleryl residues. | 6.99 | 1 | 0 | ||
| fructose 2,6-diphosphate fructose 2,6-diphosphate: phosphofructokinase activator synthesized via Mg-ATP & fructose-6-P. beta-D-fructofuranose 2,6-bisphosphate : A D-fructofuranose 2,6-bisphosphate with a beta-configuration at the anomeric centre. | 2.02 | 1 | 0 | D-fructofuranose 2,6-bisphosphate | human metabolite; mouse metabolite |
| cyanates Cyanates: Organic salts of cyanic acid containing the -OCN radical.. cyanates : Salts and esters of cyanic acid, HOC#N; compounds carrying the cyanate functional group -O-C#N.. isocyanates : Organonitrogen compounds that are derivatives of isocyanic acid; compounds containing the isocyanate functional group -N=C=O (as opposed to the cyanate group, -O-C#N). | 3.48 | 8 | 0 | ||
| 3,4-dihydroxypyridine 3-hydroxy-4(1H)-pyridone: structure in first source | 2.05 | 1 | 0 | 4-pyridones; dihydroxypyridine | |
| 1,n(6)-ethenodeoxyadenosine [no description available] | 2.05 | 1 | 0 | purines | |
| 3-((3-cholamidopropyl)dimethylammonium)-1-propanesulfonate 3-((3-cholamidopropyl)dimethylammonium)-1-propanesulfonate: a surfactant; structure given in first source | 2 | 1 | 0 | 1,1-diunsubstituted alkanesulfonate | |
| aminomethyltrioxsalen [no description available] | 1.97 | 1 | 0 | ||
| 22-hydroxycholesterol [no description available] | 2.02 | 1 | 0 | cholanoid | |
| inositol 1-phosphate 1D-myo-inositol 1-phosphate : An inositol having myo- configuration substituted at position 1 by a phosphate group. | 1.98 | 1 | 0 | ||
| arginyl-glycyl-aspartyl-serine arginyl-glycyl-aspartyl-serine: corresponds to cell attachment site of fibronectin; located near carboxyl-terminal region of alpha-chain of fibrinogen; inhibits platelet aggregation & fibrinogen binding to activated platelets | 2.01 | 1 | 0 | ||
| beta-hydroxyvaleric acid 3-hydroxypentanoic acid : A short-chain fatty acid that is valeric acid in which one of the methylene hydrogens at position 3 has been replaced by a hydroxy group. | 2.07 | 1 | 0 | 3-hydroxy fatty acid; ketone body; short-chain fatty acid | |
| chlorodiethylenetriamine platinum chlorodiethylenetriamine platinum: RN given refers to parent cpd; structure | 2 | 1 | 0 | ||
| 1,n(2)-propanodeoxyguanosine 1,N(2)-propanodeoxyguanosine: structure & RN given in first source | 2.03 | 1 | 0 | carbohydrate derivative; nucleobase-containing molecular entity | |
| procyanidin Proanthocyanidins: Dimers and oligomers of flavan-3-ol units (CATECHIN analogs) linked mainly through C4 to C8 bonds to leucoanthocyanidins. They are structurally similar to ANTHOCYANINS but are the result of a different fork in biosynthetic pathways. | 2.1 | 1 | 0 | proanthocyanidin | |
| phosphites Phosphites: Inorganic salts or organic esters of phosphorous acid that contain the (3-)PO3 radical. (From Grant & Hackh's Chemical Dictionary, 5th ed). phosphite(3-) : A trivalent inorganic anion obtained by removal of all three protons from phosphorous acid. | 6.11 | 16 | 0 | phosphite ion; trivalent inorganic anion | |
| 2'-5'-oligoadenylate trimer 2',5'-oligoadenylate: inhibits protein synthesis in cell-free systems | 8.06 | 127 | 0 | ||
| (2-(trimethylammonium)ethyl)methanethiosulfonate (2-(trimethylammonium)ethyl)methanethiosulfonate: RN given for bromide; used in dopamine analysis | 2.43 | 2 | 0 | ||
| cobaltiprotoporphyrin cobaltiprotoporphyrin: RN given refers to cobalt protoporphyrin IX | 2.03 | 1 | 0 | ||
| parthenolide [no description available] | 2.02 | 1 | 0 | germacranolide | |
| ecteinascidin 743 [no description available] | 5.74 | 6 | 0 | acetate ester; azaspiro compound; bridged compound; hemiaminal; isoquinoline alkaloid; lactone; organic heteropolycyclic compound; organic sulfide; oxaspiro compound; polyphenol; tertiary amino compound | alkylating agent; angiogenesis modulating agent; anti-inflammatory agent; antineoplastic agent; marine metabolite |
| 1-hexadecyl-2-acetyl-glycero-3-phosphocholine Platelet Activating Factor: A phospholipid derivative formed by PLATELETS; BASOPHILS; NEUTROPHILS; MONOCYTES; and MACROPHAGES. It is a potent platelet aggregating agent and inducer of systemic anaphylactic symptoms, including HYPOTENSION; THROMBOCYTOPENIA; NEUTROPENIA; and BRONCHOCONSTRICTION.. 2-O-acetyl-1-O-hexadecyl-sn-glycero-3-phosphocholine : A 2-acetyl-1-alkyl-sn-glycero-3-phosphocholine betaine which has hexadecyl as the alkyl group. PAF is a potent phospholipid activator and mediator of many leukocyte functions, including platelet aggregation, inflammation, and anaphylaxis. | 2.7 | 3 | 0 | 2-acetyl-1-alkyl-sn-glycero-3-phosphocholine | antihypertensive agent; beta-adrenergic antagonist; bronchoconstrictor agent; hematologic agent; vasodilator agent |
| aristolochic acid ii aristolochic acid II: structure given in first source. aristolochic acid B : An aristolochic acid that is phenanthrene-1-carboxylic acid substituted by a methylenedioxy group at the 3,4 positions and by a nitro group at position 10. | 2.03 | 1 | 0 | aristolochic acids; aromatic ether; C-nitro compound; cyclic acetal; monocarboxylic acid; organic heterotetracyclic compound | carcinogenic agent; metabolite; mutagen; nephrotoxin; toxin |
| 1,2-epoxy-3,4-dihydroxy-1,2,3,4-tetrahydrobenzo(c)phenanthrene 1,2-epoxy-3,4-dihydroxy-1,2,3,4-tetrahydrobenzo(c)phenanthrene: RN given refers to compound with no isomeric designation; do not confuse with the tetrahydrobenz(a)anthracene analog | 2.7 | 3 | 0 | ||
| 3,4-epoxybutane-1,2-diol 3,4-epoxybutane-1,2-diol: a butadiene metabolite | 2 | 1 | 0 | ||
| deoxyglucose Deoxyglucose: 2-Deoxy-D-arabino-hexose. An antimetabolite of glucose with antiviral activity.. deoxyglucose : A deoxyhexose comprising glucose having at least one hydroxy group replaced by hydrogen. | 2.66 | 3 | 0 | ||
| anecortave acetate anecortave acetate: derived from cortisone (11 OH replaced by 9-11 double bond) | 2.02 | 1 | 0 | organic molecular entity | |
| 1-phenyl-2-decanoylamino-3-morpholino-1-propanol RV 538: noninactivating inhibitor of ceramide-UDPG glucosyltransferase; RN given for unspecified HCl; structure given in first source | 2.05 | 1 | 0 | ||
| valerates Valerates: Derivatives of valeric acid, including its salts and esters. | 2.39 | 2 | 0 | short-chain fatty acid anion; straight-chain saturated fatty acid anion | plant metabolite |
| monobromobimane monobromobimane: fluorescent when reacted with thiol group; RN & N1 from CA Vol 91 Form Index; inhibits platelet calcium-dependent protease activity & the ability of dibucaine-stimulated platelets to support factor X activation; structure in first source. monobromobimane : A pyrazolopyrazole that consists of 1H,7H-pyrazolo[1,2-a]pyrazole-1,7-dione bearing three methyl substituents at positions 2, 5 and 6 as well as a bromomethyl substituent at the 3-position. | 1.99 | 1 | 0 | organobromine compound; pyrazolopyrazole | fluorochrome |
| dodecyl-beta-d-maltoside dodecyl beta-D-maltoside : A glycoside resulting from attachment of a dodecyl group to the reducing-end anomeric centre of a beta-maltose molecule. | 2.03 | 1 | 0 | disaccharide derivative; glycoside | detergent |
| 6-methyl-1,3,8-trichlorodibenzofuran 6-methyl-1,3,8-trichlorodibenzofuran: structure given in first source | 2.41 | 2 | 0 | ||
| 4,6-diamino-5-n-formamidopyrimidine 4,6-diamino-5-N-formamidopyrimidine: formed when adenine is exposed to ionizing radiation. 4,6-diamino-5-formamidopyrimidine : A member of the class of aminopyrimidines that is 4,6-diaminopyrimidine bearing an additional formamido substituent at position 5. A DNA lesion formed when DNA exposed to ionising radiation. | 3.01 | 4 | 0 | aminopyrimidine; formamidopyrimidine | |
| dynemicin a [no description available] | 1.97 | 1 | 0 | ||
| fe(ii)-edta Fe(II)-EDTA: RN given refers to parent cpd | 2.41 | 2 | 0 | iron coordination entity | |
| thymidine c5-hydrate thymidine C5-hydrate: structure in first source | 2.4 | 2 | 0 | ||
| 3beta-(n-(n',n'-dimethylaminoethane)carbamoyl)cholesterol 3-(N-(N',N'-dimethylaminoethane)carbamoyl)cholesterol: used to prepare sonicated liposomes | 2.69 | 3 | 0 | ||
| sc 58125 1-((4-methylsulfonyl)phenyl)-3-trifluoromethyl-5-(4-fluorophenyl)pyrazole: a COX-2 inhibitor | 2.03 | 1 | 0 | organofluorine compound; pyrazoles; sulfone | antineoplastic agent; cyclooxygenase 2 inhibitor |
| duocarmycin sa duocarmycin SA: structure similar to CC-1065 and yatakemycin, composed of a pyrrolo-indole plus an indole; isolated from Streptomyces | 2.42 | 2 | 0 | ||
| glyceraldehyde 3-phosphate dehydrogenase (304-313) glyceraldehyde 3-phosphate dehydrogenase (304-313): from Bacillus stearothermophilus | 2.02 | 1 | 0 | ||
| chymosin Chymosin: The predominant milk-clotting enzyme from the true stomach or abomasum of the suckling calf. It is secreted as an inactive precursor called prorennin and converted in the acid environment of the stomach to the active enzyme. EC 3.4.23.4. | 1.96 | 1 | 0 | ||
| 5-methoxymethyl-2'-deoxyuridine 5-methoxymethyl-2'-deoxyuridine: used in treatment of experimental herpes simplex keratitis | 1.98 | 1 | 0 | ||
| thiodigalactoside thiodigalactoside: RN given refers to beta-D-galactopyranoside (D-Gal)-isomer | 2.02 | 1 | 0 | ||
| clofarabine [no description available] | 4.14 | 3 | 1 | adenosines; organofluorine compound | antimetabolite; antineoplastic agent |
| caprylates Caprylates: Derivatives of caprylic acid. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain a carboxy terminated eight carbon aliphatic structure.. octanoate : A straight-chain saturated fatty acid anion that is the conjugate base of octanoic acid (caprylic acid); believed to block adipogenesis. | 2.74 | 3 | 0 | fatty acid anion 8:0; straight-chain saturated fatty acid anion | human metabolite; Saccharomyces cerevisiae metabolite |
| tris(2-carboxyethyl)phosphine tris(2-carboxyethyl)phosphine: water-soluble reagent which irreversibly reduces disulfides to thiols at room temperature & is active below neutral pH; used for quantitation of iodine and iodate. TCEP : A tertiary phosphine in which phosphane is substituted with three 2-carboxyethyl groups. It is a commonly used reducing agent. | 2.95 | 4 | 0 | phosphine derivative; tricarboxylic acid | reducing agent |
| lexitropsin lexitropsin: structure given in first source; information reading oligopeptide | 2.68 | 3 | 0 | ||
| 1,4,7,10-tetraazacyclododecane- 1,4,7,10-tetraacetic acid 1,4,7,10-tetraazacyclododecane- 1,4,7,10-tetraacetic acid: structure given in first source. DOTA : An azamacrocyle in which four nitrogen atoms at positions 1, 4, 7 and 10 of a twelve-membered ring are each substituted with a carboxymethyl group. | 4.06 | 4 | 0 | azamacrocycle | chelator; copper chelator |
| lacto-n-neotetraose lacto-N-neotetraose: binds human cold agglutinin | 2.06 | 1 | 0 | ||
| gadolinium 1,4,7,10-tetraazacyclododecane-n,n',n'',n'''-tetraacetate gadolinium 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetate: RN refers to Na salt | 2.52 | 2 | 0 | ||
| (3-dimyristyloxypropyl)(dimethyl)(hydroxyethyl)ammonium (3-dimyristyloxypropyl)(dimethyl)(hydroxyethyl)ammonium: a cationic lipid; RN refers to bromide salt | 2.01 | 1 | 0 | ||
| magnesium pyrophosphate magnesium pyrophosphate: RN given refers to parent cpd (2:1) | 2.13 | 1 | 0 | ||
| florox reagent Florox Reagent: reagent for analysis of ketosteroids; structure | 2.01 | 1 | 0 | ||
| inositol cyclic phosphate inositol cyclic phosphate: RN given refers to cpd without isomeric designation. 1D-myo-inositol 1,2-cyclic phosphate : A myo-inositol cyclic phosphate that is the 1,2-cyclic phosphate derivative of 1D-myo-inositol. | 2.38 | 2 | 0 | myo-inositol cyclic phosphate | epitope |
| 1-ethyl-3-(3-dimethylaminoethyl)carbodiimide 1-ethyl-3-(3-dimethylaminoethyl)carbodiimide: carboxyl modifying agent | 2.68 | 3 | 0 | ||
| adenylyl-(2'-5')-adenylyl-(2'-5')adenosine adenylyl-(2'-5')-adenylyl-(2'-5')adenosine: inhibits protein synthesis in intact mouse lymphocytes, hepatocytes & bone marrow cells | 1.96 | 1 | 0 | ||
| celastrol [no description available] | 2.6 | 1 | 0 | monocarboxylic acid; pentacyclic triterpenoid | anti-inflammatory drug; antineoplastic agent; antioxidant; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; Hsp90 inhibitor; metabolite |
| stannane [no description available] | 2.1 | 1 | 0 | mononuclear parent hydride; tin hydride | |
| carbene carbene: electrically neutral species H2C: and its derivatives, in which the carbon is covalently bonded to two univalent groups of any kind or a divalent group and bears two nonbonding electrons; carbene is the name of the parent hydride :CH2 ; hence, the name dichlorocarbene for :CCl2. However, names for acyclic and cyclic hydrocarbons containing one or more divalent carbon atoms are derived from the name of the corresponding all-4-hydrocarbon using the suffix -ylidene; methylene carbene also available. carbene : The electrically neutral species H2C(2.) and its derivatives, in which the carbon is covalently bonded to two univalent groups of any kind or a divalent group and bears two nonbonding electrons, which may be spin-paired (singlet state) or spin-non-paired (triplet state). | 7.48 | 2 | 0 | carbene; methanediyl | |
| cyclopropene cyclopropene: structure. cyclopropene : A cycloalkene that consists of cyclopropane having a double bond in the ring. The parent of the class of cyclopropenes. | 7.63 | 2 | 0 | cycloalkene; cyclopropenes | |
| phosphoramide phosphoramide: RN given refers to triamide. phosphoramide : A compound in which one or more of the OH groups of phosphoric acid have been replaced with an amino or substituted amino group. The term is commonly confined to the phosphoric triamides, P(=O)(NR2)3, since replacement of one or two OH groups produces phosphoramidic acids: P(=O)(OH)(NR2)2 , P(=O)(OH)2(NR2). | 2.94 | 4 | 0 | ||
| peroxynitrous acid Peroxynitrous Acid: A potent oxidant synthesized by the cell during its normal metabolism. Peroxynitrite is formed from the reaction of two free radicals, NITRIC OXIDE and the superoxide anion (SUPEROXIDES). | 2.72 | 3 | 0 | nitrogen oxoacid | |
| fullerene c60 Fullerenes: A polyhedral CARBON structure composed of around 60-80 carbon atoms in pentagon and hexagon configuration. They are named after Buckminster Fuller because of structural resemblance to geodesic domes. Fullerenes can be made in high temperature such as arc discharge in an inert atmosphere.. fullerene : A compound composed solely of an even number of carbon atoms, which form a cage-like fused-ring polycyclic system with twelve five-membered rings and the rest six-membered rings. The term has been broadened to include any closed cage structure consisting entirely of three-coordinate carbon atoms. | 3.06 | 4 | 0 | fullerene | geroprotector |
| imatinib mesylate imatinib methanesulfonate : A methanesulfonate (mesylate) salt that is the monomesylate salt of imatinib. Used for treatment of chronic myelogenous leukemia and gastrointestinal stromal tumours. | 10.46 | 14 | 3 | methanesulfonate salt | anticoronaviral agent; antineoplastic agent; apoptosis inducer; tyrosine kinase inhibitor |
| gefitinib [no description available] | 5.38 | 7 | 0 | aromatic ether; monochlorobenzenes; monofluorobenzenes; morpholines; quinazolines; secondary amino compound; tertiary amino compound | antineoplastic agent; epidermal growth factor receptor antagonist |
| chromozym th chromozym TH: synthetic substrate for thrombin which acts on it to liberate p-nitroaniline (yellow color) | 2.05 | 1 | 0 | ||
| (3,4-dihydroxyphenylamino)-2-imidazoline (3,4-dihydroxyphenylamino)-2-imidazoline: potent agonist at dopamine receptors mediating neuronal inhibition; RN given refers to parent cpd; structure in UD indicates phenyl-imino group | 3.11 | 1 | 0 | ||
| 4-carboxyfluorescein [no description available] | 2.46 | 2 | 0 | monocarboxylic acid | fluorochrome |
| n,n',n''-triacetylchitotriose N,N',N''-triacetylchitotriose: used for affinity chromatography of potato lectin when coupled to Sepharose; structure | 2 | 1 | 0 | N-acyl-hexosamine | |
| acth (4-10) ACTH (4-10): part of ACTH molecule containing amino acids 4-10 of total 39 amino acid chain; heptapeptide common to MSH & ACTH; RN given refers to glycine cpd | 1.96 | 1 | 0 | ||
| technetium tc 99m hydroxymethylene diphosphonate technetium Tc 99m hydroxymethylene diphosphonate: bone-seeking radiopharmaceutical | 2.25 | 1 | 0 | ||
| 5,5'-bis(8-(phenylamino)-1-naphthalenesulfonate) [no description available] | 2.02 | 1 | 0 | ||
| 5-iodoacetamidofluorescein [no description available] | 2 | 1 | 0 | ||
| n-acetylglucosaminylasparagine N-acetylglucosaminylasparagine: RN given refers to parent cpd; presence in urine characteristic of aspartylglucosaminuria; structure. N(4)-(beta-N-acetyl-D-glucosaminyl)-L-asparagine : An N(4)-glycosyl-L-asparagine having (beta-N-acetyl-D-glucosaminyl as the glycosyl component. | 1.98 | 1 | 0 | amino acid zwitterion; glucosaminylamine; N(4)-glycosyl-L-asparagine | |
| antibiotic g 418 antibiotic G 418: from Micromonospora rhodorangea | 2.71 | 3 | 0 | ||
| 1-((3,5-dichloro)-2,6-dihydroxy-4-methoxyphenyl)-1-hexanone 1-((3,5-dichloro)-2,6-dihydroxy-4-methoxyphenyl)-1-hexanone: structure given in first source. 1-(3,5-dichloro-2,6-dihydroxy-4-methoxyphenyl)hexan-1-one : A differentiation-inducing factor that is hexaphenone bearing two chloro substituents at positions 3 and 5, two hydroxy substituents at positions 2 and 6 as well as a single methoxy substituent at position 4. A secreted, chlorinated molecule that controls cell fate during development of Dictyostelium cells. | 4.87 | 11 | 0 | dichlorobenzene; differentiation-inducing factor; monomethoxybenzene; resorcinols | eukaryotic metabolite; signalling molecule |
| 3,3'-dithiobis(sulfosuccinimidyl propionate) 3,3'-dithiobis(sulfosuccinimidyl propionate): structure given in first source | 1.99 | 1 | 0 | ||
| vadimezan vadimezan : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens is replaced by a 5,6-dimethyl-9-oxoxanthen-4-yl group. | 3.14 | 1 | 0 | monocarboxylic acid; xanthones | antineoplastic agent |
| desloratadine desloratadine: major metabolite of loratadine. desloratadine : Loratadine in which the ethoxycarbonyl group attached to the piperidine ring is replaced by hydrogen. The major metabolite of loratidine, desloratadine is an antihistamine which is used for the symptomatic relief of allergic conditions including rhinitis and chronic urticaria. It does not readily enter the central nervous system, so does not cause drowsiness. | 2.17 | 1 | 0 | benzocycloheptapyridine | anti-allergic agent; cholinergic antagonist; drug metabolite; H1-receptor antagonist |
| ferric bleomycin iron bleomycin: iron-bleomycin complexes | 3.24 | 6 | 0 | ||
| 5-((glucopyranosyloxy)methyl)uracil 5-((glucopyranosyloxy)methyl)uracil: a base found in the DNA of Trypanosoma brucei | 2.01 | 1 | 0 | ||
| 1,(n2)-ethenoguanine 1,(N2)-ethenoguanine: formed from 2-halooxiranes; structure given in first source. 1,N(2)-ethenoguanine : A nucleobase analogue obtained by addition of an etheno group across positions 1 and N2 of guanine. | 2.72 | 3 | 0 | imidazopurine; nucleobase analogue | |
| 1,4,7-triazacyclononane-n,n',n''-triacetic acid 1,4,7-triazacyclononane-N,N',N''-triacetic acid: structure given in first source | 2.13 | 1 | 0 | ||
| benzotriazol-1-yloxy-tris(dimethylamino)phosphonium benzotriazol-1-yloxy-tris(dimethylamino)phosphonium: condensing agent to promote internucleotide bond formation in phosphotriester oligodeoxyribonucleotide synthesis; structure in first source | 1.95 | 1 | 0 | ||
| pseudoisocytidine pseudoisocytidine: RN given refers to parent cpd; structure | 2.03 | 1 | 0 | ||
| 1,2-dideoxyribofuranose 1,2-dideoxyribofuranose: structure given in first source | 2.92 | 4 | 0 | ||
| 6-methoxypurine arabinoside [no description available] | 1.97 | 1 | 0 | ||
| solutol hs 15 Solutol HS 15: multidrug resistance modification agent in tumor cells; polyoxyethylene esters of 12-hydroxystearic acid; previous RN 105109-85-1 | 2.08 | 1 | 0 | aliphatic alcohol | |
| 3-amino-2-hydroxy-4-phenylbutanoic acid [no description available] | 2 | 1 | 0 | ||
| 8-oxo-dado 2'-deoxy-7,8-dihydro-8-oxoadenosine: structure given in first source | 2.75 | 3 | 0 | ||
| glycerophosphoinositol 4,5-bisphosphate glycerophosphoinositol 4,5-bisphosphate: do not confuse with phosphatidylinositols which have fatty acids esterified at the C-1 and C-2 hydroxyl groups of glycerol | 2.01 | 1 | 0 | ||
| n-(4-carboxycyclohexylmethyl)maleimide n-hydroxysuccinimide ester N-(4-carboxycyclohexylmethyl)maleimide N-hydroxysuccinimide ester: used in the preparation of rabbit Fab'-peroxidase conjugates. succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate : An N-hydroxysuccinimide ester derived from 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid. | 2.11 | 1 | 0 | maleimides; N-hydroxysuccinimide ester | |
| adenosine triphosphate adenosine monophosphate adenosine monophosphate adenosine triphosphate adenosine monophosphate adenosine monophosphate: see also 2',5'-oligoadenylate | 3.46 | 8 | 0 | ||
| 10-(2-hydroxyethyl)phenazine 10-(2-hydroxyethyl)phenazine: structure given in first source | 1.98 | 1 | 0 | ||
| methotrexate [no description available] | 3.41 | 7 | 0 | dicarboxylic acid; monocarboxylic acid amide; pteridines | abortifacient; antimetabolite; antineoplastic agent; antirheumatic drug; dermatologic drug; DNA synthesis inhibitor; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; immunosuppressive agent |
| guanidinopropylsuccinic acid [no description available] | 2.07 | 1 | 0 | ||
| 4-maleimidophenyl isocyanate 4-maleimidophenyl isocyanate: structure given in first source | 2.45 | 2 | 0 | ||
| bis-benzimidazole bis-benzimidazole: in vitro inhibitor of arenavirus synthesis; studied in treatment of lymphocytic choriomeningitis virus infections; also used as its di-HCl salt, A37536; RN given refers to parent cpd with unspecified isomeric designation; structure | 2.01 | 1 | 0 | ||
| 1,n(2)-ethenodeoxyguanosine [no description available] | 2.42 | 2 | 0 | ||
| kifunensine kifunensine: inhibitor of the glycoprotein processing mannosidase I; from actinomycete Kitasatosporia kifunense 9482; structure given in first source; RN given refers to (5R-(5alpha,6beta,7alpha,8alpha,8aalpha))-isomer; RN for cpd without isomeric designation not avail 10/90 | 2.01 | 1 | 0 | ||
| 2'-methyl-2'-deoxycytidine 2'-methyl-2'-deoxycytidine: structure given in first source | 2.15 | 1 | 0 | ||
| picrocrocin picrocrocin: a glucoside of safranal; a bitter-tasting substance; structure given in first source. picrocrocin : A beta-D-glucoside of beta-cyclocitral; the precursor of safranal. It is the compound most responsible for the bitter taste of saffron. | 7.04 | 1 | 0 | beta-D-glucoside | |
| 4-diethoxyphosphorylmethyl-n-(4-bromo-2-cyanophenyl)benzamide 4-diethoxyphosphorylmethyl-N-(4-bromo-2-cyanophenyl)benzamide: increases lipoprotein lipase activity with resulting elevation of high density lipoprotein cholesterol | 2.02 | 1 | 0 | ||
| 3-methoxy-7h-8-methyl-11-((3'-amino)propylamino)benzo(e)pyrido(4,3-b)indole 3-methoxy-7H-8-methyl-11-((3'-amino)propylamino)benzo(e)pyrido(4,3-b)indole: a benzo(e)pyridoindole derivative | 2.92 | 4 | 0 | ||
| l 696040 L 696040: structure given in first source | 1.97 | 1 | 0 | ||
| 5-formylcytidine 5-formylcytidine: found at the first position of the anticodon of methionine tRNA from bovine liver mitochondria; structure given in first source | 7.63 | 2 | 0 | ||
| omega-n-methylarginine omega-N-Methylarginine: A competitive inhibitor of nitric oxide synthetase.. N(omega)-methyl-L-arginine : A L-arginine derivative with a N(omega)-methyl substituent. | 2.01 | 1 | 0 | amino acid zwitterion; arginine derivative; guanidines; L-arginine derivative; non-proteinogenic L-alpha-amino acid | |
| zinquin zinquin: zinquin is an ethyl ester in second source; specific chelator for zinc(II) | 2.06 | 1 | 0 | ||
| n-(gamma-maleimidobutyryloxy)succinimide [no description available] | 2.02 | 1 | 0 | ||
| imidazolecarboxamide imidazolecarboxamide: RN given refers to parent cpd; see also related record for imidazole-4-carboxamide | 2.02 | 1 | 0 | ||
| 4-hydroxy-equilenin 4-hydroxy-equilenin: structure given in first source; is the major catechol metabolite of the equine estrogens EQUILENIN and EQUILIN; induces DNA damage | 2.73 | 3 | 0 | ||
| 1-(4-bromoacetamidobenzyl)edta 1-(4-bromoacetamidobenzyl)EDTA: bifunctional chelating agent. (S)-1-(4-bromoacetamidobenzyl)EDTA : A tetracarboxylic acid consisting of ethylenediaminetetraacetic acid having a 4-bromoacetamidobenzyl group at the C1-position and (S)-configuration. | 2 | 1 | 0 | tetracarboxylic acid | chelator |
| pixantrone pixantrone: an immunosuppressant; structure given in first source | 2.05 | 1 | 0 | isoquinolines | |
| carbapenems [no description available] | 2.15 | 1 | 0 | ||
| cycloastragenol [no description available] | 2.04 | 1 | 0 | ||
| cytidine 5'-phospho-2-methylimidazolide [no description available] | 2.66 | 3 | 0 | ||
| xylose xylopyranose: structure in first source | 3.25 | 6 | 0 | D-xylose | |
| cd 437 CD 437: selective for retinoic acid receptors gamma. CD437 : A naphthoic acid that is 6-phenylnaphthylene-2-carboxyic acid in which the phenyl substituent has been substituted at positions 3 and 4 by adamant-1-yl and hydroxy groups, respectively. It acts as a selective agonist of retinoic acid receptor (RAR)gamma and induces cell cycle arrest and apoptosis in various cancer cells. | 2.01 | 1 | 0 | adamantanes; monocarboxylic acid; naphthoic acid; phenols | apoptosis inducer; retinoic acid receptor gamma agonist |
| 3,4-diaminobenzophenone [no description available] | 2.44 | 2 | 0 | ||
| 3-(2'-deoxyribofuranosyl)pyrimido(1,2-a)purin-10(3h)-one 3-(2'-deoxyribofuranosyl)pyrimido(1,2-a)purin-10(3H)-one: a malondialdehyde-deoxyguanosine adduct; structure given in first source | 1.99 | 1 | 0 | ||
| quinone methide quinone methide: intermediate in eumelanin biosynthesis; structure given in first source. quinomethane : A methylidenecyclohexadienone, formally derived from a benzoquinone by replacement of one of the quinone oxygens by a methylidene group. | 2.78 | 3 | 0 | quinomethane | |
| beta-lactams 2-azetidinone: structure in first source. azetidin-2-one : An unsubstituted beta-lactam compound.. beta-lactam : A lactam in which the amide bond is contained within a four-membered ring, which includes the amide nitrogen and the carbonyl carbon. | 2 | 1 | 0 | beta-lactam antibiotic allergen; beta-lactam | |
| 1,3,5-triaza-7-phosphaadamantane 1,3,5-triaza-7-phosphaadamantane: structure in first source | 2.13 | 1 | 0 | ||
| phytol [no description available] | 2.08 | 1 | 0 | ||
| proline Proline: A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.. proline : An alpha-amino acid that is pyrrolidine bearing a carboxy substituent at position 2. | 5.49 | 21 | 0 | amino acid zwitterion; glutamine family amino acid; L-alpha-amino acid; proline; proteinogenic amino acid | algal metabolite; compatible osmolytes; Escherichia coli metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite |
| 3-nitropyrrole [no description available] | 2.41 | 2 | 0 | ||
| n-acetyltalosaminuronic acid N-acetyltalosaminuronic acid: partially comprises saccharide frame of pseudomurein; structure given in first source. N-acetyl-alpha-L-talosaminuronic acid : A carbohydrate acid derivative that is alpha-L-talosaminuronic acid in which the hydroxy group at position 2 is substituted by an acetamido group. | 2.41 | 1 | 0 | amino monosaccharide; carbohydrate acid derivative; hexuronic acid derivative | |
| bis(1,10-phenanthroline)copper(2+) ion bis(1,10-phenanthroline)copper(2+) ion: RN given refers to (Cu+2) cation | 2.37 | 2 | 0 | ||
| bis(phenanthroline)(phenanthrenequinone diimine)rhodium(iii) bis(phenanthroline)(phenanthrenequinone diimine)rhodium(III): structure given in first source; used to study folding of 5S rRNA | 2 | 1 | 0 | ||
| docetaxel anhydrous Docetaxel: A semisynthetic analog of PACLITAXEL used in the treatment of locally advanced or metastatic BREAST NEOPLASMS and NON-SMALL CELL LUNG CANCER.. docetaxel anhydrous : A tetracyclic diterpenoid that is paclitaxel with the N-benzyloxycarbonyl group replaced by N-tert-butoxycarbonyl, and the acetoxy group at position 10 replaced by a hydroxy group. | 8.08 | 12 | 5 | secondary alpha-hydroxy ketone; tetracyclic diterpenoid | antimalarial; antineoplastic agent; photosensitizing agent |
| dichlorotetrakis(dimethyl sulfoxide)ruthenium ii dichlorotetrakis(dimethyl sulfoxide)ruthenium II: RN given refers to parent cpd without isomeric designation, | 2 | 1 | 0 | ||
| ezetimibe Ezetimibe: An azetidine derivative and ANTICHOLESTEREMIC AGENT that inhibits intestinal STEROL absorption. It is used to reduce total CHOLESTEROL; LDL CHOLESTEROL, and APOLIPOPROTEINS B in the treatment of HYPERLIPIDEMIAS.. ezetimibe : A beta-lactam that is azetidin-2-one which is substituted at 1, 3, and 4 by p-fluorophenyl, 3-(p-fluorophenyl)-3-hydroxypropyl, and 4-hydroxyphenyl groups, respectively (the 3R,3'S,4S enantiomer). | 7.05 | 7 | 1 | azetidines; beta-lactam; organofluorine compound | anticholesteremic drug; antilipemic drug; antimetabolite |
| 2'fluoro-2'-deoxyuridine [no description available] | 1.98 | 1 | 0 | ||
| 2'-o-methylcytidine [no description available] | 2.1 | 1 | 0 | methylcytidine | |
| threonic acid threonic acid: RN given refers to (R*,S*)-isomer | 2.02 | 1 | 0 | threonic acid | |
| vatalanib [no description available] | 5.7 | 6 | 0 | monochlorobenzenes; phthalazines; pyridines; secondary amino compound | angiogenesis inhibitor; antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; vascular endothelial growth factor receptor antagonist |
| tyrosinamide tyrosinamide: RN given refers to (S)-isomer. L-tyrosinamide : An amino acid amide that is L-tyrosine in which the carboxy OH group is replaced by NH2. | 2.44 | 2 | 0 | amino acid amide; L-tyrosine derivative | |
| altritol altritol: structure given in first source. D-altritol : A hexitol that is hexane-1,2,3,4,5,6-hexol having (2R,3R,4S,5R) configuration; the D-enantiomer of altritol. | 2.95 | 4 | 0 | hexitol | algal metabolite; marine metabolite |
| sabarubicin sabarubicin: structure given in first source | 2.01 | 1 | 0 | ||
| phosphorodithioic acid dithiophosphoric acid : A phosphorothioic acid that is the phosphoric acid having two of its oxygen atoms replaced by sulfur atoms. | 5.22 | 15 | 0 | phosphorothioic acid | |
| n-(mercaptoacetyl)glycine [no description available] | 2.02 | 1 | 0 | ||
| iminoglutarate iminoglutarate: RN given is for the ion(2-) | 2.02 | 1 | 0 | ||
| 1-hydroxy-6-nitrobenzotriazole 1-hydroxy-6-nitrobenzotriazole: structure given in first source | 1.96 | 1 | 0 | ||
| moxifloxacin Moxifloxacin: A fluoroquinolone that acts as an inhibitor of DNA TOPOISOMERASE II and is used as a broad-spectrum antibacterial agent.. moxifloxacin : A quinolone that consists of 4-oxo-1,4-dihydroquinoline-3-carboxylic acid bearing a cyclopropyl substituent at position 1, a fluoro substitiuent at position 6, a (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl group at position 7 and a methoxy substituent at position 8. A member of the fluoroquinolone class of antibacterial agents. | 3.64 | 1 | 1 | aromatic ether; cyclopropanes; fluoroquinolone antibiotic; pyrrolidinopiperidine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone | antibacterial drug |
| 1-ethynylpyrene 1-ethynylpyrene: RN & structure given in first source; RN not in Chemline 12/84 | 2.72 | 3 | 0 | ||
| phorbols Phorbols: The parent alcohol of the tumor promoting compounds from CROTON OIL (Croton tiglium). | 2.06 | 1 | 0 | diterpene; terpenoid fundamental parent | |
| ly 311727 LY 311727: a potent & selective inhibitor of human non-pancreatic secretory phospholipase A2; structure given in first source | 1.99 | 1 | 0 | ||
| birb 796 [no description available] | 2.11 | 1 | 0 | aromatic ether; morpholines; naphthalenes; pyrazoles; ureas | EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; immunomodulator |
| hydroxyl radical Hydroxyl Radical: The univalent radical OH. Hydroxyl radical is a potent oxidizing agent. | 5.98 | 34 | 0 | oxygen hydride; oxygen radical; reactive oxygen species | |
| naphthalenediimide naphthalenediimide: structure in first source | 2.95 | 4 | 0 | ||
| gemcabene [no description available] | 3.69 | 2 | 0 | ||
| n-(2-(1-maleimidyl)ethyl)-7-(diethylamino)coumarin-3-carboxamide N-(2-(1-maleimidyl)ethyl)-7-(diethylamino)coumarin-3-carboxamide: structure given in first source | 2.02 | 1 | 0 | ||
| lead titanate zirconate [no description available] | 2.06 | 1 | 0 | ||
| resiquimod S 28463: structure given in first source | 2.25 | 1 | 0 | imidazoquinoline | |
| singlet oxygen Singlet Oxygen: An excited state of molecular oxygen generated photochemically or chemically. Singlet oxygen reacts with a variety of biological molecules such as NUCLEIC ACIDS; PROTEINS; and LIPIDS; causing oxidative damages. | 3.45 | 7 | 0 | chalcogen; monoatomic oxygen; nonmetal atom | macronutrient |
| dipyrandium dipyrandium: RN given is from CA online & refers to (3beta,17beta)-isomer; structure | 1.97 | 1 | 0 | ||
| fenton's reagent Fenton's reagent: used for oxidizing sugars & alcohols | 2.13 | 1 | 0 | ||
| 7,8-dihydroxy-9,10-epoxy-8-methyl-7,8,9,10-tetrahydrobenzo(a)pyrene 7,8-dihydroxy-9,10-epoxy-8-methyl-7,8,9,10-tetrahydrobenzo(a)pyrene: putative oxidized metabolite of 8-methylbenzo(a)pyrene; structure given in first source | 1.99 | 1 | 0 | ||
| carbodiimides Carbodiimides: Compounds with the general formula RN=C=NR, where R is a hydrocarbyl group.. methanediimine : A carbodiimide in which both nitrogens are unsubstituted. | 4.47 | 23 | 0 | carbodiimide | |
| inositol 2-monophosphate 1D-myo-inositol 2-phosphate : A myo-inositol monophosphate in which the phosphate group is located at the 2-position.. 1D-myo-inositol 5-phosphate : An inositol having myo- configuration substituted at position 5 by a phosphate group. | 1.98 | 1 | 0 | ||
| zirconium phosphate zirconium phosphate: reagent for carcinoembryonic antigen determination in plasma from patients having benign or malignant disease; RN given refers to cpd with unspecified ratio | 2.04 | 1 | 0 | ||
| zinc hematoporphyrin [no description available] | 2.05 | 1 | 0 | ||
| 2'-deoxythymidylyl-(3'-5')-2'-deoxyadenosine [no description available] | 2.73 | 3 | 0 | ||
| adenosine 5'-phosphoroimidazolide [no description available] | 2.89 | 4 | 0 | ||
| pyropheophorbide a pyropheophorbide a: RN given refers to (3S-trans)-isomer | 2.44 | 2 | 0 | ||
| 5-thyminyl-5,6-dihydrothymine 5-thyminyl-5,6-dihydrothymine: spore photoproduct from spore DNA | 4.25 | 5 | 0 | ||
| 2,4,5-trihydroxypentanoic acid gamma-lactone [no description available] | 3.72 | 10 | 0 | ribonolactone | metabolite |
| 4(n)-(2-chloroethyl-n-methylamino)benzylamine 4(N)-(2-chloroethyl-N-methylamino)benzylamine: structure in first source | 3.47 | 2 | 0 | ||
| 5'-o-dimethyltritylthymidine [no description available] | 2.66 | 3 | 0 | ||
| aminopotentidine aminopotentidine: structure given in first source; RN given refers to the oxalate. aminopotentidine : A benzamide obtained by formal condensation of the carboxy group of 4-aminobenzoic acid with the primary amino group of 1-(2-aminoethyl)-2-cyano-3-{3-[3-(piperidin-1-ylmethyl)phenoxy]propyl}guanidine. | 1.99 | 1 | 0 | aromatic ether; benzamides; guanidines; nitrile; piperidines; substituted aniline | H2-receptor antagonist |
| mevaldic acid mevaldic acid: RN given refers to cpd without isomeric designation; structure | 1.97 | 1 | 0 | 3-hydroxy monocarboxylic acid; 5-oxo monocarboxylic acid | |
| calcium pyrophosphate [no description available] | 2.39 | 2 | 0 | ||
| adenylyl-(3'-5')-uridine 3'-monophosphate [no description available] | 2.37 | 2 | 0 | ||
| 5,6-dihydrothymidine 5,6-dihydrothymidine: RN given refers to cpd without isomeric designation. 5,6-dihydrothymidine : A pyrimidine 2'-deoxyribonucleoside having dihydrothymine as the nucleobase. | 2.01 | 1 | 0 | pyrimidine 2'-deoxyribonucleoside | Mycoplasma genitalium metabolite |
| diadenosine triphosphate [no description available] | 2 | 1 | 0 | diadenosyl triphosphate | mouse metabolite |
| paromomycin Paromomycin: An aminoglycoside antibacterial and antiprotozoal agent produced by species of STREPTOMYCES.. paromomycin : An amino cyclitol glycoside that is the 1-O-(2-amino-2-deoxy-alpha-D-glucopyranoside) and the 3-O-(2,6-diamino-2,6-dideoxy-beta-L-idopyranosyl)-beta-D-ribofuranoside of 4,6-diamino-2,3-dihydroxycyclohexane (the 1R,2R,3S,4R,6S diastereoisomer). It is obtained from various Streptomyces species. A broad-spectrum antibiotic, it is used (generally as the sulfate salt) for the treatment of acute and chronic intestinal protozoal infections, but is not effective for extraintestinal protozoal infections. It is also used as a therapeutic against visceral leishmaniasis. | 3.52 | 8 | 0 | amino cyclitol glycoside; aminoglycoside antibiotic | anthelminthic drug; antibacterial drug; antiparasitic agent; antiprotozoal drug |
| metaperiodate metaperiodate: RN given refers to periodic acid, Na salt; structure. periodate : A monovalent inorganic anion obtained by deprotonation of periodic acid. | 4.37 | 6 | 0 | iodine oxoanion; monovalent inorganic anion | |
| thiophosphoric acid thiophosphoric acid: RN given refers to parent cpd | 5.45 | 11 | 0 | phosphorothioic acid | |
| 2'-deoxy-3'-adenosine monophosphate 2'-deoxy-3'-adenosine monophosphate: inhibitor of adenylate cyclase; see also record for 2',5' cpd. 2'-deoxyadenosine 3'-monophosphate : A 2'-deoxyadenosine phosphate having a monophosphate group located at the 3'-position. | 2 | 1 | 0 | 2'-deoxyadenosine phosphate; purine 2'-deoxyribonucleoside 3'-monophosphate | |
| vinylphosphonic acid [no description available] | 2.41 | 2 | 0 | ||
| deoxythymidylyl-3'-5'-deoxyadenylate [no description available] | 2.37 | 2 | 0 | ||
| adenosine 2',5'-diphosphate [no description available] | 1.97 | 1 | 0 | ||
| thymidylyl-(3'-5')-deoxycytidine 5'-d[TC]-3' : A single-strand DNA oligonucleotide consisting of a thymidine residue phospho-linked 3'->5' to a deoxycytidine residue (PDB entry: 2OK0). | 1.95 | 1 | 0 | single-stranded DNA oligonucleotide | |
| 5-hydroxymethyldeoxycytidine monophosphate 5-hydroxymethyl-2'-deoxycytidine: structure in first source | 2.06 | 1 | 0 | ||
| 1,2-diphytanoylphosphatidylcholine [no description available] | 2.17 | 1 | 0 | ||
| glycyl-prolyl-arginine [no description available] | 2.07 | 1 | 0 | oligopeptide | |
| biotin vitamin B7 : Any member of a group of vitamers that belong to the chemical structural class called biotins that exhibit biological activity against vitamin B7 deficiency. Vitamin B7 deficiency is very rare in individuals who take a normal balanced diet. Foods rich in biotin are egg yolk, liver, cereals, vegetables (spinach, mushrooms) and rice. Symptoms associated with vitamin B7 deficiency include thinning hair, scaly skin rashes around eyes, nose and mouth, and brittle nails. The vitamers include biotin and its ionized and salt forms. | 8.5 | 144 | 0 | biotins; vitamin B7 | coenzyme; cofactor; Escherichia coli metabolite; fundamental metabolite; human metabolite; mouse metabolite; nutraceutical; prosthetic group; Saccharomyces cerevisiae metabolite |
| angiotensin ii Giapreza: injectable form of angiotensin II used to increase blood pressure in adult patients with septic or other distributive shock. Ile(5)-angiotensin II : An angiotensin II that acts on the central nervous system (PDB entry: 1N9V). | 3.89 | 12 | 0 | amino acid zwitterion; angiotensin II | human metabolite |
| eosine-5-isothiocyanate eosine-5-isothiocyanate: ''triplet'' probe for measuring slow rotational diffusion of macromolecules | 2.04 | 1 | 0 | isothiocyanate; organobromine compound | |
| atropine tropan-3alpha-yl 3-hydroxy-2-phenylpropanoate : A tropane alkaloid that is (1R,5)-8-methyl-8-azabicyclo[3.2.1]octane substituted by a (3-hydroxy-2-phenylpropanoyl)oxy group at position 3. | 2.11 | 1 | 0 | ||
| ruthenium-tris-1,4,5,8-tetraazaphenanthrene ruthenium-tris-1,4,5,8-tetraazaphenanthrene: structure given in first source; RN refers to dichloride | 2.07 | 1 | 0 | ||
| 10-thiirane-4-estrene-3,17-dione 10-thiirane-4-estrene-3,17-dione: structure given in first source; RN given refers to (19R)-isomer; RN for cpd without isomeric designation not available 1/89 | 1.98 | 1 | 0 | ||
| lignin Lignin: The most abundant natural aromatic organic polymer found in all vascular plants. Lignin together with cellulose and hemicellulose are the major cell wall components of the fibers of all wood and grass species. Lignin is composed of coniferyl, p-coumaryl, and sinapyl alcohols in varying ratios in different plant species. (From Merck Index, 11th ed). lignin : A polyphenylpropanoid derived from three monolignol monomers: trans-p-coumaryl alcohol, coniferol and trans-sinapyl alcohol. There is extensive cross-linking and no defined primary structure. | 2.07 | 1 | 0 | ||
| sb 203580 [no description available] | 2.78 | 3 | 0 | imidazoles; monofluorobenzenes; pyridines; sulfoxide | EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; geroprotector; Hsp90 inhibitor; neuroprotective agent |
| sb 216763 [no description available] | 2.05 | 1 | 0 | indoles; maleimides | |
| erlotinib hydrochloride [no description available] | 5.87 | 4 | 2 | hydrochloride; terminal acetylenic compound | antineoplastic agent; protein kinase inhibitor |
| organophosphonates hydrogenphosphite : A divalent inorganic anion resulting from the removal of a proton from two of the hydroxy groups of phosphorous acid. | 9.47 | 78 | 1 | divalent inorganic anion; phosphite ion | |
| nickel monoxide [no description available] | 2.17 | 1 | 0 | ||
| aflatoxin b1 Aflatoxin B1: A potent hepatotoxic and hepatocarcinogenic mycotoxin produced by the Aspergillus flavus group of fungi. It is also mutagenic, teratogenic, and causes immunosuppression in animals. It is found as a contaminant in peanuts, cottonseed meal, corn, and other grains. The mycotoxin requires epoxidation to aflatoxin B1 2,3-oxide for activation. Microsomal monooxygenases biotransform the toxin to the less toxic metabolites aflatoxin M1 and Q1.. aflatoxin B1 : An aflatoxin having a tetrahydrocyclopenta[c]furo[3',2':4,5]furo[2,3-h]chromene skeleton with oxygen functionality at positions 1, 4 and 11. | 8.75 | 10 | 0 | aflatoxin; aromatic ether; aromatic ketone | carcinogenic agent; human metabolite |
| alpha-fluoromethylhistidine alpha-fluoromethylhistidine: RN given refers to cpd without isomeric designation | 2.02 | 1 | 0 | ||
| alpha-putrescinylthymine alpha-putrescinylthymine : An N-substituted putrescine that is thymine in which a hydrogen of the methyl group has been replaced by one of the amino groups of putrescine. It replaces about half of the thymine residues in the DNA of bacetriophage phiW-14. | 2.65 | 3 | 0 | N-substituted putrescine; pyrimidine nucleobase; pyrimidone; secondary amino compound; tertiary amino compound | |
| uridine 5'-tetraphosphate [no description available] | 2.08 | 1 | 0 | ||
| deflazacort deflazacort: structure | 4.27 | 2 | 0 | corticosteroid hormone | |
| 2,2'-dipyridyl diselenide [no description available] | 1.95 | 1 | 0 | ||
| maltotriose Porcelite: a light-cured composite resin. alpha-maltotriose : A maltotriose trisaccharide in which the glucose residue at the reducing end is in the pyranose ring form and has alpha configuration at the anomeric carbon atom.. | 2.04 | 1 | 0 | maltotriose trisaccharide | human metabolite |
| 4-deoxyneosamine c 4-deoxyneosamine C: structure | 2.43 | 2 | 0 | glucosamines; trideoxyhexose derivative | |
| adenosine 3'-diphosphate 5'-diphosphate [no description available] | 1.96 | 1 | 0 | ||
| 4-nitrophenyl 3-diazopyruvate 4-nitrophenyl 3-diazopyruvate: RN given in first source | 2 | 1 | 0 | ||
| 5'-o-(9-phenylxanthen-9-yl)-2'-deoxynebularine 5'-O-(9-phenylxanthen-9-yl)-2'-deoxynebularine: RN not in Chemline 10/88; RN from first source | 1.97 | 1 | 0 | ||
| 3-(2'-pyridyldithio)benzyldiazoacetate 3-(2'-pyridyldithio)benzyldiazoacetate: structure given in first source; isomeric probe | 2.6 | 1 | 0 | ||
| 2'-deoxyadenosine 5'-o-(1-thiotriphosphate) 2'-deoxyadenosine 5'-O-(1-thiotriphosphate): RN given refers to cpd without isomeric designation; structure. | 2.06 | 1 | 0 | ||
| n(4)-hydroxycytidine N(4)-hydroxycytidine : A nucleoside analogue that is cytidine which carries a hydroxy group at the N(4)-positon. It has broad-spectrum antiviral activity against influenza, SARS-CoV , SARS-CoV-2 and MERS-CoV. | 2 | 1 | 0 | ketoxime; nucleoside analogue | anticoronaviral agent; antiviral agent; drug metabolite; human xenobiotic metabolite |
| methylphosphonothiolate [no description available] | 2.21 | 1 | 0 | organothiophosphorus compound | |
| fe(iii)-edta Fe(III)-EDTA: iron fortifying agent; RN given refers to parent cpd | 1.97 | 1 | 0 | iron coordination entity | |
| prizes acetamiprid: structure in first source. (E)-acetamiprid : The (E)-stereoisomer of acetamiprid.. acetamiprid : A carboxamidine that is acetamidine in which the amino hydrogens are substituted by a (6-chloropyridin-3-yl)methyl and a methyl group while the hydrogen attached to the imino nitrogen is replaced by a cyano group. | 2.08 | 1 | 0 | carboxamidine; monochloropyridine; nitrile | environmental contaminant; neonicotinoid insectide; xenobiotic |
| sorafenib [no description available] | 10.05 | 19 | 1 | (trifluoromethyl)benzenes; aromatic ether; monochlorobenzenes; phenylureas; pyridinecarboxamide | angiogenesis inhibitor; anticoronaviral agent; antineoplastic agent; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; ferroptosis inducer; tyrosine kinase inhibitor |
| lenalidomide [no description available] | 5.32 | 3 | 0 | aromatic amine; dicarboximide; isoindoles; piperidones | angiogenesis inhibitor; antineoplastic agent; immunomodulator |
| cholic acid Cholic Acid: A major primary bile acid produced in the liver and usually conjugated with glycine or taurine. It facilitates fat absorption and cholesterol excretion.. cholic acid : A bile acid that is 5beta-cholan-24-oic acid bearing three alpha-hydroxy substituents at position 3, 7 and 12. | 3.27 | 6 | 0 | 12alpha-hydroxy steroid; 3alpha-hydroxy steroid; 7alpha-hydroxy steroid; bile acid; C24-steroid; trihydroxy-5beta-cholanic acid | human metabolite; mouse metabolite |
| erythritol [no description available] | 7.45 | 2 | 0 | butane-1,2,3,4-tetrol | antioxidant; human metabolite; plant metabolite |
| deoxycholic acid Deoxycholic Acid: A bile acid formed by bacterial action from cholate. It is usually conjugated with glycine or taurine. Deoxycholic acid acts as a detergent to solubilize fats for intestinal absorption, is reabsorbed itself, and is used as a choleretic and detergent.. deoxycholic acid : A bile acid that is 5beta-cholan-24-oic acid substituted by hydroxy groups at positions 3 and 12 respectively. | 2.42 | 2 | 0 | bile acid; C24-steroid; dihydroxy-5beta-cholanic acid | human blood serum metabolite |
| equilin Equilin: An estrogenic steroid produced by HORSES. It has a total of four double bonds in the A- and B-ring. High concentration of euilin is found in the URINE of pregnant mares. | 2.05 | 1 | 0 | 17-oxo steroid; 3-hydroxy steroid | |
| 2-methylthioadenosine [no description available] | 2.01 | 1 | 0 | ||
| 3-nitrotyrosine 3-nitrotyrosine: RN given refers to parent cpd without isomeric designation. 3-nitrotyrosine : A nitrotyrosine comprising tyrosine having a nitro group at the 3-position on the phenyl ring. | 2.75 | 3 | 0 | 2-nitrophenols; C-nitro compound; nitrotyrosine; non-proteinogenic alpha-amino acid | |
| sodium sulfide sodium sulfide: see also record for sodium bisulfide; actisoufre is the sodium sulfide component of sulfur-containing thermal springs which is also found in Saccharomyces cerevisiae | 1.97 | 1 | 0 | ||
| propargylamine propargylamine: RN given refers to parent cpd; structure | 2.78 | 3 | 0 | ||
| nogalamycin Nogalamycin: An anthrocycline from a Streptomyces nogalater variant. It is a cytolytic antineoplastic that inhibits DNA-dependent RNA synthesis by binding to DNA.. nogalamycin : An anthracycline antibiotic isolated from Streptomyces nogalater. It is a DNA intercalator and exhibits anticancer properties. | 3.09 | 5 | 0 | ||
| mibolerone mibolerone: prevents estrus in animals & prevents experimental lymphoid leukosis; minor descriptor (80-83); on-line & Index Medicus search NANDROLONE/AA (80-83); RN given refers to (7alpha,17beta)-isomer; structure. mibolerone : An androgen that is nalandrone carrying two methyl substituents at positions 7alpha and 17. | 1.97 | 1 | 0 | 17beta-hydroxy steroid; 3-oxo-Delta(4) steroid | anabolic agent; androgen |
| anisomycin Anisomycin: An antibiotic isolated from various Streptomyces species. It interferes with protein and DNA synthesis by inhibiting peptidyl transferase or the 80S ribosome system.. (-)-anisomycin : An antibiotic isolated from various Streptomyces species. It interferes with protein and DNA synthesis by inhibiting peptidyl transferase or the 80S ribosome system. | 1.99 | 1 | 0 | monohydroxypyrrolidine; organonitrogen heterocyclic antibiotic | anticoronaviral agent; antimicrobial agent; antineoplastic agent; antiparasitic agent; bacterial metabolite; DNA synthesis inhibitor; protein synthesis inhibitor |
| benzofurans Benzofurans: Compounds that contain a BENZENE ring fused to a furan ring. | 4.95 | 8 | 1 | ||
| metribolone Metribolone: A synthetic non-aromatizable androgen and anabolic steroid. It binds strongly to the androgen receptor and has therefore also been used as an affinity label for this receptor in the prostate and in prostatic tumors.. 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one : A synthetic non-aromatisable androgen and anabolic steroid. It binds strongly to the androgen receptor and has therefore also been used as an affinity label for this receptor in the prostate and in prostatic tumors. | 2.44 | 2 | 0 | 17beta-hydroxy steroid; 3-oxo steroid; anabolic androgenic steroid | androgen |
| 11-mercaptoundecanol 11-mercaptoundecanol: structure in first source | 2.05 | 1 | 0 | ||
| 5-formyluracil 5-formyluracil: structure. 5-formyluracil : A pyrimidone resulting from the formal oxidation of the alcoholic hydroxy group of 5-hydroxymethyluracil to the corresponding aldehyde. It is a major one-electron photooxidation product of thymine in oligodeoxynucleotides. | 8.4 | 7 | 0 | aldehyde; nucleobase analogue; pyrimidone | human metabolite; mutagen |
| 2-amino-3,3-dimethylbutanoic acid tert-butylglycine : A glycine derivative that is glycine with a tertiary butyl group at position 2. | 1.98 | 1 | 0 | non-proteinogenic alpha-amino acid | metabolite |
| wortmannin [no description available] | 2.95 | 4 | 0 | acetate ester; cyclic ketone; delta-lactone; organic heteropentacyclic compound | anticoronaviral agent; antineoplastic agent; autophagy inhibitor; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; geroprotector; Penicillium metabolite; radiosensitizing agent |
| trimethoprim, sulfamethoxazole drug combination Trimethoprim, Sulfamethoxazole Drug Combination: A drug combination with broad-spectrum antibacterial activity against both gram-positive and gram-negative organisms. It is effective in the treatment of many infections, including PNEUMOCYSTIS PNEUMONIA in AIDS.. co-trimoxazole : A two-component mixture comprising trimethoprim and sulfamethoxazole. | 1.97 | 1 | 0 | ||
| 1,3,8-trihydroxy-6-hydroxymethylanthraquinone 1,3,8-trihydroxy-6-hydroxymethylanthraquinone: metabolite of emodin | 2.07 | 1 | 0 | trihydroxyanthraquinone | |
| 3-(9-acridinylamino)-5-hydroxymethylaniline 3-(9-acridinylamino)-5-hydroxymethylaniline: structure in first source | 2.01 | 1 | 0 | ||
| taurochenodeoxycholic acid Taurochenodeoxycholic Acid: A bile salt formed in the liver by conjugation of chenodeoxycholate with taurine, usually as the sodium salt. It acts as detergent to solubilize fats in the small intestine and is itself absorbed. It is used as a cholagogue and choleretic.. taurochenodeoxycholate : An organosulfonate oxoanion that is the conjugate base of taurochenodeoxycholic acid arising from deprotonation of the sulfonate OH group; major species at pH 7.3.. taurochenodeoxycholic acid : A bile acid taurine conjugate of chenodeoxycholic acid. | 2.31 | 1 | 0 | bile acid taurine conjugate | human metabolite; mouse metabolite |
| bortezomib [no description available] | 5.14 | 5 | 0 | amino acid amide; L-phenylalanine derivative; pyrazines | antineoplastic agent; antiprotozoal drug; protease inhibitor; proteasome inhibitor |
| aminoflavone aminoflavone: structure in first source | 2.21 | 1 | 0 | ||
| sjg 136 1,1'-((propane-1,3-diyl)dioxy)bis(7-methoxy-2-methylidene-1,2,3,10,11,11a-hexahydro-5H-pyrrolo(2,1-c)(1,4)benzodiazepin-5,11-dione): structure in first source | 2.51 | 2 | 0 | ||
| 3-deazaadenine [no description available] | 2 | 1 | 0 | ||
| permanganate [no description available] | 2.02 | 1 | 0 | manganese oxoacid | |
| leupeptins Leupeptins: A group of acylated oligopeptides produced by Actinomycetes that function as protease inhibitors. They have been known to inhibit to varying degrees trypsin, plasmin, KALLIKREINS, papain and the cathepsins. | 3.4 | 2 | 0 | ||
| carboplatin [no description available] | 11.76 | 15 | 10 | ||
| n-(2-aminoethyl)glycine N-(2-aminoethyl)glycine: RN given refers to parent cpd | 3.54 | 2 | 0 | ||
| lithium chloride Lithium Chloride: A salt of lithium that has been used experimentally as an immunomodulator.. lithium chloride : A metal chloride salt with a Li(+) counterion. | 2.69 | 3 | 0 | inorganic chloride; lithium salt | antimanic drug; geroprotector |
| xr5944 XR5944: structure in first source | 2.1 | 1 | 0 | ||
| s-adenosylhomocysteine S-Adenosylhomocysteine: 5'-S-(3-Amino-3-carboxypropyl)-5'-thioadenosine. Formed from S-adenosylmethionine after transmethylation reactions.. S-adenosyl-L-homocysteine : An organic sulfide that is the S-adenosyl derivative of L-homocysteine. | 2.94 | 4 | 0 | adenosines; amino acid zwitterion; homocysteine derivative; homocysteines; organic sulfide | cofactor; EC 2.1.1.72 [site-specific DNA-methyltransferase (adenine-specific)] inhibitor; EC 2.1.1.79 (cyclopropane-fatty-acyl-phospholipid synthase) inhibitor; epitope; fundamental metabolite |
| glyceraldehyde 3-phosphate Glyceraldehyde 3-Phosphate: An aldotriose which is an important intermediate in glycolysis and in tryptophan biosynthesis.. glyceraldehyde 3-phosphate : An aldotriose phosphate that is the 3-phospho derivative of glyceraldehyde. It is an important metabolic intermediate in several central metabolic pathways in all organisms. | 2.08 | 1 | 0 | glyceraldehyde 3-phosphate | mouse metabolite |
| glycogen glycogen : A polydisperse, highly branched glucan composed of chains of D-glucopyranose residues in alpha(1->4) glycosidic linkage, joined together by alpha(1->6) glycosidic linkages. A small number of alpha(1->3) glycosidic linkages and some cumulative alpha(1->6) links also may occur. The branches in glycogen typically contain 8 to 12 glucose residues. | 3.26 | 6 | 0 | ||
| ribulose 5-phosphate ribulose 5-phosphate: RN given refers to cpd without isomeric designation. D-ribulose 5-phosphate : The D-enantiomer of ribulose 5-phosphate that is one of the end-products of the pentose phosphate pathway.. ribulose 5-phosphate : A ribulose phosphate in which the phosphate group is attached at position 5. | 1.98 | 1 | 0 | ribulose 5-phosphate | mouse metabolite |
| arabinose [no description available] | 3.93 | 13 | 0 | L-arabinose | Escherichia coli metabolite; mouse metabolite |
| n-acetylneuraminic acid N-Acetylneuraminic Acid: An N-acyl derivative of neuraminic acid. N-acetylneuraminic acid occurs in many polysaccharides, glycoproteins, and glycolipids in animals and bacteria. (From Dorland, 28th ed, p1518). N-acetylneuraminic acid : An N-acylneuraminic acid where the N-acyl group is specified as acetyl. | 2.73 | 3 | 0 | N-acetylneuraminic acids | antioxidant; bacterial metabolite; EC 3.2.1.18 (exo-alpha-sialidase) inhibitor; human metabolite; mouse metabolite |
| mannose-6-phosphate beta-D-mannose 6-phosphate : A D-mannopyranose 6-phosphate with a beta-configuration at the anomeric position. | 3.83 | 3 | 0 | D-mannopyranose 6-phosphate | |
| fibrin Fibrin: A protein derived from FIBRINOGEN in the presence of THROMBIN, which forms part of the blood clot. | 2.73 | 3 | 0 | peptide | |
| bradykinin [no description available] | 2.92 | 4 | 0 | oligopeptide | human blood serum metabolite; vasodilator agent |
| canavanine L-canavanine : A non-proteinogenic L-alpha-amino acid that is L-homoserine substituted at oxygen with a guanidino (carbamimidamido) group. Although structurally related to L-arginine, it is non-proteinogenic. | 2 | 1 | 0 | amino acid zwitterion; non-proteinogenic L-alpha-amino acid | phytogenic insecticide; plant metabolite |
| hexacyanoferrate iii hexacyanoferrate III: RN given refers to parent cpd | 2.72 | 3 | 0 | ||
| glucosamine D-glucosamine : An amino sugar whose structure comprises D-glucose having an amino substituent at position 2.. 2-amino-2-deoxy-D-glucopyranose : A D-glucosamine whose structure comprises D-glucopyranose having an amino substituent at position 2. | 8.33 | 6 | 0 | D-glucosamine | Escherichia coli metabolite; geroprotector; mouse metabolite |
| glucosamine 6-phosphate glucosamine 6-phosphate: RN given refers to parent cpd | 2.03 | 1 | 0 | 2-amino-2-deoxy-D-glucopyranose 6-phosphate | human metabolite; Saccharomyces cerevisiae metabolite |
| elastin [no description available] | 3.53 | 8 | 0 | oligopeptide | |
| mevalonic acid Mevalonic Acid: A dihydroxy monocarboxylic acid and precursor in the biosynthetic pathway known as the mevalonate pathway, which produces terpenes and steroids that are vital for diverse cellular functions.. mevalonic acid : A racemate composed of equimolar amounts of (R)- and (S)-mevalonic acid.. (R)-mevalonic acid : The (R)-enantiomer of mevalonic acid. | 2.38 | 2 | 0 | 3,5-dihydroxy-3-methylpentanoic acid | |
| lyxose D-lyxose : Any lyxose having D-configuration.. D-lyxopyranose : The pyranose form of D-lyxose. | 2 | 1 | 0 | D-lyxose | |
| raffinose Raffinose: A trisaccharide occurring in Australian manna (from Eucalyptus spp, Myrtaceae) and in cottonseed meal.. raffinose : A trisaccharide composed of alpha-D-galactopyranose, alpha-D-glucopyranose and beta-D-fructofuranose joined in sequence by 1->6 and 1<->2 glycosidic linkages, respectively. | 2.04 | 1 | 0 | raffinose family oligosaccharide; trisaccharide | mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| epiglucan epiglucan: a highly side-chain/branched alkali-insoluble cell wall glucan from fungus such as Epicoccum nigrum, Botrytis cinerea, ascomycetes & basidiomycetes; also isolated S-4001 from Lei Wan (polyporus mylitiae), HA-beta-glucan from mushroom Pleutotus ostreatus (Fr.) Quel., and translam from seaweed Laminaria cichorioides; with commercially important functional properties including emulsification and friction reduction. | 3.04 | 3 | 0 | ||
| oxytocin Oxytocin: A nonapeptide hormone released from the neurohypophysis (PITUITARY GLAND, POSTERIOR). It differs from VASOPRESSIN by two amino acids at residues 3 and 8. Oxytocin acts on SMOOTH MUSCLE CELLS, such as causing UTERINE CONTRACTIONS and MILK EJECTION.. oxytocin : A cyclic nonapeptide hormone with amino acid sequence CYIQNCPLG that also acts as a neurotransmitter in the brain; the principal uterine-contracting and milk-ejecting hormone of the posterior pituitary. Together with the neuropeptide vasopressin, it is believed to influence social cognition and behaviour. | 8.68 | 10 | 0 | heterodetic cyclic peptide; peptide hormone | oxytocic; vasodilator agent |
| bekanamycin bekanamycin: kanendomycin is the sulfate of bekanamycin; RN given refers to parent cpd; structure | 2.05 | 1 | 0 | kanamycins | |
| ouabain Ouabain: A cardioactive glycoside consisting of rhamnose and ouabagenin, obtained from the seeds of Strophanthus gratus and other plants of the Apocynaceae; used like DIGITALIS. It is commonly used in cell biological studies as an inhibitor of the NA(+)-K(+)-EXCHANGING ATPASE.. cardiac glycoside : Steroid lactones containing sugar residues that act on the contractile force of the cardiac muscles.. ouabain : A steroid hormone that is a multi-hydroxylated alpha-L-rhamnosyl cardenoloide. It binds to and inhibits the plasma membrane Na(+)/K(+)-ATPase (sodium pump). It has been isolated naturally from Strophanthus gratus. | 2.41 | 2 | 0 | 11alpha-hydroxy steroid; 14beta-hydroxy steroid; 5beta-hydroxy steroid; alpha-L-rhamnoside; cardenolide glycoside; steroid hormone | anti-arrhythmia drug; cardiotonic drug; EC 2.3.3.1 [citrate (Si)-synthase] inhibitor; EC 3.1.3.41 (4-nitrophenylphosphatase) inhibitor; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor; EC 3.6.3.9 (Na(+)/K(+)-transporting ATPase) inhibitor; ion transport inhibitor; plant metabolite |
| puromycin [no description available] | 4.31 | 20 | 0 | puromycins | antiinfective agent; antimicrobial agent; antineoplastic agent; EC 3.4.11.14 (cytosol alanyl aminopeptidase) inhibitor; EC 3.4.14.2 (dipeptidyl-peptidase II) inhibitor; nucleoside antibiotic; protein synthesis inhibitor |
| cellotetraose cellotetraose: RN given refers to (beta-D)-isomer. cellotetraose : A glucotetrose comprised of four D-glucose residues connected by beta(1->4) linkages. | 2.06 | 1 | 0 | glucotetraose | |
| tartaric acid tartaric acid: RN given refers to cpd with unspecified isomeric designation. D-tartaric acid : The D-enantiomer of tartaric acid. | 2.41 | 2 | 0 | tartaric acid | Escherichia coli metabolite |
| pentostatin Pentostatin: A potent inhibitor of ADENOSINE DEAMINASE. The drug induces APOPTOSIS of LYMPHOCYTES, and is used in the treatment of many lymphoproliferative malignancies, particularly HAIRY CELL LEUKEMIA. It is also synergistic with some other antineoplastic agents and has immunosuppressive activity.. pentostatin : A member of the class of coformycins that is coformycin in which the hydroxy group at position 2' is replaced with a hydrogen. It is a drug used for the treatment of hairy cell leukaemia. | 1.96 | 1 | 0 | coformycins | antimetabolite; antineoplastic agent; Aspergillus metabolite; bacterial metabolite; EC 3.5.4.4 (adenosine deaminase) inhibitor |
| n-formylmethionine N-formyl-L-methionine : A L-methionine derivative in which one of the hydrogens attached to the nitrogen is replaced by a formyl group. | 3.05 | 5 | 0 | L-methionine derivative; N-formyl amino acid; proteinogenic amino acid | metabolite |
| n(6),n(6)-dimethyladenosine N(6),N(6)-dimethyladenosine : A methyladenosine compound with two methyl groups attached to N(6) of the adenine nucleobase. | 1.94 | 1 | 0 | hydrocarbyladenosine | |
| 5-methyldeoxycytidine [no description available] | 2.02 | 1 | 0 | 2'-deoxycytidine | |
| adenosine 5'-o-(3-thiotriphosphate) adenosine 5'-O-(3-thiotriphosphate): RN given refers to cpd with unspecified locant for thio group; see also records for 1-thio & 2-thio-isomers. adenosine 5'-[gamma-thio]triphosphate : A nucleoside triphosphate analogue that is ATP in which one of the oxygens attached to 3-phosphate group is replaced by sulfur. | 3.6 | 9 | 0 | nucleoside triphosphate analogue | |
| cortodoxone Cortodoxone: 17,21-Dihydroxypregn-4-ene-3,20-dione. A 17-hydroxycorticosteroid with glucocorticoid and anti-inflammatory activities.. 11-deoxycortisol : A deoxycortisol that is cortisol in which the hydroxy group at position 11 has been replaced by a hydrogen. | 1.97 | 1 | 0 | deoxycortisol; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone | human metabolite; mouse metabolite |
| cellulase Cellulase: An endocellulase with specificity for the hydrolysis of 1,4-beta-glucosidic linkages in CELLULOSE, lichenin, and cereal beta-glucans.. beta-cellotriose : A cellotriose with a beta-configuration at the anomeric position. | 2.68 | 3 | 0 | cellotriose | |
| actinorhodin actinorhodin: structure. actinorhodin : A member of the class of benzoisochromanequinone that is produced by Streptomyces coelicolor A3(2) and exhibits antibiotic activity. | 1.97 | 1 | 0 | ||
| monensin Monensin: An antiprotozoal agent produced by Streptomyces cinnamonensis. It exerts its effect during the development of first-generation trophozoites into first-generation schizonts within the intestinal epithelial cells. It does not interfere with hosts' development of acquired immunity to the majority of coccidial species. Monensin is a sodium and proton selective ionophore and is widely used as such in biochemical studies.. monensin A : A spiroketal, monensin A is the major component of monensin, a mixture of antibiotic substances produced by Streptomyces cinnamonensis. An antiprotozoal, it is used as the sodium salt as a feed additive for the prevention of coccidiosis in poultry and as a growth promoter in cattle. | 2 | 1 | 0 | cyclic hemiketal; monocarboxylic acid; polyether antibiotic; spiroketal | antifungal agent; coccidiostat; ionophore |
| digitoxin Digitoxin: A cardiac glycoside sometimes used in place of DIGOXIN. It has a longer half-life than digoxin; toxic effects, which are similar to those of digoxin, are longer lasting. (From Martindale, The Extra Pharmacopoeia, 30th ed, p665). digitoxin : A cardenolide glycoside in which the 3beta-hydroxy group of digitoxigenin carries a 2,6-dideoxy-beta-D-ribo-hexopyranosyl-(1->4)-2,6-dideoxy-beta-D-ribo-hexopyranosyl-(1->4)-2,6-dideoxy-beta-D-ribo-hexopyranosyl trisaccharide chain. | 2.02 | 1 | 0 | cardenolide glycoside | EC 3.6.3.9 (Na(+)/K(+)-transporting ATPase) inhibitor |
| saquinavir Saquinavir: An HIV protease inhibitor which acts as an analog of an HIV protease cleavage site. It is a highly specific inhibitor of HIV-1 and HIV-2 proteases, and also inhibits CYTOCHROME P-450 CYP3A.. saquinavir : An aspartic acid derivative obtained by formal condensation of the primary amino group of (2S,3R)-4-[(3S,4aS,8aS)-3-(tert-butylcarbamoyl)octahydroisoquinolin-2(1H)-yl]-3-hydroxy-1-phenylbutan-2-ylamine with the carboxy group of N(2)(-quinolin-2-ylcarbonyl)-L-asparagine. An inhibitor of HIV-1 protease. | 2.02 | 1 | 0 | L-asparagine derivative; quinolines | antiviral drug; HIV protease inhibitor |
| ryanodine Ryanodine: A methylpyrrole-carboxylate from RYANIA that disrupts the RYANODINE RECEPTOR CALCIUM RELEASE CHANNEL to modify CALCIUM release from SARCOPLASMIC RETICULUM resulting in alteration of MUSCLE CONTRACTION. It was previously used in INSECTICIDES. It is used experimentally in conjunction with THAPSIGARGIN and other inhibitors of CALCIUM ATPASE uptake of calcium into SARCOPLASMIC RETICULUM.. ryanodine : An insecticide alkaloid isolated from South American plant Ryania speciosa. | 2 | 1 | 0 | ||
| ochratoxin a ochratoxin A: structure in first source & in Merck, 9th ed, #6549. ochratoxin A : A phenylalanine derivative resulting from the formal condensation of the amino group of L-phenylalanine with the carboxy group of (3R)-5-chloro-8-hydroxy-3-methyl-1-oxo-3,4-dihydro-1H-2-benzopyran-7-carboxylic acid (ochratoxin alpha). It is among the most widely occurring food-contaminating mycotoxins, produced by Aspergillus ochraceus, Aspergillus carbonarius and Penicillium verrucosum. | 2.9 | 2 | 0 | isochromanes; monocarboxylic acid amide; N-acyl-L-phenylalanine; organochlorine compound; phenylalanine derivative | Aspergillus metabolite; calcium channel blocker; carcinogenic agent; mycotoxin; nephrotoxin; Penicillium metabolite; teratogenic agent |
| acriflavine Acriflavine: 3,6-Diamino-10-methylacridinium chloride mixt. with 3,6-acridinediamine. Fluorescent dye used as a local antiseptic and also as a biological stain. It intercalates into nucleic acids thereby inhibiting bacterial and viral replication. | 1.96 | 1 | 0 | ||
| bq 123 cyclo(Trp-Asp-Pro-Val-Leu): derived from the modification of a natural lead of BE-18257B, an endothelin A receptor antagonist; has neuroprotective activity; amino acid sequence given in first source | 2.03 | 1 | 0 | cyclic peptide | |
| sodium arsenite sodium arsenite : An inoganic sodium salt with formula with formula NaAsO2. | 2.43 | 2 | 0 | arsenic molecular entity; inorganic sodium salt | antibacterial agent; antifungal agent; antineoplastic agent; carcinogenic agent; herbicide; insecticide; rodenticide |
| betadex beta-Cyclodextrins: Cyclic GLUCANS consisting of seven (7) glucopyranose units linked by 1,4-glycosidic bonds. | 3.54 | 8 | 0 | cyclodextrin | |
| acetyl coenzyme a Acetyl Coenzyme A: Acetyl CoA participates in the biosynthesis of fatty acids and sterols, in the oxidation of fatty acids and in the metabolism of many amino acids. It also acts as a biological acetylating agent. | 2.07 | 1 | 0 | acyl-CoA | acyl donor; coenzyme; effector; fundamental metabolite |
| trichostatin a trichostatin A: chelates zinc ion in the active site of histone deacetylases, resulting in preventing histone unpacking so DNA is less available for transcription; do not confuse with TRICHOSANTHIN which is a protein; found in STREPTOMYCES | 3.11 | 5 | 0 | antibiotic antifungal agent; hydroxamic acid; trichostatin | bacterial metabolite; EC 3.5.1.98 (histone deacetylase) inhibitor; geroprotector |
| tretinoin Tretinoin: An important regulator of GENE EXPRESSION during growth and development, and in NEOPLASMS. Tretinoin, also known as retinoic acid and derived from maternal VITAMIN A, is essential for normal GROWTH; and EMBRYONIC DEVELOPMENT. An excess of tretinoin can be teratogenic. It is used in the treatment of PSORIASIS; ACNE VULGARIS; and several other SKIN DISEASES. It has also been approved for use in promyelocytic leukemia (LEUKEMIA, PROMYELOCYTIC, ACUTE).. retinoic acid : A retinoid consisting of 3,7-dimethylnona-2,4,6,8-tetraenoic acid substituted at position 9 by a 2,6,6-trimethylcyclohex-1-en-1-yl group (geometry of the four exocyclic double bonds is not specified).. all-trans-retinoic acid : A retinoic acid in which all four exocyclic double bonds have E- (trans-) geometry. | 7.88 | 24 | 2 | retinoic acid; vitamin A | anti-inflammatory agent; antineoplastic agent; antioxidant; AP-1 antagonist; human metabolite; keratolytic drug; retinoic acid receptor agonist; retinoid X receptor agonist; signalling molecule |
| equilenin Equilenin: An estrogenic steroid produced by HORSES. It has a total of five double bonds in the A- and B-ring. High concentration of equilenin is found in the URINE of pregnant mares.. equilenin : A 3-hydroxy steroid that is estrone which carries two double bonds at positions 6 and 8. It is found in the urine of pregnant mare's and extensively used for estrogen replacement therapy in postmenopausal women. | 2.73 | 3 | 0 | 17-oxo steroid; 3-hydroxy steroid | antioxidant; mammalian metabolite |
| arachidonic acid icosa-5,8,11,14-tetraenoic acid : Any icosatetraenoic acid with the double bonds at positions 5, 8, 11 and 14.. arachidonate : A long-chain fatty acid anion resulting from the removal of a proton from the carboxy group of arachidonic acid. | 2.92 | 4 | 0 | icosa-5,8,11,14-tetraenoic acid; long-chain fatty acid; omega-6 fatty acid | Daphnia galeata metabolite; EC 3.1.1.1 (carboxylesterase) inhibitor; human metabolite; mouse metabolite |
| elinafide elinafide: structure given in first source | 2 | 1 | 0 | ||
| alpha-cyclodextrin alpha-cyclodextrin : A cycloamylose composed of six alpha-(1->4) linked D-glucopyranose units. | 2.01 | 1 | 0 | cyclodextrin | |
| resveratrol trans-resveratrol : A resveratrol in which the double bond has E configuration. | 2.07 | 1 | 0 | resveratrol | antioxidant; phytoalexin; plant metabolite; quorum sensing inhibitor; radical scavenger |
| (north)-methanocarbathymidine (north)-methanocarbathymidine: also called NMCT. 1-[(1S,2S,4S,5R)-4-hydroxy-5-(hydroxymethyl)bicyclo[3.1.0]hexan-2-yl]thymine : A carbobicyclic compound that is bicyclo[3.1.0]hexane which is substituted at the 2-pro-S, 4-pro-S and 5-pro-R positions by thymin-1-yl, hydroxy, and hydroxymethyl groups, respectively. | 2.1 | 1 | 0 | C-glycosyl pyrimidine; carbobicyclic compound; primary alcohol; pyrimidone; secondary alcohol | |
| retinol Vitamin A: Retinol and derivatives of retinol that play an essential role in metabolic functioning of the retina, the growth of and differentiation of epithelial tissue, the growth of bone, reproduction, and the immune response. Dietary vitamin A is derived from a variety of CAROTENOIDS found in plants. It is enriched in the liver, egg yolks, and the fat component of dairy products.. vitamin A : Any member of a group of fat-soluble retinoids produced via metabolism of provitamin A carotenoids that exhibit biological activity against vitamin A deficiency. Vitamin A is involved in immune function, vision, reproduction, and cellular communication.. all-trans-retinol : A retinol in which all four exocyclic double bonds have E- (trans-) geometry.. retinol : A retinoid consisting of 3,7-dimethylnona-2,4,6,8-tetraen-1-ol substituted at position 9 by a 2,6,6-trimethylcyclohex-1-en-1-yl group (geometry of the four exocyclic double bonds is not specified). | 2.38 | 2 | 0 | retinol; vitamin A | human metabolite; mouse metabolite; plant metabolite |
| ribothymidine ribothymidine : A methyluridine having a single methyl substituent at the 5-position on the uracil ring. | 8.68 | 9 | 0 | methyluridine | antigen; Escherichia coli metabolite; human metabolite |
| latrunculin a latrunculin A: 16-membered macrolide attached to 2-thiazolidinone moiety; from Red Sea sponge Latrunculia magnifica; see also latrunculin B; structure given in first source. latrunculin A : A bicyclic macrolide natural product consisting of a 16-membered bicyclic lactone attached to the rare 2-thiazolidinone moiety. It is obtained from the Red Sea sponge Latrunculia magnifica and from the Fiji Islands sponge Cacospongia mycofijiensis. Latrunculin A inhibits actin polymerisation, microfilament organsation and microfilament-mediated processes. | 2.02 | 1 | 0 | cyclic hemiketal; macrolide; oxabicycloalkane; thiazolidinone | actin polymerisation inhibitor; metabolite; toxin |
| cyanoginosin lr cyanoginosin LR: cyclic heptapeptide from cyanobacterium Microcystis aeruginosa. microcystin-LR : A microcystin consisting of D-alanyl, L-leucyl, (3S)-3-methyl-D-beta-aspartyl,L-arginyl, 2S,3S,4E,6E,8S,9S)-3-amino-4,5,6,7-tetradehydro-9-methoxy-2,6,8-trimethyl-10-phenyldecanoyl, D-gamma-glutamyl, and 2,3-didehydro-N-methylalanyl residues joined into a 25-membered macrocycle. Produced by the cyanobacterium Microcystis aeruginosa, it is the most studied of the microcystins. | 2.46 | 2 | 0 | microcystin | bacterial metabolite; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; environmental contaminant; xenobiotic |
| oleic acid Oleic Acid: An unsaturated fatty acid that is the most widely distributed and abundant fatty acid in nature. It is used commercially in the preparation of oleates and lotions, and as a pharmaceutical solvent. (Stedman, 26th ed). oleic acid : An octadec-9-enoic acid in which the double bond at C-9 has Z (cis) stereochemistry. | 3.51 | 8 | 0 | octadec-9-enoic acid | antioxidant; Daphnia galeata metabolite; EC 3.1.1.1 (carboxylesterase) inhibitor; Escherichia coli metabolite; mouse metabolite; plant metabolite; solvent |
| tacrolimus Tacrolimus: A macrolide isolated from the culture broth of a strain of Streptomyces tsukubaensis that has strong immunosuppressive activity in vivo and prevents the activation of T-lymphocytes in response to antigenic or mitogenic stimulation in vitro.. tacrolimus (anhydrous) : A macrolide lactam containing a 23-membered lactone ring, originally isolated from the fermentation broth of a Japanese soil sample that contained the bacteria Streptomyces tsukubaensis. | 4.03 | 4 | 0 | macrolide lactam | bacterial metabolite; immunosuppressive agent |
| phenylalanine amide phenylalanine amide: inhibits an isoenzyme of alkaline phosphatase; RN given for cpd without isomeric designation. L-phenylalanine amide : An amino acid amide derived from L-phenylalanine. | 2 | 1 | 0 | amino acid amide; phenylalanine derivative | |
| farnesyl pyrophosphate farnesyl pyrophosphate: a sesquiterpene that dimerizes to SQUALENE; RN given refers to cpd without isomeric designation. 2-trans,6-trans-farnesyl diphosphate : The trans,trans-stereoisomer of farnesyl diphosphate. | 1.97 | 1 | 0 | farnesyl diphosphate | Escherichia coli metabolite; mouse metabolite |
| pectins Pectins: High molecular weight polysaccharides present in the cell walls of all plants. Pectins cement cell walls together. They are used as emulsifiers and stabilizers in the food industry. They have been tried for a variety of therapeutic uses including as antidiarrheals, where they are now generally considered ineffective, and in the treatment of hypercholesterolemia.. alpha-D-galacturonic acid : The alpha-anomer of D-galacturonic acid. | 2.03 | 1 | 0 | D-galactopyranuronic acid | |
| cerivastatin cerivastatin: cerivastatin is the ((E)-(+))-isomer; structure given in first source. cerivastatin : (3R,5S)-3,5-dihydroxyhept-6-enoic acid in which the (7E)-hydrogen is substituted by a 4-(4-fluorophenyl)-2,6-diisopropyl-5-(methoxymethyl)pyridin-3-yl group. Formerly used (as its sodium salt) to lower cholesterol and prevent cardiovascular disease, it was withdrawn from the market worldwide in 2001 following reports of a severe form of muscle toxicity. | 2 | 1 | 0 | dihydroxy monocarboxylic acid; pyridines; statin (synthetic) | |
| cocaine Cocaine: An alkaloid ester extracted from the leaves of plants including coca. It is a local anesthetic and vasoconstrictor and is clinically used for that purpose, particularly in the eye, ear, nose, and throat. It also has powerful central nervous system effects similar to the amphetamines and is a drug of abuse. Cocaine, like amphetamines, acts by multiple mechanisms on brain catecholaminergic neurons; the mechanism of its reinforcing effects is thought to involve inhibition of dopamine uptake.. cocaine : A tropane alkaloid obtained from leaves of the South American shrub Erythroxylon coca. | 3.4 | 7 | 0 | benzoate ester; methyl ester; tertiary amino compound; tropane alkaloid | adrenergic uptake inhibitor; central nervous system stimulant; dopamine uptake inhibitor; environmental contaminant; local anaesthetic; mouse metabolite; plant metabolite; serotonin uptake inhibitor; sodium channel blocker; sympathomimetic agent; vasoconstrictor agent; xenobiotic |
| eicosapentaenoic acid icosapentaenoic acid : Any straight-chain, C20 polyunsaturated fatty acid having five C=C double bonds.. all-cis-5,8,11,14,17-icosapentaenoic acid : An icosapentaenoic acid having five cis-double bonds at positions 5, 8, 11, 14 and 17. | 3.64 | 2 | 0 | icosapentaenoic acid; omega-3 fatty acid | anticholesteremic drug; antidepressant; antineoplastic agent; Daphnia galeata metabolite; fungal metabolite; micronutrient; mouse metabolite; nutraceutical |
| alpha-methyl-4-carboxyphenylglycine alpha-methyl-4-carboxyphenylglycine: glutamate receptor antagonist. (S)-alpha-methyl-4-carboxyphenylglycine : A non-proteinogenic alpha-amino acid that is alanine in which the alpha-hydrogen is replaced by a 4-carboxyphenyl group (the S-enantiomer). It is a non-selective group I/group II metabotropic glutamate receptor (mGluR) antagonist. | 2 | 1 | 0 | non-proteinogenic alpha-amino acid | metabotropic glutamate receptor antagonist |
| thapsigargin Thapsigargin: A sesquiterpene lactone found in roots of THAPSIA. It inhibits SARCOPLASMIC RETICULUM CALCIUM-TRANSPORTING ATPASES.. thapsigargin : An organic heterotricyclic compound that is a hexa-oxygenated 6,7-guaianolide isolated fron the roots of Thapsia garganica L., Apiaceae. A potent skin irritant, it is used in traditional medicine as a counter-irritant. Thapsigargin inhibits Ca(2+)-transporting ATPase mediated uptake of calcium ions into sarcoplasmic reticulum and is used in experimentation examining the impacts of increasing cytosolic calcium concentrations. | 2.93 | 4 | 0 | butyrate ester; organic heterotricyclic compound; sesquiterpene lactone | calcium channel blocker; EC 3.6.3.8 (Ca(2+)-transporting ATPase) inhibitor |
| fumaramide [no description available] | 2.01 | 1 | 0 | ||
| mycophenolic acid Mycophenolic Acid: Compound derived from Penicillium stoloniferum and related species. It blocks de novo biosynthesis of purine nucleotides by inhibition of the enzyme inosine monophosphate dehydrogenase (IMP DEHYDROGENASE). Mycophenolic acid exerts selective effects on the immune system in which it prevents the proliferation of T-CELLS, LYMPHOCYTES, and the formation of antibodies from B-CELLS. It may also inhibit recruitment of LEUKOCYTES to sites of INFLAMMATION.. mycophenolate : A monocarboxylic acid anion resulting from the removal of a proton from the carboxy group of mycophenolic acid.. mycophenolic acid : A member of the class of 2-benzofurans that is 2-benzofuran-1(3H)-one which is substituted at positions 4, 5, 6, and 7 by methyl, methoxy, (2E)-5-carboxy-3-methylpent-2-en-1-yl, and hydroxy groups, respectively. It is an antibiotic produced by Penicillium brevi-compactum, P. stoloniferum, P. echinulatum and related species. An immunosuppressant, it is widely used (partiularly as its sodium salt and as the 2-(morpholin-4-yl)ethyl ester prodrug, mycophenolate mofetil) to prevent tissue rejection following organ transplants and for the treatment of certain autoimmune diseases. | 7.69 | 11 | 0 | 2-benzofurans; gamma-lactone; monocarboxylic acid; phenols | anticoronaviral agent; antimicrobial agent; antineoplastic agent; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; environmental contaminant; immunosuppressive agent; mycotoxin; Penicillium metabolite; xenobiotic |
| keratan sulfate Keratan Sulfate: A sulfated mucopolysaccharide initially isolated from bovine cornea. At least two types are known. Type I, found mostly in the cornea, contains D-galactose and D-glucosamine-6-O-sulfate as the repeating unit; type II, found in skeletal tissues, contains D-galactose and D-galactosamine-6-O-sulfate as the repeating unit.. keratan sulfate : A sulfated glycosaminoglycan, a linear polymer that consists of the repeating disaccharide [3)-beta-Gal-(1->4)-beta-GlcNAc-(1->] and containing sulfo groups located at random positions.. keratan 6'-sulfate : A keratan sulfate with random sulfation at the 6'-position. | 2.02 | 1 | 0 | ||
| brivudine brivudine: anti-herpes agent | 3.12 | 1 | 0 | ||
| lycopene [no description available] | 2.05 | 1 | 0 | acyclic carotene | antioxidant; plant metabolite |
| zithromax Azithromycin: A semi-synthetic macrolide antibiotic structurally related to ERYTHROMYCIN. It has been used in the treatment of Mycobacterium avium intracellulare infections, toxoplasmosis, and cryptosporidiosis.. azithromycin : A macrolide antibiotic useful for the treatment of bacterial infections. | 2.25 | 1 | 0 | macrolide antibiotic | antibacterial drug; environmental contaminant; xenobiotic |
| formycin [no description available] | 6.95 | 1 | 0 | formycin | antineoplastic agent |
| geranylgeranyl pyrophosphate geranylgeranyl pyrophosphate: RN given refers to (E,E,E)-isomer. geranylgeranyl diphosphate : A polyprenol diphosphate having geranylgeranyl as the polyprenyl component.. 2-trans,6-trans,10-trans-geranylgeranyl diphosphate : The all-trans-isomer of geranylgeranyl diphosphate. | 1.97 | 1 | 0 | geranylgeranyl diphosphate | mouse metabolite |
| 2-butenal crotonaldehyde : An enal consisting of propene having a formyl group at the 1-position. | 2.71 | 3 | 0 | enal | |
| neocarzinostatin chromophore neocarzinostatin chromophore: nonprotein chromophore of neocarzinostatin; antibiotic activity of Neocarzinostatin depends on wholy on chromophore interaction with DNA; Chrom A & Chrom B are separated by HPLC; Chrom C is derived from Chrom A; Chrom D is inactive minor component. neocarzinostatin chromophore : A naphthoate ester obtained by formal condensation of the carboxy group of 2-hydroxy-7-methoxy-5-methyl-1-naphthoic acid with the 5-hydroxy group of (1aS,5R,6R,6aE,9aR)-5-hydroxy-1a-[(4R)-2-oxo-1,3-dioxolan-4-yl]-2,3,8,9-tetradehydro-1a,5,6,9a-tetrahydrocyclopenta[5,6]cyclonona[1,2-b]oxiren-6-yl 2,6-dideoxy-2-(methylamino)-alpha-D-galactopyranoside. The chromophoric part of neocarzinostatin, it is tightly and non-covelently bound to a 113-membered apoprotein, which serves to protect it and release it to the target DNA. | 9.02 | 4 | 0 | cyclopentacyclononaoxirene; D-galactosaminide; dioxolane; monosaccharide derivative; naphthoate ester | antineoplastic agent |
| argininamide argininamide: RN given refers to parent cpd without isomeric designation. L-arginine amide : An amino acid amide resulting from the formal condensation of the carboxy group of L-arginine with ammonia. | 2.43 | 2 | 0 | amino acid amide; guanidines; L-arginine derivative | |
| 2'-amino-2'-deoxyadenosine [no description available] | 1.96 | 1 | 0 | ||
| obeticholic acid obeticholic acid: A farnesoid X receptor agonist and anticholestatic agent that is used in the treatment of chronic liver diseases; structure in first source.. obeticholic acid : A dihydroxy-5beta-cholanic acid that is chenodeoxycholic acid carrying an additional ethyl substituent at the 6alpha-position. A semi-synthetic bile acid which acts as a farnesoid X receptor agonist and is used for treatment of primary biliary cholangitis. | 2.15 | 1 | 0 | 3alpha-hydroxy steroid; 7alpha-hydroxy steroid; dihydroxy-5beta-cholanic acid | farnesoid X receptor agonist; hepatoprotective agent |
| t0901317 T0901317: an LXRalpha and LXRbeta agonist | 2.08 | 1 | 0 | ||
| y 27632 Y 27632: RN given for di-HCl salt; inhibits Rho-associated protein kinase; inhibits calcium sensitization to affect smooth muscle relaxation; structure in first source. Y-27632 : A monocarboxylic acid amide that is trans-[(1R)-1-aminoethyl]cyclohexanecarboxamide in which one of the nitrogens of the aminocarbony group is substituted by a pyridine nucleus. It has been shown to exhibit inhibitory activity against Rho-associated protein kinase (ROCK) enzyme. | 2.06 | 1 | 0 | aromatic amide | |
| prostaglandin d2 Prostaglandin D2: The principal cyclooxygenase metabolite of arachidonic acid. It is released upon activation of mast cells and is also synthesized by alveolar macrophages. Among its many biological actions, the most important are its bronchoconstrictor, platelet-activating-factor-inhibitory, and cytotoxic effects.. prostaglandin D2 : A member of the class of prostaglandins D that is prosta-5,13-dien-1-oic acid substituted by hydroxy groups at positions 9 and 15 and an oxo group at position 11 (the 5Z,9alpha,13E,15S- stereoisomer). | 3.13 | 5 | 0 | prostaglandins D | human metabolite; mouse metabolite |
| diethylstilbestrol Diethylstilbestrol: A synthetic nonsteroidal estrogen used in the treatment of menopausal and postmenopausal disorders. It was also used formerly as a growth promoter in animals. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), diethylstilbestrol has been listed as a known carcinogen. (Merck, 11th ed). diethylstilbestrol : An olefinic compound that is trans-hex-3-ene in which the hydrogens at positions 3 and 4 have been replaced by p-hydroxyphenyl groups. | 2.6 | 1 | 0 | olefinic compound; polyphenol | antifungal agent; antineoplastic agent; autophagy inducer; calcium channel blocker; carcinogenic agent; EC 1.1.1.146 (11beta-hydroxysteroid dehydrogenase) inhibitor; EC 3.6.3.10 (H(+)/K(+)-exchanging ATPase) inhibitor; endocrine disruptor; xenoestrogen |
| 6-bromoindirubin-3'-oxime 6-bromoindirubin-3'-oxime: structure in first source. 6-bromoindirubin-3'-oxime : A member of the class of biindoles that is indirubin substituted at position 6 by a bromo group and in which the keto group at position 3' has undergone condensation with hydroxylamine to form the corresponding oxime. | 2.15 | 1 | 0 | ||
| alitretinoin Alitretinoin: A retinoid that is used for the treatment of chronic hand ECZEMA unresponsive to topical CORTICOSTEROIDS. It is also used to treat cutaneous lesions associated with AIDS-related KAPOSI SARCOMA. | 2 | 1 | 0 | retinoic acid | antineoplastic agent; keratolytic drug; metabolite; retinoid X receptor agonist |
| h 89 N-(2-(4-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide: structure given in first source. N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide : A member of the class of isoquinolines that is the sulfonamide obtained by formal condensation of the sulfo group of isoquinoline-5-sulfonic acid with the primary amino group of N(1)-[3-(4-bromophenyl)prop-2-en-1-yl]ethane-1,2-diamine. It is a protein kinase A inhibitor.. (E)-N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide : A N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide in which the double bond adopts a trans-configuration. | 2 | 1 | 0 | N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide | |
| afimoxifene afimoxifene : A tertiary amino compound that is tamoxifen in which the phenyl group which is in a Z- relationship to the ethyl substituent is hydroxylated at the para- position. It is the active metabolite of tamoxifen. | 2.05 | 1 | 0 | phenols; tertiary amino compound | antineoplastic agent; estrogen receptor antagonist; metabolite |
| imidazolidines [no description available] | 2.03 | 1 | 0 | azacycloalkane; imidazolidines; saturated organic heteromonocyclic parent | |
| decitabine [no description available] | 4.55 | 7 | 0 | 2'-deoxyribonucleoside | |
| texas red Texas red: hydrophilic Texas red; structure given in first source | 3.29 | 6 | 0 | organic heteroheptacyclic compound | fluorochrome |
| troxacitabine troxacitabine: shows good anti-HIV activity without cytotoxicity | 2 | 1 | 0 | carbohydrate derivative; nucleobase-containing molecular entity | |
| kt 5720 KT 5720: indolocarbazole; synthetic derivative of K 252a. KT 5720 : An organic heterooctacyclic compound that is 1H,1'H-2,2'-biindole in which the nitrogens have undergone formal oxidative coupling to positions 2 and 5 of hexyl (3S)-3-hydroxy-2-methyltetrahydrofuran-3-carboxylate (the 2R,3S,5S product), and in which the 3 and 3' positions of the biindole moiety have also undergone formal oxidative coupling to positions 3 and 4 of 1,5-dihydro-2H-pyrrol-2-one. | 2.01 | 1 | 0 | carboxylic ester; gamma-lactam; hemiaminal; indolocarbazole; organic heterooctacyclic compound; semisynthetic derivative; tertiary alcohol | EC 2.7.11.11 (cAMP-dependent protein kinase) inhibitor |
| dactinomycin Dactinomycin: A compound composed of a two CYCLIC PEPTIDES attached to a phenoxazine that is derived from STREPTOMYCES parvullus. It binds to DNA and inhibits RNA synthesis (transcription), with chain elongation more sensitive than initiation, termination, or release. As a result of impaired mRNA production, protein synthesis also declines after dactinomycin therapy. (From AMA Drug Evaluations Annual, 1993, p2015) | 6.51 | 62 | 0 | actinomycin | mutagen |
| aphidicolin Aphidicolin: An antiviral antibiotic produced by Cephalosporium aphidicola and other fungi. It inhibits the growth of eukaryotic cells and certain animal viruses by selectively inhibiting the cellular replication of DNA polymerase II or the viral-induced DNA polymerases. The drug may be useful for controlling excessive cell proliferation in patients with cancer, psoriasis or other dermatitis with little or no adverse effect upon non-multiplying cells.. aphidicolin : A tetracyclic diterpenoid that has an tetradecahydro-8,11a-methanocyclohepta[a]naphthalene skeleton with two hydroxymethyl substituents at positions 4 and 9, two methyl substituents at positions 4 and 11b and two hydroxy substituents at positions 3 and 9. An antibiotic with antiviral and antimitotical properties. Aphidicolin is a reversible inhibitor of eukaryotic nuclear DNA replication. | 3.1 | 5 | 0 | tetracyclic diterpenoid | antimicrobial agent; antimitotic; antineoplastic agent; antiviral drug; apoptosis inducer; Aspergillus metabolite; DNA synthesis inhibitor; EC 2.7.7.7 (DNA-directed DNA polymerase) inhibitor; fungal metabolite |
| db293 DB293: structure in first source | 2.01 | 1 | 0 | ||
| azaserine Azaserine: Antibiotic substance produced by various Streptomyces species. It is an inhibitor of enzymatic activities that involve glutamine and is used as an antineoplastic and immunosuppressive agent.. azaserine : A carboxylic ester resulting from the formal condensation of the carboxy group of diazoacetic acid with the alcoholic hydroxy group of L-serine. An antibiotic produced by a Streptomyces species. | 1.95 | 1 | 0 | carboxylic ester; diazo compound; L-serine derivative; non-proteinogenic L-alpha-amino acid | antifungal agent; antimetabolite; antimicrobial agent; antineoplastic agent; glutamine antagonist; immunosuppressive agent; metabolite |
| melphalan Melphalan: An alkylating nitrogen mustard that is used as an antineoplastic in the form of the levo isomer - MELPHALAN, the racemic mixture - MERPHALAN, and the dextro isomer - MEDPHALAN; toxic to bone marrow, but little vesicant action; potential carcinogen.. melphalan : A phenylalanine derivative comprising L-phenylalanine having [bis(2-chloroethyl)amino group at the 4-position on the phenyl ring. | 3.05 | 1 | 0 | L-phenylalanine derivative; nitrogen mustard; non-proteinogenic L-alpha-amino acid; organochlorine compound | alkylating agent; antineoplastic agent; carcinogenic agent; drug allergen; immunosuppressive agent |
| enkephalin, leucine Enkephalin, Leucine: One of the endogenous pentapeptides with morphine-like activity. It differs from MET-ENKEPHALIN in the LEUCINE at position 5. Its first four amino acid sequence is identical to the tetrapeptide sequence at the N-terminal of BETA-ENDORPHIN.. Leu-enkephalin : A pentapeptide comprising L-tyrosine, glycine, glycine, L-phenylalanine and L-leucine residues joined in sequence by peptide linkages. It is an endogenous opioid peptide produced in vertebrate species, including rodents, primates and humans that results from decomposition of proenkephalin or dynorphin and exhibits antinociceptive properties. | 3.85 | 12 | 0 | pentapeptide; peptide zwitterion | analgesic; delta-opioid receptor agonist; human metabolite; mu-opioid receptor agonist; neurotransmitter; rat metabolite |
| benzyloxycarbonylleucyl-leucyl-leucine aldehyde benzyloxycarbonylleucyl-leucyl-leucine aldehyde: proteasome inhibitor. N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal : A tripeptide that is L-leucyl-L-leucyl-L-leucine in which the C-terminal carboxy group has been reduced to the corresponding aldehyde and the N-terminal amino group is protected as its benzyloxycarbonyl derivative. | 2.02 | 1 | 0 | amino aldehyde; carbamate ester; tripeptide | proteasome inhibitor |
| tenofovir tenofovir (anhydrous) : A member of the class of phosphonic acids that is methylphosphonic acid in which one of the methyl hydrogens is replaced by a [(2R)-1-(6-amino-9H-purin-9-yl)propan-2-yl]oxy group. An inhibitor of HIV-1 reverse transcriptase, the bis(isopropyloxycarbonyloxymethyl) ester (disoproxil ester) prodrug is used as the fumaric acid salt in combination therapy for the treatment of HIV infection. | 2.21 | 1 | 0 | nucleoside analogue; phosphonic acids | antiviral drug; drug metabolite; HIV-1 reverse transcriptase inhibitor |
| bromodeoxycytidine Bromodeoxycytidine: 5-Bromo-2'-deoxycytidine. Can be incorporated into DNA in the presence of DNA polymerase, replacing dCTP. | 2.42 | 2 | 0 | ||
| l 731988 L 731988: structure in first source | 3.12 | 1 | 0 | ||
| 5-hydroxy-2'-deoxycytidine 5-hydroxy-2'-deoxycytidine: a major oxidation product of 2'-deoxycytidine | 6.99 | 1 | 0 | ||
| oxanosine oxanosine: from Streptomyces capreolus MG265-CF3; has weak anti-bacterial action; structure in first source | 2.02 | 1 | 0 | ||
| 2'-deoxyoxanosine 2'-deoxyoxanosine: structure given in first source | 1.99 | 1 | 0 | ||
| shikonin shikonin: a naphthazarin; has antineoplastic and angiogenesis inhibiting activities | 2.04 | 1 | 0 | hydroxy-1,4-naphthoquinone | |
| riboflavin vitamin B2 : Any member of a group of vitamers that belong to the chemical structural class called flavins that exhibit biological activity against vitamin B2 deficiency. Symptoms associated with vitamin B2 deficiency include glossitis, seborrhea, angular stomaitis, cheilosis and photophobia. The vitamers include riboflavin and its phosphate derivatives (and includes their salt, ionised and hydrate forms). | 2.96 | 4 | 0 | flavin; vitamin B2 | anti-inflammatory agent; antioxidant; cofactor; Escherichia coli metabolite; food colouring; fundamental metabolite; human urinary metabolite; mouse metabolite; photosensitizing agent; plant metabolite |
| 2'-c-methyluridine 2'-C-methyluridine: structure in first source | 2.05 | 1 | 0 | ||
| tyrosine o-sulfate O(4')-sulfo-L-tyrosine : An O-sulfoamino acid that is L-tyrosine in which the phenolic hydrogen has been replaced by a sulfo group. | 2.04 | 1 | 0 | aryl sulfate; L-tyrosine derivative; O-sulfoamino acid | human metabolite |
| 5-fluoro-2'-deoxycytidine 5-fluoro-2'-deoxycytidine: structure | 2.03 | 1 | 0 | ||
| potassium permanganate Potassium Permanganate: Permanganic acid (HMnO4), potassium salt. A highly oxidative, water-soluble compound with purple crystals, and a sweet taste. (From McGraw-Hill Dictionary of Scientific and Technical Information, 4th ed) | 3.89 | 12 | 0 | ||
| potassium perchlorate potassium perchlorate: thyroid antagonist; structure | 2 | 1 | 0 | ||
| potassium acetate Potassium Acetate: A potassium salt used to replenish ELECTROLYTES, for restoration of WATER-ELECTROLYTE BALANCE, as well as a urinary and systemic alkalizer, which can be administered orally or by intravenous infusion. Formerly, it was used in DIURETICS and EXPECTORANTS.. potassium acetate : A potassium salt comprising equal numbers of potassium and acetate ions | 1.99 | 1 | 0 | potassium salt | food acidity regulator |
| sodium acetate, anhydrous Sodium Acetate: The trihydrate sodium salt of acetic acid, which is used as a source of sodium ions in solutions for dialysis and as a systemic and urinary alkalizer, diuretic, and expectorant. | 2.72 | 3 | 0 | organic sodium salt | NMR chemical shift reference compound |
| ammonium acetate ammonium acetate : An ammonium salt obtained by reaction of ammonia with acetic acid. A deliquescent white crystalline solid, it has a relatively low melting point (114degreeC) for a salt. Used as a food acidity regulator, although no longer approved for this purpose in the EU. | 3.51 | 8 | 0 | acetate salt; ammonium salt | buffer; food acidity regulator |
| sodium perchlorate sodium perchlorate : An inorganic sodium salt comprising equal numbers of sodium and perchlorate ions. | 8.1 | 5 | 0 | inorganic sodium salt | |
| oxazolidine oxazolidine: structure given in first source | 2.31 | 1 | 0 | oxazolidine | |
| 10,12-tricosadiynoic acid [no description available] | 2.02 | 1 | 0 | very long-chain fatty acid | |
| bromochloroacetic acid Keratins: A class of fibrous proteins or scleroproteins that represents the principal constituent of EPIDERMIS; HAIR; NAILS; horny tissues, and the organic matrix of tooth ENAMEL. Two major conformational groups have been characterized, alpha-keratin, whose peptide backbone forms a coiled-coil alpha helical structure consisting of TYPE I KERATIN and a TYPE II KERATIN, and beta-keratin, whose backbone forms a zigzag or pleated sheet structure. alpha-Keratins have been classified into at least 20 subtypes. In addition multiple isoforms of subtypes have been found which may be due to GENE DUPLICATION.. bromochloroacetic acid : A monocarboxylic acid that is acetic acid in which one of the methyl hydrogens is replaced by bromine while a second is replaced by chlorine. A low-melting (27.5-31.5degreeC), hygroscopic crystalline solid, it can be formed during the disinfection (by chlorination) of water that contains bromide ions and organic matter, so can occur in drinking water as a byproduct of the disinfection process. | 4.07 | 15 | 0 | 2-bromocarboxylic acid; monocarboxylic acid; organochlorine compound | |
| 6-mercapto-1-hexanol [no description available] | 2.02 | 1 | 0 | ||
| calix(4)arene calix(4)arene: a cyclophane consisting of four phenolic units linked by methylene groups; structure in first source | 2.43 | 2 | 0 | ||
| cinnamaldehyde 3-phenylprop-2-enal : A member of the class of cinnamaldehydes that is prop-2-enal in which a hydrogen at position 3 has been replaced by a phenyl group. The configuration of the double bond is not specified; the name "cinnamaldehyde" is widely used to refer to the E (trans) isomer.. (E)-cinnamaldehyde : The E (trans) stereoisomer of cinnamaldehyde, the parent of the class of cinnamaldehydes. | 2.03 | 1 | 0 | 3-phenylprop-2-enal; cinnamaldehydes | antifungal agent; EC 4.3.1.24 (phenylalanine ammonia-lyase) inhibitor; flavouring agent; hypoglycemic agent; plant metabolite; sensitiser; vasodilator agent |
| geraniol [no description available] | 2.08 | 1 | 0 | 3,7-dimethylocta-2,6-dien-1-ol; monoterpenoid; primary alcohol | allergen; fragrance; plant metabolite; volatile oil component |
| dimethyl fumarate [no description available] | 2.1 | 1 | 0 | diester; enoate ester; methyl ester | antipsoriatic; immunomodulator |
| glycosides [no description available] | 6.39 | 22 | 0 | ||
| chalcone trans-chalcone : The trans-isomer of chalcone. | 2.41 | 1 | 0 | chalcone | EC 3.2.1.1 (alpha-amylase) inhibitor |
| isomethyleugenol Methylation: Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed) | 9.85 | 191 | 0 | isomethyleugenol | |
| retinaldehyde Retinaldehyde: A diterpene derived from the carotenoid VITAMIN A which functions as the active component of the visual cycle. It is the prosthetic group of RHODOPSIN (i.e., covalently bonded to ROD OPSIN as 11-cis-retinal). When stimulated by visible light, rhodopsin transforms this cis-isomer of retinal to the trans-isomer (11-trans-retinal). This transformation straightens-out the bend of the retinal molecule and causes a change in the shape of rhodopsin triggering the visual process. A series of energy-requiring enzyme-catalyzed reactions convert the 11-trans-retinal back to the cis-isomer.. all-trans-retinal : A retinal in which all four exocyclic double bonds have E- (trans-) geometry. | 1.97 | 1 | 0 | retinal; vitamin A | gap junctional intercellular communication inhibitor; human metabolite; mouse metabolite |
| squalene Addavax: an oil-water nanoemulsion and adjuvant containing squalene, Tween 80, and sorbitane trioleate | 2.51 | 2 | 0 | triterpene | human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| stilbenes Stilbenes: Organic compounds that contain 1,2-diphenylethylene as a functional group.. trans-stilbene : The trans-isomer of stilbene. | 3.76 | 10 | 0 | stilbene | |
| p-hydroxycinnamaldehyde p-hydroxycinnamaldehyde: an antibacterial substance from the saw fly, Acantholyda parki S.; structure in first source. 4-hydroxycinnamaldehyde : A cinnamaldehyde that is (E)-cinnamaldehyde substituted at position 4 on the phenyl ring by a hydroxy group. | 2.03 | 1 | 0 | cinnamaldehydes | apoptosis inducer; EC 1.14.13.39 (nitric oxide synthase) inhibitor; plant metabolite |
| cardamonin cardamonin: found in Zingiberaceae; structure in first source | 2.08 | 1 | 0 | chalcones | |
| floxuridine [no description available] | 2.08 | 1 | 0 | ||
| flavin-adenine dinucleotide Flavin-Adenine Dinucleotide: A condensation product of riboflavin and adenosine diphosphate. The coenzyme of various aerobic dehydrogenases, e.g., D-amino acid oxidase and L-amino acid oxidase. (Lehninger, Principles of Biochemistry, 1982, p972) | 2.95 | 4 | 0 | flavin adenine dinucleotide; vitamin B2 | cofactor; Escherichia coli metabolite; human metabolite; mouse metabolite; prosthetic group |
| arginine vasopressin Arginine Vasopressin: The predominant form of mammalian antidiuretic hormone. It is a nonapeptide containing an ARGININE at residue 8 and two disulfide-linked cysteines at residues of 1 and 6. Arg-vasopressin is used to treat DIABETES INSIPIDUS or to improve vasomotor tone and BLOOD PRESSURE.. argipressin : The predominant form of mammalian vasopressin (antidiuretic hormone). It is a nonapeptide containing an arginine at residue 8 and two disulfide-linked cysteines at residues of 1 and 6. | 3.07 | 5 | 0 | vasopressin | cardiovascular drug; hematologic agent; mitogen |
| pyrophosphate Diphosphates: Inorganic salts of phosphoric acid that contain two phosphate groups. | 6.36 | 31 | 0 | diphosphate ion | |
| gw9662 2-chloro-5-nitrobenzanilide: pretreatment of peroxisome proliferator activated receptors with GW9662 results in the irreversible loss of ligand binding | 2.05 | 1 | 0 | benzamides | |
| s 1033 [no description available] | 4.35 | 3 | 0 | (trifluoromethyl)benzenes; imidazoles; pyridines; pyrimidines; secondary amino compound; secondary carboxamide | anticoronaviral agent; antineoplastic agent; tyrosine kinase inhibitor |
| acetyl-aspartyl-glutamyl-valyl-aspartal acetyl-aspartyl-glutamyl-valyl-aspartal: a capase inhibitor. Ac-Asp-Glu-Val-Asp-H : A tetrapeptide consisting of two L-aspartic acid residues, an L-glutamyl residue and an L-valine residue with an acetyl group at the N-terminal and with the C-terminal carboxy group reduced to an aldehyde. It is an inhibitor of caspase-3/7. | 2.01 | 1 | 0 | tetrapeptide | protease inhibitor |
| amygdalin [no description available] | 1.98 | 1 | 0 | ||
| trilostane trilostane: inhibits conversion of pregnenolone to progesterone; adrenal blocking agent used in treatment of Cushing's syndrome. trilostane : An epoxy steroid that is 3,17beta-dihydroxy-5alpha-androst-2-ene-2-carbonitrile in which the oxygen of the epoxy group is joined to the 4alpha and 5 alpha positions. | 3.18 | 1 | 0 | 17beta-hydroxy steroid; 3-hydroxy steroid; androstanoid; epoxy steroid; nitrile | abortifacient; antineoplastic agent; EC 1.1.1.210 [3beta(or 20alpha)-hydroxysteroid dehydrogenase] inhibitor |
| isopropyl thiogalactoside Isopropyl Thiogalactoside: A non-metabolizable galactose analog that induces expression of the LAC OPERON.. isopropyl beta-D-thiogalactopyranoside : An S-glycosyl compound consisting of beta-D-1-thiogalactose having an isopropyl group attached to the anomeric sulfur. | 2.7 | 3 | 0 | S-glycosyl compound | |
| fludarabine [no description available] | 3.12 | 5 | 0 | purine nucleoside | |
| sesquiterpenes [no description available] | 2.71 | 3 | 0 | ||
| benzoylacrylic acid benzoylacrylic acid: structure in first source | 2.31 | 1 | 0 | ||
| thioinosine Thioinosine: Sulfhydryl analog of INOSINE that inhibits nucleoside transport across erythrocyte plasma membranes, and has immunosuppressive properties. It has been used similarly to MERCAPTOPURINE in the treatment of leukemia. (From Martindale, The Extra Pharmacopoeia, 30th ed, p503) | 2.01 | 1 | 0 | ||
| phenylthiourea Phenylthiourea: Phenylthiourea is a THIOUREA derivative containing a phenyl ring. Depending on their genetic makeup, humans can find it either bitter-tasting or tasteless.. N-phenylthiourea : A member of the class of thioureas that is thiourea in which one of the hydrogens is replaced by a phenyl group. Depending on their genetic makeup, humans find it either very bitter-tasting or tasteless. This unusual property resulted in N-phenylthiourea being used in paternity testing prior to the advent of DNA testing. | 2.04 | 1 | 0 | thioureas | EC 1.14.18.1 (tyrosinase) inhibitor |
| 2-mercaptobenzimidazole 2-mercaptobenzimidazole: purine synthesis antimetabolite; RN given refers to parent cpd | 2.11 | 1 | 0 | ||
| 2-thiothymine 2-thiothymine: structure given in first source | 7.79 | 3 | 0 | ||
| curcumin Curcumin: A yellow-orange dye obtained from tumeric, the powdered root of CURCUMA longa. It is used in the preparation of curcuma paper and the detection of boron. Curcumin appears to possess a spectrum of pharmacological properties, due primarily to its inhibitory effects on metabolic enzymes.. curcumin : A beta-diketone that is methane in which two of the hydrogens are substituted by feruloyl groups. A natural dyestuff found in the root of Curcuma longa. | 4.24 | 5 | 0 | aromatic ether; beta-diketone; diarylheptanoid; enone; polyphenol | anti-inflammatory agent; antifungal agent; antineoplastic agent; biological pigment; contraceptive drug; dye; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; EC 1.1.1.21 (aldehyde reductase) inhibitor; EC 1.1.1.25 (shikimate dehydrogenase) inhibitor; EC 1.6.5.2 [NAD(P)H dehydrogenase (quinone)] inhibitor; EC 1.8.1.9 (thioredoxin reductase) inhibitor; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor; EC 3.5.1.98 (histone deacetylase) inhibitor; flavouring agent; food colouring; geroprotector; hepatoprotective agent; immunomodulator; iron chelator; ligand; lipoxygenase inhibitor; metabolite; neuroprotective agent; nutraceutical; radical scavenger |
| 2-thio-6-azathymine [no description available] | 1.98 | 1 | 0 | ||
| 5-iodouridine 5-iodouridine: RN given refers to unlabeled cpd | 2.78 | 3 | 0 | ||
| thiouracil Thiouracil: Occurs in seeds of Brassica and Crucifera species. Thiouracil has been used as antithyroid, coronary vasodilator, and in congestive heart failure although its use has been largely supplanted by other drugs. It is known to cause blood dyscrasias and suspected of terato- and carcinogenesis.. thiouracil : A nucleobase analogue that is uracil in which the oxo group at C-2 is replaced by a thioxo group. | 8.28 | 6 | 0 | nucleobase analogue; thiocarbonyl compound | antithyroid drug; metabolite |
| triethylammonium cation triethylammonium ion : An organoammonium cation having three ethyl substituents on the nitrogen atom. | 2.15 | 1 | 0 | ammonium ion derivative | |
| sulindac Sulindac: A sulfinylindene derivative prodrug whose sulfinyl moiety is converted in vivo to an active NSAID analgesic. Specifically, the prodrug is converted by liver enzymes to a sulfide which is excreted in the bile and then reabsorbed from the intestine. This helps to maintain constant blood levels with reduced gastrointestinal side effects.. sulindac : A monocarboxylic acid that is 1-benzylidene-1H-indene which is substituted at positions 2, 3, and 5 by methyl, carboxymethyl, and fluorine respectively, and in which the phenyl group of the benzylidene moiety is substituted at the para position by a methylsulfinyl group. It is a prodrug for the corresponding sulfide, a non-steroidal anti-inflammatory drug, used particularly in the treatment of acute and chronic inflammatory conditions. | 2.01 | 1 | 0 | monocarboxylic acid; organofluorine compound; sulfoxide | analgesic; antineoplastic agent; antipyretic; apoptosis inducer; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; prodrug; tocolytic agent |
| oxazolone Oxazolone: Immunologic adjuvant and sensitizing agent. | 2.4 | 2 | 0 | ||
| fatostatin fatostatin: inhibits activation of SREBP; structure in first source | 2.11 | 1 | 0 | thiazoles | |
| threoninol [no description available] | 3.35 | 6 | 0 | ||
| thioguanine anhydrous Thioguanine: An antineoplastic compound which also has antimetabolite action. The drug is used in the therapy of acute leukemia.. tioguanine : A 2-aminopurine that is the 6-thiono derivative of 2-amino-1,9-dihydro-6H-purine. Incorporates into DNA and inhibits synthesis. Used in the treatment of leukaemia. | 3.13 | 5 | 0 | 2-aminopurines | anticoronaviral agent; antimetabolite; antineoplastic agent |
| thiobarbituric acid thiobarbituric acid: RN given refers to parent cpd. 2-thiobarbituric acid : A barbiturate, the structure of which is that of barbituric acid in which the oxygen at C-2 is replaced by sulfur. | 2.01 | 1 | 0 | barbiturates | allergen; reagent |
| thiourea Thiourea: A photographic fixative used also in the manufacture of resins. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), this substance may reasonably be anticipated to be a carcinogen (Merck Index, 9th ed). Many of its derivatives are ANTITHYROID AGENTS and/or FREE RADICAL SCAVENGERS.. thiourea : The simplest member of the thiourea class, consisting of urea with the oxygen atom substituted by sulfur. | 3.27 | 6 | 0 | one-carbon compound; thioureas; ureas | antioxidant; chromophore |
| D-fructopyranose [no description available] | 2 | 1 | 0 | cyclic hemiketal; D-fructose; fructopyranose | sweetening agent |
| thioacetamide Thioacetamide: A crystalline compound used as a laboratory reagent in place of HYDROGEN SULFIDE. It is a potent hepatocarcinogen.. thioacetamide : A thiocarboxamide consiting of acetamide having the oxygen replaced by sulfur. | 2.46 | 2 | 0 | thiocarboxamide | hepatotoxic agent |
| tempo TEMPO: structure. TEMPO : A member of the class of aminoxyls that is piperidine that carries an oxidanediyl group at position 1 and methyl groups at positions 2, 2, 6, and 6, respectively. | 7.94 | 4 | 0 | aminoxyls; piperidines | catalyst; ferroptosis inhibitor; radical scavenger |
| ferric ferrocyanide ferric ferrocyanide: antidote to thallium poisoning; RN given refers to Fe(+3)[3:4] salt; structure | 2.6 | 1 | 0 | ||
| brij-58 Cetomacrogol: Non-ionic surfactant of the polyethylene glycol family. It is used as a solubilizer and emulsifying agent in foods, cosmetics, and pharmaceuticals, often as an ointment base, and also as a research tool. | 2.42 | 2 | 0 | ||
| digoxin Digoxin: A cardiotonic glycoside obtained mainly from Digitalis lanata; it consists of three sugars and the aglycone DIGOXIGENIN. Digoxin has positive inotropic and negative chronotropic activity. It is used to control ventricular rate in ATRIAL FIBRILLATION and in the management of congestive heart failure with atrial fibrillation. Its use in congestive heart failure and sinus rhythm is less certain. The margin between toxic and therapeutic doses is small. (From Martindale, The Extra Pharmacopoeia, 30th ed, p666). digoxin : A cardenolide glycoside that is digitoxin beta-hydroxylated at C-12. A cardiac glycoside extracted from the foxglove plant, Digitalis lanata, it is used to control ventricular rate in atrial fibrillation and in the management of congestive heart failure with atrial fibrillation, but the margin between toxic and therapeutic doses is small. | 2.21 | 1 | 0 | cardenolide glycoside; steroid saponin | anti-arrhythmia drug; cardiotonic drug; EC 3.6.3.9 (Na(+)/K(+)-transporting ATPase) inhibitor; epitope |
| 6-thioguanosine 6-thioguanosine: RN given refers to cpd without isomeric designation | 1.99 | 1 | 0 | purine nucleoside | |
| fumonisin b1 fumonisin B1: isolated from Fusarium moniliforme MRC 826; structure given in first source; has cancer-promoting activity; inhibits ceramide synthase. fumonisin B1 : A diester that results from the condensation of the 1-carboxy groups of two molecules of propane-1,2,3-tricarboxylic acid with hydroxy groups at positions 14 and 15 of (2S,3S,5R,10R,12S,14S,15R,16R)-2-amino-12,16-dimethylicosane-3,5,10,14,15-pentol. | 2.47 | 2 | 0 | diester; fumonisin; primary amino compound; triol | carcinogenic agent; metabolite |
| tamoxifen [no description available] | 3.28 | 6 | 0 | stilbenoid; tertiary amino compound | angiogenesis inhibitor; antineoplastic agent; bone density conservation agent; EC 1.2.3.1 (aldehyde oxidase) inhibitor; EC 2.7.11.13 (protein kinase C) inhibitor; estrogen antagonist; estrogen receptor antagonist; estrogen receptor modulator |
| nadp [no description available] | 3.28 | 6 | 0 | ||
| 8-azidoadenosine 5'-triphosphate [no description available] | 2.4 | 2 | 0 | ||
| n-cyanoimidazole N-cyanoimidazole: structure given in first source | 2.1 | 1 | 0 | ||
| 5-carboxytetramethylrhodamine succinimidyl ester [no description available] | 4.85 | 10 | 0 | ||
| 5-carboxytetramethylrhodamine 5-carboxytetramethylrhodamine: structure in first source. 5-carboxytetramethylrhodamine : A tetramethylrhodamine compound having a carboxy substituent at the 5-position | 2.05 | 1 | 0 | xanthenes | fluorochrome |
| 6-carboxytetramethylrhodamine [no description available] | 2.01 | 1 | 0 | ||
| sc 514 SC 514: inhibits IkappaB kinase-2; structure in first source | 2.06 | 1 | 0 | ring assembly; thiophenes | |
| krn 7000 KRN 7000: has an alpha-galactosylceramide structure; structure given in first source. alpha-galactosylceramide : A galactosylceramide in which the galactosyl residue has alpha anomeric conofiguration.. 1-O-(alpha-D-galactosyl)-N-hexacosanoylphytosphingosine : A glycophytoceramide having an alpha-D-galactosyl residue at the O-1 position and a hexacosanoyl group attached to the nitrogen. | 2.03 | 1 | 0 | glycophytoceramide; N-acyl-beta-D-galactosylphytosphingosine | allergen; antigen; antineoplastic agent; epitope; immunological adjuvant |
| methyl-thiohydantoin-tryptophan methyl-thiohydantoin-tryptophan: structure in first source | 2.11 | 1 | 0 | organonitrogen compound; organooxygen compound | |
| fusidic acid Fusidic Acid: An antibiotic isolated from the fermentation broth of Fusidium coccineum. (From Merck Index, 11th ed). It acts by inhibiting translocation during protein synthesis.. fusidic acid : A steroid antibiotic that is isolated from the fermentation broth of Fusidium coccineum. | 1.95 | 1 | 0 | 11alpha-hydroxy steroid; 3alpha-hydroxy steroid; alpha,beta-unsaturated monocarboxylic acid; steroid acid; steroid antibiotic; sterol ester | EC 2.7.1.33 (pantothenate kinase) inhibitor; Escherichia coli metabolite; protein synthesis inhibitor |
| lincomycin Lincomycin: An antibiotic produced by Streptomyces lincolnensis var. lincolnensis. It has been used in the treatment of staphylococcal, streptococcal, and Bacteroides fragilis infections.. lincomycin : A carbohydrate-containing antibiotic produced by the actinomyces Streptomyces lincolnensis. | 2.4 | 2 | 0 | carbohydrate-containing antibiotic; L-proline derivative; monocarboxylic acid amide; pyrrolidinecarboxamide; S-glycosyl compound | antimicrobial agent; bacterial metabolite |
| beta-2'-deoxythioguanosine beta-2'-deoxythioguanosine: RN given refers to parent cpd | 2.42 | 2 | 0 | ||
| valinomycin Valinomycin: A cyclododecadepsipeptide ionophore antibiotic produced by Streptomyces fulvissimus and related to the enniatins. It is composed of 3 moles each of L-valine, D-alpha-hydroxyisovaleric acid, D-valine, and L-lactic acid linked alternately to form a 36-membered ring. (From Merck Index, 11th ed) Valinomycin is a potassium selective ionophore and is commonly used as a tool in biochemical studies.. valinomycin : A twelve-membered cyclodepsipeptide composed of three repeating D-alpha-hydroxyisovaleryl-D-valyl-L-lactoyl-L-valyl units joined in sequence. An antibiotic found in several Streptomyces strains. | 3.05 | 1 | 0 | cyclodepsipeptide; macrocycle | antimicrobial agent; antiviral agent; bacterial metabolite; potassium ionophore |
| ranitidine Ranitidine: A non-imidazole blocker of those histamine receptors that mediate gastric secretion (H2 receptors). It is used to treat gastrointestinal ulcers.. ranitidine : A member of the class of furans used to treat peptic ulcer disease (PUD) and gastroesophageal reflux disease. | 1.99 | 1 | 0 | C-nitro compound; furans; organic sulfide; tertiary amino compound | anti-ulcer drug; drug allergen; environmental contaminant; H2-receptor antagonist; xenobiotic |
| 2-thiothymidine 2-thiothymidine: structure given in first source | 7.72 | 3 | 0 | ||
| 2'-deoxytubercidin 2'-deoxytubercidin: structure given in first source. 2'-deoxytubercidin : An N-glycosylpyrrolopyrimidine that is tubercidin in which the hydroxy group at position 2 of the ribose moiety has been replaced by a hydrogen. | 2.99 | 4 | 0 | deoxyribonucleoside; N-glycosylpyrrolopyrimidine | |
| u 0126 U 0126: protein kinase kinase inhibitor; structure in first source | 2.44 | 2 | 0 | aryl sulfide; dinitrile; enamine; substituted aniline | antineoplastic agent; antioxidant; apoptosis inducer; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; osteogenesis regulator; vasoconstrictor agent |
| telaprevir [no description available] | 4.41 | 1 | 1 | cyclopentapyrrole; cyclopropanes; oligopeptide; pyrazines | antiviral drug; hepatitis C protease inhibitor; peptidomimetic |
| 5-hydroxycytosine [no description available] | 2.74 | 3 | 0 | ||
| 7-mercaptoheptanoic acid 7-mercaptoheptanoic acid: found in methanogenic bacteria; RN & structure given in first source | 2.03 | 1 | 0 | medium-chain fatty acid | |
| tetomilast [no description available] | 3.35 | 1 | 0 | ||
| 6-methyl-2-(phenylethynyl)pyridine 6-methyl-2-(phenylethynyl)pyridine: an mGlu5 antagonist. 2-methyl-6-(phenylethynyl)pyridine : A methylpyridine that coinsists of 2-methylp[yridine bearing an additional phenylethynyl group at position 6. Potent and highly selective non-competitive antagonist at the mGlu5 receptor subtype (IC50 = 36 nM) and a positive allosteric modulator at mGlu4 receptors. Centrally active following systemic administration in vivo. Reverses mechanical hyperalgesia in the inflamed rat hind paw. | 2.25 | 1 | 0 | acetylenic compound; methylpyridines | anxiolytic drug; metabotropic glutamate receptor antagonist |
| lithium Lithium: An element in the alkali metals family. It has the atomic symbol Li, atomic number 3, and atomic weight [6.938; 6.997]. Salts of lithium are used in treating BIPOLAR DISORDER. | 3.59 | 9 | 0 | alkali metal atom | |
| alpha-sarcin alpha-sarcin: basic protein 150 aa, MW 16 kDa; isolated from aspergillus giganteus; sequence similarity with ribonucleases such as RIBONUCLEASE T1; 85% identity with restrictocin; a ribotoxin cleaving the phosphodiester bond on the 3' side of G4325 in the alpha-sarcin/ricin domain of rat 28S RIBOSOMAL RNA; sometimes called a ribosome-inactivating protein but falls outside the normal definition of plant RIP that de-adenylate rRNA | 8.24 | 6 | 0 | ||
| cobaltous chloride cobaltous chloride: RN given refers to unlabeled cpd; RN in Chemline for cobalt trichloride: 10241-04-0; RN for 60-labeled cpd: 14543-09-0; RN for 57-labeled cpd: 164113-89-1; RN for 58-labeled cpd: 29377-09-1; structure. cobalt dichloride : A cobalt salt in which the cobalt metal is in the +2 oxidation state and the counter-anion is chloride. It is used as an indicator for water in desiccants. | 2.42 | 2 | 0 | cobalt salt; inorganic chloride | allergen; calcium channel blocker; sensitiser; two-colour indicator |
| nitrogen dioxide Nitrogen Dioxide: Nitrogen oxide (NO2). A highly poisonous gas. Exposure produces inflammation of lungs that may only cause slight pain or pass unnoticed, but resulting edema several days later may cause death. (From Merck, 11th ed) It is a major atmospheric pollutant that is able to absorb UV light that does not reach the earth's surface. | 2.42 | 2 | 0 | nitrogen oxide | |
| thiouridine Thiouridine: A photoactivable URIDINE analog that is used as an affinity label.. 4-thiouridine : A thiouridine in which the oxygen replaced by sulfur is that at C-4. | 4.61 | 26 | 0 | nucleoside analogue; thiouridine | affinity label; antimetabolite |
| dermatan sulfate Dermatan Sulfate: A naturally occurring glycosaminoglycan found mostly in the skin and in connective tissue. It differs from CHONDROITIN SULFATE A (see CHONDROITIN SULFATES) by containing IDURONIC ACID in place of glucuronic acid, its epimer, at carbon atom 5. (from Merck, 12th ed). alpha-L-IdopA-(1->3)-beta-D-GalpNAc4S : An oligosaccharide sulfate that is 2-acetamido-2-deoxy-4-O-sulfo-beta-D-galactopyranose in which the hydroxy group at position 3 has been converted to the corresponding alpha-L-idopyranuronoside.. dermatan sulfate : Any of a group of glycosaminoglycans with repeating units consisting of variously sulfated beta1->4-linked L-iduronyl-(alpha1->3)-N-acetyl-D-galactosamine units. | 3.47 | 2 | 0 | amino disaccharide; glycosylgalactose derivative; iduronic acids; oligosaccharide sulfate | |
| tamoxifen aziridine tamoxifen aziridine: estrogen receptor inactivator; structure given in first source | 1.99 | 1 | 0 | ||
| quinine [no description available] | 2.69 | 3 | 0 | cinchona alkaloid | antimalarial; muscle relaxant; non-narcotic analgesic |
| deoxy-4-thiothymidine 4-thiothymidine: structure in first source | 2.96 | 4 | 0 | ||
| 4-thio-2'-deoxyuridine 4-thio-2'-deoxyuridine: RN in Chemline for 2-thio-isomer: 2i35059-12-2 | 2.98 | 4 | 0 | ||
| 1,2-bis(2-aminophenoxy)ethane n,n,n',n'-tetraacetic acid acetoxymethyl ester [no description available] | 2.7 | 3 | 0 | ||
| thymidine glycol thymidine glycol: RN given refers to cpd without isomeric designation | 3.18 | 1 | 0 | pyrimidine 2'-deoxyribonucleoside | |
| deltorphin deltorphin: isolated from skin of Phyllomedusa sauvagei; has affinity to opioid receptor; note deltorphin I and deltorphin II are available, they have Ala in position 2 | 1.99 | 1 | 0 | peptide | |
| atp gamma-p-azidoanilide ATP gamma-p-azidoanilide: photoaffinity label | 1.96 | 1 | 0 | ||
| e 7010 E 7010: inhibits tubulin polymerization; structure given in first source | 3.14 | 1 | 0 | sulfonamide | |
| 2-thiouridine [no description available] | 8.14 | 5 | 0 | nucleoside analogue; thiouridine | |
| ospemifene Ospemifene: structure in first source. ospemifene : An organochlorine compound that is a selective estrogen receptor modulator; used for treatment of dyspareunia. | 2.1 | 1 | 0 | aromatic ether; organochlorine compound; primary alcohol | anti-inflammatory agent; antineoplastic agent; estrogen receptor modulator |
| dasatinib N-(2-chloro-6-methylphenyl)-2-((6-(4-(2-hydroxyethyl)piperazin-1-yl)-2-methylpyrimidin-4-yl)amino)-1,3-thiazole-5-carboxamide: a dasatinib prodrug; structure in first source. dasatinib (anhydrous) : An aminopyrimidine that is 2-methylpyrimidine which is substituted at position 4 by the primary amino group of 2-amino-1,3-thiazole-5-carboxylic acid and at position 6 by a 4-(2-hydroxyethyl)piperazin-1-yl group, and in which the carboxylic acid group has been formally condensed with 2-chloro-6-methylaniline to afford the corresponding amide. A multi-targeted kinase inhibitor, it is used, particularly as the monohydrate, for the treatment of chronic, accelerated, or myeloid or lymphoid blast phase chronic myeloid leukemia. Note that the name 'dasatinib' is used to refer to the monohydrate (USAN) as well as to anhydrous dasatinib (INN). | 3.59 | 2 | 0 | 1,3-thiazoles; aminopyrimidine; monocarboxylic acid amide; N-(2-hydroxyethyl)piperazine; N-arylpiperazine; organochlorine compound; secondary amino compound; tertiary amino compound | anticoronaviral agent; antineoplastic agent; tyrosine kinase inhibitor |
| glycyllysine glycyllysine: RN given refers to (L)-isomer. Gly-Lys : A dipeptide formed from glycine and L-lysine residues. | 2.08 | 1 | 0 | dipeptide | metabolite |
| mercuric perchlorate [no description available] | 1.98 | 1 | 0 | ||
| 5-(3-aminopropyl)-2'-deoxyuridine 5-(3-aminopropyl)-2'-deoxyuridine: used to investigate protein-DNA interactions; structure given in first source | 2.68 | 3 | 0 | ||
| zd 6474 CH 331: structure in first source | 6.9 | 11 | 0 | aromatic ether; organobromine compound; organofluorine compound; piperidines; quinazolines; secondary amine | antineoplastic agent; tyrosine kinase inhibitor |
| molybdocene dichloride molybdenocene dichloride: structure in first source | 2.03 | 1 | 0 | ||
| tris(2,2'-bipyridine)ruthenium iii tris(2,2'-bipyridine)ruthenium III: RN refers to trichloride | 2.42 | 2 | 0 | ||
| nitinol nitinol: RN given refers to cpd with MF of Ni-Ti; do not confuse with titanium nickelide; other nitinols (nitinol SE and nitinol 55) are Co-Ni-Ti alloys | 2.6 | 1 | 0 | ||
| bis(2,2'-bipyridyl)(dipyrido(3,2-alpha-2',3'-c)phenazine)ruthenium (ii) bis(2,2'-bipyridyl)(dipyrido(3,2-alpha-2',3'-c)phenazine)ruthenium (II): serves as molecular light switch for DNA, displaying no photoluminescence in aqueous solution but luminescing intensively in presence of DNA; structure given in first source | 2.05 | 1 | 0 | ||
| bis(phenanthrenequinonediimine)(bipyridyl)rhodium(iii) bis(phenanthrenequinonediimine)(bipyridyl)rhodium(III): structure given in first source; photofootprinting reagent | 2.39 | 2 | 0 | ||
| europium cryptate europium(III) trisbipyridine cryptate: structure given in first source | 2 | 1 | 0 | ||
| calixarenes Calixarenes: Phenolic metacyclophanes derived from condensation of PHENOLS and ALDEHYDES. The name derives from the vase-like molecular structures. A bracketed [n] indicates the number of aromatic rings.. calixarenes : Originally macrocyclic compounds capable of assuming a basket (or "calix") shaped conformation. They are formed from p-hydrocarbyl phenols and formaldehyde. The term now applies to a variety of derivatives by substitution of the hydrocarbon cyclo{oligo[(1,3-phenylene)methylene]}.. calixarene : A macrocycle composed of 1,3-phenylene groups linked by methylene groups. The number of 1,3-phenylene units in the macrocycle is denoted by the "n" in calix[n]arene name. | 5.05 | 7 | 0 | ||
| 5-chlorocytosine 5-chlorocytosine: structure in first source | 7.97 | 4 | 0 | ||
| amanitins Amanitins: Cyclic peptides extracted from carpophores of various mushroom species. They are potent inhibitors of RNA polymerases in most eukaryotic species, blocking the production of mRNA and protein synthesis. These peptides are important in the study of transcription. Alpha-amanitin is the main toxin from the species Amanitia phalloides, poisonous if ingested by humans or animals. | 2.89 | 4 | 0 | ||
| silicon nitride [no description available] | 2.05 | 1 | 0 | ||
| phosphonic acid phosphonic acid : A phosphorus oxoacid that consists of a single pentavalent phosphorus covalently bound via single bonds to a single hydrogen and two hydroxy groups and via a double bond to an oxygen. The parent of the class of phosphonic acids. | 2.13 | 1 | 0 | ||
| phosphothreonine Phosphothreonine: The phosphoric acid ester of threonine. Used as an identifier in the analysis of peptides, proteins, and enzymes.. O-phospho-L-threonine : A L-threonine derivative phosphorylated at the side-chain hydroxy function. | 2.7 | 3 | 0 | L-threonine derivative; non-proteinogenic L-alpha-amino acid; O-phosphoamino acid | Escherichia coli metabolite |
| ovalbumin Ovalbumin: An albumin obtained from the white of eggs. It is a member of the serpin superfamily. | 4.75 | 30 | 0 | ||
| phenylacetyl disulfide phenylacetyl disulfide: structure in first source | 7.03 | 1 | 0 | ||
| sodium dodecyl sulfate Sodium Dodecyl Sulfate: An anionic surfactant, usually a mixture of sodium alkyl sulfates, mainly the lauryl; lowers surface tension of aqueous solutions; used as fat emulsifier, wetting agent, detergent in cosmetics, pharmaceuticals and toothpastes; also as research tool in protein biochemistry.. sodium dodecyl sulfate : An organic sodium salt that is the sodium salt of dodecyl hydrogen sulfate. | 3.92 | 13 | 0 | organic sodium salt | detergent; protein denaturant |
| lithium acetate lithium acetate : An acetate salt comprising equal numbers of acetate and lithium ions. | 2.02 | 1 | 0 | acetate salt; organic lithium salt | |
| blister blebbistatin: structure in first source. blebbistatin : A pyrroloquinoline that is 1,2,3,3a-tetrahydro-H-pyrrolo[2,3-b]quinolin-4-one substituted by a hydroxy group at position 3a, a methyl group at position 6 and a phenyl group at position 1. It acts as an inhibitor of ATPase activity of non-muscle myosin II. | 2.21 | 1 | 0 | cyclic ketone; pyrroloquinoline; tertiary alcohol; tertiary alpha-hydroxy ketone | inhibitor |
| adenylyl-(3'-5')-adenylyl-(3'-5')-adenosine [no description available] | 1.96 | 1 | 0 | ||
| mtt formazan MTT formazan: a blue MEM-insoluble mitochondrial byproduct; used to determine viability of cells with active mitochondrial dehydrogenase enzymes | 2.06 | 1 | 0 | ||
| zinc protoporphyrin ix [no description available] | 2.02 | 1 | 0 | ||
| 1-(2'-deoxy-beta-threopentofuranosyl)thymine 1-(2'-deoxy-beta-threopentofuranosyl)thymine: RN refers to D-isomer | 1.97 | 1 | 0 | ||
| alpha-chymotrypsin Chymotrypsin: A serine endopeptidase secreted by the pancreas as its zymogen, CHYMOTRYPSINOGEN and carried in the pancreatic juice to the duodenum where it is activated by TRYPSIN. It selectively cleaves aromatic amino acids on the carboxyl side. | 5.26 | 17 | 0 | ||
| 7-deazapurine 7-deazapurine: structure in first source | 8.53 | 7 | 0 | ||
| bromodeoxyuridine triphosphate [no description available] | 2.1 | 1 | 0 | ||
| naphthoquinones Naphthoquinones: Naphthalene rings which contain two ketone moieties in any position. They can be substituted in any position except at the ketone groups. | 2.7 | 3 | 0 | ||
| gr 103691 GR 103691: dopamine D3 receptor antagonist | 2.03 | 1 | 0 | aromatic ketone | |
| sodium borohydride sodium borohydride: RN given refers to parent cpd | 3.14 | 5 | 0 | inorganic sodium salt; metal tetrahydridoborate | |
| hydroxyethylcellulose hydroxyethylcellulose: component of contact lens wetting solutions; aldiamed is an artificial saliva; RN given refers to parent cpd. hydroxyethylcellulose : A polysaccharide derivative that is cellulose in which hydroxyethyl groups are bound to some of the hydroxyl groups of the glucopyranose monomers. | 2.03 | 1 | 0 | ||
| cathepsin g Cathepsin G: A serine protease found in the azurophil granules of NEUTROPHILS. It has an enzyme specificity similar to that of chymotrypsin C. | 2.67 | 3 | 0 | ||
| 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1h-imidazol-2-yl)benzamide 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide: a TGF-beta type I receptor kinase activity inhibitor | 2.5 | 2 | 0 | benzamides; benzodioxoles; imidazoles; pyridines | EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor |
| rhodamine 123 Rhodamine 123: A fluorescent probe with low toxicity which is a potent substrate for ATP BINDING CASSETTE TRANSPORTER, SUBFAMILY B, MEMBER 1 and the bacterial multidrug efflux transporter. It is used to assess mitochondrial bioenergetics in living cells and to measure the efflux activity of ATP BINDING CASSETTE TRANSPORTER, SUBFAMILY B, MEMBER 1 in both normal and malignant cells. (Leukemia 1997;11(7):1124-30). rhodamine 123(1+) : A cationic fluorescent dye derived from 9-phenylxanthene. | 2.42 | 2 | 0 | organic cation; xanthene dye | fluorochrome |
| sulfosuccinimidyl 4-(n-maleimidomethyl)cyclohexane-1-carboxylate [no description available] | 2.06 | 1 | 0 | ||
| tolcapone Tolcapone: A benzophenone and nitrophenol compound that acts as an inhibitor of CATECHOL O-METHYLTRANSFERASE, an enzyme involved in the metabolism of DOPAMINE and LEVODOPA. It is used in the treatment of PARKINSON DISEASE in patients for whom levodopa is ineffective or contraindicated.. tolcapone : Benzophenone substituted on one of the phenyl rings at C-3 and C-4 by hydroxy groups and at C-5 by a nitro group, and on the other phenyl ring by a methyl group at C-4. It is an inhibitor of catechol O-methyltransferase. | 4.33 | 1 | 0 | 2-nitrophenols; benzophenones; catechols | antiparkinson drug; EC 2.1.1.6 (catechol O-methyltransferase) inhibitor |
| myelin basic protein Myelin Basic Protein: An abundant cytosolic protein that plays a critical role in the structure of multilamellar myelin. Myelin basic protein binds to the cytosolic sides of myelin cell membranes and causes a tight adhesion between opposing cell membranes. | 4.88 | 11 | 0 | ||
| 2-mercaptoacetate 2-mercaptoacetate: RN given refers to parent cpd | 2.15 | 1 | 0 | monocarboxylic acid anion | |
| methanethiosulfonate methanethiosulfonate: used for measurement of rhodanese activity; RN given refers to parent cpd | 2.41 | 2 | 0 | ||
| diethyl maleate diethyl maleate : A maleate ester resulting from the formal condensation of both carboxy groups of maleic acid with ethanol. A colourless liquid at room temperature (m.p. -10degreeC) with boiling point 220degreeC at 1 atm., it is commonly used as a dienophile for Diels-Alder-type cycloaddition reactions in organic synthesis. | 2.02 | 1 | 0 | ethyl ester; maleate ester | glutathione depleting agent |
| quercetin 3-o-glucuronide quercetin 3-O-glucuronide: structure in first source. miquelianin : A quercetin O-glycoside that consists of quercetin attached to a beta-D-glucuronopyranosyl moiety at position 3 via a glycosidic linkage. Isolated from Salvia and Phaseolus vulgaris, it exhibits antioxidant and antidepressant activities. | 2.03 | 1 | 0 | beta-D-glucosiduronic acid; quercetin O-glycoside | antidepressant; antioxidant; metabolite |
| sphingosine sphing-4-enine : A sphingenine in which the C=C double bond is located at the 4-position.. sphingenine : A 2-aminooctadecene-1,3-diol having (2S,3R)-configuration.. sphingoid : Sphinganine, its homologs and stereoisomers, and the hydroxy and unsaturated derivatives of these compounds.. 2-aminooctadec-4-ene-1,3-diol : A 2-aminooctadecene-1,3-diol having its double bond at position 4. | 4.37 | 6 | 0 | sphing-4-enine | human metabolite; mouse metabolite |
| quercetin [no description available] | 2.79 | 3 | 0 | 7-hydroxyflavonol; pentahydroxyflavone | antibacterial agent; antineoplastic agent; antioxidant; Aurora kinase inhibitor; chelator; EC 1.10.99.2 [ribosyldihydronicotinamide dehydrogenase (quinone)] inhibitor; geroprotector; phytoestrogen; plant metabolite; protein kinase inhibitor; radical scavenger |
| bilirubin [no description available] | 6.52 | 5 | 1 | biladienes; dicarboxylic acid | antioxidant; human metabolite; mouse metabolite |
| dinoprostone prostaglandin E2 : Prostaglandin F2alpha in which the hydroxy group at position 9 has been oxidised to the corresponding ketone. Prostaglandin E2 is the most common and most biologically potent of mammalian prostaglandins. | 3.89 | 12 | 0 | prostaglandins E | human metabolite; mouse metabolite; oxytocic |
| sterigmatocystin [no description available] | 1.96 | 1 | 0 | sterigmatocystins | metabolite |
| luteolin [no description available] | 2.61 | 2 | 0 | 3'-hydroxyflavonoid; tetrahydroxyflavone | angiogenesis inhibitor; anti-inflammatory agent; antineoplastic agent; apoptosis inducer; c-Jun N-terminal kinase inhibitor; EC 2.3.1.85 (fatty acid synthase) inhibitor; immunomodulator; nephroprotective agent; plant metabolite; radical scavenger; vascular endothelial growth factor receptor antagonist |
| linoleic acid Linoleic Acid: A doubly unsaturated fatty acid, occurring widely in plant glycosides. It is an essential fatty acid in mammalian nutrition and is used in the biosynthesis of prostaglandins and cell membranes. (From Stedman, 26th ed). linoleic acid : An octadecadienoic acid in which the two double bonds are at positions 9 and 12 and have Z (cis) stereochemistry. | 2.42 | 2 | 0 | octadecadienoic acid; omega-6 fatty acid | algal metabolite; Daphnia galeata metabolite; plant metabolite |
| calcitriol dihydroxy-vitamin D3: as a major in vitro metabolite of 1alpha,25-dihydroxyvitamin D3, produced in primary cultures of neonatal human keratinocytes | 3.62 | 9 | 0 | D3 vitamins; hydroxycalciol; triol | antineoplastic agent; antipsoriatic; bone density conservation agent; calcium channel agonist; calcium channel modulator; hormone; human metabolite; immunomodulator; metabolite; mouse metabolite; nutraceutical |
| vitamin k semiquinone radical vitamin K semiquinone radical: found in active preparations of vitamin K-dependent carboxylase. vitamin K : Any member of a group of fat-soluble 2-methyl-1,4-napthoquinones that exhibit biological activity against vitamin K deficiency. Vitamin K is required for the synthesis of prothrombin and certain other blood coagulation factors. | 1.99 | 1 | 0 | ||
| 11-cis-retinal Rhodopsin: A purplish-red, light-sensitive pigment found in RETINAL ROD CELLS of most vertebrates. It is a complex consisting of a molecule of ROD OPSIN and a molecule of 11-cis retinal (RETINALDEHYDE). Rhodopsin exhibits peak absorption wavelength at about 500 nm.. 11-cis-retinal : A retinal having 2E,4Z,6E,8E-double bond geometry. | 3.7 | 10 | 0 | retinal | chromophore; human metabolite; mouse metabolite |
| thromboxane a2 Thromboxane A2: An unstable intermediate between the prostaglandin endoperoxides and thromboxane B2. The compound has a bicyclic oxaneoxetane structure. It is a potent inducer of platelet aggregation and causes vasoconstriction. It is the principal component of rabbit aorta contracting substance (RCS).. thromboxane A2 : A thromboxane which is produced by activated platelets and has prothrombotic properties: it stimulates activation of new platelets as well as increases platelet aggregation. | 2.03 | 1 | 0 | epoxy monocarboxylic acid; thromboxanes A | mouse metabolite |
| hymecromone Hymecromone: A coumarin derivative possessing properties as a spasmolytic, choleretic and light-protective agent. It is also used in ANALYTICAL CHEMISTRY TECHNIQUES for the determination of NITRIC ACID. | 2.02 | 1 | 0 | hydroxycoumarin | antineoplastic agent; hyaluronic acid synthesis inhibitor |
| undecaprenyl pyrophosphate undecaprenyl diphosphate : A polyprenol diphosphate compound having eleven prenyl units with undefined stereochemistry about the double bonds. | 2.43 | 2 | 0 | all-trans-polyprenyl diphosphate; undecaprenyl diphosphate; undecaprenyl phosphate | |
| chrysoeriol chrysoeriol: isolated from leaves of Eurya japonica & E. emarginata. 4',5,7-trihydroxy-3'-methoxyflavone : The 3'-O-methyl derivative of luteolin. | 2.02 | 1 | 0 | monomethoxyflavone; trihydroxyflavone | antineoplastic agent; antioxidant; metabolite |
| alprostadil [no description available] | 2.03 | 1 | 0 | prostaglandins E | anticoagulant; human metabolite; platelet aggregation inhibitor; vasodilator agent |
| cholecalciferol Cholecalciferol: Derivative of 7-dehydroxycholesterol formed by ULTRAVIOLET RAYS breaking of the C9-C10 bond. It differs from ERGOCALCIFEROL in having a single bond between C22 and C23 and lacking a methyl group at C24.. calciol : A hydroxy seco-steroid that is (5Z,7E)-9,10-secocholesta-5,7,10(19)-triene in which the pro-S hydrogen at position 3 has been replaced by a hydroxy group. It is the inactive form of vitamin D3, being hydroxylated in the liver to calcidiol (25-hydroxyvitamin D3), which is then further hydroxylated in the kidney to give calcitriol (1,25-dihydroxyvitamin D3), the active hormone. | 2.94 | 4 | 0 | D3 vitamins; hydroxy seco-steroid; seco-cholestane; secondary alcohol; steroid hormone | geroprotector; human metabolite |
| harmine Harmine: Alkaloid isolated from seeds of PEGANUM HARMALA; ZYGOPHYLLACEAE. It is identical to banisterine, or telepathine, from Banisteria caapi and is one of the active ingredients of hallucinogenic drinks made in the western Amazon region from related plants. It has no therapeutic use, but (as banisterine) was hailed as a cure for postencephalitic PARKINSON DISEASE in the 1920's.. harmine : A harmala alkaloid in which the harman skeleton is methoxy-substituted at C-7. | 7.13 | 1 | 0 | harmala alkaloid | anti-HIV agent; EC 1.4.3.4 (monoamine oxidase) inhibitor; metabolite |
| genistein [no description available] | 2.72 | 3 | 0 | 7-hydroxyisoflavones | antineoplastic agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; geroprotector; human urinary metabolite; phytoestrogen; plant metabolite; tyrosine kinase inhibitor |
| clavulanic acid Clavulanic Acid: A beta-lactam antibiotic produced by the actinobacterium Streptomyces clavuligerus. It is a suicide inhibitor of bacterial beta-lactamase enzymes. Administered alone, it has only weak antibacterial activity against most organisms, but given in combination with other beta-lactam antibiotics it prevents antibiotic inactivation by microbial lactamase.. clavulanate : The conjugate base of clavulanic acid.. clavulanic acid : Antibiotic isolated from Streptomyces clavuligerus. It acts as a suicide inhibitor of bacterial beta-lactamase enzymes. | 2.08 | 1 | 0 | oxapenam | antibacterial drug; anxiolytic drug; bacterial metabolite; EC 3.5.2.6 (beta-lactamase) inhibitor |
| jasmonic acid jasmonic acid: a derivative of alpha-linolenic acid that has a role in plant response to herbivory analogous to the role of prostanoids in inflammation in mammals;. jasmonic acid : An oxo monocarboxylic acid that is (3-oxocyclopentyl)acetic acid substituted by a (2Z)-pent-2-en-1-yl group at position 2 of the cyclopentane ring. | 2.73 | 3 | 0 | oxo monocarboxylic acid | jasmonates; plant metabolite |
| cucurbitacin i cucurbitacin I: toxic constituent in edible gourd; see also records for cucurbitacins & specific cucurbitacins. cucurbitacin I : A cucurbitacin that is 9,10,14-trimethyl-4,9-cyclo-9,10-secocholesta-2,5,23-triene substituted by hydroxy groups at positions 2, 16, 20 and 25 and oxo groups at positions 1, 11 and 22. | 3.12 | 1 | 0 | cucurbitacin; tertiary alpha-hydroxy ketone | antineoplastic agent; plant metabolite |
| zearalenone Zearalenone: (S-(E))-3,4,5,6,8,10-Hexahydro-14,16-dihydroxy-3-methyl-1H-2-benzoxacyclotetradecin-1,7(8H)-dione. One of a group of compounds known under the general designation of resorcylic acid lactones. Cis, trans, dextro and levo forms have been isolated from the fungus Gibberella zeae (formerly Fusarium graminearum). They have estrogenic activity, cause toxicity in livestock as feed contaminant, and have been used as anabolic or estrogen substitutes.. zearalenone : A macrolide comprising a fourteen-membered lactone fused to 1,3-dihydroxybenzene; a potent estrogenic metabolite produced by some Giberella species. | 2.25 | 1 | 0 | macrolide; resorcinols | fungal metabolite; mycoestrogen |
| myricetin [no description available] | 2 | 1 | 0 | 7-hydroxyflavonol; hexahydroxyflavone | antineoplastic agent; antioxidant; cyclooxygenase 1 inhibitor; food component; geroprotector; hypoglycemic agent; plant metabolite |
| chicoric acid chicoric acid: inhibits HIV-1 integrase | 4.65 | 3 | 0 | organooxygen compound | geroprotector; HIV-1 integrase inhibitor |
| caffeic acid phenethyl ester phenethyl caffeate : An alkyl caffeate ester in which 2-phenylethyl is the alkyl component. | 1.98 | 1 | 0 | alkyl caffeate ester | anti-inflammatory agent; antibacterial agent; antineoplastic agent; antioxidant; antiviral agent; immunomodulator; metabolite; neuroprotective agent |
| maytansine Maytansine: An ansa macrolide isolated from the MAYTENUS genus of East African shrubs.. maytansine : An organic heterotetracyclic compound and 19-membered macrocyclic lactam antibiotic originally isolated from the Ethiopian shrub Maytenus serrata but also found in other Maytenus species. It exhibits cytotoxicity against many tumour cell lines. | 2.25 | 1 | 0 | alpha-amino acid ester; carbamate ester; epoxide; maytansinoid; organic heterotetracyclic compound; organochlorine compound | antimicrobial agent; antimitotic; antineoplastic agent; plant metabolite; tubulin modulator |
| ellagic acid [no description available] | 2.13 | 1 | 0 | catechols; cyclic ketone; lactone; organic heterotetracyclic compound; polyphenol | antioxidant; EC 1.14.18.1 (tyrosinase) inhibitor; EC 2.3.1.5 (arylamine N-acetyltransferase) inhibitor; EC 2.4.1.1 (glycogen phosphorylase) inhibitor; EC 2.5.1.18 (glutathione transferase) inhibitor; EC 2.7.1.127 (inositol-trisphosphate 3-kinase) inhibitor; EC 2.7.1.151 (inositol-polyphosphate multikinase) inhibitor; EC 2.7.4.6 (nucleoside-diphosphate kinase) inhibitor; EC 2.7.7.7 (DNA-directed DNA polymerase) inhibitor; EC 5.99.1.2 (DNA topoisomerase) inhibitor; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; food additive; fungal metabolite; geroprotector; plant metabolite; skin lightening agent |
| sdz psc 833 valspodar: nonimmunosuppressive cyclosporin analog which is a potent multidrug resistance modifier; 7-10 fold more potent than cyclosporin A; a potent P glycoprotein inhibitor; MW 1215 | 2.05 | 1 | 0 | homodetic cyclic peptide | |
| coenzyme q10 coenzyme Q10: Ubiquinone ring with a chain of 10 isoprene units; redox equilibrium with ubiqunol serving in mitochondrial inner membrane to transfer electrons; presence during reconstitution of acetylcholine receptor into phospholipid vesicles yields vesicles active in catalyzing carbamylcholine-sensitive Na+ flux; coenzyme Q10 depletion has been noted with use of statins. coenzyme Q10 : A ubiquinone having a side chain of 10 isoprenoid units. In the naturally occurring isomer, all isoprenyl double bonds are in the E- configuration. | 2.02 | 1 | 0 | ubiquinones | antioxidant; ferroptosis inhibitor; human metabolite |
| plaunotol plaunotol: RN refers to (Z,E,E)-isomer. plaunotol : A diterpenoid that is geranylgeraniol carrying an additional hydroxy substituent at position 18. | 2.02 | 1 | 0 | diterpenoid; primary alcohol | anti-ulcer drug; antibacterial agent; antineoplastic agent; apoptosis inducer; nephroprotective agent; plant metabolite; vulnerary |
| tranilast tranilast: antiallergic drug; potent inhibitor of homologous passive cutaneous anaphylaxis. tranilast : An amidobenzoic acid that is anthranilic acid in which one of the anilino hydrogens is replaced by a 3,4-dimethoxycinnamoyl group. | 2.05 | 1 | 0 | amidobenzoic acid; cinnamamides; dimethoxybenzene; secondary carboxamide | anti-allergic agent; anti-asthmatic drug; antineoplastic agent; aryl hydrocarbon receptor agonist; calcium channel blocker; hepatoprotective agent; nephroprotective agent |
| 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid 4-Acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic Acid: A non-penetrating amino reagent (commonly called SITS) which acts as an inhibitor of anion transport in erythrocytes and other cells. | 2.69 | 3 | 0 | stilbenoid | |
| glyceryl 2-arachidonate glyceryl 2-arachidonate: binds to cannabinoid receptors; structure in first source. 2-arachidonoylglycerol : An endocannabinoid and an endogenous agonist of the cannabinoid receptors (CB1 and CB2). It is an ester formed from omega-6-arachidonic acid and glycerol. | 2.02 | 1 | 0 | 2-acylglycerol 20:4; endocannabinoid | human metabolite |
| 1-palmitoyl-2-oleoylglycero-3-phosphoglycerol [no description available] | 2.44 | 2 | 0 | phosphatidylglycerol | |
| n,n-dimethylsphingenine N,N-dimethylsphingosine: a sphingosine kinase inhibitor. N,N-dimethylsphingosine : A sphingoid that is sphingosine in which the two amino hydrogens are replaced by methyl groups. | 2.03 | 1 | 0 | aminodiol; sphingoid; tertiary amino compound | EC 2.7.1.91 (sphingosine kinase) inhibitor; metabolite |
| isotretinoin Isotretinoin: A topical dermatologic agent that is used in the treatment of ACNE VULGARIS and several other skin diseases. The drug has teratogenic and other adverse effects.. isotretinoin : A retinoic acid that is all-trans-retinoic acid in which the double bond which is alpha,beta- to the carboxy group is isomerised to Z configuration. A synthetic retinoid, it is used for the treatment of severe cases of acne and other skin diseases. | 1.98 | 1 | 0 | retinoic acid | antineoplastic agent; keratolytic drug; teratogenic agent |
| zinostatin Zinostatin: An enediyne that alkylates DNA and RNA like MITOMYCIN does, so it is cytotoxic. | 9.49 | 7 | 0 | ||
| 20-hydroxy-5,8,11,14-eicosatetraenoic acid 20-hydroxy-5,8,11,14-eicosatetraenoic acid: stimulator of renal sodium, potassium atpase; RN given is for the (all-Z) isomer. 20-HETE : A HETE that consists of arachidonic acid bearing a hydroxy substituent at position 20. | 3.27 | 1 | 0 | HETE; hydroxy monocarboxylic acid | human metabolite; mouse metabolite |
| 4-hydroxy-2-nonenal 4-hydroxy-2-nonenal: cytotoxic product from peroxidation of liver microsomal lipids; RN given refers to cpd without isomeric designation. 4-hydroxynon-2-enal : An enal consisting of non-2-ene having an oxo group at the 1-position and a hydroxy group at the 4-position.. 4-hydroxynonenal : A monounsaturated fatty aldehyde that is nonanal that has undergone dehydrogenation to introduce a double bond at any position in the aliphatic chain and in which a hydrogen at position 4 has been replaced by a hydroxy group. | 2.71 | 3 | 0 | 4-hydroxynon-2-enal; 4-hydroxynonenal | |
| 1-monooleoyl-rac-glycerol Peceol: lipid excipient containing readily dispersible mixture of mono- & diglycerides of oleic acid. 1-oleoylglycerol : A 1-monoglyceride where the acyl group is oleoyl.. monooleoylglycerol : A monoglyceride in which the acyl group is oleoyl with the position of acylation unspecified. | 2.43 | 2 | 0 | 1-acylglycerol 18:1; monooleoylglycerol | plant metabolite |
| sphingosine 1-phosphate sphingosine 1-phosphate: RN given refers to (R-(R*,S*-(E)))-isomer; RN for cpd without isomeric designation not available 8/89. sphingosine 1-phosphate : A phosphosphingolipid that consists of sphingosine having a phospho group attached at position 1 | 3.87 | 3 | 0 | sphingoid 1-phosphate | mouse metabolite; signalling molecule; sphingosine-1-phosphate receptor agonist; T-cell proliferation inhibitor; vasodilator agent |
| codeine [no description available] | 2.05 | 1 | 0 | morphinane alkaloid; organic heteropentacyclic compound | antitussive; drug allergen; environmental contaminant; opioid analgesic; opioid receptor agonist; prodrug; xenobiotic |
| amsonic acid amsonic acid: RN given refers to parent cpd | 1.99 | 1 | 0 | ||
| diminazene aceturate diminazene diaceturate : An N-acetylglycinate salt resulting from the reaction of diminazene with 2 mol eq. of N-acetylglycine. | 2.39 | 2 | 0 | N-acetylglycinate salt | antiparasitic agent; trypanocidal drug |
| sirolimus Sirolimus: A macrolide compound obtained from Streptomyces hygroscopicus that acts by selectively blocking the transcriptional activation of cytokines thereby inhibiting cytokine production. It is bioactive only when bound to IMMUNOPHILINS. Sirolimus is a potent immunosuppressant and possesses both antifungal and antineoplastic properties.. sirolimus : A macrolide lactam isolated from Streptomyces hygroscopicus consisting of a 29-membered ring containing 4 trans double bonds, three of which are conjugated. It is an antibiotic, immunosupressive and antineoplastic agent. | 4.54 | 7 | 0 | antibiotic antifungal drug; cyclic acetal; cyclic ketone; ether; macrolide lactam; organic heterotricyclic compound; secondary alcohol | antibacterial drug; anticoronaviral agent; antineoplastic agent; bacterial metabolite; geroprotector; immunosuppressive agent; mTOR inhibitor |
| gamma-cyclodextrin gamma-cyclodextrin : A cycloamylose composed of eight alpha-(1->4) linked D-glucopyranose units. | 3.58 | 2 | 0 | cyclodextrin | |
| brefeldin a [no description available] | 2.02 | 1 | 0 | macrolide antibiotic | Penicillium metabolite |
| 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin: structure in first source. alvespimycin : A 19-membered macrocyle that is geldanamycin in which the methoxy group attached to the benzoquinone moiety has been replaced by a 2-(N,N-dimethylamino)ethylamino group. | 2.11 | 1 | 0 | 1,4-benzoquinones; ansamycin; carbamate ester; secondary amino compound; tertiary amino compound | Hsp90 inhibitor |
| morphine Meconium: The thick green-to-black mucilaginous material found in the intestines of a full-term fetus. It consists of secretions of the INTESTINAL GLANDS; BILE PIGMENTS; FATTY ACIDS; AMNIOTIC FLUID; and intrauterine debris. It constitutes the first stools passed by a newborn. | 2.06 | 1 | 0 | morphinane alkaloid; organic heteropentacyclic compound; tertiary amino compound | anaesthetic; drug allergen; environmental contaminant; geroprotector; mu-opioid receptor agonist; opioid analgesic; plant metabolite; vasodilator agent; xenobiotic |
| oregon green 488 carboxylic acid [no description available] | 2.1 | 1 | 0 | xanthene dye | epitope; fluorochrome |
| pactamycin Pactamycin: Antibiotic produced by Streptomyces pactum used as an antineoplastic agent. It is also used as a tool in biochemistry because it inhibits certain steps in protein synthesis. | 2.39 | 2 | 0 | ||
| pyoverdin pyoverdin: a partly cyclic octapeptide linked to a chromophore, derived from 2,3-diamino-6,7-dihydroxyquinoline, which confers color and fluorescence to the molecule; yellow-green pigment produced by Pseudomonas aeruginosa; pyoverdin Pf from P. fluorescens; structure has been determined | 2.03 | 1 | 0 | ||
| cgp 62349 [no description available] | 2 | 1 | 0 | ||
| 2-methylthio-atp 2-methylthio-ATP: purinergic receptors agonist; relaxes mammalian gut preparations; structure given in first source | 1.99 | 1 | 0 | ||
| anthramycin [no description available] | 3.25 | 6 | 0 | ||
| benzphetamine Benzphetamine: A sympathomimetic agent with properties similar to DEXTROAMPHETAMINE. It is used in the treatment of obesity. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1222). benzphetamine : Dextroamphetamine in which the the hydrogens attached to the amino group are substituted by a methyl and a benzyl group. A sympathomimetic agent with properties similar to dextroamphetamine, it is used as its hydrochloride salt in the treatment of obesity. | 2.44 | 2 | 0 | amphetamines; tertiary amine | adrenergic uptake inhibitor; appetite depressant; dopamine uptake inhibitor; sympathomimetic agent |
| iloprost Iloprost: An eicosanoid, derived from the cyclooxygenase pathway of arachidonic acid metabolism. It is a stable and synthetic analog of EPOPROSTENOL, but with a longer half-life than the parent compound. Its actions are similar to prostacyclin. Iloprost produces vasodilation and inhibits platelet aggregation.. iloprost : A carbobicyclic compound that is prostaglandin I2 in which the endocyclic oxygen is replaced by a methylene group and in which the (1E,3S)-3-hydroxyoct-1-en-1-yl side chain is replaced by a (3R)-3-hydroxy-4-methyloct-1-en-6-yn-1-yl group. A synthetic analogue of prostacyclin, it is used as the trometamol salt (generally by intravenous infusion) for the treatment of peripheral vascular disease and pulmonary hypertension. | 2.44 | 2 | 0 | carbobicyclic compound; monocarboxylic acid; secondary alcohol | platelet aggregation inhibitor; vasodilator agent |
| 15-deoxy-delta(12,14)-prostaglandin j2 15-deoxy-delta(12,14)-prostaglandin J2: 15-deoxy-PGJ2 is also available; check for double bonds (indicated by delta) at 12 and 14 positions. 15-deoxy-Delta(12,14)-prostaglandin J2 : A prostaglandin J derivative comprising prostaglandin J2 lacking the 15-hydroxy group and having C=C double bonds at the 12- and 14-positions. | 2.94 | 4 | 0 | prostaglandins J | electrophilic reagent; insulin-sensitizing drug; metabolite |
| taprostene [no description available] | 2.05 | 1 | 0 | benzoic acids | |
| lysophosphatidic acid lysophosphatidic acid: RN given refers to parent cpd. 1-oleoyl-sn-glycerol 3-phosphate : A 1-acyl-sn-glycerol 3-phosphate having oleoyl as the 1-O-acyl group.. lysophosphatidic acid : A member of the class of lysophosphatidic acids obtained by hydrolytic removal of one of the two acyl groups of any phosphatidic acid. A 'closed' class. | 2.02 | 1 | 0 | 1-acyl-sn-glycerol 3-phosphate | |
| n-(n-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester DAPT : A dipeptide consisting of alanylphenylglycine derivatised as a 3,5-difluorophenylacetamide at the amino terminal and a tert-butyl ester at the carboxy terminal. A gamma-secretase inhibitor. | 2.13 | 1 | 0 | carboxylic ester; difluorobenzene; dipeptide; tert-butyl ester | EC 3.4.23.46 (memapsin 2) inhibitor |
| kn 93 KN 93: reduces dopamine content in PC12h cells. KN-93 : A sulfonamide resulting from the formal condensation of p-methoxybenzenesulfonic acid with the anilino nitrogen of 2-(aminomethyl)-N-(2-hydroxyethyl)aniline in which the hydrogens of the primary amino group have been replaced by methyl and p-chlorocinnamyl groups. KN-93 is a selective inhibitor of Ca(2+)/calmodulin-dependent protein kinase II. | 2.02 | 1 | 0 | monochlorobenzenes; monomethoxybenzene; primary alcohol; sulfonamide; tertiary amino compound | EC 2.7.11.17 (Ca(2+)/calmodulin-dependent protein kinase) inhibitor; geroprotector |
| kn 62 KN 62: inhibitor of Ca/calmodulin-dependent protein kinase II | 2.02 | 1 | 0 | piperazines | |
| 1,2-oleoylphosphatidylcholine 1,2-oleoylphosphatidylcholine: RN given refers to (Z,Z)-isomer. dioleoyl phosphatidylcholine : A phosphatidylcholine in which the phosphatidyl acyl groups are both oleoyl. | 3.43 | 7 | 0 | phosphatidylcholine(1+) | |
| biliverdine [no description available] | 2.02 | 1 | 0 | ||
| ag-490 [no description available] | 3.53 | 2 | 0 | catechols; enamide; monocarboxylic acid amide; nitrile; secondary carboxamide | anti-inflammatory agent; antioxidant; apoptosis inducer; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor; geroprotector; STAT3 inhibitor |
| semaxinib semaxanib : An oxindole that is 3-methyleneoxindole in which one of the hydrogens of the methylene group is replaced by a 3,5-dimethylpyrrol-2-yl group. | 2.11 | 1 | 0 | olefinic compound; oxindoles; pyrroles | angiogenesis modulating agent; antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; vascular endothelial growth factor receptor antagonist |
| su 11248 [no description available] | 7.22 | 13 | 0 | monocarboxylic acid amide; pyrroles | angiogenesis inhibitor; antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; immunomodulator; neuroprotective agent; vascular endothelial growth factor receptor antagonist |
| lead Lead: A soft, grayish metal with poisonous salts; atomic number 82, atomic weight 207.2, symbol Pb. | 4.79 | 31 | 0 | carbon group element atom; elemental lead; metal atom | neurotoxin |
| tin [no description available] | 2.38 | 2 | 0 | carbon group element atom; elemental tin; metal atom | micronutrient |
| 13-hydroperoxy-9,11-octadecadienoic acid 13-hydroperoxy-9,11-octadecadienoic acid: RN given refers to (E,Z)-isomer; RN for unspecified isomer not in Chemline 8/12/83. 13-HPODE : An HPODE (hydroperoxyoctadecadienoic acid) in which the double bonds are at positions 9 and 11 (E and Z geometry, respectively) and the hydroperoxy group is at position 13. | 2.02 | 1 | 0 | hydroperoxy polyunsaturated fatty acid; octadecadienoic acid | |
| bay 11-7082 (E)-3-tosylacrylonitrile : A nitrile that is acrylonitrile in which the hydrogen located beta,trans to the cyano group is replaced by a tosyl group. It is an inhibitor of cytokine-induced IkappaB-alpha phosphorylation in cells. | 2.1 | 1 | 0 | nitrile; sulfone | apoptosis inducer; EC 2.7.11.10 (IkappaB kinase) inhibitor; EC 3.1.3.48 (protein-tyrosine-phosphatase) inhibitor; non-steroidal anti-inflammatory drug; platelet aggregation inhibitor |
| diamide Diamide: A sulfhydryl reagent which oxidizes sulfhydryl groups to the disulfide form. It is a radiation-sensitizing agent of anoxic bacterial and mammalian cells. | 2 | 1 | 0 | 1,1'-azobis(N,N-dimethylformamide) | |
| antimony Antimony: A metallic element that has the atomic symbol Sb, atomic number 51, and atomic weight 121.75. It is used as a metal alloy and as medicinal and poisonous salts. It is toxic and an irritant to the skin and the mucous membranes. | 8.14 | 1 | 0 | metalloid atom; pnictogen | |
| cesium Cesium: A member of the alkali metals. It has an atomic symbol Cs, atomic number 50, and atomic weight 132.91. Cesium has many industrial applications, including the construction of atomic clocks based on its atomic vibrational frequency. | 3.6 | 9 | 0 | alkali metal atom | |
| 8-hydroxyadenine 8-hydroxyadenine: xanthine oxidase reacted adenine metabolite in epidermis of hairless mice; structure. 8-oxoadenine : An oxopurine that is adenine bearing a single oxo substituent at position 8.. 8-hydroxyadenine : A nucleobase analogue that is adenine bearing a single hydroxy substituent at position 8. | 3.09 | 5 | 0 | 6-aminopurines; heteroaryl hydroxy compound; nucleobase analogue; oxopurine | bacterial metabolite; human metabolite |
| barium Barium: An element of the alkaline earth group of metals. It has an atomic symbol Ba, atomic number 56, and atomic weight 138. All of its acid-soluble salts are poisonous. | 8.25 | 6 | 0 | alkaline earth metal atom; elemental barium | |
| mevinphos Mevinphos: An organophosphate cholinesterase inhibitor that is used as an insecticide. | 2.05 | 1 | 0 | ||
| oleylamine oleylamine: promotes fusion of mouse A(9) fibroblasts; RN given refers to parent cpd with unspecified isomeric designation; structure | 2.04 | 1 | 0 | ||
| triphenyltin triphenyltin: triphenyltin derivatives widely used as pesticides; all of first source is triphenyltin cpds | 2.01 | 1 | 0 | ||
| rubidium Rubidium: An element that is an alkali metal. It has an atomic symbol Rb, atomic number 37, and atomic weight 85.47. It is used as a chemical reagent and in the manufacture of photoelectric cells. | 3.1 | 5 | 0 | alkali metal atom | |
| aluminum Aluminum: A metallic element that has the atomic number 13, atomic symbol Al, and atomic weight 26.98. | 3.78 | 3 | 0 | boron group element atom; elemental aluminium; metal atom | |
| 6-chloropurine [no description available] | 7.05 | 1 | 0 | purines | |
| strontium Strontium: An element of the alkaline earth family of metals. It has the atomic symbol Sr, atomic number 38, and atomic weight 87.62. | 3.42 | 7 | 0 | alkaline earth metal atom | |
| bismuth Bismuth: A metallic element that has the atomic symbol Bi, and atomic number 83. Its principal isotope is Bismuth 209. | 2.97 | 4 | 0 | metal atom; pnictogen | |
| thallium Thallium: A heavy, bluish white metal, atomic number 81, atomic weight [204.382; 204.385], symbol Tl.. thallium : A metallic element first identified and named from the brilliant green line in its flame spectrum (from Greek thetaalphalambdalambdaomicronsigma, a green shoot). | 2.08 | 1 | 0 | boron group element atom | |
| alternariol alternariol: structure. alternariol : A benzochromenone that is 6H-benzo[c]chromen-6-one which is substituted by a methyl group at position 1 and by hydroxy groups at positions 3, 7, and 9. It is the most important mycotoxin produced by the black mould Alternaria species, which are the most common mycoflora infecting small grain cereals worldwide. | 3.14 | 1 | 0 | benzochromenone; phenols | EC 3.1.1.8 (cholinesterase) inhibitor; metabolite; mycotoxin |
| arsenic Arsenic: A shiny gray element with atomic symbol As, atomic number 33, and atomic weight 75. It occurs throughout the universe, mostly in the form of metallic arsenides. Most forms are toxic. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), arsenic and certain arsenic compounds have been listed as known carcinogens. (From Merck Index, 11th ed) | 2.05 | 1 | 0 | metalloid atom; pnictogen | micronutrient |
| 7-deazaadenine [no description available] | 7.69 | 3 | 0 | ||
| 2-amino-6-chloropurine 6-chloroguanine: an antimalarial that inhibits hypoxanthine-guanine-xanthine phosphoribosyltransferase; structure in first source. 6-chloroguanine : An organochlorine compound that is 7H-purin-2-amine substituted by a chloro group at position 6. | 2.25 | 1 | 0 | 2-aminopurines; organochlorine compound | |
| gallium Gallium: A rare, metallic element designated by the symbol, Ga, atomic number 31, and atomic weight 69.72.. gallium atom : A metallic element predicted as eka-aluminium by Mendeleev in 1870 and discovered by Paul-Emile Lecoq de Boisbaudran in 1875. Named in honour of France (Latin Gallia) and perhaps also from the Latin gallus cock, a translation of Lecoq. | 2.01 | 1 | 0 | boron group element atom | |
| indinavir sulfate Indinavir: A potent and specific HIV protease inhibitor that appears to have good oral bioavailability. | 1.99 | 1 | 0 | dicarboxylic acid diamide; N-(2-hydroxyethyl)piperazine; piperazinecarboxamide | HIV protease inhibitor |
| sulfur Sulfur: An element that is a member of the chalcogen family. It has an atomic symbol S, atomic number 16, and atomic weight [32.059; 32.076]. It is found in the amino acids cysteine and methionine. | 5.87 | 18 | 0 | chalcogen; nonmetal atom | macronutrient |
| geldanamycin [no description available] | 2.06 | 1 | 0 | ||
| 5-deazaflavin [no description available] | 7.4 | 2 | 0 | pyridopyrimidine | |
| diphenylhexatriene Diphenylhexatriene: A fluorescent compound that emits light only in specific configurations in certain lipid media. It is used as a tool in the study of membrane lipids. | 2 | 1 | 0 | alkatriene | fluorochrome |
| dimyristoylphosphatidylcholine 1,2-di-O-myristoyl-sn-glycero-3-phosphocholine : A 1,2-diacyl-sn-glycero-3-phosphocholine where the two phosphatidyl acyl groups are specified as tetradecanoyl (myristoyl).. dimyristoyl phosphatidylcholine : A phosphatidylcholine where the phosphatidyl acyl groups are specified as tetradecanoyl (myristoyl). | 2.42 | 2 | 0 | 1,2-diacyl-sn-glycero-3-phosphocholine; phosphatidylcholine 28:0; tetradecanoate ester | antigen; mouse metabolite |
| deoxyribose [no description available] | 7.44 | 50 | 0 | deoxypentose | human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| cysteine Cysteine: A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.. L-cysteinium : The L-enantiomer of cysteinium.. cysteine : A sulfur-containing amino acid that is propanoic acid with an amino group at position 2 and a sulfanyl group at position 3. | 10.77 | 85 | 0 | cysteinium | fundamental metabolite |
| isophthalate isophthalate: RN given refers to parent cpd | 2.17 | 1 | 0 | dicarboxylic acid dianion | |
| silicon Silicon: A trace element that constitutes about 27.6% of the earth's crust in the form of SILICON DIOXIDE. It does not occur free in nature. Silicon has the atomic symbol Si, atomic number 14, and atomic weight [28.084; 28.086]. | 4.77 | 30 | 0 | carbon group element atom; metalloid atom; nonmetal atom | |
| 7-mercaptoheptanoylthreonine phosphate 7-mercaptoheptanoylthreonine phosphate: component B of the methylcoenzyme M methylreductase system of Methanobacterium thermoautotrophicum; structure given in first source | 2.02 | 1 | 0 | L-threonine derivative | coenzyme |
| phosphorus Phosphorus: A non-metal element that has the atomic symbol P, atomic number 15, and atomic weight 31. It is an essential element that takes part in a broad variety of biochemical reactions. | 7.83 | 52 | 0 | monoatomic phosphorus; nonmetal atom; pnictogen | macronutrient |
| boron Boron: A trace element with the atomic symbol B, atomic number 5, and atomic weight [10.806; 10.821]. Boron-10, an isotope of boron, is used as a neutron absorber in BORON NEUTRON CAPTURE THERAPY. | 3.15 | 5 | 0 | boron group element atom; metalloid atom; nonmetal atom | micronutrient |
| 2,2'-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid 2,2'-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid: chromogen in glucose oxidase-peroxidase method for determining serum glucose; used in free radical scavenging assays; structure in first source | 3 | 4 | 0 | ||
| sulindac sulfone sulindac sulfone: inhibits K-ras-dependent cyclooxygenase-2; sulfated analog of indomethacin;; CP248 is an antineoplastic agent that fosters microtubule depolymerization; structure in first source. sulindac sulfone : A sulfone metabolite of sulindac that inhibits cell growth by inducing apoptosis independently of cyclooxygenase inhibition. It inhibits the development and induces regression of premalignant adenomatous polyps. Lipoxygenase and Cox-2 inhibitor. | 2.01 | 1 | 0 | monocarboxylic acid; organofluorine compound; sulfone | apoptosis inducer; cyclooxygenase 2 inhibitor; EC 1.13.11.34 (arachidonate 5-lipoxygenase) inhibitor |
| solanesol solanesol : A nonaprenol that is hexatriaconta-2,6,10,14,18,22,26,30,34-nonaen-1-ol substituted by 9 methyl groups at positions 3, 7, 11, 15, 19, 23, 27, 31 and 35 (the all-trans0stereoisomer). | 2.17 | 1 | 0 | nonaprenol; primary alcohol | plant metabolite |
| enkephalin, ala(2)-mephe(4)-gly(5)- Enkephalin, Ala(2)-MePhe(4)-Gly(5)-: An enkephalin analog that selectively binds to the MU OPIOID RECEPTOR. It is used as a model for drug permeability experiments. | 1.99 | 1 | 0 | ||
| 4-heptadecylumbelliferone 4-heptadecylumbelliferone: fluorescence pH indicator | 2 | 1 | 0 | ||
| n-acetylsphingosine N-acetylsphingosine: inhibits phospholipase D. N-acetylsphingosine : A N-acylsphingosine that has an acetamido group at position 2. | 2.41 | 2 | 0 | N-acylsphingosine | |
| abscisic acid Abscisic Acid: Abscission-accelerating plant growth substance isolated from young cotton fruit, leaves of sycamore, birch, and other plants, and from potatoes, lemons, avocados, and other fruits.. (S)-2-trans-abscisic acid : A 2-trans-abscisic acid with (S)-configuration at the chiral centre.. (+)-abscisic acid : The naturally occurring (1'S)-(+) enantiomer of abscisic acid. It is an important sesquiterpenoid plant hormone which acts as a regulator of plant responses to environmental stresses such as drought and cold. | 2.44 | 2 | 0 | 2-trans-abscisic acid | |
| n-caproylsphingosine N-(hexanoyl)sphing-4-enine : An N-acylsphingosine consisting of sphing-4-enine bearing a hexanoyl group on nitrogen. | 2.44 | 2 | 0 | N-acylsphingosine | |
| 3,3'-dihexyl-2,2'-oxacarbocyanine 3,3'-dihexyl-2,2'-oxacarbocyanine: a fluorescent probe | 2.01 | 1 | 0 | ||
| carbocyanines Carbocyanines: Compounds that contain three methine groups. They are frequently used as cationic dyes used for differential staining of biological materials. | 7.3 | 75 | 0 | cyanine dye; organic iodide salt | fluorochrome |
| 3-methyl-2-benzothiazolone hydrazone 3-methyl-2-benzothiazolone hydrazone: RN given refers to parent cpd | 1.94 | 1 | 0 | ||
| 1,2-dielaidoylphosphatidylethanolamine 1,2-dielaidoylphosphatidylethanolamine: RN given refers to (E,E)-isomer; member of a class of cationic lipid formulations called cytofectins | 3.88 | 12 | 0 | ||
| ammonium sulfate Ammonium Sulfate: Sulfuric acid diammonium salt. It is used in CHEMICAL FRACTIONATION of proteins.. ammonium sulfate : An inorganic sulfate salt obtained by reaction of sulfuric acid with two equivalents of ammonia. A high-melting (decomposes above 280degreeC) white solid which is very soluble in water (70.6 g/100 g water at 0degreeC; 103.8 g/100 g water at 100degreeC), it is widely used as a fertilizer for alkaline soils. | 3.82 | 12 | 0 | ammonium salt; inorganic sulfate salt | fertilizer |
| caffeoyl-coenzyme a caffeoyl-coenzyme A: structure given in first source | 2.03 | 1 | 0 | ||
| coomassie brilliant blue [no description available] | 2.46 | 2 | 0 | ||
| tetrodotoxin Tetrodotoxin: An aminoperhydroquinazoline poison found mainly in the liver and ovaries of fishes in the order TETRAODONTIFORMES, which are eaten. The toxin causes paresthesia and paralysis through interference with neuromuscular conduction.. tetrodotoxin : A quinazoline alkaloid that is a marine toxin isolated from fish such as puffer fish. It has been shown to exhibit potential neutotoxicity due to its ability to block voltage-gated sodium channels. | 2.39 | 2 | 0 | azatetracycloalkane; oxatetracycloalkane; quinazoline alkaloid | animal metabolite; bacterial metabolite; marine metabolite; neurotoxin; voltage-gated sodium channel blocker |
| selenium Selenium: An element with the atomic symbol Se, atomic number 34, and atomic weight 78.97. It is an essential micronutrient for mammals and other animals but is toxic in large amounts. Selenium protects intracellular structures against oxidative damage. It is an essential component of GLUTATHIONE PEROXIDASE. | 4.11 | 15 | 0 | chalcogen; nonmetal atom | micronutrient |
| selenocysteine Selenocysteine: A naturally occurring amino acid in both eukaryotic and prokaryotic organisms. It is found in tRNAs and in the catalytic site of some enzymes. The genes for glutathione peroxidase and formate dehydrogenase contain the TGA codon, which codes for this amino acid.. selenocysteine : An alpha-amino acid that consists of alanine where one of the methyl hydrogens is substituted with a seleno group. | 2.41 | 2 | 0 | ||
| tellurium Tellurium: An element that is a member of the chalcogen family. It has the atomic symbol Te, atomic number 52, and atomic weight 127.60. It has been used as a coloring agent and in the manufacture of electrical equipment. Exposure may cause nausea, vomiting, and CNS depression. | 8.18 | 5 | 0 | chalcogen; metalloid atom | |
| polonium Polonium: A radioactive element that is a member of the chalcogen family. It has the atomic symbol Po, atomic number 84, and the atomic weight of the isotope with the longest half-life (209Po) is 208.98. It decays by alpha-emission.. polonium atom : A radioactive metallic element discovered in 1898 by Marie Sklodowska Curie and named after her home country, Poland (Latin Polonia). | 2.64 | 3 | 0 | chalcogen; metal atom | |
| bismuth oxychloride bismuth oxychloride: active against rotaviruses and enteric viruses | 2.13 | 1 | 0 | ||
| oxalates Oxalates: Derivatives of OXALIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that are derived from the ethanedioic acid structure. | 2.71 | 3 | 0 | ||
| octadecylsilane [no description available] | 2.17 | 1 | 0 | ||
| 5-((methylamino)methyl)-2-selenouridine 5-((methylamino)methyl)-2-selenouridine: naturally occurring nucleotide in bacterial tRNAs; structure given in first source | 1.96 | 1 | 0 | ||
| dizocilpine maleate Dizocilpine Maleate: A potent noncompetitive antagonist of the NMDA receptor (RECEPTORS, N-METHYL-D-ASPARTATE) used mainly as a research tool. The drug has been considered for the wide variety of neurodegenerative conditions or disorders in which NMDA receptors may play an important role. Its use has been primarily limited to animal and tissue experiments because of its psychotropic effects.. dizocilpine maleate : A maleate salt obtained by reaction of dizocilpine with one equivalent of maleic acid. | 2.72 | 3 | 0 | maleate salt; tetracyclic antidepressant | anaesthetic; anticonvulsant; neuroprotective agent; nicotinic antagonist; NMDA receptor antagonist |
| antimycin a Antimycin A: An antibiotic substance produced by Streptomyces species. It inhibits mitochondrial respiration and may deplete cellular levels of ATP. Antimycin A1 has been used as a fungicide, insecticide, and miticide. (From Merck Index, 12th ed). antimycin A : A nine-membered bis-lactone having methyl substituents at the 2- and 6-positions, an n-hexyl substituent at the 8-position, an acyloxy substituent at the 7-position and an aroylamido substituent at the 3-position. It is produced by Streptomyces bacteria and has found commercial use as a fish poison. | 2.02 | 1 | 0 | amidobenzoic acid | |
| ciproxifan [no description available] | 2.25 | 1 | 0 | aromatic ketone | |
| hygromycin a hygromycin A: a cinnamide derivative produced by Streptomyces hygroscopicus; structure differs from HYGROMYCIN B | 2.41 | 2 | 0 | hydroxycinnamic acid | metabolite |
| bambermycins Bambermycins: Antibiotic complex obtained from Streptomyces bambergiensis containing mainly Moenomycins A and C. They are used as feed additives and growth promoters for poultry, swine, and cattle. | 2 | 1 | 0 | ||
| 1-palmitoyl-2-oleoylphosphatidylcholine 1-palmitoyl-2-oleoylphosphatidylcholine: RN given refers to (Z)-isomer | 3.3 | 6 | 0 | ||
| aminoethoxyvinylglycine aminoethoxyvinylglycine: RN given for (S-(E))-isomer | 2.05 | 1 | 0 | ||
| biotin-11-dutp biotin-11-dUTP: used in detection of sickle cell anemia | 1.97 | 1 | 0 | ||
| 1-oleoyl-2-acetylglycerol [no description available] | 2.02 | 1 | 0 | 1,2-diglyceride | |
| involucrin involucrin: soluble precursor protein of cross-linked envelope characteristic of epidermal s. corneum synthesized by keratinocytes in natural & cultured human epithelia; see also related records for prekeratin & stratum corneum basic protein precursor | 2.02 | 1 | 0 | ||
| sibiromycin [no description available] | 2.04 | 1 | 0 | aminoglycoside antibiotic; hemiaminal; phenols; pyrrolobenzodiazepine | antineoplastic agent; bacterial metabolite |
| 1,2-dioleoyloxy-3-(trimethylammonium)propane 1,2-dioleoyloxy-3-(trimethylammonium)propane: fluorescent probe for phospholipids; RN & structure given in first source | 4.34 | 19 | 0 | ||
| dioleoyl phosphatidylethanolamine dioleoyl phosphatidylethanolamine: chemical name in article is incorrect - phosphatidylethandamine instead of phosphatidylethanolamine. dioleoyl phosphatidylethanolamine : A phosphatidylethanolamine in which the phosphatidyl acyl groups are both oleoyl. | 3.42 | 7 | 0 | phosphatidylethanolamine | |
| 1,1'-((4,4,7,7-tetramethyl)-4,7-diazaundecamethylene)bis-4-(3-methyl-2,3-dihydro(benzo-1,3-oxazole)-2-methylidine)quinolinium, tetraiodide 1,1'-((4,4,7,7-tetramethyl)-4,7-diazaundecamethylene)bis-4-(3-methyl-2,3-dihydro(benzo-1,3-oxazole)-2-methylidene)quinolinium: non-fluorescent in solution but forms highly fluorescent complex with double-stranded DNA; RN refers to the tetraiodide compound | 3.43 | 7 | 0 | cyanine dye; organic iodide salt | fluorochrome |
| concanamycin a concanamycin A: from Streptomyces diastatochromogenes S-45; inhibits vacuolar H+ ATPase. concanamycin A : A concanamycin in which the lactone ring contains 4 double bonds and is substituted by 4 methyl groups, 2 hydroxy groups, 2 methoxy groups and an ethyl group. | 2.1 | 1 | 0 | carbamate ester; concanamycin | antifungal agent; EC 3.6.3.14 (H(+)-transporting two-sector ATPase) inhibitor; metabolite |
| thiazole orange thiazole orange: structure given in first source. thiazole orange : A cyanine dye comprising the thiazole orange cation [1-methyl-4-[(3-methyl-1,3-benzothiazol-2(3H)-ylidene)methyl]quinolinium] with the p-tosylate counterion. | 9.19 | 16 | 0 | cyanine dye | fluorochrome |
| n-(1-(2,3-dioleyloxy)propyl)-n,n,n-trimethylammonium chloride N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium: cationic lipid; structure given in first source | 2.41 | 2 | 0 | ||
| 1,2-dioleoylphosphatidylserine 1,2-dioleoylphosphatidylserine: RN given in first source; RN given refers to (R-(Z,Z))-isomer; RN for cpd without isomeric designation not available 6/90. 1,2-dioleoyl-sn-glycero-3-phospho-L-serine : A 3-sn-phosphatidyl L-serine in which the phosphatidyl acyl groups are both oleoyl.. phosphatidylserine(18:1/18:1) : A 3-sn-phosphatidyl-L-serine in which the 1- and 2-acyl groups are octadecenoyl groups. | 2.1 | 1 | 0 | phosphatidylserine(18:1/18:1) | mouse metabolite |
| 2-crotonyloxymethyl-2-cyclohexenone 2-crotonyloxymethyl-2-cyclohexenone: structure given in first source | 2.01 | 1 | 0 | ||
| yo-pro 1 oxazole yellow: structure in first source. Yo-Pro-1 : An unsymmetrical C1 cyanine dye having 1,3-benzoxazol-2-yl and quinolinium-4-yl substituents. | 2 | 1 | 0 | cyanine dye; organic iodide salt; quaternary ammonium salt | fluorochrome |
| a 201a A 201A: from Streptomyces capreolus; structure given in first source | 2.15 | 1 | 0 | ||
| everolimus [no description available] | 3.55 | 2 | 0 | cyclic acetal; cyclic ketone; ether; macrolide lactam; primary alcohol; secondary alcohol | anticoronaviral agent; antineoplastic agent; geroprotector; immunosuppressive agent; mTOR inhibitor |
| emerin emerin: a serine-rich protein; responsible for Emery-Dreifuss muscular dystrophy (EDMD) | 2.03 | 1 | 0 | ||
| 11-hydroperoxyeicosa-5,8,12,14-tetraenoic acid [no description available] | 2.02 | 1 | 0 | ||
| digoxigenin-11-2',3'-dideoxyuridine 5'-triphosphate [no description available] | 1.98 | 1 | 0 | ||
| asialo gm1 ganglioside [no description available] | 2 | 1 | 0 | ||
| axitinib [no description available] | 6.62 | 9 | 0 | aryl sulfide; benzamides; indazoles; pyridines | antineoplastic agent; tyrosine kinase inhibitor; vascular endothelial growth factor receptor antagonist |
| s 1360 [no description available] | 3.12 | 1 | 0 | ||
| oxepins Oxepins: Compounds based on a 7-membered heterocyclic ring including an oxygen. They can be considered a medium ring ether. A natural source is the MONTANOA plant genus. Some dibenzo-dioxepins, called depsidones, are found in GARCINIA plants. | 2.03 | 1 | 0 | ||
| 2'-amino-2'-deoxyuridine 2'-amino-2'-deoxyuridine: structure in first source | 7.03 | 1 | 0 | ||
| tanespimycin CP 127374: analog of herbimycin A | 3.86 | 3 | 0 | 1,4-benzoquinones; ansamycin; carbamate ester; organic heterobicyclic compound; secondary amino compound | antineoplastic agent; apoptosis inducer; Hsp90 inhibitor |
| fusaproliferin fusaproliferin: isolated from Fusarium proliferatum; structure in first source | 2 | 1 | 0 | ||
| beta-escin [no description available] | 2.99 | 4 | 0 | ||
| s-nitroso-n-acetylpenicillamine S-Nitroso-N-Acetylpenicillamine: A sulfur-containing alkyl thionitrite that is one of the NITRIC OXIDE DONORS. | 2.41 | 2 | 0 | nitroso compound; nitrosothio compound | nitric oxide donor; vasodilator agent |
| lactacystin [no description available] | 2.42 | 2 | 0 | lactam; S-substituted L-cysteine | |
| peplomycin Peplomycin: An antineoplastic agent derived from BLEOMYCIN. | 2.02 | 1 | 0 | glycopeptide | |
| gadolinium dtpa Gadolinium DTPA: A complex of gadolinium with a chelating agent, diethylenetriamine penta-acetic acid (DTPA see PENTETIC ACID), that is given to enhance the image in cranial and spinal MRIs. (From Martindale, The Extra Pharmacopoeia, 30th ed, p706) | 2.04 | 1 | 0 | gadolinium coordination entity | MRI contrast agent |
| adenosine-3',5'-cyclic phosphorothioate adenosine-3',5'-cyclic phosphorothioate: RP-cAMP-S is a protein kinase A inhibitor; SP-cAMP-S is a protein kinase A agonist. (Sp)-cAMPS : A nucleoside 3',5'-cyclic phosphorothioate having adenine as the nucleobase (the Sp-stereoisomer).. (Rp)-cAMPS : A nucleoside 3',5'-cyclic phosphorothioate having adenine as the nucleobase (the Rp-stereoisomer). | 1.97 | 1 | 0 | nucleoside 3',5'-cyclic phosphorothioate | |
| sq-23377 Ionomycin: A divalent calcium ionophore that is widely used as a tool to investigate the role of intracellular calcium in cellular processes.. ionomycin : A very long-chain fatty acid that is docosa-10,16-dienoic acid which is substituted by methyl groups at positions 4, 6, 8, 12, 14, 18 and 20, by hydroxy groups at positions 11, 19 and 21, and by a (2',5-dimethyloctahydro-2,2'-bifuran-5-yl)ethanol group at position 21. An ionophore produced by Streptomyces conglobatus, it is used in research to raise the intracellular level of Ca(2+) and as a research tool to understand Ca(2+) transport across biological membranes. | 2.68 | 3 | 0 | cyclic ether; enol; polyunsaturated fatty acid; very long-chain fatty acid | calcium ionophore; metabolite |
| 2-thioribothymidine [no description available] | 2.03 | 1 | 0 | thiouridine | |
| beraprost beraprost: stable prostacyclin analog; structure given in first source. beraprost : An organic heterotricyclic compound that is (3aS,8bS)-2,3,3a,8b-tetrahydro-1H-benzo[b]cyclopenta[d]furan in which the hydrogens at positions 1R, 2R and 5 are replaced by (3S)-3-hydroxy-4-methyloct-1-en-6-yn-1-yl, hydroxy and 3-carboxypropyl groups, respectively. It is a prostaglandin receptor agonist which is approved to treat pulmonary arterial hypertension in Asia. | 2.01 | 1 | 0 | enyne; monocarboxylic acid; organic heterotricyclic compound; secondary alcohol; secondary allylic alcohol | anti-inflammatory agent; antihypertensive agent; platelet aggregation inhibitor; prostaglandin receptor agonist; vasodilator agent |
| panobinostat Panobinostat: An indole and hydroxamic acid derivative that acts as a HISTONE DEACETYLASE inhibitor. It is used as an antineoplastic agent in combination with BORTEZOMIB and DEXAMETHASONE for the treatment of MULTIPLE MYELOMA.. panobinostat : A hydroxamic acid obtained by formal condensation of the carboxy group of (2E)-3-[4-({[2-(2-methylindol-3-yl)ethyl]amino}methyl)phenyl]prop-2-enoic acid with the amino group of hydroxylamine. A histone deacetylase inhibitor used (as its lactate salt) in combination with bortezomib and dexamethasone for the treatment of multiple myeloma. | 2.25 | 1 | 0 | cinnamamides; hydroxamic acid; methylindole; secondary amino compound | angiogenesis modulating agent; antineoplastic agent; EC 3.5.1.98 (histone deacetylase) inhibitor |
| staurosporine staurosporinium : Conjugate acid of staurosporine. | 5.12 | 8 | 0 | ammonium ion derivative | |
| 1,2-5,6-di-o-isopropylidene-d-glucofuranose 1,2-5,6-di-O-isopropylidene-D-glucofuranose: used in determination of blood glucose; RN given refers to parent cpd; structure given in first source | 1.98 | 1 | 0 | ||
| 2-amino-5,6,7-trimethyl-1,8-naphthyridine 2-amino-5,6,7-trimethyl-1,8-naphthyridine: structure in first source | 2.05 | 1 | 0 | ||
| hypericum Hypericum: Genus of perennial plants in the family CLUSIACEAE (sometimes classified as Hypericaceae). Herbal and homeopathic preparations are used for depression, neuralgias, and a variety of other conditions. Hypericum contains flavonoids; GLYCOSIDES; mucilage, TANNINS; volatile oils (OILS, ESSENTIAL), hypericin and hyperforin.. 6-formamidopenicillanic acid : A penicillanic acid having a (6R)-formamido substituent. | 2.11 | 1 | 0 | penicillanic acids | |
| phosphocreatine Phosphocreatine: An endogenous substance found mainly in skeletal muscle of vertebrates. It has been tried in the treatment of cardiac disorders and has been added to cardioplegic solutions. (Reynolds JEF(Ed): Martindale: The Extra Pharmacopoeia (electronic version). Micromedex, Inc, Englewood, CO, 1996). phosphagen : Any of a group of guanidine or amidine phosphates that function as storage depots for high-energy phosphate in muscle with the purpose of regenerating ATP from ADP during muscular contraction.. N-phosphocreatine : A phosphoamino acid consisting of creatine having a phospho group attached at the primary nitrogen of the guanidino group. | 2.48 | 2 | 0 | phosphagen; phosphoamino acid | human metabolite; mouse metabolite |
| formazans Formazans: Colored azo compounds formed by the reduction of tetrazolium salts. Employing this reaction, oxidoreductase activity can be determined quantitatively in tissue sections by allowing the enzymes to act on their specific substrates in the presence of tetrazolium salts. | 2.06 | 1 | 0 | ||
| thioacetazone Thioacetazone: A thiosemicarbazone that is used in association with other antimycobacterial agents in the initial and continuation phases of antituberculosis regimens. Thiacetazone containing regimens are less effective than the short-course regimen recommended by the International Union Against Tuberculosis and are used in some developing countries to reduce drug costs. (From Martindale, The Extra Pharmacopoeia, 30th ed, p217). thiosemicarbazone : A hydrazone resulting from the formal condensation of an aldehyde or ketone with the non-thioacylated nitrogen of thiosemicarbazide or its substituted derivatives. | 2.08 | 1 | 0 | ||
| braco-19 BRACO-19: structure in first source | 3.14 | 1 | 0 | acridines; N-alkylpyrrolidine | |
| lenvatinib lenvatinib : A member of the class of quinolines that is the carboxamide of 4-{3-chloro-4-[(cyclopropylcarbamoyl)amino]phenoxy}-7-methoxyquinoline-6-carboxylic acid. A multi-kinase inhibitor and orphan drug used (as its mesylate salt) for the treatment of various types of thyroid cancer that do not respond to radioiodine. | 4.1 | 2 | 0 | aromatic amide; aromatic ether; cyclopropanes; monocarboxylic acid amide; monochlorobenzenes; phenylureas; quinolines | antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; fibroblast growth factor receptor antagonist; orphan drug; vascular endothelial growth factor receptor antagonist |
| midostaurin midostaurin : An organic heterooctacyclic compound that is the N-benzoyl derivative of staurosporine. | 4.05 | 2 | 0 | benzamides; gamma-lactam; indolocarbazole; organic heterooctacyclic compound | antineoplastic agent; EC 2.7.11.13 (protein kinase C) inhibitor |
| sincalide Sincalide: An octapeptide hormone present in the intestine and brain. When secreted from the gastric mucosa, it stimulates the release of bile from the gallbladder and digestive enzymes from the pancreas. | 2.49 | 2 | 0 | oligopeptide | |
| ursodoxicoltaurine tauroursodeoxycholate : An organosulfonate oxoanion that is the conjugate base of tauroursodeoxycholic acid arising from deprotonation of the sulfonate OH group; major species at pH 7.3.. tauroursodeoxycholic acid : A bile acid taurine conjugate derived from ursoodeoxycholic acid. | 2.31 | 1 | 0 | bile acid taurine conjugate | anti-inflammatory agent; apoptosis inhibitor; bone density conservation agent; cardioprotective agent; human metabolite; neuroprotective agent |
| dc 107 leinamycin: a thiazole containing macrolide characterized by an unusual 1,3-dioxo-1,2-dithiolane moiety that is spiro fused to an 18 member macrolactam ring; isolated from Streptomyces; MF C22-H26-N2-O6-S3; possible DNA alkylator; the leinamycin biosynthetic gene cluster from Streptomyces atroolivaceus S-140 consists of two polyketide synthases genes | 2.41 | 2 | 0 | dithiolanes | |
| akr 501 avatrombopag: enhances megakaryocytopoiesis; structure in first source | 2.21 | 1 | 0 | ||
| bms201038 BMS201038: an anticholesteremic agent and microsomal triglycide transfer protein inhibitor. lomitapide : A member of the class of benzamides obtained by formal condensation of the carboxy group of 4'-(trifluoromethyl)biphenyl-2-carboxylic acid with the primary amino group of 9-[4-(4-aminopiperidin-1-yl)butyl]-N-(2,2,2-trifluoroethyl)-9H-fluorene-9-carboxamide. Used (as its mesylate salt) as a complement to a low-fat diet and other lipid-lowering treatments in patients with homozygous familial hypercholesterolemia. | 10.1 | 32 | 1 | (trifluoromethyl)benzenes; benzamides; fluorenes; piperidines | anticholesteremic drug; MTP inhibitor |
| biln 2061 BILN 2061: a macrocyclic NS3 protease inhibitor and antiviral agent; structure in first source | 4.41 | 1 | 1 | ||
| kla peptide KLA peptide: a synthetic amphipathic peptide that disrupts mitochondrial membranes when internalized; has antineoplastic activity | 2.07 | 1 | 0 | ||
| nu 7026 2-(morpholin-4-yl)benzo(h)chromen-4-one: a radiosensitizing agent that inhibits DNA-dependent protein kinase; structure in first source | 2.04 | 1 | 0 | organic heterotricyclic compound; organooxygen compound | |
| mocetinostat mocetinostat: undergoing phase II clinical trials for treatment of cancer. mocetinostat : A benzamide obtained by formal condensation of the carboxy group of 4-({[4-(pyridin-3-yl)pyrimidin-2-yl]amino}methyl)benzoic acid with one of the amino groups of benzene-1,2-diamine. It is an orally active and isotype-selective HDAC inhibitor which exhibits antitumour activity (IC50 = 0.15, 0.29, 1.66 and 0.59 muM for HDAC1, HDAC2, HDAC3 and HDAC11). | 4.4 | 20 | 0 | aminopyrimidine; benzamides; pyridines; secondary amino compound; secondary carboxamide; substituted aniline | antineoplastic agent; apoptosis inducer; autophagy inducer; cardioprotective agent; EC 3.5.1.98 (histone deacetylase) inhibitor; hepatotoxic agent |
| tak 475 1-((1-(3-acetoxy-2,2-dimethylpropyl)-7-chloro-5-(2,3-dimethoxyphenyl)-2-oxo-1,2,3,5-tetrahydro-4,1-benzoxazepin-3-yl)acetyl)piperidine-4-acetic acid: inhibits squalene synthase; structure in first source | 3.14 | 1 | 0 | ||
| lipid a Lipid A: Lipid A is the biologically active component of lipopolysaccharides. It shows strong endotoxic activity and exhibits immunogenic properties.. lipid A : The glycolipid moiety of bacterial lipopolysaccharide (R can be either hydrogen or a fatty acyl group). | 4.23 | 5 | 0 | dodecanoate ester; lipid A; tetradecanoate ester | Escherichia coli metabolite |
| mart-1 antigen MART-1 Antigen: A melanosome-specific protein that plays a role in the expression, stability, trafficking, and processing of GP100 MELANOMA ANTIGEN, which is critical to the formation of Stage II MELANOSOMES. The protein is used as an antigen marker for MELANOMA cells. | 2.01 | 1 | 0 | ||
| g(m2) ganglioside G(M2) Ganglioside: A glycosphingolipid that accumulates due to a deficiency of hexosaminidase A or B (BETA-N-ACETYLHEXOSAMINIDASES), or GM2 activator protein, resulting in GANGLIOSIDOSES, heredity metabolic disorders that include TAY-SACHS DISEASE and SANDHOFF DISEASE.. ganglioside GM2 (18:0) : A sialotriaosylceramide that is N-acetyl-beta-D-galactosaminyl-(1->4)-alpha-N-acetylneuraminosyl-(2->3)-beta-D-galactosyl-(1->4)-beta-D-glucosyl-N-acylsphingosine in which the acyl group on the sphingosine nitrogen is octadecanoyl. A constituent of natural ganglioside GM2. | 1.97 | 1 | 0 | N-acetyl-beta-D-galactosaminyl-(1->4)-alpha-N-acetylneuraminosyl-(2->3)-beta-D-galactosyl-(1->4)-beta-D-glucosyl-N-acylsphingosine; sialotriaosylceramide | antigen |
| selexipag selexipag: prostacyclin receptor agonist. selexipag : A member of the class of pyrazines that is N-(methanesulfonyl)-2-{4-[(propan-2-yl)(pyrazin-2-yl)amino]butoxy}acetamide carrying two additional phenyl substituents at positions 5 and 6 on the pyrazine ring. An orphan drug used for the treatment of pulmonary arterial hypertension. It is a prodrug for ACT-333679 (the free carboxylic acid). | 2.15 | 1 | 0 | aromatic amine; ether; monocarboxylic acid amide; N-sulfonylcarboxamide; pyrazines; tertiary amino compound | orphan drug; platelet aggregation inhibitor; prodrug; prostacyclin receptor agonist; vasodilator agent |
| ptr 3173 PTR 3173: amino acid sequence in first source | 4.14 | 1 | 0 | ||
| tofacitinib tofacitinib : A pyrrolopyrimidine that is pyrrolo[2,3-d]pyrimidine substituted at position 4 by an N-methyl,N-(1-cyanoacetyl-4-methylpiperidin-3-yl)amino moiety. Used as its citrate salt to treat moderately to severely active rheumatoid arthritis. | 5.03 | 4 | 0 | N-acylpiperidine; nitrile; pyrrolopyrimidine; tertiary amino compound | antirheumatic drug; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor |
| bibr 1532 [no description available] | 4.09 | 2 | 0 | ||
| olesoxime olesoxime: drug candidate for amyotrophic lateral sclerosis; structure in first source | 4.24 | 2 | 0 | ||
| rucaparib AG14447: Poly(ADP-ribose) polymerase inhibitor; structure in first source | 2.15 | 1 | 0 | azepinoindole; caprolactams; organofluorine compound; secondary amino compound | antineoplastic agent; EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor |
| cediranib [no description available] | 5.88 | 6 | 0 | aromatic ether | |
| cc 1065 CC 1065: from Streptomyces zelensis; structure in second sourc | 2.9 | 4 | 0 | ||
| zeolites [no description available] | 2.21 | 1 | 0 | ||
| tetramethylrhodamine tetramethylrhodamine: RN given refers to perchlorate; structure | 3.82 | 11 | 0 | xanthene dye | |
| benzyloxycarbonyl-isoleucyl-glutamyl(o-tert-butyl)-alanyl-leucinal benzyloxycarbonyl-isoleucyl-glutamyl(O-tert-butyl)-alanyl-leucinal: inhibits chymotrypsin activity of the proteasome | 2.03 | 1 | 0 | ||
| ubiquinol ubiquinol: reduced forms of ubiquinone; see also record for ubiquinol 10. ubiquinol-10 : A ubiquinol in which the polyprenyl substituent is decaprenyl. | 2.05 | 1 | 0 | polyprenylhydroquinone; ubiquinol | biomarker; metabolite |
| g(m1) ganglioside G(M1) Ganglioside: A specific monosialoganglioside that accumulates abnormally within the nervous system due to a deficiency of GM1-b-galactosidase, resulting in GM1 gangliosidosis.. ganglioside GM1 : A sialotetraosylceramide consisting of a branched pentasaccharide made up from one sialyl residue, two galactose residues, one N-acetylgalactosamine residue and a glucose residue at the reducing end attached to N-stearoylsphingosine via a beta-linkage. | 2.74 | 3 | 0 | alpha-N-acetylneuraminosyl-(2->3)-[beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminyl-(1->4)]-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-N-acylsphingosine; sialotetraosylceramide | |
| aluminum oxide Aluminum Oxide: An oxide of aluminum, occurring in nature as various minerals such as bauxite, corundum, etc. It is used as an adsorbent, desiccating agent, and catalyst, and in the manufacture of dental cements and refractories. | 3.3 | 6 | 0 | ||
| masitinib [no description available] | 3.91 | 3 | 0 | 1,3-thiazoles; benzamides; N-alkylpiperazine; pyridines | antineoplastic agent; antirheumatic drug; tyrosine kinase inhibitor |
| mhc binding peptide MHC binding peptide: structure in first source | 2.1 | 1 | 0 | ||
| phosphoramidite phosphoramidite: structure in first source. phosphoramidite : A compound with the general formula (RO)2PNR2. Phosphoramidites can be regarded as phosphites that have an NR2 instead of an OH group, or as amides of phosphorous acid. | 10.29 | 230 | 0 | ||
| cystathionine Cystathionine: Sulfur-containing amino acid formed as an intermediate in the conversion of METHIONINE to CYSTEINE.. cystathionine : A modified amino acid generated by enzymic means from homocysteine and serine. | 2 | 1 | 0 | cysteine derivative | |
| pazopanib pazopanib: a protein kinase inhibitor. pazopanib : A pyrimidine that is 5-(pyrimidin-2-yl}amino-2-methylbenzenesulfonamide substituted at position 4 by a (2,3-dimethylindazol-6-yl)(methyl)amino group. Used as its hydrochloride salt for treatment of kidney cancer. | 5.89 | 6 | 0 | aminopyrimidine; indazoles; sulfonamide | angiogenesis modulating agent; antineoplastic agent; tyrosine kinase inhibitor; vascular endothelial growth factor receptor antagonist |
| n-t-butyl-n'-tetradecyl-3-tetradecylaminopropionamidine N-t-butyl-n'-tetradecyl-3-tetradecylaminopropionamidine: an amphiphile that forms hydrophobic stable complexes with plasmid DNA, rendering it resistant to DNase I | 2.08 | 1 | 0 | ||
| bibw 2992 [no description available] | 3.15 | 1 | 0 | aromatic ether; enamide; furans; monochlorobenzenes; organofluorine compound; quinazolines; secondary carboxamide; tertiary amino compound | antineoplastic agent; tyrosine kinase inhibitor |
| vitamin u Vitamin U: A vitamin found in green vegetables. It is used in the treatment of peptic ulcers, colitis, and gastritis and has an effect on secretory, acid-forming, and enzymatic functions of the intestinal tract.. S-methyl-L-methioninate : A sulfonium betaine that is a conjugate base of S-methyl-L-methionine obtained by the deprotonation of the carboxy group. | 2.08 | 1 | 0 | methyl-L-methionine; sulfonium betaine | |
| cl 075 [no description available] | 2.06 | 1 | 0 | ||
| ro3244794 RO3244794: structure in first source | 2.05 | 1 | 0 | ||
| alpha-synuclein alpha-Synuclein: A synuclein that is a major component of LEWY BODIES and plays a role in SYNUCLEINOPATHIES, neurodegeneration and neuroprotection. | 4.81 | 9 | 0 | ||
| erucylphospho-n,n,n-trimethylpropylammonium erucylphospho-N,N,N-trimethylpropylammonium: an antineoplastic agent | 2.03 | 1 | 0 | ||
| 7-aminoactinomycin d 7-aminoactinomycin D: staining reagent used in flow cytometry | 2.03 | 1 | 0 | ||
| ccx282-b CCX282-B: antagonist of CCR9 chemokine receptor | 3.27 | 1 | 0 | ||
| 2'-o-methyl-2-thiouridine 2'-O-methyl-2-thiouridine: structure in first source | 7.44 | 2 | 0 | ||
| etc-1002 8-hydroxy-2,2,14,14-tetramethylpentadecanedioic acid: inhibits ATP citrate lyase (ACL); has anti-atherosclerotic activity. bempedoic acid : An alpha,omega-dicarboxylic acid that is pentadecanedioic acid which is substituted by methyl groups groups at positions 2 and 14, and by a hydroxy group at position 8. It is a drug used for the treatment of high LDL cholesterol, which is sometimes referred to as 'bad cholesterol'. | 4.99 | 4 | 0 | alpha,omega-dicarboxylic acid | antilipemic drug; EC 2.3.3.8 (ATP citrate synthase) inhibitor; prodrug |
| oxadiazoles Oxadiazoles: Compounds containing five-membered heteroaromatic rings containing two carbons, two nitrogens, and one oxygen atom which exist in various regioisomeric forms. | 6.27 | 9 | 0 | ||
| spliceostatin a spliceostatin A: antiangiogenic agent that blocks expression of VEGF; structure in first source | 3.25 | 1 | 0 | ||
| 2'-deoxyadenylyl-(3'-5')-2'-deoxyadenosine [no description available] | 2.36 | 2 | 0 | nucleoside analogue; purines | |
| 4'-thiothymidine 4'-thiothymidine: RN & structure given in first source | 2.02 | 1 | 0 | ||
| ucn 1028 c calphostin C: structure given in first source; isolated from Cladosporium cladosporioides | 2.7 | 3 | 0 | ||
| ribose ribopyranose : The pyranose form of ribose. | 7.8 | 73 | 0 | D-ribose; ribopyranose | |
| 5-formylcytosine 5-formylcytosine: structure in first source. 5-formylcytosine : A nucleobase analogue that is cytosine in which the hydrogen at position 5 is replaced by a formyl group. | 8.04 | 4 | 0 | aminopyrimidine; heteroarenecarbaldehyde; nucleobase analogue; pyrimidone | metabolite |
| acebutolol alpha-D-glucosyl-(1->4)-alpha-D-mannose : An alpha-D-glucosyl-(1->4)-D-mannopyranose in which the anomeric hydroxy group has alpha configuration. | 2.38 | 2 | 0 | alpha-D-glucosyl-(1->4)-D-mannopyranose | |
| 8-oxo-2'-deoxyadenosine 8-hydroxy-2'-deoxyadenosine: structure in first source | 2.03 | 1 | 0 | purine 2'-deoxyribonucleoside | |
| tafamidis tafamidis: may be effective in treating transthyretin amyloid polyneuropathy. tafamidis : A member of the class of 1,3-benzoxazoles that is 1,3-benzoxazole-6-carboxylic acid in which the hydrogen at position 2 is replaced by a 3,5-dichlorophenyl group. Used (as its meglumine salt) for the amelioration of transthyretin-related hereditary amyloidosis. | 8.69 | 11 | 0 | 1,3-benzoxazoles; dichlorobenzene; monocarboxylic acid | central nervous system drug |
| negamycin negamycin: broad spectrum hydrazide antibiotic obtained from Streptomyces species; action seems to be due to its binding to ribosomes & interference with amino coding in protein synthesis; precursor is probably leucyl-negamycin; minor descriptor (76-85); on-line & Index Medicus search AMINO ACIDS, DIAMINO (76-85); RN given refers to (threo-L)-isomer | 3.17 | 1 | 0 | ||
| regorafenib [no description available] | 3.19 | 1 | 0 | (trifluoromethyl)benzenes; aromatic ether; monochlorobenzenes; monofluorobenzenes; phenylureas; pyridinecarboxamide | antineoplastic agent; hepatotoxic agent; tyrosine kinase inhibitor |
| 8,5'-cyclo-2'-deoxyadenosine 8,5'-cyclo-2'-deoxyadenosine : An organic heterotetracyclic compound obtained by intramolecular formation of a C-C bond between positions 8 and 5' of 2'-deoxyadenosine. | 3.6 | 8 | 0 | aromatic amine; bridged compound; diol; N-glycosyl compound; organic heterotetracyclic compound | Mycoplasma genitalium metabolite |
| ptc 124 [no description available] | 5.41 | 5 | 0 | oxadiazole; ring assembly | |
| px 478 2-amino-3-(4'-N,N-bis(2-chloroethyl)amino)phenylpropionic acid N-oxide: inhibits hypoxia-inducible factor-1alpha | 2.61 | 2 | 0 | ||
| fg-4592 roxadustat: structure in first source. roxadustat : An N-acylglycine resulting from the formal condensation of the amino group of glycine with the carboxy group of 4-hydroxy-1-methyl-7-phenoxyisoquinoline-3-carboxylic acid. It is an inhibitor of hypoxia inducible factor prolyl hydroxylase (HIF-PH). | 2.25 | 1 | 0 | aromatic ether; isoquinolines; N-acylglycine | EC 1.14.11.2 (procollagen-proline dioxygenase) inhibitor; EC 1.14.11.29 (hypoxia-inducible factor-proline dioxygenase) inhibitor |
| nu 7441 8-dibenzothiophen-4-yl-2-morpholin-4-yl-chromen-4-one: structure in first source | 2.05 | 1 | 0 | dibenzothiophenes | |
| vx 765 belnacasan: a NSAID | 2.15 | 1 | 0 | dipeptide | |
| alogliptin alogliptin: structure in first source. alogliptin : A piperidine that is 3-methyl-2,4-dioxo-3,4-dihydropyrimidine carrying additional 2-cyanobenzyl and 3-aminopiperidin-1-yl groups at positions 1 and 2 respectively (the R-enantiomer). Used in the form of its benzoate salt for treatment of type 2 diabetes. | 2.1 | 1 | 0 | nitrile; piperidines; primary amino compound; pyrimidines | EC 3.4.14.5 (dipeptidyl-peptidase IV) inhibitor; hypoglycemic agent |
| dorsomorphin dorsomorphin: an AMPK inhibitor. dorsomorphin : A pyrazolopyrimidine that is pyrazolo[1,5-a]pyrimidine which is substituted at positions 3 and 6 by pyridin-4-yl and p-[2-(piperidin-1-yl)ethoxy]phenyl groups, respectively. It is a potent, selective, reversible, and ATP-competitive inhibitor of AMPK (AMP-activated protein kinase, EC 2.7.11.31) and a selective inhibitor of bone morphogenetic protein (BMP) signaling. | 2.07 | 1 | 0 | aromatic ether; piperidines; pyrazolopyrimidine; pyridines | bone morphogenetic protein receptor antagonist; EC 2.7.11.31 {[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase} inhibitor |
| anacetrapib [no description available] | 5.2 | 4 | 0 | ||
| apremilast [no description available] | 3.35 | 1 | 0 | aromatic ether; N-acetylarylamine; phthalimides; sulfone | non-steroidal anti-inflammatory drug; phosphodiesterase IV inhibitor |
| idelalisib idelalisib: an antineoplastic agent and p110delta inhibitor; structure in first source. idelalisib : A member of the class of quinazolines that is 5-fluoro-3-phenylquinazolin-4-one in which the hydrogen at position 2 is replaced by a (1S)-1-(3H-purin-6-ylamino)propyl group. used for for the treatment of refractory indolent non-Hodgkin's lymphoma and relapsed chronic lymphocytic leukemia. | 2.15 | 1 | 0 | aromatic amine; organofluorine compound; purines; quinazolines; secondary amino compound | antineoplastic agent; apoptosis inducer; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor |
| crizotinib Crizotinib: A piperidine and aminopyridine derivative that acts as an inhibitor of RECEPTOR PROTEIN-TYROSINE KINASES, including ANAPLASTIC LYMPHOMA KINASE (ALK) and HEPATOCYTE GROWTH FACTOR RECEPTOR (HGFR; c-Met). It is used in the treatment of NON-SMALL CELL LUNG CANCER.. crizotinib : A 3-[1-(2,6-dichloro-3-fluorophenyl)ethoxy]-5-[1-(piperidin-4-yl)pyrazol-4-yl]pyridin-2-amine that has R configuration at the chiral centre. The active enantiomer, it acts as a kinase inhibitor and is used for the treatment of patients with locally advanced or metastatic non-small cell lung cancer (NSCLC) | 2.11 | 1 | 0 | 3-[1-(2,6-dichloro-3-fluorophenyl)ethoxy]-5-[1-(piperidin-4-yl)pyrazol-4-yl]pyridin-2-amine | antineoplastic agent; biomarker; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor |
| zstk474 ZSTK-474 : A triamino-1,3,5-triazine that is 1,3,5-triazine in which two of the hydrogens have been replaced by morpholin-4-yl groups while the third hydrogen has been replaced by a 2-(difluoromethyl)benzimidazol-1-yl group. It is an inhibitor of phosphatidylinositol 3-kinase. | 2.15 | 1 | 0 | benzimidazoles; morpholines; organofluorine compound; triamino-1,3,5-triazine | antineoplastic agent; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor |
| chir-265 [no description available] | 2.11 | 1 | 0 | aromatic ether | |
| lorcaserin lorcaserin: orally active, small-molecule 5-hydroxytryptamine 2C agonist for the potential treatment of obesity and diabetes. lorcaserin : A benzazepine that is 2,3,4,5-tetrahydro-3-benzazepine substituted at position 1 by a methyl group and a t position 6 by a chloro group. | 2.1 | 1 | 0 | benzazepine; organochlorine compound | anti-obesity agent; appetite depressant |
| fostamatinib fostamatinib: a spleen tyrosine kinase (Syk) inhibitor, metabolized to R406 | 2.21 | 1 | 0 | ||
| losartan potassium Erythropoietin: Glycoprotein hormone, secreted chiefly by the KIDNEY in the adult and the LIVER in the FETUS, that acts on erythroid stem cells of the BONE MARROW to stimulate proliferation and differentiation. | 4.2 | 17 | 0 | ||
| sesone 7-deazaxanthine: structure in first source | 2.04 | 1 | 0 | ||
| alpha-Neup5Ac-(2->3)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-D-GlcpNAc Sialyl Lewis X Antigen: A sialylated version of Lewis X antigen expressed on cell surfaces. It is a ligand for SELECTINS.. alpha-Neup5Ac-(2->3)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-D-GlcpNAc : A branched amino tetrasaccharide consisting of a sialyl residue, linked (2->3) to a galactosyl residue that in turn is linked (1->4) to a glucosaminyl residue, which is also carrying a fucosyl residue at the 3-position. | 2.4 | 2 | 0 | amino tetrasaccharide; glucosamine oligosaccharide | epitope |
| empagliflozin [no description available] | 3.35 | 1 | 0 | aromatic ether; C-glycosyl compound; monochlorobenzenes; tetrahydrofuryl ether | hypoglycemic agent; sodium-glucose transport protein subtype 2 inhibitor |
| telomestatin telomestatin: isolated from Spreptomyces anulatus; structure in first source | 7.72 | 3 | 0 | ||
| calcimycin Calcimycin: An ionophorous, polyether antibiotic from Streptomyces chartreusensis. It binds and transports CALCIUM and other divalent cations across membranes and uncouples oxidative phosphorylation while inhibiting ATPase of rat liver mitochondria. The substance is used mostly as a biochemical tool to study the role of divalent cations in various biological systems. | 2.67 | 3 | 0 | benzoxazole | |
| veliparib [no description available] | 2.15 | 1 | 0 | benzimidazoles | EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor |
| sepharose agarose : A linear polysaccharide made up from alternating D-galactose and 3,6-anhydro-alpha-L-galactopyranose residues joined by alpha-(1->3)- and beta-(1->4)-linkages. | 4.94 | 37 | 0 | ||
| pituitrin Pituitrin: A substance or extract from the neurohypophysis (PITUITARY GLAND, POSTERIOR). | 3.77 | 11 | 0 | ||
| ra v RA V: structure given in first source | 2.21 | 1 | 0 | ||
| virginiamycin Virginiamycin: A cyclic polypeptide antibiotic complex from Streptomyces virginiae, S. loidensis, S. mitakaensis, S. pristina-spiralis, S. ostreogriseus, and others. It consists of 2 major components, VIRGINIAMYCIN FACTOR M1 and virginiamycin Factor S1. It is used to treat infections with gram-positive organisms and as a growth promoter in cattle, swine, and poultry.. virginiamycin : A mixture of cyclic polypeptide streptogramin antibiotics produced by Streptomyces virginiae, S. loidensis, S. mitakaensis, S. pristina-spiralis, S. ostreogriseus, and others. The two major components are virginiamycin M1 (also known as pristinamycin IIA) and virginiamycin S1. Virginiamycin has been widely used as a growth promotion agent in livestock and has been to have bacteriostatic activity against Gram-positive organisms such as staphylococci and streptococci. | 2 | 1 | 0 | ||
| tris(4,7-diphenyl-1,10-phenanthroline)ruthenium (ii) tris(4,7-diphenyl-1,10-phenanthroline)ruthenium (II): reagent which distinguishes right- & left-handed DNA helices | 2.05 | 1 | 0 | ruthenium coordination entity | fluorochrome |
| arabinofuranosyluracil Arabinofuranosyluracil: A pyrimidine nucleoside formed in the body by the deamination of CYTARABINE. | 7.01 | 1 | 0 | ||
| enerbol Life: The state that distinguishes organisms from inorganic matter, manifested by growth, metabolism, reproduction, and adaptation. It includes the course of existence, the sum of experiences, the mode of existing, or the fact of being. Over the centuries inquiries into the nature of life have crossed the boundaries from philosophy to biology, forensic medicine, anthropology, etc., in creative as well as scientific literature. (Random House Unabridged Dictionary, 2d ed; Dr. James H. Cassedy, NLM History of Medicine Division) | 2.43 | 2 | 0 | ||
| rifamycins [no description available] | 1.95 | 1 | 0 | ||
| ethidium homodimer-1 [no description available] | 2.02 | 1 | 0 | ||
| tomaymycin tomaymycin: structure. tomaymycin : A pyrrolobenzodiazepine that is (11aS)-2,3,5,10,11,11a-hexahydro-1H-pyrrolo[2,1-c][1,4]benzodiazepine which is substituted at positions 2,5,7,8 and 11R by ethylidene, oxo, methoxy, hydroxy and methoxy groups, respectively. It is a natural product of Streptomyces achromogenes that binds covalently with guanine in the minor groove of DNA. It is an antitumoral compound which is active in ovarian, plasmacytoma, and leukemia cancer cell lines at nanomolar concentrations.. (Z)-tomaymycin : The (Z)-isomer of tomaymycin. | 2.04 | 1 | 0 | tomaymycin | |
| titanocene titanocene: C10-H10-Ti. titanocene : A bis(eta(5)-cyclopentadienyl)metal(II) having Ti(II) as the metal(II) species. The parent of the class of titanonocenes. | 7.17 | 1 | 0 | ||
| acid phosphatase Acid Phosphatase: An enzyme that catalyzes the conversion of an orthophosphoric monoester and water to an alcohol and orthophosphate. EC 3.1.3.2. | 3.49 | 8 | 0 | ||
| mefloquine Mefloquine: A phospholipid-interacting antimalarial drug (ANTIMALARIALS). It is very effective against PLASMODIUM FALCIPARUM with very few side effects.. mefloquine : A racemate composed of (+)-(11R,2'S)- and (-)-(11S,2'R)-enantiomers of mefloquine. An antimalarial agent which acts as a blood schizonticide; its mechanism of action is unknown. | 2.06 | 1 | 0 | ||
| bleomycetin bleomycetin: RN given refers to parent cpd | 2.89 | 4 | 0 | ||
| ammonium citrate [no description available] | 2.44 | 2 | 0 | ammonium salt; citrate salt | buffer; food emulsifier |
| isoguanosine [no description available] | 2.02 | 1 | 0 | ||
| n(4)-aminocytidine [no description available] | 2 | 1 | 0 | ||
| maltoheptaose maltoheptaose: consists of seven glucose residues in a linear 1,4-alpha-linkage; substrate for determining alpha-amylase in serum; RN given refers to (D-glucopyranose)-isomer. maltoheptaose : A maltoheptaose heptasaccharide in which the glucose residue at the reducing end is in the aldehydo open-chain form.. alpha-D-Glcp-(1->4)-alpha-D-Glcp-(1->4)-alpha-D-Glcp-(1->4)-alpha-D-Glcp-(1->4)-alpha-D-Glcp-(1->4)-alpha-D-Glcp-(1->4)-D-Glcp : A maltoheptaose heptasaccharide consisting of six alpha-D-glucose residues and a D-glucose residue joined in sequence by (1->4) glycosidic bonds. | 2.01 | 1 | 0 | maltoheptaose heptasaccharide | |
| 5-azido-2'-deoxyuridine 5'-triphosphate 5-azido-2'-deoxyuridine 5'-triphosphate: tool for the enzymatic synthesis of photoactive DNA; structure given in first source | 2.02 | 1 | 0 | ||
| perylenetetracarboxylic diimide perylenetetracarboxylic diimide: structure in first source | 2.47 | 2 | 0 | ||
| icatibant icatibant: a potent bradykinin (B2) receptor antagonist; WIN 65365 is an L-Tic(7) stereoisomer. icatibant : A ten-membered synthetic oligopeptide consisting of D-Arg, Arg, Pro, Hyp, Gly, Thi, Ser, D-Tic, Oic, and Arg residues joined in sequrence. A bradykinin receptor antagonist used as its acetate salt for the treatment of acute attacks of hereditary angioedema in adult patients. | 1.99 | 1 | 0 | ||
| pyrromethene 546 pyrromethene 546: structure in first source | 2.1 | 1 | 0 | ||
| 5-formyl-2'-deoxycytidine 5-formyl-2'-deoxycytidine: structure in first source | 7 | 1 | 0 | ||
| aflatoxin m1 Aflatoxin M1: A 4-hydroxylated metabolite of AFLATOXIN B1, one of the MYCOTOXINS from ASPERGILLUS tainted food. It is associated with LIVER damage and cancer resulting from its P450 activation to the epoxide which alkylates DNA. Toxicity depends on the balance of liver enzymes that activate it (CYTOCHROME P-450) and others that detoxify it (GLUTATHIONE S TRANSFERASE) (Pharmac Ther 50.443 1991). Primates & rat are sensitive while mouse and hamster are tolerant (Canc Res 29.236 1969).. aflatoxin M1 : A member of the class of aflatoxins that is aflatoxin B1 in which the hydrogen at position 9a is replaced by a hydroxy group. | 2.17 | 1 | 0 | aflatoxin; aromatic ether; aromatic ketone; tertiary alcohol | Aspergillus metabolite; human xenobiotic metabolite; mammalian metabolite |
| nad NAD(1-) : An anionic form of nicotinamide adenine dinucleotide arising from deprotonation of the two OH groups of the diphosphate moiety. | 5.73 | 27 | 0 | organophosphate oxoanion | cofactor; human metabolite; hydrogen acceptor; Saccharomyces cerevisiae metabolite |
| cytochrome c-t Cytochromes c: Cytochromes of the c type that are found in eukaryotic MITOCHONDRIA. They serve as redox intermediates that accept electrons from MITOCHONDRIAL ELECTRON TRANSPORT COMPLEX III and transfer them to MITOCHONDRIAL ELECTRON TRANSPORT COMPLEX IV. | 4.11 | 15 | 0 | ||
| picogreen PicoGreen: a DNA-specific dye; has strong affinity for double-stranded DNA and is designed to quantify these molecules in solution; a UV-excitable dye; no further information available 6/96. PicoGreen : A cyanine dye that is 1-phenylquinoline which is substituted at position 2 by a bis[3-(dimethylamino)propyl]amino group and at position 4 by a (3-methyl-1,3-benzothiazol-3-ium-2-yl)methylene group. The counter ion is not stated. A fluorochrome that selectively binds double-stranded DNA and has characteristics similar to that of SYBR-Green I. | 2.02 | 1 | 0 | benzothiazoles; cyanine dye; quinolines; tertiary amine | fluorescent dye |
| melitten Melitten: Basic polypeptide from the venom of the honey bee (Apis mellifera). It contains 26 amino acids, has cytolytic properties, causes contracture of muscle, releases histamine, and disrupts surface tension, probably due to lysis of cell and mitochondrial membranes. | 2.69 | 3 | 0 | ||
| cholecystokinin Cholecystokinin: A peptide, of about 33 amino acids, secreted by the upper INTESTINAL MUCOSA and also found in the central nervous system. It causes gallbladder contraction, release of pancreatic exocrine (or digestive) enzymes, and affects other gastrointestinal functions. Cholecystokinin may be the mediator of satiety. | 3.36 | 7 | 0 | ||
| ceruletide Ceruletide: A specific decapeptide obtained from the skin of Hila caerulea, an Australian amphibian. Caerulein is similar in action and composition to CHOLECYSTOKININ. It stimulates gastric, biliary, and pancreatic secretion; and certain smooth muscle. It is used in paralytic ileus and as diagnostic aid in pancreatic malfunction.. ceruletide : A decapeptide comprising 5-oxoprolyl, glutamyl, aspartyl, O-sulfotyrosyl, threonyl, glycyl, tryptopyl, methionyl, aspartyl and phenylalaninamide residues in sequence. Found in the skins of certain Australian amphibians, it is an analogue of the gastrointestinal peptide hormone cholecystokinin and stimulates gastric, biliary, and pancreatic secretion. It is used in cases of paralysis of the intestine (paralytic ileus) and as a diagnostic aid in pancreatic malfunction. | 2.46 | 2 | 0 | oligopeptide | diagnostic agent; gastrointestinal drug |
| dynorphins Dynorphins: A class of opioid peptides including dynorphin A, dynorphin B, and smaller fragments of these peptides. Dynorphins prefer kappa-opioid receptors (RECEPTORS, OPIOID, KAPPA) and have been shown to play a role as central nervous system transmitters. | 3.52 | 2 | 0 | ||
| bivalirudin bivalirudin: designed to bind to the alpha-thrombin catalytic site and anion-binding exosite for fibrin(ogen) recognition. bivalirudin : A synthetic peptide of 20 amino acids, comprising D-Phe, Pro, Arg, Pro, Gly, Gly, Gly, Gly, Asn, Gly, Asp, Phe, Glu, Glu, Ile, Pro, Glu, Glu, Tyr, and Leu in sequence. A congener of hirudin (a naturally occurring drug found in the saliva of the medicinal leech), it a specific and reversible inhibitor of thrombin, and is used as an anticoagulant. | 4.79 | 2 | 1 | polypeptide | anticoagulant; EC 3.4.21.5 (thrombin) inhibitor |
| atrial natriuretic factor Atrial Natriuretic Factor: A potent natriuretic and vasodilatory peptide or mixture of different-sized low molecular weight PEPTIDES derived from a common precursor and secreted mainly by the HEART ATRIUM. All these peptides share a sequence of about 20 AMINO ACIDS. | 3.78 | 11 | 0 | polypeptide | |
| t 30177 T 30177: an oligonucleotide composed of only deoxyguanosine and thymidine; 17 nucleotides long; contains single phosphorothioate internucleoside linkages at its 5' and 3' ends; nucleotide sequence given in first source | 5.81 | 17 | 0 | ||
| bbm-928 a BBM-928 A: see also BBM-928 | 1.99 | 1 | 0 | ||
| gem91 GEM91: a 25-mer antisense oligonucleotide phosphorothioate used as a therapeutic agents for AIDS; may block the translation of gag mRNA& disrupt the secondary structure of RNA | 4.29 | 3 | 0 | ||
| dermaseptin s dermaseptin: 34 amino acid residues given in first source; antimicrobial peptide of amphibian skin | 2.02 | 1 | 0 | ||
| gala peptide GALA peptide: synthetic 30 amino acid peptide; its association with membrane vesicles has been studied; amino acid sequence given in first source | 3.12 | 1 | 0 | ||
| fibrinopeptide b Fibrinopeptide B: Two small peptide chains removed from the N-terminal segment of the beta chains of fibrinogen by the action of thrombin. Each peptide chain contains 20 amino acid residues. The removal of fibrinopeptides B is not required for coagulation. | 1.97 | 1 | 0 | ||
| gastrins Gastrins: A family of gastrointestinal peptide hormones that excite the secretion of GASTRIC JUICE. They may also occur in the central nervous system where they are presumed to be neurotransmitters. | 3.23 | 6 | 0 | ||
| gramicidin a Gramicidin: A group of peptide antibiotics from BACILLUS brevis. Gramicidin C or S is a cyclic, ten-amino acid polypeptide and gramicidins A, B, D are linear. Gramicidin is one of the two principal components of TYROTHRICIN. | 2.91 | 4 | 0 | ||
| glucagon Glucagon: A 29-amino acid pancreatic peptide derived from proglucagon which is also the precursor of intestinal GLUCAGON-LIKE PEPTIDES. Glucagon is secreted by PANCREATIC ALPHA CELLS and plays an important role in regulation of BLOOD GLUCOSE concentration, ketone metabolism, and several other biochemical and physiological processes. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p1511). glucagon : A 29-amino acid peptide hormone consisting of His, Ser, Gln, Gly, Thr, Phe, Thr, Ser, Asp, Tyr, Ser, Lys, Tyr, Leu, Asp, Ser, Arg, Arg, Ala, Gln, Asp, Phe, Val, Gln, Trp, Leu, Met, Asn and Thr residues joined in sequence. | 2.69 | 3 | 0 | peptide hormone | |
| mast cell degranulating peptide mast cell degranulating peptide: isolated from bee venoms; made up of 22 amino acids; has 2 disulfide bridges | 1.97 | 1 | 0 | ||
| beta-endorphin beta-Endorphin: A 31-amino acid peptide that is the C-terminal fragment of BETA-LIPOTROPIN. It acts on OPIOID RECEPTORS and is an analgesic. Its first four amino acids at the N-terminal are identical to the tetrapeptide sequence of METHIONINE ENKEPHALIN and LEUCINE ENKEPHALIN.. beta-endorphin : A polypeptide consisting of 31 amino acid residues in the sequence Tyr-Gly-Gly-Phe-Met-Thr-Ser-Glu-Lys-Ser-Gln-Thr-Pro-Leu-Val-Thr-Leu-Phe-Lys-Asn-Ala-Ile-Ile-Lys-Asn-Ala-Tyr-Lys-Lys-Gly-Glu. It is an endogenous opioid peptide neurotransmitter found in the neurons of both the central and peripheral nervous system and results from processing of the precursor protein proopiomelanocortin (POMC). | 1.98 | 1 | 0 | ||
| somatostatin-28 prosomatostatin: see also preprosomatostatins: 75037-28-4 | 1.97 | 1 | 0 | ||
| neuropeptide y Neuropeptide Y: A 36-amino acid peptide present in many organs and in many sympathetic noradrenergic neurons. It has vasoconstrictor and natriuretic activity and regulates local blood flow, glandular secretion, and smooth muscle activity. The peptide also stimulates feeding and drinking behavior and influences secretion of pituitary hormones. | 3.1 | 5 | 0 | ||
| ularitide Ularitide: a 32-amino acid peptide derived from (95-126 residues) of ANP PROHORMONE (1-126 residues); not biologically inactivated by a peptidase from dog kidney cortex membranes | 1.99 | 1 | 0 | ||
| iberiotoxin [no description available] | 2.08 | 1 | 0 | ||
| angiotensinogen Angiotensinogen: An alpha-globulin of about 453 amino acids, depending on the species. It is produced by the liver in response to lowered blood pressure and secreted into blood circulation. Angiotensinogen is the inactive precursor of the ANGIOTENSINS produced in the body by successive enzyme cleavages. Cleavage of angiotensinogen by RENIN yields the decapeptide ANGIOTENSIN I. Further cleavage of angiotensin I (by ANGIOTENSIN CONVERTING ENZYME) yields the potent vasoconstrictor octapeptide ANGIOTENSIN II; and then, via other enzymes, other angiotensins also involved in the hemodynamic-regulating RENIN-ANGIOTENSIN SYSTEM. | 3.38 | 7 | 0 | ||
| cucurbit(8)uril cucurbit(8)uril: a macrocyclic polymer compound comprising 8 GLYCOLURIL units with methylene bridges | 2.08 | 1 | 0 | ||
| tannins Tannins: Polyphenolic compounds with molecular weights of around 500-3000 daltons and containing enough hydroxyl groups (1-2 per 100 MW) for effective cross linking of other compounds (ASTRINGENTS). The two main types are HYDROLYZABLE TANNINS and CONDENSED TANNINS. Historically, the term has applied to many compounds and plant extracts able to render skin COLLAGEN impervious to degradation. The word tannin derives from the Celtic word for OAK TREE which was used for leather processing. | 2.41 | 1 | 0 | ||
| anticodon Anticodon: The sequential set of three nucleotides in TRANSFER RNA that interacts with its complement in MESSENGER RNA, the CODON, during translation in the ribosome. | 5.01 | 41 | 0 | ||
| transportan transportan: a galparan (C107160) analog, useful as a carrier vector for hydrophilic molecule, therefore named transportan; amino acid sequence known | 2.42 | 2 | 0 | ||
| ziconotide ziconotide: amino acid sequence in first source; from venom of South Pacific sea cone snail, Conus magus; calcium channel blocker; administered by injection into Cerebrospinal Fluid; Prialt is synthetic form. omega-conotoxin MVIIA : A heterodetic cyclic polypeptide consisting of the linear sequence Cys-Lys-Gly-Lys-Gly-Ala-Lys-Cys-Ser-Arg-Leu-Met-Tyr-Asp-Cys-Cys-Thr-Gly-Ser-Cys-Arg-Ser-Gly-Lys-Cys-NH2 with three disulfide bridges between cysteine residues 1-16, 8-20 and 15-25. A neuronal N-type Ca(2+) channel blocker in mammalian and amphibian brain, it blocks release of GABA and glutamate at neuronal synapses. Used as a probe for calcium channel receptors, it is selective for different receptor subtypes. A synthetic form, named ziconotide, is an atypical analgesic agent for the amelioration of severe and chronic pain. | 2.02 | 1 | 0 | ||
| glucagon-like peptide 1 Glucagon-Like Peptide 1: A peptide of 36 or 37 amino acids that is derived from PROGLUCAGON and mainly produced by the INTESTINAL L CELLS. GLP-1(1-37 or 1-36) is further N-terminally truncated resulting in GLP-1(7-37) or GLP-1-(7-36) which can be amidated. These GLP-1 peptides are known to enhance glucose-dependent INSULIN release, suppress GLUCAGON release and gastric emptying, lower BLOOD GLUCOSE, and reduce food intake. | 2.15 | 1 | 0 | ||
| c-peptide C-Peptide: The middle segment of proinsulin that is between the N-terminal B-chain and the C-terminal A-chain. It is a pancreatic peptide of about 31 residues, depending on the species. Upon proteolytic cleavage of proinsulin, equimolar INSULIN and C-peptide are released. C-peptide immunoassay has been used to assess pancreatic beta cell function in diabetic patients with circulating insulin antibodies or exogenous insulin. Half-life of C-peptide is 30 min, almost 8 times that of insulin. | 2.46 | 2 | 0 | ||
| natriuretic peptide, c-type Natriuretic Peptide, C-Type: A PEPTIDE of 22 amino acids, derived mainly from cells of VASCULAR ENDOTHELIUM. It is also found in the BRAIN, major endocrine glands, and other tissues. It shares structural homology with ATRIAL NATRIURETIC FACTOR. It has vasorelaxant activity thus is important in the regulation of vascular tone and blood flow. Several high molecular weight forms containing the 22 amino acids have been identified. | 1.99 | 1 | 0 | ||
| calcium orange calcium orange: a fluorescent calcium indicator. calcium orange : A xanthene dye-based thiourea conjugate. | 2.48 | 2 | 0 | xanthene dye | fluorochrome |
| ctce-9908 CTCE-9908: antineoplastic; a small peptide CXCR4 antagonist | 2.08 | 1 | 0 | ||
| oligonucleotide 5320 oligonucleotide 5320: a phosphorothioate oligonucleotide | 3.1 | 1 | 0 | ||
| ristocetin Ristocetin: An antibiotic mixture of two components, A and B, obtained from Nocardia lurida (or the same substance produced by any other means). It is no longer used clinically because of its toxicity. It causes platelet agglutination and blood coagulation and is used to assay those functions in vitro.. ristocetin : A heterodetic cyclic peptide that is produced by species of Amycolatopsis and Nocardia. | 2.03 | 1 | 0 | glycopeptide; heterodetic cyclic peptide; macrocycle; tetrasaccharide derivative | antibacterial drug; antimicrobial agent; bacterial metabolite; platelet-activating factor receptor agonist |
| cellulose DEAE-Cellulose: Cellulose derivative used in chromatography, as ion-exchange material, and for various industrial applications. | 6.19 | 54 | 0 | glycoside | |
| endothelin-1 Endothelin-1: A 21-amino acid peptide produced in a variety of tissues including endothelial and vascular smooth-muscle cells, neurons and astrocytes in the central nervous system, and endometrial cells. It acts as a modulator of vasomotor tone, cell proliferation, and hormone production. (N Eng J Med 1995;333(6):356-63) | 8.63 | 9 | 0 | ||
| phosphatidylcholines Phosphatidylcholines: Derivatives of PHOSPHATIDIC ACIDS in which the phosphoric acid is bound in ester linkage to a CHOLINE moiety. | 5.59 | 22 | 0 | 1,2-diacyl-sn-glycero-3-phosphocholine | |
| (9R)-9-chloro-11,17-dihydroxy-17-(2-hydroxy-1-oxoethyl)-10,13,16-trimethyl-6,7,8,11,12,14,15,16-octahydrocyclopenta[a]phenanthren-3-one Beclomethasone: An anti-inflammatory, synthetic glucocorticoid. It is used topically as an anti-inflammatory agent and in aerosol form for the treatment of ASTHMA.. beclomethasone : A 17alpha-hydroxy steroid that is prednisolone in which the hydrogens at the 9alpha and 16beta positions are substituted by a chlorine and a methyl group, respectively. | 4.39 | 1 | 1 | 21-hydroxy steroid | |
| n-(7-(4-nitrobenzo-2-oxa-1,3-diazole))-6-aminocaproyl sphingosine N-(7-(4-nitrobenzo-2-oxa-1,3-diazole))-6-aminocaproyl sphingosine: fluorescent ceramide analog; structure given in first source. N-{6-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]hexanoyl}sphingosine : An N-acylsphingosine that is sphingosine with the amino nitrogen converted into a 6-{[N-(7-nitrobenzo-2,1,3-oxadiazol-4-yl)amino]}hexananamido group. | 2.05 | 1 | 0 | N-acylsphingosine | fluorescent probe |
| chlorophyll a Chlorophyll: Porphyrin derivatives containing magnesium that act to convert light energy in photosynthetic organisms.. chlorophyll : A family of magnesium porphyrins, defined by the presence of a fifth ring beyond the four pyrrole-like rings. The rings can have various side chains which usually include a long phytol chain. | 2.93 | 4 | 0 | chlorophyll; methyl ester | cofactor |
| phenylmercuric acetate Phenylmercuric Acetate: A phenyl mercury compound used mainly as a fungicide. Has also been used as a herbicide, slimicide, and bacteriocide. | 2.02 | 1 | 0 | arylmercury compound; benzenes | |
| 4-aminophenylmercuriacetate 4-aminophenylmercuriacetate: covalently linked to agarose for purification of FAD & COA with chromatography | 2.02 | 1 | 0 | ||
| tris-(8-hydroxyquinoline)aluminum tris-(8-hydroxyquinoline)aluminum: structure in first source | 2.08 | 1 | 0 | ||
| pevonedistat pevonedistat: a potent and selective inhibitor of NAE (NEDD8-activating enzyme). pevonedistat : A pyrrolopyrimidine that is 7H-pyrrolo[2,3-d]pyrimidine which is substituted by a (1S)-2,3-dihydro-1H-inden-1-ylnitrilo group at position 4 and by a (1S,3S,4S)-3-hydroxy-4-[(sulfamoyloxy)methyl]cyclopentyl group at position 7. It is a potent and selective NEDD8-activating enzyme inhibitor with an IC50 of 4.7 nM, and currently under clinical investigation for the treatment of acute myeloid leukemia (AML) and myelodysplastic syndromes. | 2.08 | 1 | 0 | cyclopentanols; indanes; pyrrolopyrimidine; secondary amino compound; sulfamidate | antineoplastic agent; apoptosis inducer |
| fedratinib fedratinib: a selective small-molecule inhibitor of JAK2 | 3.35 | 1 | 0 | sulfonamide | |
| adenosine kinase Adenosine Kinase: An enzyme that catalyzes the formation of ADP plus AMP from adenosine plus ATP. It can serve as a salvage mechanism for returning adenosine to nucleic acids. EC 2.7.1.20. | 2.01 | 1 | 0 | ||
| hoe 33342 bisbenzimide ethoxide trihydrochloride: benzimidazole fluorescent dye | 2.44 | 2 | 0 | ||
| ubiquinone Ubiquinone: A lipid-soluble benzoquinone which is involved in ELECTRON TRANSPORT in mitochondrial preparations. The compound occurs in the majority of aerobic organisms, from bacteria to higher plants and animals. | 2.74 | 3 | 0 | ||
| igk IgK: abnormal immunoglobin in leprous-Rubino negative sera; partly related to Fc fragment of IgA & to FAB fragments; possesses Kappa but not lambda light polypeptide chains | 2.07 | 1 | 0 | ||
| alpha-amanitin Alpha-Amanitin: A cyclic octapeptide with a thioether bridge between the cystine and tryptophan. It inhibits RNA POLYMERASE II. Poisoning may require LIVER TRANSPLANTATION.. alpha-amanitin : A heterodetic cyclic peptide consisting of eight amino acid residues and containing a thioether bridge between a cysteine and a tryptophan residue. It is found in a number of poisonous mushrooms, including Amanita phalloides (the death cap), Galerina marginata, and and Conocybe filaris. | 2.1 | 1 | 0 | ||
| calpain Calpain: Cysteine proteinase found in many tissues. Hydrolyzes a variety of endogenous proteins including NEUROPEPTIDES; CYTOSKELETAL PROTEINS; proteins from SMOOTH MUSCLE; CARDIAC MUSCLE; liver; platelets; and erythrocytes. Two subclasses having high and low calcium sensitivity are known. Removes Z-discs and M-lines from myofibrils. Activates phosphorylase kinase and cyclic nucleotide-independent protein kinase. This enzyme was formerly listed as EC 3.4.22.4. | 2.42 | 2 | 0 | ||
| sodium cyanoborohydride sodium cyanoborohydride: reagent for preparing biologically active nitroxides | 2.93 | 4 | 0 | ||
| sapogenins Sapogenins: The aglucon moiety of a saponin molecule. It may be triterpenoid or steroid, usually spirostan, in nature. | 2.04 | 1 | 0 | ||
| 2-selenouridine [no description available] | 2.6 | 1 | 0 | ||
| biotinyltyramide biotinyltyramide: used in sensitive light microscopic immunochemistry | 1.99 | 1 | 0 | ||
| chitosan [no description available] | 4.53 | 22 | 0 | ||
| 1,3-diaza-2-oxophenoxazine 1,3-diaza-2-oxophenoxazine: structure in first source | 7.52 | 2 | 0 | ||
| oxathiaphospholane oxathiaphospholane: structure in first source | 2 | 1 | 0 | ||
| choline methacrylate choline methacrylate: choline methacrylate = trimethylaminoethylmethacrylate chloride salt | 2.02 | 1 | 0 | ||
| s-nitro-n-acetylpenicillamine S-nitro-N-acetylpenicillamine: a NO donor | 2.42 | 2 | 0 | ||
| imidazole-1-sulfonyl azide hydrochloride imidazole-1-sulfonyl azide: a diazotransfer reagent.; structure in first source | 2.07 | 1 | 0 | ||
| bucladesine Bucladesine: A cyclic nucleotide derivative that mimics the action of endogenous CYCLIC AMP and is capable of permeating the cell membrane. It has vasodilator properties and is used as a cardiac stimulant. (From Merck Index, 11th ed). bucladesine : A 3',5'-cyclic purine nucleotide that is the 2'-butanoate ester and 6-N-butanoyl derivative of 3',5'-cyclic AMP. | 2.92 | 4 | 0 | 3',5'-cyclic purine nucleotide | |
| lithium perchlorate lithium perchlorate: stabilizes DNA-polycation complex; RN given refers to parent compound | 2 | 1 | 0 | ||
| lithium niobate [no description available] | 2.04 | 1 | 0 | ||
| sodium hypochlorite Sodium Hypochlorite: It is used as an oxidizing and bleaching agent and as a disinfectant. (From Grant & Hackh's Chemical Dictionary, 5th ed). sodium hypochlorite : An inorganic sodium salt in which hypochlorite is the counterion. It is used as a bleaching and disinfecting agent and is commonly found in household bleach. | 2.02 | 1 | 0 | inorganic sodium salt | bleaching agent; disinfectant |
| sodium bisulfite sodium bisulfite: has been used externally for parasitic skin diseases and as gastrointestinal antiseptic; structure. sodium hydrogensulfite : An inorganic sodium salt having hydrogensulfite as the counterion. | 2.71 | 3 | 0 | inorganic sodium salt; sulfite salt | allergen; food antioxidant; food colour retention agent; mutagen; reducing agent |
| raltegravir potassium Raltegravir Potassium: A pyrrolidinone derivative and HIV INTEGRASE INHIBITOR that is used in combination with other ANTI-HIV AGENTS for the treatment of HIV INFECTION. | 2.05 | 1 | 0 | ||
| sarkosyl sarkosyl: RN given is for sarkosyl L, the parent cpd; structure | 1.97 | 1 | 0 | ||
| potassium bromate potassium bromate: used as bread improver | 2.01 | 1 | 0 | bromate salt; potassium salt | flour treatment agent |
| ro13-9904 Ceftriaxone: A broad-spectrum cephalosporin antibiotic and cefotaxime derivative with a very long half-life and high penetrability to meninges, eyes and inner ears.. ceftriaxone : A third-generation cephalosporin compound having 2-(2-amino-1,3-thiazol-4-yl)-2-(methoxyimino)acetylamino and [(2-methyl-5,6-dioxo-1,2,5,6-tetrahydro-1,2,4-triazin-3-yl)sulfanyl]methyl side-groups. | 2.25 | 1 | 0 | ||
| (2-sulfonatoethyl)methanethiosulfonate (2-sulfonatoethyl)methanethiosulfonate: RN given for Na salt | 2.05 | 1 | 0 | ||
| chiniofon Hydroxyquinolines: The 8-hydroxy derivatives inhibit various enzymes and their halogenated derivatives, though neurotoxic, are used as topical anti-infective agents, among other uses. | 2.93 | 4 | 0 | ||
| echinomycin Echinomycin: A cytotoxic polypeptide quinoxaline antibiotic isolated from Streptomyces echinatus that binds to DNA and inhibits RNA synthesis. | 3.61 | 9 | 0 | cyclodepsipeptide | |
| ck-2017357 CK-2017357: a fast-skeletal-troponin activator; structure in first source | 3.27 | 1 | 0 | ||
| thiostrepton Thiostrepton: One of the CYCLIC PEPTIDES from Streptomyces that is active against gram-positive bacteria. In veterinary medicine, it has been used in mastitis caused by gram-negative organisms and in dermatologic disorders.. thiostrepton : A heterodetic cyclic peptide, in which the cyclisation step involves a formal lactonisation between the carboxy group of a quinaldic acid-based residue and a secondary alcohol. An antibiotic that inhibits bacterial protein synthesis. Also acts as an antitumor agent. | 1.99 | 1 | 0 | ||
| hygromycin b [no description available] | 3.28 | 6 | 0 | ||
| daunoform daunoform: a daunorubicin-formaldehyde conjugate; structure in first source | 2 | 1 | 0 | ||
| methyl jasmonate [no description available] | 2.42 | 2 | 0 | ||
| s-adenosylmethionine (R)-S-adenosyl-L-methionine : An S-adenosyl-L-methionine that has R-configuration.. S-adenosyl-L-methionine zwitterion : A zwitterionic tautomer of S-adenosyl-L-methionine arising from shift of the proton from the carboxy group to the amino group.. (R)-S-adenosyl-L-methionine zwitterion : An S-adenosyl-L-methionine zwitterion that has R-configuration; major species at pH 7.3.. (S)-S-adenosyl-L-methionine zwitterion : An S-adenosyl-L-methionine zwitterion that has S-configuration; major species at pH 7.3.. S-adenosyl-L-methionine : A sulfonium compound that is the S-adenosyl derivative of L-methionine. It is an intermediate in the metabolic pathway of methionine. | 4.67 | 29 | 0 | organic cation; sulfonium compound | coenzyme; cofactor; human metabolite; micronutrient; Mycoplasma genitalium metabolite; nutraceutical; Saccharomyces cerevisiae metabolite |
| 4'-selenouridine 4'-selenouridine: structure in first source | 7.6 | 1 | 0 | ||
| snx 2112 SNX 2112: an orally available small molecule Hsp90 inhibitor; structure in first source | 2.1 | 1 | 0 | ||
| lomibuvir lomibuvir: an antiviral agent with polymerase NS5 inhibitory activity | 4.41 | 1 | 1 | thiophenecarboxylic acid | |
| picrotoxin Picrotoxin: A noncompetitive antagonist at GABA-A receptors and thus a convulsant. Picrotoxin blocks the GAMMA-AMINOBUTYRIC ACID-activated chloride ionophore. Although it is most often used as a research tool, it has been used as a CNS stimulant and an antidote in poisoning by CNS depressants, especially the barbiturates.. picrotoxin : A mixture consisting of equimolar amounts of picrotoxinin and picrotin found in the climbing plant Anamirta cocculus. | 2.06 | 1 | 0 | ||
| canagliflozin canagliflozin hydrate : A hydrate that is the hemihydrate form of canagliflozin. Used for treatment of type II diabetes via inhibition of sodium-glucose transport protein subtype 2. | 2.1 | 1 | 0 | C-glycosyl compound; organofluorine compound; thiophenes | hypoglycemic agent; sodium-glucose transport protein subtype 2 inhibitor |
| 2',3'-o-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate: analog of ATP; do not confuse with TNP-ATP record | 2.06 | 1 | 0 | C-nitro compound; spiroketal | antagonist |
| pci 32765 ibrutinib: a Btk protein inhibitor. ibrutinib : A member of the class of acrylamides that is (3R)-3-[4-amino-3-(4-phenoxyphenyl)pyrazolo[3,4-d]pyrimidin-1-yl]piperidine in which the piperidine nitrogen is replaced by an acryloyl group. A selective and covalent inhibitor of the enzyme Bruton's tyrosine kinase, it is used for treatment of B-cell malignancies. | 2.07 | 1 | 0 | acrylamides; aromatic amine; aromatic ether; N-acylpiperidine; pyrazolopyrimidine; tertiary carboxamide | antineoplastic agent; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor |
| clomiphene citrate phosphomannan : A polymannosidic phosphodiester in which one secondary phosphoryl is linked as mannose 6-phosphate and the other as alpha-hemiacetal phosphate. | 2.07 | 1 | 0 | ||
| pervanadate pervanadate: from a mixture of orthovanadate and hydrogen peroxide | 2.01 | 1 | 0 | ||
| egg white Egg White: The white of an egg, especially a chicken's egg, used in cooking. It contains albumin. (Random House Unabridged Dictionary, 2d ed) | 2.65 | 3 | 0 | ||
| 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene [no description available] | 3.92 | 12 | 0 | BODIPY compound | |
| n-(cyanomethyl)-4-(2-((4-(4-morpholinyl)phenyl)amino)-4-pyrimidinyl)benzamide N-(cyanomethyl)-4-(2-((4-(4-morpholinyl)phenyl)amino)-4-pyrimidinyl)benzamide: a Janus kinase 1 and Janus kinase 2 inhibitor; structure in first source. momelotinib : A benzamide obtained by formal condensation of the carboxy group of 4-{2-[4-(morpholin-4-yl)anilino]pyrimidin-4-yl}benzoic acid with the primary amino group of aminoacetonitrile. It is an ATP-competitive JAK1/JAK2 inhibitor with IC50 of 11 nM and 18 nM, respectively. Used for the treatment of patients with intermediate- or high-risk myelofibrosis. | 2.15 | 1 | 0 | aminopyrimidine; benzamides; morpholines; nitrile; secondary amino compound; tertiary amino compound | anti-anaemic agent; antineoplastic agent; apoptosis inducer; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor |
| cardiovascular agents Cardiovascular Agents: Agents that affect the rate or intensity of cardiac contraction, blood vessel diameter, or blood volume. | 9.17 | 8 | 2 | ||
| rimorphin rimorphin: tridecapeptide NH2-Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Gln-Phe-Lys-Val-Val-Thr-COOH from bovine posterior pituitary gland; major leucine enkephalin containing peptide in tissue that contains dynorphin & alpha-neo-endorphin | 3.08 | 1 | 0 | ||
| neurotensin neurotensin, Tyr(11)-: RN given refers to parent cpd & (D)-isomer; RN for cpd without isomeric designation not avail 5/91 | 2.69 | 3 | 0 | peptide hormone | human metabolite; mitogen; neurotransmitter; vulnerary |
| fibrinopeptide a Fibrinopeptide A: Two small peptide chains removed from the N-terminal segment of the alpha chains of fibrinogen by the action of thrombin during the blood coagulation process. Each peptide chain contains 18 amino acid residues. In vivo, fibrinopeptide A is used as a marker to determine the rate of conversion of fibrinogen to fibrin by thrombin. | 2.38 | 2 | 0 | ||
| systemin systemin: amino acid sequence given in first source; a mobile 18 amino acid polypeptide, induces proteinase inhibitor synthesis; from Lycopersicon esculentum (tomato) | 2.01 | 1 | 0 | ||
| cabozantinib cabozantinib: a multikinase inhibitor. cabozantinib : A dicarboxylic acid diamide that is N-phenyl-N'-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide in which the hydrogen at position 4 on the phenyl ring is substituted by a (6,7-dimethoxyquinolin-4-yl)oxy group. A multi-tyrosine kinase inhibitor, used (as its malate salt) for the treatment of progressive, metastatic, medullary thyroid cancer. | 4.4 | 3 | 0 | aromatic ether; dicarboxylic acid diamide; organofluorine compound; quinolines | antineoplastic agent; tyrosine kinase inhibitor |
| incb-018424 [no description available] | 5.45 | 3 | 1 | nitrile; pyrazoles; pyrrolopyrimidine | antineoplastic agent; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor |
| mannans [no description available] | 2.48 | 2 | 0 | ||
| bms-790052 daclatasvir: an HCV NS5A inhibitor. daclatasvir : A member of the class of biphenyls that is a potent inhibitor of nonstructural protein 5A and is used (as its hydrochloride salt) for treatment of hepatitis C. | 4.41 | 1 | 1 | biphenyls; carbamate ester; carboxamide; imidazoles; valine derivative | antiviral drug; nonstructural protein 5A inhibitor |
| alexa fluor 546 Alexa fluor 546: a fluorescent dye | 2.99 | 4 | 0 | organic heteropentacyclic compound | fluorochrome |
| acridine yellow acridine yellow: RN given refers to acridine yellow base | 1.96 | 1 | 0 | aminoacridines; hydrochloride | fluorochrome |
| gsk 2126458 omipalisib: inhibitor of mTOR protein. omipalisib : A member of the class of quinolines that is quinoline which is substituted by pyridazin-4-yl and 5-[(2,4-difluorobenzene-1-sulfonyl)amino]-6-methoxypyridin-3-yl groups at positions 4 and 6, respectively. It is a highly potent inhibitor of PI3K and mTOR developed by GlaxoSmithKline and was previously in human phase 1 clinical trials for the treatment of idiopathic pulmonary fibrosis and solid tumors. | 2.15 | 1 | 0 | aromatic ether; difluorobenzene; pyridazines; pyridines; quinolines; sulfonamide | anticoronaviral agent; antineoplastic agent; autophagy inducer; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; mTOR inhibitor; radiosensitizing agent |
| ixazomib ixazomib: a proteasome inhibitor with antineoplastic activity; MLN2238 is the biologically active form of MLN9708; structure in first source. ixazomib : A glycine derivative that is the amide obtained by formal condensation of the carboxy group of N-(2,5-dichlorobenzoyl)glycine with the amino group of [(1R)-1-amino-3-methylbutyl]boronic acid. The active metabolite of ixazomib citrate, it is used in combination therapy for treatment of multiple myeloma. | 3.21 | 1 | 0 | benzamides; boronic acids; dichlorobenzene; glycine derivative | antineoplastic agent; apoptosis inducer; drug metabolite; orphan drug; proteasome inhibitor |
| nitrogenase Nitrogenase: An enzyme system that catalyzes the fixing of nitrogen in soil bacteria and blue-green algae (CYANOBACTERIA). EC 1.18.6.1. | 2.02 | 1 | 0 | ||
| pyridostatin pyridostatin: binds telomeric G-quadruplexes; structure in first source | 2.58 | 2 | 0 | ||
| phosphinothricin phosphinothricin: RN given refers to parent cpd with unspecified isomeric designation; structure. phosphinothricin(1-) : Conjugate base of phosphinothricin arising from deprotonation of the phosphinate function. | 1.97 | 1 | 0 | organic anion | |
| plx4032 [no description available] | 2.07 | 1 | 0 | aromatic ketone; difluorobenzene; monochlorobenzenes; pyrrolopyridine; sulfonamide | antineoplastic agent; B-Raf inhibitor |
| achn 490 plazomicin: structure in first source | 2.21 | 1 | 0 | ||
| cytochromes c1 Cytochromes c1: The 30-kDa membrane-bound c-type cytochrome protein of mitochondria that functions as an electron donor to CYTOCHROME C GROUP in the mitochondrial and bacterial RESPIRATORY CHAIN. (From Enzyme Nomenclature, 1992, p545) | 2.08 | 1 | 0 | ||
| 1,3-di-(4-amidinophenoxy)-2,2-bis-(4-amidinophenoxymethyl)propane 1,3-di-(4-amidinophenoxy)-2,2-bis-(4-amidinophenoxymethyl)propane: RN given refers to parent cpd; structure given in first source | 1.98 | 1 | 0 | ||
| glycolipids [no description available] | 3.71 | 10 | 0 | ||
| piperidines Piperidines: A family of hexahydropyridines. | 8.49 | 40 | 0 | ||
| thymosin Thymosin: Thymosin. A family of heat-stable, polypeptide hormones secreted by the thymus gland. Their biological activities include lymphocytopoiesis, restoration of immunological competence and enhancement of expression of T-cell characteristics and function. They have therapeutic potential in patients having primary or secondary immunodeficiency diseases, cancer or diseases related to aging. | 3.05 | 1 | 0 | ||
| interleukin-8 Interleukin-8: A member of the CXC chemokine family that plays a role in the regulation of the acute inflammatory response. It is secreted by variety of cell types and induces CHEMOTAXIS of NEUTROPHILS and other inflammatory cells. | 6.21 | 25 | 0 | ||
| bobo 3 BOBO 3: a cyanine dye; excitation 570 nm, emission 602 nm | 2.46 | 2 | 0 | cyanine dye; organic iodide salt | fluorochrome |
| guanidinohydantoin guanidinohydantoin: structure in first source. 5-guanidinohydantoin : An imidazolidine-2,4-dione substituted by a guanidino group at position 5. | 2.02 | 1 | 0 | guanidines; imidazolidine-2,4-dione | |
| p(1),p(5)-di(adenosine-5'-)pentaphosphate P(1),P(5)-di(adenosine-5'-)pentaphosphate: structure. P(1),P(5)-bis(5'-adenosyl) pentaphosphate(5-) : An organophosphate oxoanion arising from global deprotonation of the pentaphosphate OH groups of P(1),P(5)-bis(5'-adenosyl) pentaphosphate. | 1.97 | 1 | 0 | organophosphate oxoanion | |
| exenatide Exenatide: A synthetic form of exendin-4, a 39-amino acid peptide isolated from the venom of the Gila monster lizard (Heloderma suspectum). Exenatide increases CYCLIC AMP levels in pancreatic acinar cells and acts as a GLUCAGON-LIKE PEPTIDE-1 RECEPTOR (GLP-1) agonist and incretin mimetic, enhancing insulin secretion in response to increased glucose levels; it also suppresses inappropriate glucagon secretion and slows gastric emptying. It is used an anti-diabetic and anti-obesity agent. | 2.1 | 1 | 0 | ||
| 2-deoxyribose 5-phosphate [no description available] | 2.01 | 1 | 0 | phospho sugar | |
| abt-348 ilorasertib: an antineoplastic agent and protein kinase inhibitor; structure in first source | 2.11 | 1 | 0 | ||
| ly2784544 [no description available] | 2.25 | 1 | 0 | pyridazines | |
| uridine diphosphate n-acetylgalactosamine Uridine Diphosphate N-Acetylgalactosamine: A nucleoside diphosphate sugar which serves as a source of N-acetylgalactosamine for glycoproteins, sulfatides and cerebrosides.. UDP-N-acetyl-D-galactosamine(2-) : Dianion of UDP-N-acetyl-D-galactosamine arising from deprotonation of the diphosphate OH groups; major species at pH 7.3.. UDP-N-acetyl-D-galactosamine : A UDP-sugar having N-acetyl-D-galactosamine as the sugar component. | 1.95 | 1 | 0 | nucleotide-sugar oxoanion | human metabolite |
| calcipotriene calcipotriene: a topical dermatologic for the treatment of moderate plaque psoriasis; structure in first source. calcipotriol hydrate : A hydrate that is the monohydrate form of calcipotriol. It is used in combination with betamethasone dipropionate, a corticosteroid, for the topical treatment of plaque psoriasis in adult patients. | 2.13 | 1 | 0 | hydrate | antipsoriatic |
| alectinib [no description available] | 2.15 | 1 | 0 | aromatic ketone; morpholines; nitrile; organic heterotetracyclic compound; piperidines | antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor |
| glpg0634 [no description available] | 3.25 | 1 | 0 | ||
| evacetrapib [no description available] | 4.1 | 2 | 0 | benzazepine | |
| lusutrombopag lusutrombopag: a thrombopoietin receptor agonist; structure in first source | 2.21 | 1 | 0 | cinnamic acids | |
| abt-199 venetoclax: A BCL-2 inhibitor with antineoplastic activity that is used in the treatment of CHRONIC LYMPHOCYTIC LEUKEMIA associated with chromosome 17p deletion; structure in first source.. venetoclax : A member of the class of pyrrolopyridines that is a potent inhibitor of the antiapoptotic protein B-cell lymphoma 2. It is used for treamtment of chronic lymphocytic leukemia with 17p deletion. | 5.43 | 3 | 0 | aromatic ether; C-nitro compound; monochlorobenzenes; N-alkylpiperazine; N-arylpiperazine; N-sulfonylcarboxamide; oxanes; pyrrolopyridine | antineoplastic agent; apoptosis inducer; B-cell lymphoma 2 inhibitor |
| methylcellulose Methylcellulose: Methylester of cellulose. Methylcellulose is used as an emulsifying and suspending agent in cosmetics, pharmaceutics and the chemical industry. It is used therapeutically as a bulk laxative. | 2 | 1 | 0 | ||
| butyrolactone i butyrolactone I: selective inhibitor of cdk2 & cdc2 kinase; structure given in first source | 2.02 | 1 | 0 | butenolide | |
| 1,2-dioleoyl-sn-glycero-3-phosphoglycerol 1,2-dioleoyl-sn-glycero-3-phospho-(1'-sn-glycerol) : A 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) in which both acyl groups are specified as oleoyl. | 2.42 | 2 | 0 | 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) | |
| vasoactive intestinal peptide Vasoactive Intestinal Peptide: A highly basic, 28 amino acid neuropeptide released from intestinal mucosa. It has a wide range of biological actions affecting the cardiovascular, gastrointestinal, and respiratory systems and is neuroprotective. It binds special receptors (RECEPTORS, VASOACTIVE INTESTINAL PEPTIDE). | 2.91 | 4 | 0 | ||
| natriuretic peptide, brain Natriuretic Peptide, Brain: A PEPTIDE that is secreted by the BRAIN and the HEART ATRIA, stored mainly in cardiac ventricular MYOCARDIUM. It can cause NATRIURESIS; DIURESIS; VASODILATION; and inhibits secretion of RENIN and ALDOSTERONE. It improves heart function. It contains 32 AMINO ACIDS. | 2.93 | 4 | 0 | polypeptide | |
| heme Heme: The color-furnishing portion of hemoglobin. It is found free in tissues and as the prosthetic group in many hemeproteins.. ferroheme : Any iron(II)--porphyrin coordination complex.. ferroheme b : Heme b in which the iron has oxidation state +2.. heme : A heme is any tetrapyrrolic chelate of iron. | 5.34 | 18 | 0 | ||
| leukotoxin leukotoxin: do not confuse with leukotoxin which is 9,10-epoxy-12-octadecenoate | 1.97 | 1 | 0 | ||
| chondroitin Chondroitin: A mucopolysaccharide constituent of chondrin. (Grant & Hackh's Chemical Dictionary, 5th ed) | 1.95 | 1 | 0 | ||
| heparitin sulfate Heparitin Sulfate: A heteropolysaccharide that is similar in structure to HEPARIN. It accumulates in individuals with MUCOPOLYSACCHARIDOSIS. | 3.27 | 6 | 0 | ||
| d-2-o-methylribose [no description available] | 2.48 | 2 | 0 | ||
| ascorbic acid Ascorbic Acid: A six carbon compound related to glucose. It is found naturally in citrus fruits and many vegetables. Ascorbic acid is an essential nutrient in human diets, and necessary to maintain connective tissue and bone. Its biologically active form, vitamin C, functions as a reducing agent and coenzyme in several metabolic pathways. Vitamin C is considered an antioxidant.. L-ascorbic acid : The L-enantiomer of ascorbic acid and conjugate acid of L-ascorbate.. L-ascorbate : The L-enantiomer of ascorbate and conjugate base of L-ascorbic acid, arising from selective deprotonation of the 3-hydroxy group. Required for a range of essential metabolic reactions in all animals and plants.. vitamin C : Any member of a group of vitamers that belong to the chemical structural class called butenolides that exhibit biological activity against vitamin C deficiency in animals. The vitamers include L-ascorbic acid and its salt, ionized and oxidized forms. | 3.15 | 5 | 0 | ascorbic acid; vitamin C | coenzyme; cofactor; flour treatment agent; food antioxidant; food colour retention agent; geroprotector; plant metabolite; skin lightening agent |
| coumermycin coumermycin: RN given refers to coumermycin A1; structure. coumermycin A1 : A hydroxycoumarin antibiotic that is obtained from Streptomyces rishiriensis and exhibits potent antibacterial and anticancer activity. | 1.99 | 1 | 0 | aromatic amide; coumarins; glycoside; heteroarenecarboxylate ester; pyrroles | antimicrobial agent; antineoplastic agent; bacterial metabolite; DNA synthesis inhibitor; Hsp90 inhibitor; topoisomerase IV inhibitor |
| tetracycline Tetracycline: A naphthacene antibiotic that inhibits AMINO ACYL TRNA binding during protein synthesis.. tetracycline : A broad-spectrum polyketide antibiotic produced by the Streptomyces genus of actinobacteria. | 3.72 | 10 | 0 | ||
| oxytetracycline, anhydrous Oxytetracycline: A TETRACYCLINE analog isolated from the actinomycete STREPTOMYCES RIMOSUS and used in a wide variety of clinical conditions.. oxytetracycline : A tetracycline used for treatment of infections caused by a variety of Gram positive and Gram negative microorganisms including Mycoplasma pneumoniae, Pasteurella pestis, Escherichia coli, Haemophilus influenzae (respiratory infections), and Diplococcus pneumoniae. | 2.55 | 2 | 0 | ||
| salicylates Salicylates: The salts or esters of salicylic acids, or salicylate esters of an organic acid. Some of these have analgesic, antipyretic, and anti-inflammatory activities by inhibiting prostaglandin synthesis.. hydroxybenzoate : Any benzoate derivative carrying a single carboxylate group and at least one hydroxy substituent.. salicylates : Any salt or ester arising from reaction of the carboxy group of salicylic acid, or any ester resulting from the condensation of the phenolic hydroxy group of salicylic acid with an organic acid.. salicylate : A monohydroxybenzoate that is the conjugate base of salicylic acid. | 2.73 | 3 | 0 | monohydroxybenzoate | plant metabolite |
| laquinimod [no description available] | 3.21 | 1 | 0 | aromatic amide | |
| warfarin Warfarin: An anticoagulant that acts by inhibiting the synthesis of vitamin K-dependent coagulation factors. Warfarin is indicated for the prophylaxis and/or treatment of venous thrombosis and its extension, pulmonary embolism, and atrial fibrillation with embolization. It is also used as an adjunct in the prophylaxis of systemic embolism after myocardial infarction. Warfarin is also used as a rodenticide.. warfarin : A racemate comprising equal amounts of (R)- and (S)-warfarin. Extensively used as both an anticoagulant drug and as a pesticide against rats and mice.. 4-hydroxy-3-(3-oxo-1-phenylbutyl)-1-benzopyran-2-one : A member of the class of coumarins that is 4-hydroxycoumarin which is substituted at position 3 by a 1-phenyl-3-oxo-1-butyl group. | 6.19 | 31 | 1 | benzenes; hydroxycoumarin; methyl ketone | |
| citrinin Citrinin: Antibiotic and mycotoxin from Aspergillus niveus and Penicillium citrinum. | 2.03 | 1 | 0 | ||
| rolitetracycline Rolitetracycline: A pyrrolidinylmethyl TETRACYCLINE.. rolitetracycline : A derivative of tetracycline in which the amide function is substituted with a pyrrolidinomethyl group. | 1.94 | 1 | 0 | ||
| eravacycline eravacycline: has antibacterial activity | 2.21 | 1 | 0 | tetracyclines | |
| almagate pegaptanib: a 28-base ribonucleic acid aptamer covalently linked to two branched 20-kD polyethylene glycol moieties to block the activity of extracellular VEGF, specifically the 165-amino-acid isoform (VEGF165); for treatment of neovascular age-related macular degeneration | 12.47 | 23 | 7 | ||
| grn163 GRN163: inhibitor of telomerase RNA in human multiple myeloma cells. | 5.59 | 13 | 0 | ||
| 9-(2-aminoethoxy)phenoxazine 9-(2-aminoethoxy)phenoxazine: structure in first source | 2.79 | 3 | 0 | ||
| gpi0100 GPI0100: quillaja saponin semi-synthetic analog; a systemic and mucosal adjuvant, has potential use in the development of vaccines against periodontal, as well as other pathogens | 2.11 | 1 | 0 | ||
| epidermal growth factor Epidermal Growth Factor: A 6-kDa polypeptide growth factor initially discovered in mouse submaxillary glands. Human epidermal growth factor was originally isolated from urine based on its ability to inhibit gastric secretion and called urogastrone. Epidermal growth factor exerts a wide variety of biological effects including the promotion of proliferation and differentiation of mesenchymal and EPITHELIAL CELLS. It is synthesized as a transmembrane protein which can be cleaved to release a soluble active form. | 4.65 | 27 | 0 | ||
| pf 3512676 ProMune: an anticancer adjuvant and immunostimulant | 4.82 | 2 | 1 | ||
| gastrin-releasing peptide Gastrin-Releasing Peptide: Neuropeptide and gut hormone that helps regulate GASTRIC ACID secretion and motor function. Once released from nerves in the antrum of the STOMACH, the neuropeptide stimulates release of GASTRIN from the GASTRIN-SECRETING CELLS. | 2.07 | 1 | 0 | ||
| kaolinite Kaolin: The most common mineral of a group of hydrated aluminum silicates, approximately H2Al2Si2O8-H2O. It is prepared for pharmaceutical and medicinal purposes by levigating with water to remove sand, etc. (From Merck Index, 11th ed) The name is derived from Kao-ling (Chinese: high ridge), the original site. (From Grant & Hackh's Chemical Dictionary, 5th ed). kaolin : An aluminosilicate soft white mineral named after the hill in China (Kao-ling) from which it was mined for centuries. In its natural state kaolin is a white, soft powder consisting principally of the mineral kaolinite, and varying amounts of other minerals such as muscovite, quartz, feldspar, and anatase. It is used in the manufacture of china and porcelain and also widely used in the production of paper, rubber, paint, drying agents, and many other products. | 2.35 | 2 | 0 | aluminosilicate mineral; mixture | antidiarrhoeal drug; excipient |
| en101 EN101: a 20-mer oligonucleotide that is chemically modified by the insertion of 2'-oxymethyl groups at the three terminal positions of the 3' end; selectively lowers AChE-R in blood and muscle yet leaves unaffected the synaptic variant AChE-S | 2.02 | 1 | 0 | ||
| clay Clay: A naturally-occurring rock or soil constituent characterized by particles with a diameter of less than 0.005 mm. It is composed primarily of hydrous aluminum silicates, trace amounts of metal OXIDES, and organic matter. | 4.61 | 8 | 0 | ||
| transforming growth factor beta Transforming Growth Factor beta: A factor synthesized in a wide variety of tissues. It acts synergistically with TGF-alpha in inducing phenotypic transformation and can also act as a negative autocrine growth factor. TGF-beta has a potential role in embryonal development, cellular differentiation, hormone secretion, and immune function. TGF-beta is found mostly as homodimer forms of separate gene products TGF-beta1, TGF-beta2 or TGF-beta3. Heterodimers composed of TGF-beta1 and 2 (TGF-beta1.2) or of TGF-beta2 and 3 (TGF-beta2.3) have been isolated. The TGF-beta proteins are synthesized as precursor proteins. | 8.12 | 67 | 0 | ||
| miravirsen miravirsen: has antiviral activity; a 15-nucleotide locked nucleic acid-modified antisense oligonucleotide that inhibits miR-122 | 11.11 | 20 | 4 | ||
| antimony potassium tartrate Antimony Potassium Tartrate: A schistosomicide possibly useful against other parasites. It has irritant emetic properties and may cause lethal cardiac toxicity among other adverse effects. | 2.03 | 1 | 0 | ||
| calicheamicin gamma(1)i calicheamicin gamma(1)I: structure given in first source; isolated from Micromonospora echinospora sp. calichensis; acts as a DNA double-stranded cleaving agent. calicheamicin gamma1(I) : A calcheamicin in which contains 3-O-methyl-alpha-L-rhamnosyl, 2,6-dideoxy-4-thio-beta-D-ribo-hexopyranosyl, and 4-amino-4,6-dideoxy-2-O-[2,4-dideoxy-4-(ethylamino)-3-O-methyl-alpha-L-threo-pentopyranosyl]-alpha-L-idopyranose units and in which the aromatic ring contains an iodo substituent. | 2.93 | 1 | 0 | calicheamicin; enediyne antibiotic; organoiodine compound | antineoplastic agent; metabolite |
| saxitoxin Saxitoxin: A compound that contains a reduced purine ring system but is not biosynthetically related to the purine alkaloids. It is a poison found in certain edible mollusks at certain times; elaborated by GONYAULAX and consumed by mollusks, fishes, etc. without ill effects. It is neurotoxic and causes RESPIRATORY PARALYSIS and other effects in MAMMALS, known as paralytic SHELLFISH poisoning.. saxitoxin : An alkaloid isolated from the marine dinoflagellates and cyanobacteria that causes paralytic shellfish poisoning. | 2.76 | 3 | 0 | alkaloid; carbamate ester; guanidines; ketone hydrate; paralytic shellfish toxin; pyrrolopurine | cyanotoxin; marine metabolite; neurotoxin; sodium channel blocker; toxin |
| okadaic acid Okadaic Acid: A specific inhibitor of phosphoserine/threonine protein phosphatase 1 and 2a. It is also a potent tumor promoter. It is produced by DINOFLAGELLATES and causes diarrhetic SHELLFISH POISONING.. okadaic acid : A polycyclic ether that is produced by several species of dinoflagellates, and is known to accumulate in both marine sponges and shellfish. A polyketide, polyether derivative of a C38 fatty acid, it is one of the primary causes of diarrhetic shellfish poisoning (DSP). It is a potent inhibitor of specific protein phosphatases and is known to have a variety of negative effects on cells. | 2.9 | 4 | 0 | ketal | |
| ferricrocin ferricrocin: close structural analog of ferrichrome, mediating iron uptake with same rate. ferricrocin : A member of the class of ferrichromes that is an iron(III) chelate of the homodetic cyclic hexapeptide cyclo(glycyl-L-serylglycyl-N(5)-acetyl-N(5)-hydroxy-L-ornithyl-N(5)-acetyl-N(5)-hydroxy-L-ornithyl-N(5)-acetyl-N(5)-hydroxy-L-ornithyl). | 2.01 | 1 | 0 | ||
| adenosine triphosphate uridine monophosphate [no description available] | 1.96 | 1 | 0 | ||
| sybr green i SYBR Green I: binds to double stranded DNA of less than 20 pg following agarose or polyacrylamide gel electrophoresis; excited at 497 nm and emits at 520 nm. SYBR Green I : A benzothiazolium ion resulting from the methylation of the nitrogen of the benzothiazole group of N-[4-(1,3-benzothiazol-2-ylmethylene)-1-phenyl-1,4-dihydroquinolin-2-yl]-N',N'-dimethyl-N-propylpropane-1,3-diamine. A cationic unsymmetrical cyanine dye that binds to double-stranded DNA and is used as a nucleic acid stain in molecular biology. | 9.53 | 22 | 0 | benzothiazolium ion; cyanine dye; quinolines; tertiary amine | fluorescent dye |
| pyrethrins [no description available] | 2.31 | 1 | 0 | ||
| kiss1 protein, human Kisspeptins: Intercellular signaling peptides that were originally characterized by their ability to suppress NEOPLASM METASTASIS. Kisspeptins have since been found to play an important role in the neuroendocrine regulation of REPRODUCTION. | 2.06 | 1 | 0 | ||
| spiroiminodihydantoin spiroiminodihydantoin: structure in first source. spiroiminodihydantoin : An azaspiro compound that is 1,3,6,8-tetraazaspiro[4.4]non-6-ene which is substituted by oxo groups at positions 2, 4, and 9. Both enantiomers are highly mutagenic products resulting from the oxidation of guanine and 8-oxo-7,8-dihydroguanine in DNA by reactive oxygen species. | 2.73 | 3 | 0 | azaspiro compound | mutagen |
| idarucizumab [no description available] | 5.68 | 2 | 0 | ||
| lumacaftor, ivacaftor drug combination Orkambi : A two-drug mixture consisting of lumacaftor and ivacaftor, which is used for the treatment of cystic fibrosis. | 2.25 | 1 | 0 | ||
| osimertinib osimertinib: an EGFR tyrosine kinase inhibitor. osimertinib : A member of the class of aminopyrimidines that is 4-(1-methylindol-3-yl)pyrimidin-2-amine in which one of the amino hydrogens is replaced by a 2-methoxy-4-[2-(dimethylamino)ethyl](methyl)amino-5-acrylamidophenyl group. Used (as the mesylate salt) for treatment of EGFR T790M mutation positive non-small cell lung cancer. | 2.15 | 1 | 0 | acrylamides; aminopyrimidine; biaryl; indoles; monomethoxybenzene; secondary amino compound; secondary carboxamide; substituted aniline; tertiary amino compound | antineoplastic agent; epidermal growth factor receptor antagonist |
| agar Agar: A complex sulfated polymer of galactose units, extracted from Gelidium cartilagineum, Gracilaria confervoides, and related red algae. It is used as a gel in the preparation of solid culture media for microorganisms, as a bulk laxative, in making emulsions, and as a supporting medium for immunodiffusion and immunoelectrophoresis.. agar : A complex mixture of polysaccharides extracted from species of red algae. Its two main components are agarose and agaropectin. Agarose is the component responsible for the high-strength gelling properties of agar, while agaropectin provides the viscous properties. | 3.52 | 8 | 0 | ||
| olivine olivine: sand of primarily magnesium iron silicate, containing low levels of free silica; suggested as a less injurious substitute for silica quartz in foundries; RN in Chemline for unspecified composition: 1317-71-1 | 2.02 | 1 | 0 | ||
| afovirsen sodium afovirsen sodium: a phosphorothioate oligodeoxynucleotide; 20 nucleotides in length; base sequence given in first source | 2.03 | 1 | 0 | ||
| hirudin Hirudin: A 65-residue polypeptide from LEECHES. | 6.69 | 6 | 1 | ||
| 2',3'-(o-(2,4,6-trinitrocyclohexadienylidine))adenosine 5'-diphosphate 2',3'-(O-(2,4,6-trinitrocyclohexadienylidine))adenosine 5'-diphosphate: structure given in first source | 2.06 | 1 | 0 | ||
| imetelstat [no description available] | 18.53 | 119 | 36 | ||
| glutaminase [no description available] | 2.71 | 3 | 0 | ||
| cyclin d1 Cyclin D1: Protein encoded by the bcl-1 gene which plays a critical role in regulating the cell cycle. Overexpression of cyclin D1 is the result of bcl-1 rearrangement, a t(11;14) translocation, and is implicated in various neoplasms. | 5.28 | 16 | 0 | ||
| alcohol oxidase [no description available] | 2.01 | 1 | 0 | ||
| qs 21 [no description available] | 2.03 | 1 | 0 | ||
| caseins Caseins: A mixture of related phosphoproteins occurring in milk and cheese. The group is characterized as one of the most nutritive milk proteins, containing all of the common amino acids and rich in the essential ones. | 3.51 | 8 | 0 | ||
| blasticidin a blasticidin A: an inhibitor of aflatoxin production by Aspergillus parasiticus; structure in first source | 2.02 | 1 | 0 | ||
| oligomycins Oligomycins: A closely related group of toxic substances elaborated by various strains of Streptomyces. They are 26-membered macrolides with lactone moieties and double bonds and inhibit various ATPases, causing uncoupling of phosphorylation from mitochondrial respiration. Used as tools in cytochemistry. Some specific oligomycins are RUTAMYCIN, peliomycin, and botrycidin (formerly venturicidin X). | 1.98 | 1 | 0 | ||
| scorpion toxin i, androctonus scorpion toxin I, Androctonus: from Androdoctonus australis Hector | 2.03 | 1 | 0 | ||
| illite [no description available] | 1.99 | 1 | 0 | ||
| rb 006 [no description available] | 9.02 | 11 | 8 | ||
| tetracarboxyphenylporphine [no description available] | 2.15 | 1 | 0 | ||
| phthalocyanine phthalocyanine : A tetrapyrrole fundamental parent that consists of four isoindole-type units, with the connecting carbon atoms in the macrocycle replaced by nitrogen. | 8.76 | 10 | 0 | phthalocyanines; tetrapyrrole fundamental parent | |
| tetraphenylporphine tetraphenylporphyrin: structure in first source | 2.03 | 1 | 0 | ||
| biotin tyramine biotin tyramine: used as a signal amplification in flow cytometry | 2.15 | 1 | 0 | ||
| benzyloxycarbonylvalyl-alanyl-aspartyl fluoromethyl ketone benzyloxycarbonylvalyl-alanyl-aspartyl fluoromethyl ketone: an interleukin-1beta converting enzyme (ICE)-like protease inhibitor | 2.41 | 2 | 0 | ||
| nitrophenols Nitrophenols: PHENOLS carrying nitro group substituents. | 3.49 | 8 | 0 | ||
| bassianolide bassianolide: cyclodepsipeptide from mycelia of Beauveria bassiana; inhibits isotonic contractions induced by acetylcholine. bassianolide : A cyclodepsipeptide consisting of a cyclic tetramer of the depsipeptide D-Hiv-N-methyl-L-leucine (where D-Hiv = D-alpha-hydroxyisovaleric acid). Found in the fungal species Beauveria bassiana and Verticillium lecanii, it has insecticidal properties and is used as a commercial biopesticide to control of insects of agricultural, veterinary and medical significance. For elucidation of the structure, see Suzuki et al., Tetrahedron Lett. 1977 v25, 2167-2170. | 2.72 | 3 | 0 | cyclodepsipeptide; cyclooctadepsipeptide | antineoplastic agent; fungal metabolite; insecticide |
| carboxypeptidase b Carboxypeptidase B: A ZINC-dependent carboxypeptidase primary found in the DIGESTIVE SYSTEM. The enzyme catalyzes the preferential cleavage of a C-terminal peptidyl-L-lysine or arginine. It was formerly classified as EC 3.4.2.2 and EC 3.4.12.3. | 1.98 | 1 | 0 | ||
| pladienolide b pladienolide B: structure in first source | 3.25 | 1 | 0 | ||
| 9,10-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene 9,10-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene: RN given refers to cpd with unspecified isomeric designation; structure given in first source | 2.01 | 1 | 0 | ||
| cobamamide cobamamide : A member of the class of cobalamins that is vitamin B12 in which the cyano group is replaced by a 5'-deoxyadenos-5'-yl moiety. It is one of the two metabolically active form of vitamin B12. | 2.42 | 2 | 0 | ||
| hyaluronoglucosaminidase Hyaluronoglucosaminidase: An enzyme that catalyzes the random hydrolysis of 1,4-linkages between N-acetyl-beta-D-glucosamine and D-glucuronate residues in hyaluronate. (From Enzyme Nomenclature, 1992) There has been use as ANTINEOPLASTIC AGENTS to limit NEOPLASM METASTASIS. | 3.09 | 5 | 0 | ||
| apatorsen apatorsen: an antisense oligonucleotide that targets Hsp27 for support of cancer therapy | 7.05 | 8 | 3 | ||
| 8-oxoadenosine [no description available] | 2.11 | 1 | 0 | ||
| adrenomedullin Adrenomedullin: A 52-amino acid peptide with multi-functions. It was originally isolated from PHEOCHROMOCYTOMA and ADRENAL MEDULLA but is widely distributed throughout the body including lung and kidney tissues. Besides controlling fluid-electrolyte homeostasis, adrenomedullin is a potent vasodilator and can inhibit pituitary ACTH secretion. | 2.41 | 2 | 0 | ||
| mesotocin [no description available] | 2.02 | 1 | 0 | ||
| lipofectamine Lipofectamine: mediates gene transfer; a polycationic lipid reagent | 3.84 | 11 | 0 | ||
| diospyros Diospyros: A plant genus of the family EBENACEAE, order Ebenales, subclass Dilleniidae, class Magnoliopsida best known for the edible fruit and the antibacterial activity and compounds of the wood. | 2.07 | 1 | 0 | ||
| nephrin nephrin: gene nephrin is mutated in congenital nephrotic syndrome; amino acid sequence in first source; GenBank F19541; RefSeq NM_019459 (mouse), NM_004646 (human), NM_022628 (rat) | 2.73 | 3 | 0 | ||
| naphthyridinomycin naphthyridinomycin: antibiotic isolated from culture filtrate of Streptomyces lusitanus; structure | 2 | 1 | 0 | ||
| vitamin b 12 Vitamin B 12: A cobalt-containing coordination compound produced by intestinal micro-organisms and found also in soil and water. Higher plants do not concentrate vitamin B 12 from the soil and so are a poor source of the substance as compared with animal tissues. INTRINSIC FACTOR is important for the assimilation of vitamin B 12. | 2.81 | 3 | 0 | ||
| refludan lepirudin : A heterodetic cyclic peptide composed of 65 amino acids joined in sequence and cyclised by three disulfide bridges between cysteine residues 6-14, 16-28 and 22-39. It is a highly specific inhibitor of thrombin and used as an anticoagulant in patients with heparin-induced thrombocytopenia. | 2.05 | 1 | 0 | ||
| oblimersen oblimersen: targets the Bcl-2 oncogene good efficacy with low toxicity tumour regressions | 5.26 | 9 | 0 | ||
| s 8932 [no description available] | 4.27 | 1 | 0 | aromatic amine; C-nucleoside; carboxylic ester; nitrile; phosphoramidate ester; pyrrolotriazine | anticoronaviral agent; antiviral drug; prodrug |
| ged0301 GED0301: a Smad7 antisense oligonucleotide | 11.98 | 20 | 6 | ||
| aprinocarsen ISIS 3521: 20-nucleotide phosphorothioate antisense molecule that targets protein kinase C-alpha isoenzyme | 5.92 | 4 | 1 | ||
| transforming growth factor alpha Transforming Growth Factor alpha: An EPIDERMAL GROWTH FACTOR related protein that is found in a variety of tissues including EPITHELIUM, and maternal DECIDUA. It is synthesized as a transmembrane protein which can be cleaved to release a soluble active form which binds to the EGF RECEPTOR. | 2.68 | 3 | 0 | ||
| as 1411 AGRO 100: an antineoplastic agent that inhibits nuclear factor-kappaB activation; base sequence in first source | 2.57 | 2 | 0 | ||
| moxidectin moxidectin: family of macrolide antibiotics with insecticidal & acaricidal activity | 2.21 | 1 | 0 | ||
| dodecaborate dodecaborate: RN given for disodium salt; structure in first source | 2.21 | 1 | 0 | ||
| cyclosporine Cyclosporine: A cyclic undecapeptide from an extract of soil fungi. It is a powerful immunosupressant with a specific action on T-lymphocytes. It is used for the prophylaxis of graft rejection in organ and tissue transplantation. (From Martindale, The Extra Pharmacopoeia, 30th ed). | 4.38 | 6 | 0 | ||
| flavin mononucleotide Flavin Mononucleotide: A coenzyme for a number of oxidative enzymes including NADH DEHYDROGENASE. It is the principal form in which RIBOFLAVIN is found in cells and tissues. | 5.12 | 8 | 0 | ||
| lactoferrin Lactoferrin: An iron-binding protein that was originally characterized as a milk protein. It is widely distributed in secretory fluids and is found in the neutrophilic granules of LEUKOCYTES. The N-terminal part of lactoferrin possesses a serine protease which functions to inactivate the TYPE III SECRETION SYSTEM used by bacteria to export virulence proteins for host cell invasion. | 4.43 | 6 | 0 | ||
| oligo(dg-dc) [no description available] | 1.98 | 1 | 0 | ||
| digitonin Digitonin: A glycoside obtained from Digitalis purpurea; the aglycone is digitogenin which is bound to five sugars. Digitonin solubilizes lipids, especially in membranes and is used as a tool in cellular biochemistry, and reagent for precipitating cholesterol. It has no cardiac effects.. digitonin : A spirostanyl glycoside that is digitogenin in which the 3-hydroxy group is substituted by a beta-D-glucopyranosyl-(1->3)-beta-D-galactopyranosyl-(1->2)-[beta-D-xylopyranosyl-(1->3)]-beta-D-glucopyranosyl-(1->4)-beta-D-galactopyranosyl group. It is a steroidal saponin isolated from the foxglove plant, Digitalis purpurea. It is used extensively as a mild non-ionic detergent for extracting proteins from membranes for structure and function studies. | 2.93 | 4 | 0 | ||
| sparsomycin Sparsomycin: An antitumor antibiotic produced by Streptomyces sparsogenes. It inhibits protein synthesis in 70S and 80S ribosomal systems. | 1.97 | 1 | 0 | ||
| edifoligide edifoligide: a short piece of double-stranded DNA that mimics the consensus binding sequence for E2F (E2F decoy); used for the prevention of infrainguinal vein graft failure | 12.68 | 25 | 11 | ||
| asbestos, amosite Asbestos, Amosite: Asbestos, grunerite. A monoclinic amphibole form of asbestos having long fibers and a high iron content. It is used in insulation. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed) | 2 | 1 | 0 | ||
| technetium tc 99m medronate Technetium Tc 99m Medronate: A gamma-emitting radionuclide imaging agent used primarily in skeletal scintigraphy. Because of its absorption by a variety of tumors, it is useful for the detection of neoplasms. | 2.25 | 1 | 0 | ||
| apyrase Apyrase: A calcium-activated enzyme that catalyzes the hydrolysis of ATP to yield AMP and orthophosphate. It can also act on ADP and other nucleoside triphosphates and diphosphates. EC 3.6.1.5. | 2.69 | 3 | 0 | ||
| thromboplastin Thromboplastin: Constituent composed of protein and phospholipid that is widely distributed in many tissues. It serves as a cofactor with factor VIIa to activate factor X in the extrinsic pathway of blood coagulation. | 3.61 | 9 | 0 | ||
| muramidase Muramidase: A basic enzyme that is present in saliva, tears, egg white, and many animal fluids. It functions as an antibacterial agent. The enzyme catalyzes the hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrin. EC 3.2.1.17. | 5.76 | 28 | 0 | ||
| chromomycins Chromomycins: A complex of several closely related glycosidic antibiotics from Streptomyces griseus. The major component, CHROMOMYCIN A3, is used as a fluorescent stain of DNA where it attaches and inhibits RNA synthesis. It is also used as an antineoplastic agent, especially for solid tumors.. chromomycin : A family of antibiotics isolated from Streptomyces griseus. | 3.23 | 6 | 0 | ||
| ribosomal protein l7-l12 [no description available] | 1.97 | 1 | 0 | ||
| nusinersen nusinersen: an antisense oligonucleotide that induces SMN protein expression | 25.28 | 359 | 24 | ||
| amyloid beta-peptides amyloid beta-protein (1-40): although acutely neurotoxic in both rat & monkey cerebral cortex, neuronal degeneration in primates resembles more closely to that found in Alzheimer's disease; amino acid sequence has been determined | 2.44 | 2 | 0 | ||
| chondroitin sulfates Chondroitin Sulfates: Derivatives of chondroitin which have a sulfate moiety esterified to the galactosamine moiety of chondroitin. Chondroitin sulfate A, or chondroitin 4-sulfate, and chondroitin sulfate C, or chondroitin 6-sulfate, have the sulfate esterified in the 4- and 6-positions, respectively. Chondroitin sulfate B (beta heparin; DERMATAN SULFATE) is a misnomer and this compound is not a true chondroitin sulfate. | 2.48 | 2 | 0 | ||
| exudates Malaysia: A parliamentary democracy with a constitutional monarch in southeast Asia, consisting of 11 states (West Malaysia) on the Malay Peninsula and two states (East Malaysia) on the island of BORNEO. It is also called the Federation of Malaysia. Its capital is Kuala Lumpur. Before 1963 it was the Union of Malaya. It reorganized in 1948 as the Federation of Malaya, becoming independent from British Malaya in 1957 and becoming Malaysia in 1963 as a federation of Malaya, Sabah, Sarawak, and Singapore (which seceded in 1965). The form Malay- probably derives from the Tamil malay, mountain, with reference to its geography. (From Webster's New Geographical Dictionary, 1988, p715 & Room, Brewer's Dictionary of Names, 1992, p329) | 3.53 | 2 | 0 | ||
| angiogenin angiogenin: human tumor protein which stimulates growth of blood vessels; contains 123 amino acids; member of the pancreatic ribonuclease superfamily; MW 14,400 | 3.08 | 5 | 0 | ||
| 5'-deoxythymidine 5'-deoxythymidine: structure given in first source; used to study mechanism of entry into human erythrocytes in comparison with other deoxythymidines | 2.01 | 1 | 0 | ||
| plicamycin mithramycin A: structure given in first source | 2.71 | 3 | 0 | ||
| tautomycin tautomycin: an inhibitor of protein phosphatases 1 and 2A; isolated from Streptomyces spiroverticillatus; MF: C42-H70-O12; exists as a tautomeric mixture in solution | 1.99 | 1 | 0 | ||
| tetra(4-n-methylpyridyl)porphine tetra(4-N-methylpyridyl)porphine: structure in first source | 3.91 | 12 | 0 | ||
| entecavir entecavir (anhydrous) : Guanine substituted at the 9 position by a 4-hydroxy-3-(hydroxymethyl)-2-methylidenecyclopentyl group. A synthetic analogue of 2'-deoxyguanosine, it is a nucleoside reverse transcriptase inhibitor with selective antiviral activity against hepatitis B virus. Entecavir is phosphorylated intracellularly to the active triphosphate form, which competes with deoxyguanosine triphosphate, the natural substrate of hepatitis B virus reverse transcriptase, inhibiting every stage of the enzyme's activity, although it has no activity against HIV. It is used for the treatment of chronic hepatitis B. | 3.92 | 2 | 1 | 2-aminopurines; oxopurine; primary alcohol; secondary alcohol | antiviral drug; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor |
| acyclovir Acyclovir: A GUANOSINE analog that acts as an antimetabolite. Viruses are especially susceptible. Used especially against herpes.. acyclovir : An oxopurine that is guanine substituted by a (2-hydroxyethoxy)methyl substituent at position 9. Used in the treatment of viral infections. | 4.01 | 4 | 0 | 2-aminopurines; oxopurine | antimetabolite; antiviral drug |
| levoleucovorin Levoleucovorin: A folate analog consisting of the pharmacologically active isomer of LEUCOVORIN.. (6S)-5-formyltetrahydrofolic acid : The pharmacologically active (6S)-stereoisomer of 5-formyltetrahydrofolic acid. | 6.67 | 4 | 3 | 5-formyltetrahydrofolic acid | antineoplastic agent; metabolite |
| 8-oxodeoxyguanosine triphosphate 8-oxodeoxyguanosine triphosphate: mutagenic nucleotide; hydrolyzed by 8-oxodGTPase to 8-oxodGMP. 8-oxo-dGTP : A purine 2'-deoxyribonucleoside 5'-triphosphate having 8-oxo-7,8-dihydroguanine as the nucleobase. | 2 | 1 | 0 | purine 2'-deoxyribonucleoside 5'-triphosphate | mutagen |
| cyclic gmp Cyclic GMP: Guanosine cyclic 3',5'-(hydrogen phosphate). A guanine nucleotide containing one phosphate group which is esterified to the sugar moiety in both the 3'- and 5'-positions. It is a cellular regulatory agent and has been described as a second messenger. Its levels increase in response to a variety of hormones, including acetylcholine, insulin, and oxytocin and it has been found to activate specific protein kinases. (From Merck Index, 11th ed). 3',5'-cyclic GMP : A 3',5'-cyclic purine nucleotide in which the purine nucleobase is specified as guanidine. | 5.07 | 13 | 0 | 3',5'-cyclic purine nucleotide; guanyl ribonucleotide | Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| diguanosine tetraphosphate P(1),P(4)-bis(5'-guanosyl) tetraphosphate : A purine ribonucleoside 5'-tetraphosphate compound having 5'-guanosyl residues at the P(1)- and P(4)-positions. | 1.95 | 1 | 0 | guanosine 5'-phosphate; purine ribonucleoside 5'-tetraphosphate | Escherichia coli metabolite; mouse metabolite |
| deoxyguanosine [no description available] | 8.37 | 152 | 0 | purine 2'-deoxyribonucleoside; purines 2'-deoxy-D-ribonucleoside | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| deoxyinosine [no description available] | 3.67 | 9 | 0 | purine 2'-deoxyribonucleoside; purines 2'-deoxy-D-ribonucleoside | Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| 2'-deoxyguanosine 5'-phosphate 2'-deoxyguanosine 5'-phosphate: RN given refers to parent cpd.. 2'-deoxyguanosine 5'-monophosphate : A purine 2'-deoxyribonucleoside 5'-monophosphate having guanine as the nucleobase. | 1.98 | 1 | 0 | deoxyguanosine phosphate; guanyl deoxyribonucleotide; purine 2'-deoxyribonucleoside 5'-monophosphate | Escherichia coli metabolite; mouse metabolite |
| deoxyguanosine triphosphate [no description available] | 3.6 | 9 | 0 | deoxyguanosine phosphate; guanyl deoxyribonucleotide; purine 2'-deoxyribonucleoside 5'-triphosphate | Arabidopsis thaliana metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite; Saccharomyces cerevisiae metabolite |
| guanosine diphosphate Guanosine Diphosphate: A guanine nucleotide containing two phosphate groups esterified to the sugar moiety. | 4.42 | 8 | 0 | guanosine 5'-phosphate; purine ribonucleoside 5'-diphosphate | Escherichia coli metabolite; mouse metabolite; uncoupling protein inhibitor |
| guanosine diphosphate mannose Guanosine Diphosphate Mannose: A nucleoside diphosphate sugar which can be converted to the deoxy sugar GDPfucose, which provides fucose for lipopolysaccharides of bacterial cell walls. Also acts as mannose donor for glycolipid synthesis.. GDP-D-mannose : A GDP-mannose in which the mannose fragment has D-configuration.. GDP-alpha-D-mannose : The alpha-anomer of GDP-D-mannose. | 1.95 | 1 | 0 | GDP-D-mannose | Escherichia coli metabolite; human metabolite; mouse metabolite; plant metabolite |
| guanosine monophosphate Guanosine Monophosphate: A guanine nucleotide containing one phosphate group esterified to the sugar moiety and found widely in nature.. guanosine 5'-monophosphate : A purine ribonucleoside 5'-monophosphate having guanine as the nucleobase. | 5.02 | 41 | 0 | guanosine 5'-phosphate; purine ribonucleoside 5'-monophosphate | biomarker; Escherichia coli metabolite; metabolite; mouse metabolite |
| guanosine triphosphate Guanosine Triphosphate: Guanosine 5'-(tetrahydrogen triphosphate). A guanine nucleotide containing three phosphate groups esterified to the sugar moiety. | 6.7 | 75 | 0 | guanosine 5'-phosphate; purine ribonucleoside 5'-triphosphate | Escherichia coli metabolite; mouse metabolite; uncoupling protein inhibitor |
| guanine [no description available] | 12.13 | 450 | 1 | 2-aminopurines; oxopurine; purine nucleobase | algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| guanosine ribonucleoside : Any nucleoside where the sugar component is D-ribose. | 8.82 | 146 | 0 | guanosines; purines D-ribonucleoside | fundamental metabolite |
| guanosine tetraphosphate Guanosine Tetraphosphate: Guanosine 5'-diphosphate 2'(3')-diphosphate. A guanine nucleotide containing four phosphate groups. Two phosphate groups are esterified to the sugar moiety in the 5' position and the other two in the 2' or 3' position. This nucleotide serves as a messenger to turn off the synthesis of ribosomal RNA when amino acids are not available for protein synthesis. Synonym: magic spot I.. guanosine 3',5'-bis(diphosphate) : A guanosine bisphosphate having diphosphate groups at both the 3' and 5'-positions. | 1.96 | 1 | 0 | guanosine bisphosphate | Escherichia coli metabolite; mouse metabolite |
| hypoxanthine [no description available] | 3.71 | 10 | 0 | nucleobase analogue; oxopurine; purine nucleobase | fundamental metabolite |
| inosinic acid Inosine Monophosphate: Inosine 5'-Monophosphate. A purine nucleotide which has hypoxanthine as the base and one phosphate group esterified to the sugar moiety. | 2.36 | 2 | 0 | inosine phosphate; purine ribonucleoside 5'-monophosphate | Escherichia coli metabolite; human metabolite; mouse metabolite |
| inosine [no description available] | 6.56 | 37 | 0 | inosines; purines D-ribonucleoside | Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite |
| inosine triphosphate Inosine Triphosphate: Inosine 5'-(tetrahydrogen triphosphate). An inosine nucleotide containing three phosphate groups esterified to the sugar moiety. Synonym: IRPPP. | 2 | 1 | 0 | inosine phosphate; purine ribonucleoside 5'-triphosphate | Escherichia coli metabolite; human metabolite; mouse metabolite |
| 1-methyladenine 1-methyladenine : Adenine substituted with a methyl group at position N-1. | 2.41 | 2 | 0 | ||
| sapropterin sapropterin: RN given refers to parent cpd; co-factor required for catalytic activity of nitric oxide synthases. (6R)-5,6,7,8-tetrahydrobiopterin : A 5,6,7,8-tetrahydrobiopterin in which the stereocentre at position 6 has R-configuration.. sapropterin : A tetrahydropterin that is 2-amino-5,6,7,8-tetrahydropteridin-4(3H)-one in which a hydrogen at position 6 is substituted by a 1,2-dihydroxypropyl group (6R,1'R,2'S-enantiomer). | 1.97 | 1 | 0 | 5,6,7,8-tetrahydrobiopterin | coenzyme; cofactor; diagnostic agent; human metabolite |
| folic acid folcysteine: used to promote fertility in chickens. vitamin B9 : Any B-vitamin that exhibits biological activity against vitamin B9 deficiency. Vitamin B9 refers to the many forms of folic acid and its derivatives, including tetrahydrofolic acid (the active form), methyltetrahydrofolate (the primary form found in blood), methenyltetrahydrofolate, folinic acid amongst others. They are present in abundance in green leafy vegetables, citrus fruits, and animal products. Lack of vitamin B9 leads to anemia, a condition in which the body cannot produce sufficient number of red blood cells. Symptoms of vitamin B9 deficiency include fatigue, muscle weakness, and pale skin. | 6.24 | 14 | 0 | folic acids; N-acyl-amino acid | human metabolite; mouse metabolite; nutrient |
| queuine [no description available] | 1.97 | 1 | 0 | pyrrolopyrimidine | Escherichia coli metabolite |
| guanosine 5'-o-(3-thiotriphosphate) Guanosine 5'-O-(3-Thiotriphosphate): Guanosine 5'-(trihydrogen diphosphate), monoanhydride with phosphorothioic acid. A stable GTP analog which enjoys a variety of physiological actions such as stimulation of guanine nucleotide-binding proteins, phosphoinositide hydrolysis, cyclic AMP accumulation, and activation of specific proto-oncogenes. | 2.03 | 1 | 0 | nucleoside triphosphate analogue | |
| 7-methylguanine 7-methylguanine: RN given refers to unlabeled cpd; structure. 7-methylguanine : A methylguanine that is guanine substituted by a methyl group at position 7. It is a metabolite obtained during the methylation of DNA.. 2-imino-7-methyl-1,2,3,7-tetrahydro-6H-purin-6-one : A 7-methylguanine that is 1,2,3,7-tetrahydro-6H-purin-6-one substituted by an imino group at position 2 and a methyl group at position 7.. 2-amino-7-methyl-7H-purin-6-ol : A 7-methylguanine that is 7H-purine substituted by an amino group at position 2, a methyl group at position 7 and a hydroxy group at position 6.. 2-amino-7-methyl-1,7-dihydro-6H-purin-6-one : A 7-methylguanine that is 1,7-dihydro-6H-purin-6-one substituted by an amino group at position 2 and a methyl group at position 7. | 3.1 | 5 | 0 | 7-methylguanine | |
| pheophytin a pheophytin a: structure given in first source; RN given refers to (3S-(3alpha(2E,7S*,11S*),4beta,21beta))-isomer | 2.1 | 1 | 0 | ||
| rifampin Rifampin: A semisynthetic antibiotic produced from Streptomyces mediterranei. It has a broad antibacterial spectrum, including activity against several forms of Mycobacterium. In susceptible organisms it inhibits DNA-dependent RNA polymerase activity by forming a stable complex with the enzyme. It thus suppresses the initiation of RNA synthesis. Rifampin is bactericidal, and acts on both intracellular and extracellular organisms. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p1160) | 4.55 | 25 | 0 | cyclic ketal; hydrazone; N-iminopiperazine; N-methylpiperazine; rifamycins; semisynthetic derivative; zwitterion | angiogenesis inhibitor; antiamoebic agent; antineoplastic agent; antitubercular agent; DNA synthesis inhibitor; EC 2.7.7.6 (RNA polymerase) inhibitor; Escherichia coli metabolite; geroprotector; leprostatic drug; neuroprotective agent; pregnane X receptor agonist; protein synthesis inhibitor |
| clozapine Clozapine: A tricylic dibenzodiazepine, classified as an atypical antipsychotic agent. It binds several types of central nervous system receptors, and displays a unique pharmacological profile. Clozapine is a serotonin antagonist, with strong binding to 5-HT 2A/2C receptor subtype. It also displays strong affinity to several dopaminergic receptors, but shows only weak antagonism at the dopamine D2 receptor, a receptor commonly thought to modulate neuroleptic activity. Agranulocytosis is a major adverse effect associated with administration of this agent.. clozapine : A benzodiazepine that is 5H-dibenzo[b,e][1,4]diazepine substituted by a chloro group at position 8 and a 4-methylpiperazin-1-yl group at position 11. It is a second generation antipsychotic used in the treatment of psychiatric disorders like schizophrenia. | 2.03 | 1 | 0 | benzodiazepine; N-arylpiperazine; N-methylpiperazine; organochlorine compound | adrenergic antagonist; dopaminergic antagonist; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor; environmental contaminant; GABA antagonist; histamine antagonist; muscarinic antagonist; second generation antipsychotic; serotonergic antagonist; xenobiotic |
| dacarbazine (E)-dacarbazine : A dacarbazine in which the N=N double bond adopts a trans-configuration. | 3.3 | 6 | 0 | dacarbazine | |
| ganciclovir [no description available] | 3.52 | 2 | 0 | 2-aminopurines; oxopurine | antiinfective agent; antiviral drug |
| valacyclovir Valacyclovir: A prodrug of acyclovir that is used in the treatment of HERPES ZOSTER and HERPES SIMPLEX VIRUS INFECTION of the skin and mucous membranes, including GENITAL HERPES. | 3.12 | 1 | 0 | L-valyl ester | antiviral drug |
| 5,10-methylenetetrahydrofolic acid 5,10-methylenetetrahydrofolic acid: RN refers to parent cpd(L-Glu)-isomer | 2.05 | 1 | 0 | benzamides; methylenetetrahydrofolic acid | |
| guanylyl imidodiphosphate Guanylyl Imidodiphosphate: A non-hydrolyzable analog of GTP, in which the oxygen atom bridging the beta to the gamma phosphate is replaced by a nitrogen atom. It binds tightly to G-protein in the presence of Mg2+. The nucleotide is a potent stimulator of ADENYLYL CYCLASES.. guanosine 5'-[beta,gamma-imido]triphosphate : A nucleoside triphosphate analogue that is GTP in which the oxygen atom bridging the beta- to the gamma- phosphate is replaced by a nitrogen atom A non-hydrolyzable analog of GTP, it binds tightly to G-protein in the presence of Mg(2+). | 2.88 | 4 | 0 | nucleoside triphosphate analogue | |
| xanthopterin [no description available] | 2.71 | 3 | 0 | ||
| acyclovir triphosphate [no description available] | 1.97 | 1 | 0 | ||
| 2'-o-methylguanosine 2'-O-methylguanosine : Guanosine with the hydrogen on the hydroxyl at position C-2' substituted with a methyl group. | 2.71 | 3 | 0 | methylguanosine | metabolite |
| 8-hydroxyguanosine 8-hydroxyguanosine: immunostimulant for B lymphocytes; structure given in first source | 3.89 | 12 | 0 | purine nucleoside | |
| 7-deazaguanine [no description available] | 3.56 | 8 | 0 | organic molecular entity | |
| 8-bromoguanine 8-bromoguanine: structure in first source | 2.48 | 2 | 0 | ||
| 9-((2-phosphonylmethoxy)ethyl)guanine 9-((2-phosphonylmethoxy)ethyl)guanine: structure given in first source | 1.99 | 1 | 0 | phosphoethanolamine | |
| pemetrexed pemetrexed disodium : An organic sodium salt that is the disodium salt of N-{4-[2-(2-amino-4-oxo-4,7-dihydro-1H-pyrrolo[2,3-d]pyrimidin-5-yl)ethyl]benzoyl}-L-glutamic acid. Inhibits thymidylate synthase (TS), 421 dihydrofolate reductase (DHFR), and glycinamide ribonucleotide formyltransferase (GARFT). | 3.87 | 2 | 1 | N-acyl-L-glutamic acid; pyrrolopyrimidine | antimetabolite; antineoplastic agent; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; EC 2.1.1.45 (thymidylate synthase) inhibitor; EC 2.1.2.2 (phosphoribosylglycinamide formyltransferase) inhibitor |
| 7-deazaguanosine 7-deazaguanosine: structure given in first source | 2.44 | 2 | 0 | ||
| 7-deaza-2'-deoxyguanosine 7-deaza-2'-deoxyguanosine: structure given in first source | 2.93 | 4 | 0 | pyrrolopyrimidine | |
| tirapazamine Tirapazamine: A triazine derivative that introduces breaks into DNA strands in hypoxic cells, sensitizing tumor cells to the cytotoxic activity of other drugs and radiation.. tirapazamine : A member of the class of benzotriazines that is 1,2,4-benzotriazine carrying an amino substituent at position 3 and two oxido substituents at positions 1 and 4. | 2.03 | 1 | 0 | aromatic amine; benzotriazines; N-oxide | antibacterial agent; antineoplastic agent; apoptosis inducer |
| 5(4'-hydroxybenzylidenoimino)-3-methylisothiazolo(5,4-d)pyrimidine-(7h)-4,6-dione 5(4'-hydroxybenzylidenoimino)-3-methylisothiazolo(5,4-d)pyrimidine-(7H)-4,6-dione: structure in first source; do not confuse with IP-10 protein (Chemokine CXCL10) | 2.05 | 1 | 0 | ||
| xav939 XAV939: selectively inhibits beta-catenin-mediated transcription; structure in first source. XAV939 : A thiopyranopyrimidine in which a 7,8-dihydro-5H-thiopyrano[4,3-d]pyrimidine skeleton is substituted at C-4 by a hydroxy group and at C-2 by a para-(trifluoromethyl)phenyl group. | 2.08 | 1 | 0 | (trifluoromethyl)benzenes; thiopyranopyrimidine | tankyrase inhibitor |
| 8-hydroxyguanine 7,8-dihydro-8-oxoguanine: was substituted for guanine at G(8), G(9), G(14), or G(15) in the human telomeric oligonucleotide 5'-d[AGGGTTAG(8)G(9)GTT AG(14)G(15)GTTAGGGTGT]-3'. 7,8-dihydro-8-oxoguanine : An oxopurine that is guanine in which the hydrogen at position 8 is replaced by an oxo group and in which the nitrogens at positions 7 and 9 each bear a hydrogen. | 5.09 | 42 | 0 | oxopurine | |
| trypan blue Trypan Blue: A diazo-naphthalene sulfonate that is widely used as a stain.. trypan blue : An organosulfonate salt that is the tetrasodium salt of 3,3'-[(3,3'-dimethylbiphenyl-4,4'-diyl)didiazene-2,1-diyl]bis(5-amino-4-hydroxynaphthalene-2,7-disulfonic acid). | 2.78 | 3 | 0 | ||
| 8-aminoguanine [no description available] | 2.93 | 4 | 0 | ||
| acyclovir monophosphate acyclovir monophosphate: structure given in first source | 1.97 | 1 | 0 | ||
| nintedanib nintedanib : A member of the class of oxindoles that is a kinase inhibitor used (in the form of its ethylsulfonate salt) for the treatment of idiopathic pulmonary fibrosis and cancer. | 4.09 | 2 | 0 | ||
| 3'-fluoro-2',3'-dideoxyguanosine 3'-fluoro-2',3'-dideoxyguanosine: structure given in first source | 2.02 | 1 | 0 | ||
| methylnitronitrosoguanidine Methylnitronitrosoguanidine: A nitrosoguanidine derivative with potent mutagenic and carcinogenic properties.. N-methyl-N'-nitro-N-nitrosoguanidine : An N-nitroguanidine compound having nitroso and methyl substituents at the N'-position | 2.72 | 3 | 0 | nitroso compound | alkylating agent |
| 8-bromo-2'-deoxyguanosine 8-bromo-2'-deoxyguanosine: structure in first source. 8-bromo-2'-deoxyguanosine : An organobromine compound comprising 2'-deoxyguanosine having a bromo substituent at position 8 of the guanine ring system. | 7 | 1 | 0 | guanosines; organobromine compound | |
| bis(3',5')-cyclic diguanylic acid [no description available] | 2.58 | 2 | 0 | cyclic purine dinucleotide; guanyl ribonucleotide | immunomodulator; signalling molecule |
| 8-hydroxy-2'-deoxyguanosine 8-Hydroxy-2'-Deoxyguanosine: Common oxidized form of deoxyguanosine in which C-8 position of guanine base has a carbonyl group.. 8-hydroxy-2'-deoxyguanosine : Guanosine substituted at the purine 8-position by a hydroxy group. It is used as a biomarker of oxidative DNA damage. | 9.63 | 26 | 0 | guanosines | biomarker |
| 6-methylisoxanthopterin 6-methylisoxanthopterin: a fluorescent structural probe for monitoring the integrity of triple-stranded DNA conformation | 2.11 | 1 | 0 | ||
| 8-((4-chlorophenyl)thio)cyclic-3',5'-gmp 8-(4-chlorophenylthio)-cGMP : A 3',5'-cyclic purine nucleotide that is 3',5'-cyclic GMP in which the hydrogen at position 2 on the purine fragment is replaced by a 4-chlorophenylthio group. | 2.02 | 1 | 0 | 3',5'-cyclic purine nucleotide; aryl sulfide; organochlorine compound; ribonucleotide | protein kinase agonist |
| 7-methylguanosine 7-methylguanosine : A positively charged methylguanosine in which a single methyl substituent is located at position 7. | 2.36 | 2 | 0 | methylguanosine; organic cation | metabolite |
| formycin b formycin B: RN given refers to (beta-D)-isomer | 1.95 | 1 | 0 | formycin | |
| 2'-deoxyguanosine 3'-phosphate 2'-deoxyguanosine 3'-monophosphate : A deoxyguanosine phosphate having a monophosphate group located at the 3'-position. | 2.02 | 1 | 0 | deoxyguanosine phosphate; purine 2'-deoxyribonucleoside 3'-monophosphate | |
| gtp gamma-4-azidoanilide [no description available] | 2.37 | 2 | 0 | ||
| guanylyl-(3'-5')-guanosine [no description available] | 2.92 | 4 | 0 | nucleoside analogue; purines | |
| 9-deazaguanine [no description available] | 2.03 | 1 | 0 | ||
| 8-methylguanosine 8-methylguanosine: structure in first source | 2.01 | 1 | 0 | ||
| guanosine 5'-phosphoimidazolide [no description available] | 3.07 | 5 | 0 | ||
| deoxyadenylyl-(3'-5')-deoxyguanosine [no description available] | 2 | 1 | 0 | ||
| 3,n(4)-ethanocytosine [no description available] | 3.13 | 5 | 0 | organic heterobicyclic compound | mutagen |
| formycins Formycins: Pyrazolopyrimidine ribonucleosides isolated from Nocardia interforma. They are antineoplastic antibiotics with cytostatic properties. | 2.35 | 2 | 0 | ||
| 8-nitroguanine [no description available] | 2.4 | 2 | 0 | oxopurine | |
| 2'-amino-2'-deoxyguanosine 2'-amino-2'-deoxyguanosine: structure | 2.03 | 1 | 0 | ||
| cytidylyl-3'-5'-guanosine cytidylyl-3'-5'-guanosine: also referred to as CpG | 4.18 | 17 | 0 | (3'->5')-dinucleotide | |
| deoxycytidylyl-(3'-5')-deoxyguanosine deoxycytidylyl-(3'-5')-deoxyguanosine: RN given refers to parent cpd. dCpdG : A (3'->5')-dinucleotide consisting of 2'-deoxyguanosine having a 2'-deoxycytidylyl-3-phospho moiety attached at the 5-position. | 2.39 | 2 | 0 | (3'->5')-dinucleotide | |
| 2'-deoxy-7-deazaguanosine triphosphate 2'-deoxy-7-deazaguanosine triphosphate: has been proposed as a replacement for dGTP | 2 | 1 | 0 | ||
| 2,3-dihydro-2-(n(7)-guanyl)-3-hydroxyaflatoxin b1 2,3-dihydro-2-(N(7)-guanyl)-3-hydroxyaflatoxin B1: aflatoxin-guanine adduct in urine of aflatoxin B1 treated rats; RN given refers to (6aS-(6aalpha,8beta,9alpha,9aalpha))-isomer | 2 | 1 | 0 | ||
| n-(deoxyguanosin-8-yl)-1-aminopyrene N-(deoxyguanosin-8-yl)-1-aminopyrene: major DNA adduct in female rats treated with 1-nitropyrene | 2.69 | 3 | 0 | ||
| cyclic guanosine monophosphate-adenosine monophosphate 2'-3'-cGAMP : A cyclic purine dinucleotide that consists of AMP and GMP units cyclised via 3',5'- and 2',5'-linkages respectively. | 2.55 | 2 | 0 | adenyl ribonucleotide; cyclic purine dinucleotide; guanyl ribonucleotide | |
| defibrotide defibrotide: Single-stranded polydeoxyribonucleotide extracted from mammalian organs and used in the treatment of HEPATIC VENO-OCCLUSIVE DISEASE in patients with kidney or lung abnormalities following HEMATOPOIETIC STEM CELL TRANSPLANTATION | 3.65 | 2 | 0 | ||
| 2',3'-dideoxyguanosine 5'-triphosphate [no description available] | 2 | 1 | 0 | ||
| s-(2-(n(7)-guanyl)ethyl)glutathione [no description available] | 1.97 | 1 | 0 | ||
| deoxyguanylyl-(3'-5')-guanosine deoxyguanylyl-(3'-5')-guanosine: RN given refers to parent cpd | 2.42 | 2 | 0 | ||
| apupg [no description available] | 2.36 | 2 | 0 | ||
| gpgp GpGp: cpd is guanosine monophosphate dimer | 1.95 | 1 | 0 | ||
| tri-(deoxyguanylic acid-deoxycytidylic acid) [no description available] | 3.06 | 5 | 0 | ||
| 7-methylguanosine triphosphate [no description available] | 2.21 | 1 | 0 | guanosine 5'-phosphate | |
| archaeosine archaeosine: post-transcriptional modification seen in archaeal RNA; structure given in first source. archaeosine : A 7-deazaguanine ribonucleoside having 7-formamidino-7-deazaguanine as the nucleobase. It is found in the majority of archaeal tRNAs specifically at position 15 of the dihydrouridine loop (D-loop), a position not modified in either eukaryotic or bacterial tRNA. | 2.03 | 1 | 0 | 7-deazaguanine ribonucleoside | |
| guanosine 5'-phospho-2-methylimidazolide [no description available] | 4.37 | 21 | 0 | ||
| magnesium gtp magnesium GTP: RN given refers to unlabeled cpd Mg salt | 2.1 | 1 | 0 | ||
| 5-guanidino-4-nitroimidazole 5-guanidino-4-nitroimidazole: a guanine oxidation product; structure in first source | 2.06 | 1 | 0 | ||
| 8-nitro-2'-deoxyguanosine 8-nitro-2'-deoxyguanosine: a marker of oxidation by reactive nitrogen intermediates in phagocytic neutrophils, generated through the cell-mediated myeloperoxidase pathway; structure in first source | 2.01 | 1 | 0 | ||
| 8,5'-cyclo-2'-deoxyguanosine 8,5'-cyclo-2'-deoxyguanosine: RN given refers to (5'R)-isomer in Toxline; RN not in Chemline 1/87. 8,5'-cyclo-2'-deoxyguanosine : An organic heterotetracyclic compound obtained by intramolecular formation of a C-C bond between positions 8 and 5' of 2'-deoxyguanosine. | 2.76 | 3 | 0 | aromatic amine; bridged compound; diol; N-glycosyl compound; organic heterotetracyclic compound | Mycoplasma genitalium metabolite |
| aflatoxin b1-formamidopyrimidine aflatoxin B1-formamidopyrimidine: persistent aflatoxin-deoxyribonucleic acid(DNA) adduct | 2.41 | 2 | 0 | ||
| molybdenum cofactor molybdenum cofactor: also see records for molybdopterin cytosine dinucleotide and molybdopterin guanine dinucleotide. MoO2-molybdopterin cofactor(2-) : An organophosphate oxoanion obtained by deprotonation of the phosphate OH groups of MoO2-molybdopterin cofactor.. MoO2-molybdopterin cofactor : An Mo-molybdopterin cofactor in which the coordinated molybdenum species is MoO2. | 2 | 1 | 0 | Mo-molybdopterin cofactor; organophosphate oxoanion | |
| cyanine dye 3 cyanine dye 3: structures of Cy3 derivatives given in first source | 5.98 | 33 | 0 | ||
| 1,n(6)-ethanoadenine [no description available] | 2.01 | 1 | 0 | ||
| alcian blue Alcian Blue: A copper-containing dye used as a gelling agent for lubricants, for staining of bacteria and for the dyeing of histiocytes and fibroblasts in vivo. | 2.74 | 3 | 0 | ||
| cholestyramine resin Cholestyramine Resin: A strongly basic anion exchange resin whose main constituent is polystyrene trimethylbenzylammonium Cl(-) anion. | 2.17 | 1 | 0 | ||
| eye [no description available] | 6.56 | 14 | 0 | ||
| fructooligosaccharide [no description available] | 3.41 | 1 | 1 | oligosaccharide | |
| chromomycin a3 Chromomycin A3: Glycosidic antibiotic from Streptomyces griseus used as a fluorescent stain of DNA and as an antineoplastic agent. | 2.9 | 4 | 0 | ||
| amicoumacin a amicoumacin A: has antibacterial activity, & strongly suppresses inflammatory & ulcer activity; structure in first source | 2.13 | 1 | 0 | organic molecular entity | |
| acetylcellulose acetylcellulose: coating compound. cellulose acetate : A glucan derivative obtained through the esterification of cellulose by acetic anhydride or acetic acid, resulting in the substitution of some of the hydroxy groups of cellulose by acetyl groups. It is used in a variety of applications including base material for photographic film, clothing, membrane filters, coatings, food packaging, and as a frame material for eyeglasses. | 2.39 | 2 | 0 | ||
| sandramycin sandramycin: depsipeptide, structure given in first source; isolated from Nocardioides sp. ATCC 39419 | 1.99 | 1 | 0 | ||
| concanavalin a Concanavalin A: A MANNOSE/GLUCOSE binding lectin isolated from the jack bean (Canavalia ensiformis). It is a potent mitogen used to stimulate cell proliferation in lymphocytes, primarily T-lymphocyte, cultures. | 4.51 | 9 | 0 | ||
| nisin z nisin Z: amino acid sequence given in first source; differs from nisin in a single amino acid | 2.02 | 1 | 0 | ||
| chlorotoxin [no description available] | 2 | 1 | 0 | ||
| trypsinogen Trypsinogen: The inactive proenzyme of trypsin secreted by the pancreas, activated in the duodenum via cleavage by enteropeptidase. (Stedman, 25th ed) | 2.04 | 1 | 0 | ||
| metallothionein Metallothionein: A low-molecular-weight (approx. 10 kD) protein occurring in the cytoplasm of kidney cortex and liver. It is rich in cysteinyl residues and contains no aromatic amino acids. Metallothionein shows high affinity for bivalent heavy metals. | 4.89 | 11 | 0 | ||
| dinitrobenzenes Dinitrobenzenes: Benzene derivatives which are substituted with two nitro groups in the ortho, meta or para positions. | 2.89 | 4 | 0 | ||
| phosphorus radioisotopes Phosphorus Radioisotopes: Unstable isotopes of phosphorus that decay or disintegrate emitting radiation. P atoms with atomic weights 28-34 except 31 are radioactive phosphorus isotopes. | 8.56 | 210 | 0 | ||
| thrombin aptamer thrombin aptamer: nucleotide sequence given in first source; a synthetic polynucleotide | 12.08 | 44 | 0 | ||
| preproenkephalin preproenkephalin: initial enkephalin precursor | 2.37 | 2 | 0 | ||
| leptin Leptin: A 16-kDa peptide hormone secreted from WHITE ADIPOCYTES. Leptin serves as a feedback signal from fat cells to the CENTRAL NERVOUS SYSTEM in regulation of food intake, energy balance, and fat storage. | 3.14 | 5 | 0 | ||
| pyrimidinones Pyrimidinones: Heterocyclic compounds known as 2-pyrimidones (or 2-hydroxypyrimidines) and 4-pyrimidones (or 4-hydroxypyrimidines) with the general formula C4H4N2O. | 3.64 | 9 | 0 | ||
| filipin Filipin: A complex of polyene antibiotics obtained from Streptomyces filipinensis. Filipin III alters membrane function by interfering with membrane sterols, inhibits mitochondrial respiration, and is proposed as an antifungal agent. Filipins I, II, and IV are less important. | 2.42 | 2 | 0 | ||
| cenersen cenersen: antineoplastic p53 antisense oligonucleotide | 5.48 | 5 | 1 | ||
| phenanthrenes Phenanthrenes: POLYCYCLIC AROMATIC HYDROCARBONS composed of three fused BENZENE rings.. phenanthrenes : Any benzenoid aromatic compound that consists of a phenanthrene skeleton and its substituted derivatives thereof. | 4.27 | 18 | 0 |
| Condition | Indicated | Relationship Strength | Studies | Trials |
|---|---|---|---|---|
| Apoplexy [description not available] | 0 | 4.62 | 5 | 0 |
| Acute Ischemic Stroke [description not available] | 0 | 3.01 | 3 | 0 |
| Anoxemia [description not available] | 0 | 5.56 | 26 | 0 |
| Cerebral Ischemia [description not available] | 0 | 5.33 | 20 | 0 |
| Ischemic Stroke Stroke due to BRAIN ISCHEMIA resulting in interruption or reduction of blood flow to a part of the brain. When obstruction is due to a BLOOD CLOT formed within in a cerebral blood vessel it is a thrombotic stroke. When obstruction is formed elsewhere and moved to block a cerebral blood vessel (see CEREBRAL EMBOLISM) it is referred to as embolic stroke. Wake-up stroke refers to ischemic stroke occurring during sleep while cryptogenic stroke refers to ischemic stroke of unknown origin. | 0 | 3.01 | 3 | 0 |
| Hypoxia Sub-optimal OXYGEN levels in the ambient air of living organisms. | 0 | 10.56 | 26 | 0 |
| Brain Ischemia Localized reduction of blood flow to brain tissue due to arterial obstruction or systemic hypoperfusion. This frequently occurs in conjunction with brain hypoxia (HYPOXIA, BRAIN). Prolonged ischemia is associated with BRAIN INFARCTION. | 0 | 5.33 | 20 | 0 |
| Stroke A group of pathological conditions characterized by sudden, non-convulsive loss of neurological function due to BRAIN ISCHEMIA or INTRACRANIAL HEMORRHAGES. Stroke is classified by the type of tissue NECROSIS, such as the anatomic location, vasculature involved, etiology, age of the affected individual, and hemorrhagic vs. non-hemorrhagic nature. (From Adams et al., Principles of Neurology, 6th ed, pp777-810) | 0 | 4.62 | 5 | 0 |
| Benign Neoplasms, Brain [description not available] | 0 | 6.82 | 41 | 0 |
| Astrocytoma, Grade IV [description not available] | 0 | 6.34 | 35 | 0 |
| Brain Neoplasms Neoplasms of the intracranial components of the central nervous system, including the cerebral hemispheres, basal ganglia, hypothalamus, thalamus, brain stem, and cerebellum. Brain neoplasms are subdivided into primary (originating from brain tissue) and secondary (i.e., metastatic) forms. Primary neoplasms are subdivided into benign and malignant forms. In general, brain tumors may also be classified by age of onset, histologic type, or presenting location in the brain. | 0 | 6.82 | 41 | 0 |
| Glioblastoma A malignant form of astrocytoma histologically characterized by pleomorphism of cells, nuclear atypia, microhemorrhage, and necrosis. They may arise in any region of the central nervous system, with a predilection for the cerebral hemispheres, basal ganglia, and commissural pathways. Clinical presentation most frequently occurs in the fifth or sixth decade of life with focal neurologic signs or seizures. | 0 | 6.34 | 35 | 0 |
| 2019 Novel Coronavirus Disease [description not available] | 0 | 10.55 | 76 | 0 |
| Amyloidosis, Hereditary [description not available] | 0 | 2.31 | 1 | 0 |
| Amyloid Neuropathy Type 1 [description not available] | 0 | 15.4 | 48 | 11 |
| Amyloidosis, Familial Diseases in which there is a familial pattern of AMYLOIDOSIS. | 0 | 2.31 | 1 | 0 |
| Amyloid Neuropathies, Familial Inherited disorders of the peripheral nervous system associated with the deposition of AMYLOID in nerve tissue. The different clinical types based on symptoms correspond to the presence of a variety of mutations in several different proteins including transthyretin (PREALBUMIN); APOLIPOPROTEIN A-I; and GELSOLIN. | 0 | 15.4 | 48 | 11 |
| HIV Coinfection [description not available] | 0 | 10.92 | 71 | 2 |
| HIV Infections Includes the spectrum of human immunodeficiency virus infections that range from asymptomatic seropositivity, thru AIDS-related complex (ARC), to acquired immunodeficiency syndrome (AIDS). | 0 | 10.92 | 71 | 2 |
| Adult Spinal Muscular Atrophy [description not available] | 0 | 19.57 | 334 | 10 |
| Muscular Atrophy, Spinal A group of disorders marked by progressive degeneration of motor neurons in the spinal cord resulting in weakness and muscular atrophy, usually without evidence of injury to the corticospinal tracts. Diseases in this category include Werdnig-Hoffmann disease and later onset SPINAL MUSCULAR ATROPHIES OF CHILDHOOD, most of which are hereditary. (Adams et al., Principles of Neurology, 6th ed, p1089) | 0 | 19.57 | 334 | 10 |
| Cells, Neoplasm Circulating [description not available] | 0 | 5.97 | 8 | 1 |
| Sensitivity and Specificity Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed) | 0 | 18.44 | 565 | 1 |
| Cancer of Prostate [description not available] | 0 | 8.33 | 66 | 1 |
| Prostatic Neoplasms Tumors or cancer of the PROSTATE. | 0 | 8.33 | 66 | 1 |
| Diathesis [description not available] | 0 | 3.53 | 8 | 0 |
| Autoimmune Disease [description not available] | 0 | 6.86 | 21 | 0 |
| Disease Models, Animal Naturally-occurring or experimentally-induced animal diseases with pathological processes analogous to human diseases. | 0 | 12.29 | 231 | 1 |
| Carditis [description not available] | 0 | 2.96 | 4 | 0 |
| Autoimmune Diseases Disorders that are characterized by the production of antibodies that react with host tissues or immune effector cells that are autoreactive to endogenous peptides. | 0 | 6.86 | 21 | 0 |
| Myocarditis Inflammatory processes of the muscular walls of the heart (MYOCARDIUM) which result in injury to the cardiac muscle cells (MYOCYTES, CARDIAC). Manifestations range from subclinical to sudden death (DEATH, SUDDEN). Myocarditis in association with cardiac dysfunction is classified as inflammatory CARDIOMYOPATHY usually caused by INFECTION, autoimmune diseases, or responses to toxic substances. Myocarditis is also a common cause of DILATED CARDIOMYOPATHY and other cardiomyopathies. | 0 | 2.96 | 4 | 0 |
| Candida Infection [description not available] | 0 | 2.99 | 4 | 0 |
| Candidiasis Infection with a fungus of the genus CANDIDA. It is usually a superficial infection of the moist areas of the body and is generally caused by CANDIDA ALBICANS. (Dorland, 27th ed) | 0 | 2.99 | 4 | 0 |
| Agnogenic Myeloid Metaplasia [description not available] | 0 | 9.16 | 9 | 3 |
| Primary Myelofibrosis A de novo myeloproliferation arising from an abnormal stem cell. It is characterized by the replacement of bone marrow by fibrous tissue, a process that is mediated by CYTOKINES arising from the abnormal clone. | 0 | 9.16 | 9 | 3 |
| Benign Neoplasms [description not available] | 0 | 19.64 | 370 | 24 |
| Neoplasms New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms. | 0 | 19.64 | 370 | 24 |
| Cardiovascular Diseases Pathological conditions involving the CARDIOVASCULAR SYSTEM including the HEART; the BLOOD VESSELS; or the PERICARDIUM. | 0 | 16.85 | 68 | 8 |
| HMN (Hereditary Motor Neuropathy) Proximal Type I [description not available] | 0 | 19.58 | 203 | 54 |
| Spinal Muscular Atrophies of Childhood A group of recessive inherited diseases that feature progressive muscular atrophy and hypotonia. They are classified as type I (Werdnig-Hoffman disease), type II (intermediate form), and type III (Kugelberg-Welander disease). Type I is fatal in infancy, type II has a late infantile onset and is associated with survival into the second or third decade. Type III has its onset in childhood, and is slowly progressive. (J Med Genet 1996 Apr:33(4):281-3) | 0 | 19.58 | 203 | 54 |
| Apolipoprotein C-II Deficiency [description not available] | 0 | 10.95 | 20 | 3 |
| Hyperlipoproteinemia Type I An inherited condition due to a deficiency of either LIPOPROTEIN LIPASE or APOLIPOPROTEIN C-II (a lipase-activating protein). The lack of lipase activities results in inability to remove CHYLOMICRONS and TRIGLYCERIDES from the blood which has a creamy top layer after standing. | 0 | 10.95 | 20 | 3 |
| Atherogenesis [description not available] | 0 | 12.43 | 31 | 4 |
| Atherosclerosis A thickening and loss of elasticity of the walls of ARTERIES that occurs with formation of ATHEROSCLEROTIC PLAQUES within the ARTERIAL INTIMA. | 0 | 12.43 | 31 | 4 |
| Breast Cancer [description not available] | 0 | 12.95 | 141 | 4 |
| Breast Neoplasms Tumors or cancer of the human BREAST. | 0 | 12.95 | 141 | 4 |
| ALS - Amyotrophic Lateral Sclerosis [description not available] | 0 | 8.97 | 31 | 1 |
| Amyotrophic Lateral Sclerosis A degenerative disorder affecting upper MOTOR NEURONS in the brain and lower motor neurons in the brain stem and SPINAL CORD. Disease onset is usually after the age of 50 and the process is usually fatal within 3 to 6 years. Clinical manifestations include progressive weakness, atrophy, FASCICULATION, hyperreflexia, DYSARTHRIA, dysphagia, and eventual paralysis of respiratory function. Pathologic features include the replacement of motor neurons with fibrous ASTROCYTES and atrophy of anterior SPINAL NERVE ROOTS and corticospinal tracts. (From Adams et al., Principles of Neurology, 6th ed, pp1089-94) | 0 | 8.97 | 31 | 1 |
| Body Weight The mass or quantity of heaviness of an individual. It is expressed by units of pounds or kilograms. | 0 | 5.96 | 24 | 1 |
| Innate Inflammatory Response [description not available] | 0 | 13.19 | 100 | 2 |
| Inflammation A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function. | 0 | 13.19 | 100 | 2 |
| Aging The gradual irreversible changes in structure and function of an organism that occur as a result of the passage of time. | 0 | 7.58 | 37 | 0 |
| E chaffeensis Infection [description not available] | 0 | 2.31 | 1 | 0 |
| Becker Muscular Dystrophy [description not available] | 0 | 20.75 | 179 | 84 |
| Muscular Dystrophy, Duchenne An X-linked recessive muscle disease caused by an inability to synthesize DYSTROPHIN, which is involved with maintaining the integrity of the sarcolemma. Muscle fibers undergo a process that features degeneration and regeneration. Clinical manifestations include proximal weakness in the first few years of life, pseudohypertrophy, cardiomyopathy (see MYOCARDIAL DISEASES), and an increased incidence of impaired mentation. Becker muscular dystrophy is a closely related condition featuring a later onset of disease (usually adolescence) and a slowly progressive course. (Adams et al., Principles of Neurology, 6th ed, p1415) | 0 | 20.75 | 179 | 84 |
| Alcoholic Liver Diseases [description not available] | 0 | 3.51 | 2 | 0 |
| Alcohol Drinking Behaviors associated with the ingesting of ALCOHOLIC BEVERAGES, including social drinking. | 0 | 2.96 | 4 | 0 |
| Liver Diseases, Alcoholic Liver diseases associated with ALCOHOLISM. It usually refers to the coexistence of two or more subentities, i.e., ALCOHOLIC FATTY LIVER; ALCOHOLIC HEPATITIS; and ALCOHOLIC CIRRHOSIS. | 0 | 3.51 | 2 | 0 |
| Akinetic-Rigid Variant of Huntington Disease [description not available] | 0 | 10.22 | 34 | 2 |
| Huntington Disease A familial disorder inherited as an autosomal dominant trait and characterized by the onset of progressive CHOREA and DEMENTIA in the fourth or fifth decade of life. Common initial manifestations include paranoia; poor impulse control; DEPRESSION; HALLUCINATIONS; and DELUSIONS. Eventually intellectual impairment; loss of fine motor control; ATHETOSIS; and diffuse chorea involving axial and limb musculature develops, leading to a vegetative state within 10-15 years of disease onset. The juvenile variant has a more fulminant course including SEIZURES; ATAXIA; dementia; and chorea. (From Adams et al., Principles of Neurology, 6th ed, pp1060-4) | 0 | 10.22 | 34 | 2 |
| Cryptosporidium Infection [description not available] | 0 | 2.74 | 3 | 0 |
| Cryptosporidiosis Intestinal infection with organisms of the genus CRYPTOSPORIDIUM. It occurs in both animals and humans. Symptoms include severe DIARRHEA. | 0 | 2.74 | 3 | 0 |
| Malignant Melanoma [description not available] | 0 | 9.99 | 43 | 4 |
| Melanoma A malignant neoplasm derived from cells that are capable of forming melanin, which may occur in the skin of any part of the body, in the eye, or, rarely, in the mucous membranes of the genitalia, anus, oral cavity, or other sites. It occurs mostly in adults and may originate de novo or from a pigmented nevus or malignant lentigo. Melanomas frequently metastasize widely, and the regional lymph nodes, liver, lungs, and brain are likely to be involved. The incidence of malignant skin melanomas is rising rapidly in all parts of the world. (Stedman, 25th ed; from Rook et al., Textbook of Dermatology, 4th ed, p2445) | 0 | 9.99 | 43 | 4 |
| Infections, Pneumococcal [description not available] | 0 | 2.73 | 3 | 0 |
| Pneumococcal Infections Infections with bacteria of the species STREPTOCOCCUS PNEUMONIAE. | 0 | 2.73 | 3 | 0 |
| Experimental Neoplasms [description not available] | 0 | 7.43 | 46 | 0 |
| Scoliosis An appreciable lateral deviation in the normally straight vertical line of the spine. (Dorland, 27th ed) | 0 | 4.06 | 11 | 0 |
| Clinically Isolated CNS Demyelinating Syndrome [description not available] | 0 | 2.72 | 3 | 0 |
| Allergic Encephalomyelitis [description not available] | 0 | 3.31 | 6 | 0 |
| Graft-Versus-Host Disease [description not available] | 0 | 2.79 | 3 | 0 |
| Demyelinating Diseases Diseases characterized by loss or dysfunction of myelin in the central or peripheral nervous system. | 0 | 2.72 | 3 | 0 |
| Graft vs Host Disease The clinical entity characterized by anorexia, diarrhea, loss of hair, leukopenia, thrombocytopenia, growth retardation, and eventual death brought about by the GRAFT VS HOST REACTION. | 0 | 2.79 | 3 | 0 |
| Debility [description not available] | 0 | 2.41 | 1 | 0 |
| Grippe [description not available] | 0 | 5.2 | 18 | 0 |
| Influenza, Human An acute viral infection in humans involving the respiratory tract. It is marked by inflammation of the NASAL MUCOSA; the PHARYNX; and conjunctiva, and by headache and severe, often generalized, myalgia. | 0 | 5.2 | 18 | 0 |
| 6th Nerve Palsy [description not available] | 0 | 2.41 | 1 | 0 |
| Tauopathies Neurodegenerative disorders involving deposition of abnormal tau protein isoforms (TAU PROTEINS) in neurons and glial cells in the brain. Pathological aggregations of tau proteins are associated with mutation of the tau gene on chromosome 17 in patients with ALZHEIMER DISEASE; DEMENTIA; PARKINSONIAN DISORDERS; progressive supranuclear palsy (SUPRANUCLEAR PALSY, PROGRESSIVE); and corticobasal degeneration. | 0 | 3.81 | 2 | 0 |
| Degenerative Diseases, Central Nervous System [description not available] | 0 | 7.27 | 21 | 0 |
| Neurodegenerative Diseases Hereditary and sporadic conditions which are characterized by progressive nervous system dysfunction. These disorders are often associated with atrophy of the affected central or peripheral nervous system structures. | 0 | 7.27 | 21 | 0 |
| Injuries, Radiation [description not available] | 0 | 2.31 | 1 | 0 |
| Central Nervous System Disease [description not available] | 0 | 4.6 | 3 | 0 |
| Central Nervous System Diseases Diseases of any component of the brain (including the cerebral hemispheres, diencephalon, brain stem, and cerebellum) or the spinal cord. | 0 | 4.6 | 3 | 0 |
| Congenital Myotonic Dystrophy [description not available] | 0 | 6.33 | 19 | 0 |
| Myotonic Dystrophy Neuromuscular disorder characterized by PROGRESSIVE MUSCULAR ATROPHY; MYOTONIA, and various multisystem atrophies. Mild INTELLECTUAL DISABILITY may also occur. Abnormal TRINUCLEOTIDE REPEAT EXPANSION in the 3' UNTRANSLATED REGIONS of DMPK PROTEIN gene is associated with Myotonic Dystrophy 1. DNA REPEAT EXPANSION of zinc finger protein-9 gene intron is associated with Myotonic Dystrophy 2. | 0 | 6.33 | 19 | 0 |
| Fibrodysplasia Ossificans Progressiva [description not available] | 0 | 2.53 | 2 | 0 |
| Ectopic Ossification [description not available] | 0 | 2.41 | 1 | 0 |
| Myositis Ossificans A disease characterized by bony deposits or the ossification of muscle tissue. | 0 | 2.53 | 2 | 0 |
| Atrophy, Muscle [description not available] | 0 | 3.66 | 3 | 0 |
| Muscular Atrophy Derangement in size and number of muscle fibers occurring with aging, reduction in blood supply, or following immobilization, prolonged weightlessness, malnutrition, and particularly in denervation. | 0 | 3.66 | 3 | 0 |
| MS (Multiple Sclerosis) [description not available] | 0 | 4.56 | 9 | 0 |
| Multiple Sclerosis An autoimmune disorder mainly affecting young adults and characterized by destruction of myelin in the central nervous system. Pathologic findings include multiple sharply demarcated areas of demyelination throughout the white matter of the central nervous system. Clinical manifestations include visual loss, extra-ocular movement disorders, paresthesias, loss of sensation, weakness, dysarthria, spasticity, ataxia, and bladder dysfunction. The usual pattern is one of recurrent attacks followed by partial recovery (see MULTIPLE SCLEROSIS, RELAPSING-REMITTING), but acute fulminating and chronic progressive forms (see MULTIPLE SCLEROSIS, CHRONIC PROGRESSIVE) also occur. (Adams et al., Principles of Neurology, 6th ed, p903) | 0 | 4.56 | 9 | 0 |
| Diseases, Metabolic [description not available] | 0 | 5.08 | 6 | 0 |
| Metabolic Diseases Generic term for diseases caused by an abnormal metabolic process. It can be congenital due to inherited enzyme abnormality (METABOLISM, INBORN ERRORS) or acquired due to disease of an endocrine organ or failure of a metabolically important organ such as the liver. (Stedman, 26th ed) | 0 | 5.08 | 6 | 0 |
| Retinal Diseases Diseases involving the RETINA. | 0 | 4.35 | 4 | 0 |
| Acute Kidney Failure [description not available] | 0 | 3.41 | 6 | 0 |
| Acute Kidney Injury Abrupt reduction in kidney function. Acute kidney injury encompasses the entire spectrum of the syndrome including acute kidney failure; ACUTE KIDNEY TUBULAR NECROSIS; and other less severe conditions. | 0 | 3.41 | 6 | 0 |
| Adverse Drug Event [description not available] | 0 | 8.77 | 10 | 3 |
| Drug-Related Side Effects and Adverse Reactions Disorders that result from the intended use of PHARMACEUTICAL PREPARATIONS. Included in this heading are a broad variety of chemically-induced adverse conditions due to toxicity, DRUG INTERACTIONS, and metabolic effects of pharmaceuticals. | 0 | 8.77 | 10 | 3 |
| Acute Liver Injury, Drug-Induced [description not available] | 0 | 5.53 | 14 | 0 |
| Chemical and Drug Induced Liver Injury A spectrum of clinical liver diseases ranging from mild biochemical abnormalities to ACUTE LIVER FAILURE, caused by drugs, drug metabolites, herbal and dietary supplements and chemicals from the environment. | 0 | 5.53 | 14 | 0 |
| Apolipoprotein B-100, Familial Defective [description not available] | 0 | 17.28 | 76 | 12 |
| Hyperlipoproteinemia Type II A group of familial disorders characterized by elevated circulating cholesterol contained in either LOW-DENSITY LIPOPROTEINS alone or also in VERY-LOW-DENSITY LIPOPROTEINS (pre-beta lipoproteins). | 0 | 17.28 | 76 | 12 |
| Alloxan Diabetes [description not available] | 0 | 4.74 | 11 | 0 |
| Asymmetric Diabetic Proximal Motor Neuropathy [description not available] | 0 | 9.12 | 6 | 4 |
| Diabetic Neuropathies Peripheral, autonomic, and cranial nerve disorders that are associated with DIABETES MELLITUS. These conditions usually result from diabetic microvascular injury involving small blood vessels that supply nerves (VASA NERVORUM). Relatively common conditions which may be associated with diabetic neuropathy include third nerve palsy (see OCULOMOTOR NERVE DISEASES); MONONEUROPATHY; mononeuropathy multiplex; diabetic amyotrophy; a painful POLYNEUROPATHY; autonomic neuropathy; and thoracoabdominal neuropathy. (From Adams et al., Principles of Neurology, 6th ed, p1325) | 0 | 9.12 | 6 | 4 |
| Thrombopenia [description not available] | 0 | 8.31 | 12 | 2 |
| Thrombocytopenia A subnormal level of BLOOD PLATELETS. | 0 | 8.31 | 12 | 2 |
| Friedreich Disease [description not available] | 0 | 3.53 | 7 | 0 |
| Friedreich Ataxia An autosomal recessive disease, usually of childhood onset, characterized pathologically by degeneration of the spinocerebellar tracts, posterior columns, and to a lesser extent the corticospinal tracts. Clinical manifestations include GAIT ATAXIA, pes cavus, speech impairment, lateral curvature of spine, rhythmic head tremor, kyphoscoliosis, congestive heart failure (secondary to a cardiomyopathy), and lower extremity weakness. Most forms of this condition are associated with a mutation in a gene on chromosome 9, at band q13, which codes for the mitochondrial protein frataxin. (From Adams et al., Principles of Neurology, 6th ed, p1081; N Engl J Med 1996 Oct 17;335(16):1169-75) The severity of Friedreich ataxia associated with expansion of GAA repeats in the first intron of the frataxin gene correlates with the number of trinucleotide repeats. (From Durr et al, N Engl J Med 1996 Oct 17;335(16):1169-75) | 0 | 3.53 | 7 | 0 |
| Angioedema, Hereditary [description not available] | 0 | 2.41 | 1 | 0 |
| Angioedemas, Hereditary Inherited disorders that are characterized by subcutaneous and submucosal EDEMA in the upper RESPIRATORY TRACT and GASTROINTESTINAL TRACT. | 0 | 2.41 | 1 | 0 |
| Hypertriglyceridemia A condition of elevated levels of TRIGLYCERIDES in the blood. | 0 | 18.12 | 24 | 7 |
| Food Poisoning [description not available] | 0 | 2.98 | 4 | 0 |
| Cancer of Pancreas [description not available] | 0 | 9.34 | 40 | 2 |
| Pancreatic Neoplasms Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA). | 0 | 9.34 | 40 | 2 |
| Fungal Diseases [description not available] | 0 | 3.88 | 4 | 0 |
| Mycoses Diseases caused by FUNGI. | 0 | 3.88 | 4 | 0 |
| Deficiency of GP 2b 3a Complex [description not available] | 0 | 2.44 | 2 | 0 |
| Disseminated Fungal Infection [description not available] | 0 | 2.41 | 1 | 0 |
| Cirrhosis, Liver [description not available] | 0 | 6.98 | 11 | 1 |
| Liver Cirrhosis Liver disease in which the normal microcirculation, the gross vascular anatomy, and the hepatic architecture have been variably destroyed and altered with fibrous septa surrounding regenerated or regenerating parenchymal nodules. | 0 | 6.98 | 11 | 1 |
| Infections, Coronavirus [description not available] | 0 | 7.07 | 11 | 0 |
| Coronavirus Infections Virus diseases caused by the CORONAVIRUS genus. Some specifics include transmissible enteritis of turkeys (ENTERITIS, TRANSMISSIBLE, OF TURKEYS); FELINE INFECTIOUS PERITONITIS; and transmissible gastroenteritis of swine (GASTROENTERITIS, TRANSMISSIBLE, OF SWINE). | 0 | 7.07 | 11 | 0 |
| Cancer of Lung [description not available] | 0 | 16.24 | 123 | 19 |
| Lung Neoplasms Tumors or cancer of the LUNG. | 0 | 16.24 | 123 | 19 |
| Nervous System Disorders [description not available] | 0 | 6.63 | 16 | 0 |
| Nervous System Diseases Diseases of the central and peripheral nervous system. This includes disorders of the brain, spinal cord, cranial nerves, peripheral nerves, nerve roots, autonomic nervous system, neuromuscular junction, and muscle. | 0 | 6.63 | 16 | 0 |
| Atheroma [description not available] | 0 | 4.15 | 4 | 0 |
| Hyperlipemia [description not available] | 0 | 6.57 | 7 | 0 |
| Hyperlipidemias Conditions with excess LIPIDS in the blood. | 0 | 6.57 | 7 | 0 |
| Electrocardiogram QT Prolonged [description not available] | 0 | 2.41 | 1 | 0 |
| Long QT Syndrome A condition that is characterized by episodes of fainting (SYNCOPE) and varying degree of ventricular arrhythmia as indicated by the prolonged QT interval. The inherited forms are caused by mutation of genes encoding cardiac ion channel proteins. The two major forms are ROMANO-WARD SYNDROME and JERVELL-LANGE NIELSEN SYNDROME. | 0 | 2.41 | 1 | 0 |
| Recrudescence [description not available] | 0 | 8.87 | 20 | 7 |
| Acute Lymphoid Leukemia [description not available] | 0 | 7.24 | 20 | 2 |
| Precursor Cell Lymphoblastic Leukemia-Lymphoma A neoplasm characterized by abnormalities of the lymphoid cell precursors leading to excessive lymphoblasts in the marrow and other organs. It is the most common cancer in children and accounts for the vast majority of all childhood leukemias. | 0 | 7.24 | 20 | 2 |
| Idiopathic Parkinson Disease [description not available] | 0 | 5.75 | 13 | 0 |
| Parkinson Disease A progressive, degenerative neurologic disease characterized by a TREMOR that is maximal at rest, retropulsion (i.e. a tendency to fall backwards), rigidity, stooped posture, slowness of voluntary movements, and a masklike facial expression. Pathologic features include loss of melanin containing neurons in the substantia nigra and other pigmented nuclei of the brainstem. LEWY BODIES are present in the substantia nigra and locus coeruleus but may also be found in a related condition (LEWY BODY DISEASE, DIFFUSE) characterized by dementia in combination with varying degrees of parkinsonism. (Adams et al., Principles of Neurology, 6th ed, p1059, pp1067-75) | 0 | 5.75 | 13 | 0 |
| Local Neoplasm Recurrence [description not available] | 0 | 10.85 | 15 | 9 |
| Pregnancy The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH. | 0 | 8.12 | 91 | 0 |
| Carcinogenesis The origin, production or development of cancer through genotypic and phenotypic changes which upset the normal balance between cell proliferation and cell death. Carcinogenesis generally requires a constellation of steps, which may occur quickly or over a period of many years. | 0 | 6.4 | 24 | 0 |
| Polyneuropathy, Acquired [description not available] | 0 | 11.5 | 12 | 6 |
| Polyneuropathies Diseases of multiple peripheral nerves simultaneously. Polyneuropathies usually are characterized by symmetrical, bilateral distal motor and sensory impairment with a graded increase in severity distally. The pathological processes affecting peripheral nerves include degeneration of the axon, myelin or both. The various forms of polyneuropathy are categorized by the type of nerve affected (e.g., sensory, motor, or autonomic), by the distribution of nerve injury (e.g., distal vs. proximal), by nerve component primarily affected (e.g., demyelinating vs. axonal), by etiology, or by pattern of inheritance. | 0 | 11.5 | 12 | 6 |
| Ache [description not available] | 0 | 9.39 | 12 | 4 |
| Pain An unpleasant sensation induced by noxious stimuli which are detected by NERVE ENDINGS of NOCICEPTIVE NEURONS. | 0 | 14.39 | 12 | 4 |
| Acute Confusional Senile Dementia [description not available] | 0 | 6.24 | 22 | 0 |
| Alzheimer Disease A degenerative disease of the BRAIN characterized by the insidious onset of DEMENTIA. Impairment of MEMORY, judgment, attention span, and problem solving skills are followed by severe APRAXIAS and a global loss of cognitive abilities. The condition primarily occurs after age 60, and is marked pathologically by severe cortical atrophy and the triad of SENILE PLAQUES; NEUROFIBRILLARY TANGLES; and NEUROPIL THREADS. (From Adams et al., Principles of Neurology, 6th ed, pp1049-57) | 0 | 6.24 | 22 | 0 |
| HPV Infection [description not available] | 0 | 3.71 | 9 | 0 |
| Carcinoma, Epidermoid [description not available] | 0 | 9.63 | 39 | 3 |
| Cancer of Cervix [description not available] | 0 | 5.43 | 23 | 0 |
| Carcinoma, Squamous Cell A carcinoma derived from stratified SQUAMOUS EPITHELIAL CELLS. It may also occur in sites where glandular or columnar epithelium is normally present. (From Stedman, 25th ed) | 0 | 9.63 | 39 | 3 |
| Uterine Cervical Neoplasms Tumors or cancer of the UTERINE CERVIX. | 0 | 5.43 | 23 | 0 |
| Papillomavirus Infections Neoplasms of the skin and mucous membranes caused by papillomaviruses. They are usually benign but some have a high risk for malignant progression. | 0 | 3.71 | 9 | 0 |
| Disease Exacerbation [description not available] | 0 | 17.1 | 85 | 30 |
| Orphan Diseases Rare diseases that have not been well studied. | 0 | 5.39 | 8 | 0 |
| Inborn Errors of Metabolism [description not available] | 0 | 3.36 | 2 | 0 |
| Metabolism, Inborn Errors Errors in metabolic processes resulting from inborn genetic mutations that are inherited or acquired in utero. | 0 | 3.36 | 2 | 0 |
| Infections, Staphylococcal [description not available] | 0 | 3.52 | 7 | 0 |
| Staphylococcal Infections Infections with bacteria of the genus STAPHYLOCOCCUS. | 0 | 3.52 | 7 | 0 |
| Chronic Kidney Diseases [description not available] | 0 | 2.89 | 3 | 0 |
| Cirrhosis [description not available] | 0 | 9.01 | 27 | 1 |
| Ureteral Obstruction Blockage in any part of the URETER causing obstruction of urine flow from the kidney to the URINARY BLADDER. The obstruction may be congenital, acquired, unilateral, bilateral, complete, partial, acute, or chronic. Depending on the degree and duration of the obstruction, clinical features vary greatly such as HYDRONEPHROSIS and obstructive nephropathy. | 0 | 2.82 | 3 | 0 |
| Fibrosis Any pathological condition where fibrous connective tissue invades any organ, usually as a consequence of inflammation or other injury. | 0 | 9.01 | 27 | 1 |
| Renal Insufficiency, Chronic Conditions in which the KIDNEYS perform below the normal level for more than three months. Chronic kidney insufficiency is classified by five stages according to the decline in GLOMERULAR FILTRATION RATE and the degree of kidney damage (as measured by the level of PROTEINURIA). The most severe form is the end-stage renal disease (CHRONIC KIDNEY FAILURE). (Kidney Foundation: Kidney Disease Outcome Quality Initiative, 2002) | 0 | 2.89 | 3 | 0 |
| Acute Myelogenous Leukemia [description not available] | 0 | 10.44 | 32 | 5 |
| Leukemia, Myeloid, Acute Clonal expansion of myeloid blasts in bone marrow, blood, and other tissue. Myeloid leukemias develop from changes in cells that normally produce NEUTROPHILS; BASOPHILS; EOSINOPHILS; and MONOCYTES. | 0 | 10.44 | 32 | 5 |
| Cancer of Stomach [description not available] | 0 | 4.48 | 22 | 0 |
| Stomach Neoplasms Tumors or cancer of the STOMACH. | 0 | 4.48 | 22 | 0 |
| Brittle Bone Disease [description not available] | 0 | 2.43 | 2 | 0 |
| Osteogenesis Imperfecta COLLAGEN DISEASES characterized by brittle, osteoporotic, and easily fractured bones. It may also present with blue sclerae, loose joints, and imperfect dentin formation. Most types are autosomal dominant and are associated with mutations in COLLAGEN TYPE I. | 0 | 2.43 | 2 | 0 |
| Endometrioma An enlarged area of ENDOMETRIOSIS that resembles a tumor. It is usually found in the OVARY. When it is filled with old blood, it is known as a chocolate cyst. | 0 | 2.52 | 2 | 0 |
| Endometriosis A condition in which functional endometrial tissue is present outside the UTERUS. It is often confined to the PELVIS involving the OVARY, the ligaments, cul-de-sac, and the uterovesical peritoneum. | 0 | 2.52 | 2 | 0 |
| Multiple Hemangioblastomas [description not available] | 0 | 2.41 | 1 | 0 |
| Benign Cerebellar Neoplasms [description not available] | 0 | 2.57 | 2 | 0 |
| Angiomatosis Retinae [description not available] | 0 | 2.52 | 2 | 0 |
| von Hippel-Lindau Disease An autosomal dominant disorder caused by mutations in a tumor suppressor gene. This syndrome is characterized by abnormal growth of small blood vessels leading to a host of neoplasms. They include HEMANGIOBLASTOMA in the RETINA; CEREBELLUM; and SPINAL CORD; PHEOCHROMOCYTOMA; pancreatic tumors; and renal cell carcinoma (see CARCINOMA, RENAL CELL). Common clinical signs include HYPERTENSION and neurological dysfunctions. | 0 | 2.52 | 2 | 0 |
| Hemangioblastoma A benign tumor of the nervous system that may occur sporadically or in association with VON HIPPEL-LINDAU DISEASE. It accounts for approximately 2% of intracranial tumors, arising most frequently in the cerebellar hemispheres and vermis. Histologically, the tumors are composed of multiple capillary and sinusoidal channels lined with endothelial cells and clusters of lipid-laden pseudoxanthoma cells. Usually solitary, these tumors can be multiple and may also occur in the brain stem, spinal cord, retina, and supratentorial compartment. Cerebellar hemangioblastomas usually present in the third decade with INTRACRANIAL HYPERTENSION, and ataxia. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, pp2071-2) | 0 | 2.41 | 1 | 0 |
| Cystic Fibrosis of Pancreas [description not available] | 0 | 8.08 | 38 | 1 |
| Cystic Fibrosis An autosomal recessive genetic disease of the EXOCRINE GLANDS. It is caused by mutations in the gene encoding the CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR expressed in several organs including the LUNG, the PANCREAS, the BILIARY SYSTEM, and the SWEAT GLANDS. Cystic fibrosis is characterized by epithelial secretory dysfunction associated with ductal obstruction resulting in AIRWAY OBSTRUCTION; chronic RESPIRATORY INFECTIONS; PANCREATIC INSUFFICIENCY; maldigestion; salt depletion; and HEAT PROSTRATION. | 0 | 13.08 | 38 | 1 |
| Chromosomal Translocation [description not available] | 0 | 12.3 | 39 | 1 |
| Cardiac Failure [description not available] | 0 | 7.14 | 10 | 0 |
| Heart Failure A heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (VENTRICULAR DYSFUNCTION), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as MYOCARDIAL INFARCTION. | 0 | 12.14 | 10 | 0 |
| Hypertrophy General increase in bulk of a part or organ due to CELL ENLARGEMENT and accumulation of FLUIDS AND SECRETIONS, not due to tumor formation, nor to an increase in the number of cells (HYPERPLASIA). | 0 | 2.9 | 3 | 0 |
| Carcinoma, Non-Small Cell Lung [description not available] | 0 | 14.59 | 58 | 17 |
| Carcinoma, Non-Small-Cell Lung A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy. | 0 | 14.59 | 58 | 17 |
| Elevated Cholesterol [description not available] | 0 | 12.88 | 31 | 6 |
| Hypercholesterolemia A condition with abnormally high levels of CHOLESTEROL in the blood. It is defined as a cholesterol value exceeding the 95th percentile for the population. | 0 | 12.88 | 31 | 6 |
| Liver Dysfunction [description not available] | 0 | 5.94 | 10 | 0 |
| Liver Diseases Pathological processes of the LIVER. | 0 | 5.94 | 10 | 0 |
| Infections, Helicobacter [description not available] | 0 | 3.6 | 8 | 0 |
| Helicobacter Infections Infections with organisms of the genus HELICOBACTER, particularly, in humans, HELICOBACTER PYLORI. The clinical manifestations are focused in the stomach, usually the gastric mucosa and antrum, and the upper duodenum. This infection plays a major role in the pathogenesis of type B gastritis and peptic ulcer disease. | 0 | 3.6 | 8 | 0 |
| Amyloidosis A group of sporadic, familial and/or inherited, degenerative, and infectious disease processes, linked by the common theme of abnormal protein folding and deposition of AMYLOID. As the amyloid deposits enlarge they displace normal tissue structures, causing disruption of function. Various signs and symptoms depend on the location and size of the deposits. | 0 | 7.61 | 14 | 0 |
| Glial Cell Tumors [description not available] | 0 | 6.22 | 31 | 1 |
| Glioma Benign and malignant central nervous system neoplasms derived from glial cells (i.e., astrocytes, oligodendrocytes, and ependymocytes). Astrocytes may give rise to astrocytomas (ASTROCYTOMA) or glioblastoma multiforme (see GLIOBLASTOMA). Oligodendrocytes give rise to oligodendrogliomas (OLIGODENDROGLIOMA) and ependymocytes may undergo transformation to become EPENDYMOMA; CHOROID PLEXUS NEOPLASMS; or colloid cysts of the third ventricle. (From Escourolle et al., Manual of Basic Neuropathology, 2nd ed, p21) | 0 | 11.22 | 31 | 1 |
| Apnea, Central [description not available] | 0 | 2.6 | 1 | 0 |
| Sleep Apnea, Central A condition associated with multiple episodes of sleep apnea which are distinguished from obstructive sleep apnea (SLEEP APNEA, OBSTRUCTIVE) by the complete cessation of efforts to breathe. This disorder is associated with dysfunction of central nervous system centers that regulate respiration. | 0 | 2.6 | 1 | 0 |
| Acute-On-Chronic Liver Failure (ACLF) [description not available] | 0 | 3.33 | 1 | 0 |
| Acute-On-Chronic Liver Failure Sudden liver failure in the presence of underlying compensated chronic LIVER DISEASE (e.g., LIVER CIRRHOSIS; HEPATITIS; and liver injury and failure) due to a precipitating acute hepatic insult. | 0 | 3.33 | 1 | 0 |
| Kidney Failure A severe irreversible decline in the ability of kidneys to remove wastes, concentrate URINE, and maintain ELECTROLYTE BALANCE; BLOOD PRESSURE; and CALCIUM metabolism. | 0 | 3.55 | 2 | 0 |
| Focal Segmental Glomerulosclerosis [description not available] | 0 | 3.99 | 4 | 0 |
| Glomerulosclerosis, Focal Segmental A clinicopathological syndrome or diagnostic term for a type of glomerular injury that has multiple causes, primary or secondary. Clinical features include PROTEINURIA, reduced GLOMERULAR FILTRATION RATE, and EDEMA. Kidney biopsy initially indicates focal segmental glomerular consolidation (hyalinosis) or scarring which can progress to globally sclerotic glomeruli leading to eventual KIDNEY FAILURE. | 0 | 3.99 | 4 | 0 |
| Nephrotic Syndrome A condition characterized by severe PROTEINURIA, greater than 3.5 g/day in an average adult. The substantial loss of protein in the urine results in complications such as HYPOPROTEINEMIA; generalized EDEMA; HYPERTENSION; and HYPERLIPIDEMIAS. Diseases associated with nephrotic syndrome generally cause chronic kidney dysfunction. | 0 | 2.73 | 3 | 0 |
| Renal Insufficiency Conditions in which the KIDNEYS perform below the normal level in the ability to remove wastes, concentrate URINE, and maintain ELECTROLYTE BALANCE; BLOOD PRESSURE; and CALCIUM metabolism. Renal insufficiency can be classified by the degree of kidney damage (as measured by the level of PROTEINURIA) and reduction in GLOMERULAR FILTRATION RATE. | 0 | 3.55 | 2 | 0 |
| Cytomegalic Inclusion Disease [description not available] | 0 | 3.86 | 12 | 0 |
| Cytomegalovirus Infections Infection with CYTOMEGALOVIRUS, characterized by enlarged cells bearing intranuclear inclusions. Infection may be in almost any organ, but the salivary glands are the most common site in children, as are the lungs in adults. | 0 | 3.86 | 12 | 0 |
| Cytomegalovirus A genus of the family HERPESVIRIDAE, subfamily BETAHERPESVIRINAE, infecting the salivary glands, liver, spleen, lungs, eyes, and other organs, in which they produce characteristically enlarged cells with intranuclear inclusions. Infection with Cytomegalovirus is also seen as an opportunistic infection in AIDS. | 0 | 9.52 | 24 | 0 |
| Colorectal Cancer [description not available] | 0 | 11.84 | 55 | 5 |
| Colorectal Neoplasms Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI. | 0 | 11.84 | 55 | 5 |
| Cancer of Skin [description not available] | 0 | 9.83 | 38 | 2 |
| Skin Neoplasms Tumors or cancer of the SKIN. | 0 | 9.83 | 38 | 2 |
| Congenital Zika Syndrome [description not available] | 0 | 4.02 | 9 | 0 |
| Break-Bone Fever [description not available] | 0 | 5.11 | 15 | 0 |
| Zika Virus Infection A viral disease transmitted by the bite of AEDES mosquitoes infected with ZIKA VIRUS. Its mild DENGUE-like symptoms include fever, rash, headaches and ARTHRALGIA. The viral infection during pregnancy, in rare cases, is associated with congenital brain and ocular abnormalities, called Congenital Zika Syndrome, including MICROCEPHALY and may also lead to GUILLAIN-BARRE SYNDROME. | 0 | 4.02 | 9 | 0 |
| Dengue An acute febrile disease transmitted by the bite of AEDES mosquitoes infected with DENGUE VIRUS. It is self-limiting and characterized by fever, myalgia, headache, and rash. SEVERE DENGUE is a more virulent form of dengue. | 0 | 5.11 | 15 | 0 |
| Hepatocellular Carcinoma [description not available] | 0 | 10.66 | 74 | 1 |
| Cancer of Liver [description not available] | 0 | 10.74 | 80 | 1 |
| Carcinoma, Hepatocellular A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested. | 0 | 10.66 | 74 | 1 |
| Liver Neoplasms Tumors or cancer of the LIVER. | 0 | 10.74 | 80 | 1 |
| Disease, Pulmonary [description not available] | 0 | 5.3 | 8 | 0 |
| Lung Diseases Pathological processes involving any part of the LUNG. | 0 | 5.3 | 8 | 0 |
| Bilharziasis [description not available] | 0 | 2.6 | 1 | 0 |
| Anguilluliasis [description not available] | 0 | 2.6 | 1 | 0 |
| Schistosomiasis Infection with flukes (trematodes) of the genus SCHISTOSOMA. Three species produce the most frequent clinical diseases: SCHISTOSOMA HAEMATOBIUM (endemic in Africa and the Middle East), SCHISTOSOMA MANSONI (in Egypt, northern and southern Africa, some West Indies islands, northern 2/3 of South America), and SCHISTOSOMA JAPONICUM (in Japan, China, the Philippines, Celebes, Thailand, Laos). S. mansoni is often seen in Puerto Ricans living in the United States. | 0 | 2.6 | 1 | 0 |
| Strongyloidiasis Infection with nematodes of the genus STRONGYLOIDES. The presence of larvae may produce pneumonitis and the presence of adult worms in the intestine could lead to moderate to severe diarrhea. | 0 | 2.6 | 1 | 0 |
| Leucocythaemia [description not available] | 0 | 7.62 | 33 | 1 |
| Leukemia A progressive, malignant disease of the blood-forming organs, characterized by distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemias were originally termed acute or chronic based on life expectancy but now are classified according to cellular maturity. Acute leukemias consist of predominately immature cells; chronic leukemias are composed of more mature cells. (From The Merck Manual, 2006) | 0 | 12.62 | 33 | 1 |
| Brain Disorders [description not available] | 0 | 8.48 | 7 | 0 |
| Brain Diseases Pathologic conditions affecting the BRAIN, which is composed of the intracranial components of the CENTRAL NERVOUS SYSTEM. This includes (but is not limited to) the CEREBRAL CORTEX; intracranial white matter; BASAL GANGLIA; THALAMUS; HYPOTHALAMUS; BRAIN STEM; and CEREBELLUM. | 0 | 3.48 | 7 | 0 |
| Ischemia A hypoperfusion of the BLOOD through an organ or tissue caused by a PATHOLOGIC CONSTRICTION or obstruction of its BLOOD VESSELS, or an absence of BLOOD CIRCULATION. | 0 | 15.19 | 25 | 4 |
| Cancer of Ovary [description not available] | 0 | 6.98 | 27 | 1 |
| Ovarian Neoplasms Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS. | 0 | 6.98 | 27 | 1 |
| Anemia A reduction in the number of circulating ERYTHROCYTES or in the quantity of HEMOGLOBIN. | 0 | 4.07 | 4 | 0 |
| Rheumatoid Arthritis [description not available] | 0 | 5.96 | 18 | 0 |
| Arthritis, Rheumatoid A chronic systemic disease, primarily of the joints, marked by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures. Etiology is unknown, but autoimmune mechanisms have been implicated. | 0 | 5.96 | 18 | 0 |
| Infections, Pseudomonas [description not available] | 0 | 3.07 | 4 | 0 |
| Pseudomonas Infections Infections with bacteria of the genus PSEUDOMONAS. | 0 | 3.07 | 4 | 0 |
| Cardiovascular Stroke [description not available] | 0 | 9.13 | 23 | 2 |
| Myocardial Infarction NECROSIS of the MYOCARDIUM caused by an obstruction of the blood supply to the heart (CORONARY CIRCULATION). | 0 | 14.13 | 23 | 2 |
| Arthritides, Bacterial [description not available] | 0 | 2.6 | 1 | 0 |
| Vibrio cholerae Infection [description not available] | 0 | 2.45 | 2 | 0 |
| Cholera An acute diarrheal disease endemic in India and Southeast Asia whose causative agent is VIBRIO CHOLERAE. This condition can lead to severe dehydration in a matter of hours unless quickly treated. | 0 | 2.45 | 2 | 0 |
| Diarrhea An increased liquidity or decreased consistency of FECES, such as running stool. Fecal consistency is related to the ratio of water-holding capacity of insoluble solids to total water, rather than the amount of water present. Diarrhea is not hyperdefecation or increased fecal weight. | 0 | 5.99 | 5 | 2 |
| Diabetes Mellitus A heterogeneous group of disorders characterized by HYPERGLYCEMIA and GLUCOSE INTOLERANCE. | 0 | 5.02 | 8 | 0 |
| Carcinoma, Ductal, Pancreatic [description not available] | 0 | 4.45 | 4 | 1 |
| Carcinoma, Pancreatic Ductal Carcinoma that arises from the PANCREATIC DUCTS. It accounts for the majority of cancers derived from the PANCREAS. | 0 | 4.45 | 4 | 1 |
| Fatty Liver, Nonalcoholic [description not available] | 0 | 4.36 | 6 | 0 |
| Non-alcoholic Fatty Liver Disease Fatty liver finding without excessive ALCOHOL CONSUMPTION. | 0 | 4.36 | 6 | 0 |
| Age-Related Osteoporosis [description not available] | 0 | 2.85 | 3 | 0 |
| Osteoporosis Reduction of bone mass without alteration in the composition of bone, leading to fractures. Primary osteoporosis can be of two major types: postmenopausal osteoporosis (OSTEOPOROSIS, POSTMENOPAUSAL) and age-related or senile osteoporosis. | 0 | 2.85 | 3 | 0 |
| Blood Poisoning [description not available] | 0 | 4.57 | 9 | 0 |
| Endotoxin Shock [description not available] | 0 | 2.77 | 3 | 0 |
| Shock, Septic Sepsis associated with HYPOTENSION or hypoperfusion despite adequate fluid resuscitation. Perfusion abnormalities may include but are not limited to LACTIC ACIDOSIS; OLIGURIA; or acute alteration in mental status. | 0 | 2.77 | 3 | 0 |
| Sepsis Systemic inflammatory response syndrome with a proven or suspected infectious etiology. When sepsis is associated with organ dysfunction distant from the site of infection, it is called severe sepsis. When sepsis is accompanied by HYPOTENSION despite adequate fluid infusion, it is called SEPTIC SHOCK. | 0 | 4.57 | 9 | 0 |
| Chronic Illness [description not available] | 0 | 5.15 | 17 | 0 |
| Pain, Chronic [description not available] | 0 | 2.66 | 2 | 0 |
| Nerve Pain [description not available] | 0 | 3.24 | 5 | 0 |
| Chronic Disease Diseases which have one or more of the following characteristics: they are permanent, leave residual disability, are caused by nonreversible pathological alteration, require special training of the patient for rehabilitation, or may be expected to require a long period of supervision, observation, or care (Dictionary of Health Services Management, 2d ed). For epidemiological studies chronic disease often includes HEART DISEASES; STROKE; CANCER; and diabetes (DIABETES MELLITUS, TYPE 2). | 0 | 5.15 | 17 | 0 |
| Neuralgia Intense or aching pain that occurs along the course or distribution of a peripheral or cranial nerve. | 0 | 3.24 | 5 | 0 |
| Chronic Pain Aching sensation that persists for more than a few months. It may or may not be associated with trauma or disease, and may persist after the initial injury has healed. Its localization, character, and timing are more vague than with acute pain. | 0 | 2.66 | 2 | 0 |
| Dyslipidemia [description not available] | 0 | 10.89 | 17 | 3 |
| Dyslipidemias Abnormalities in the serum levels of LIPIDS, including overproduction or deficiency. Abnormal serum lipid profiles may include high total CHOLESTEROL, high TRIGLYCERIDES, low HIGH DENSITY LIPOPROTEIN CHOLESTEROL, and elevated LOW DENSITY LIPOPROTEIN CHOLESTEROL. | 0 | 10.89 | 17 | 3 |
| Dental Plaque A film that attaches to teeth, often causing DENTAL CARIES and GINGIVITIS. It is composed of MUCINS, secreted from salivary glands, and microorganisms. | 0 | 2.6 | 1 | 0 |
| Pericementitis [description not available] | 0 | 3.51 | 2 | 0 |
| Periodontitis Inflammation and loss of connective tissues supporting or surrounding the teeth. This may involve any part of the PERIODONTIUM. Periodontitis is currently classified by disease progression (CHRONIC PERIODONTITIS; AGGRESSIVE PERIODONTITIS) instead of age of onset. (From 1999 International Workshop for a Classification of Periodontal Diseases and Conditions, American Academy of Periodontology) | 0 | 3.51 | 2 | 0 |
| Infections, Respiratory Syncytial Virus [description not available] | 0 | 3.21 | 5 | 0 |
| Respiratory Syncytial Virus Infections Pneumovirus infections caused by the RESPIRATORY SYNCYTIAL VIRUSES. Humans and cattle are most affected but infections in goats and sheep have been reported. | 0 | 3.21 | 5 | 0 |
| Alveolar Bone Atrophy [description not available] | 0 | 3.52 | 1 | 0 |
| Fra(X) Syndrome [description not available] | 0 | 6.4 | 18 | 0 |
| Fragile X Syndrome A condition characterized genotypically by mutation of the distal end of the long arm of the X chromosome (at gene loci FRAXA or FRAXE) and phenotypically by cognitive impairment, hyperactivity, SEIZURES, language delay, and enlargement of the ears, head, and testes. INTELLECTUAL DISABILITY occurs in nearly all males and roughly 50% of females with the full mutation of FRAXA. (From Menkes, Textbook of Child Neurology, 5th ed, p226) | 0 | 6.4 | 18 | 0 |
| Amaurosis [description not available] | 0 | 2.6 | 1 | 0 |
| Blindness The inability to see or the loss or absence of perception of visual stimuli. This condition may be the result of EYE DISEASES; OPTIC NERVE DISEASES; OPTIC CHIASM diseases; or BRAIN DISEASES affecting the VISUAL PATHWAYS or OCCIPITAL LOBE. | 0 | 2.6 | 1 | 0 |
| Diabetic Retinopathy Disease of the RETINA as a complication of DIABETES MELLITUS. It is characterized by the progressive microvascular complications, such as ANEURYSM, interretinal EDEMA, and intraocular PATHOLOGIC NEOVASCULARIZATION. | 0 | 12.52 | 21 | 16 |
| Deficiency, Glucosephosphatase [description not available] | 0 | 3.01 | 2 | 0 |
| Glycogen Storage Disease Type I An autosomal recessive disease in which gene expression of glucose-6-phosphatase is absent, resulting in hypoglycemia due to lack of glucose production. Accumulation of glycogen in liver and kidney leads to organomegaly, particularly massive hepatomegaly. Increased concentrations of lactic acid and hyperlipidemia appear in the plasma. Clinical gout often appears in early childhood. | 0 | 3.01 | 2 | 0 |
| Enteric Fever [description not available] | 0 | 3.31 | 6 | 0 |
| Typhoid Fever An acute systemic febrile infection caused by SALMONELLA TYPHI, a serotype of SALMONELLA ENTERICA. | 0 | 3.31 | 6 | 0 |
| Cane-Cutter Fever [description not available] | 0 | 2.6 | 1 | 0 |
| Leptospirosis Infections with bacteria of the genus LEPTOSPIRA. | 0 | 2.6 | 1 | 0 |
| Agyria-Pachygyria-Band Spectrum [description not available] | 0 | 2.6 | 1 | 0 |
| Neoplasms, Squamous Cell Neoplasms of the SQUAMOUS EPITHELIAL CELLS. The concept does not refer to neoplasms located in tissue composed of squamous elements. | 0 | 2.6 | 1 | 0 |
| Carcinoma, Intraepithelial [description not available] | 0 | 2.49 | 2 | 0 |
| Carcinoma in Situ A lesion with cytological characteristics associated with invasive carcinoma but the tumor cells are confined to the epithelium of origin, without invasion of the basement membrane. | 0 | 2.49 | 2 | 0 |
| Infectious Diseases [description not available] | 0 | 7.75 | 14 | 1 |
| Congenital Infection, Toxoplasma gondii [description not available] | 0 | 2.6 | 1 | 0 |
| Communicable Diseases An illness caused by an infectious agent or its toxins that occurs through the direct or indirect transmission of the infectious agent or its products from an infected individual or via an animal, vector or the inanimate environment to a susceptible animal or human host. | 0 | 7.75 | 14 | 1 |
| Toxoplasmosis, Congenital Prenatal protozoal infection with TOXOPLASMA gondii which is associated with injury to the developing fetal nervous system. The severity of this condition is related to the stage of pregnancy during which the infection occurs; first trimester infections are associated with a greater degree of neurologic dysfunction. Clinical features include HYDROCEPHALUS; MICROCEPHALY; deafness; cerebral calcifications; SEIZURES; and psychomotor retardation. Signs of a systemic infection may also be present at birth, including fever, rash, and hepatosplenomegaly. (From Adams et al., Principles of Neurology, 6th ed, p735) | 0 | 2.6 | 1 | 0 |
| Cancer of Endometrium [description not available] | 0 | 4.52 | 5 | 1 |
| Endometrial Neoplasms Tumors or cancer of ENDOMETRIUM, the mucous lining of the UTERUS. These neoplasms can be benign or malignant. Their classification and grading are based on the various cell types and the percent of undifferentiated cells. | 0 | 4.52 | 5 | 1 |
| Disease A definite pathologic process with a characteristic set of signs and symptoms. It may affect the whole body or any of its parts, and its etiology, pathology, and prognosis may be known or unknown. | 0 | 4.1 | 5 | 0 |
| Dry Eye [description not available] | 0 | 3.6 | 2 | 0 |
| Dry Eye Syndromes Corneal and conjunctival dryness due to deficient tear production, predominantly in menopausal and post-menopausal women. Filamentary keratitis or erosion of the conjunctival and corneal epithelium may be caused by these disorders. Sensation of the presence of a foreign body in the eye and burning of the eyes may occur. | 0 | 3.6 | 2 | 0 |
| Complication, Postoperative [description not available] | 0 | 8.21 | 12 | 2 |
| Agitated Emergence [description not available] | 0 | 2.6 | 1 | 0 |
| Postoperative Complications Pathologic processes that affect patients after a surgical procedure. They may or may not be related to the disease for which the surgery was done, and they may or may not be direct results of the surgery. | 0 | 8.21 | 12 | 2 |
| Deficiency, Mental [description not available] | 0 | 2.8 | 3 | 0 |
| Abnormalities, Congenital, Nervous System [description not available] | 0 | 2.5 | 2 | 0 |
| Absence Seizure [description not available] | 0 | 2.78 | 3 | 0 |
| Intellectual Disability Subnormal intellectual functioning which originates during the developmental period. This has multiple potential etiologies, including genetic defects and perinatal insults. Intelligence quotient (IQ) scores are commonly used to determine whether an individual has an intellectual disability. IQ scores between 70 and 79 are in the borderline range. Scores below 67 are in the disabled range. (from Joynt, Clinical Neurology, 1992, Ch55, p28) | 0 | 2.8 | 3 | 0 |
| Seizures Clinical or subclinical disturbances of cortical function due to a sudden, abnormal, excessive, and disorganized discharge of brain cells. Clinical manifestations include abnormal motor, sensory and psychic phenomena. Recurrent seizures are usually referred to as EPILEPSY or seizure disorder. | 0 | 2.78 | 3 | 0 |
| Fasting Hypoglycemia HYPOGLYCEMIA expressed in the postabsorptive state, after prolonged FASTING, or an overnight fast. | 0 | 2.6 | 1 | 0 |
| Hypoglycemia A syndrome of abnormally low BLOOD GLUCOSE level. Clinical hypoglycemia has diverse etiologies. Severe hypoglycemia eventually lead to glucose deprivation of the CENTRAL NERVOUS SYSTEM resulting in HUNGER; SWEATING; PARESTHESIA; impaired mental function; SEIZURES; COMA; and even DEATH. | 0 | 2.6 | 1 | 0 |
| Chickungunya Fever [description not available] | 0 | 2.6 | 1 | 0 |
| Libman-Sacks Disease [description not available] | 0 | 12.58 | 50 | 4 |
| Lupus Erythematosus, Systemic A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys, and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow. | 0 | 12.58 | 50 | 4 |
| Cardiac Hypertrophy Enlargement of the HEART due to chamber HYPERTROPHY, an increase in wall thickness without an increase in the number of cells (MYOCYTES, CARDIAC). It is the result of increase in myocyte size, mitochondrial and myofibrillar mass, as well as changes in extracellular matrix. | 0 | 4.49 | 8 | 0 |
| Cardiomegaly Enlargement of the HEART, usually indicated by a cardiothoracic ratio above 0.50. Heart enlargement may involve the right, the left, or both HEART VENTRICLES or HEART ATRIA. Cardiomegaly is a nonspecific symptom seen in patients with chronic systolic heart failure (HEART FAILURE) or several forms of CARDIOMYOPATHIES. | 0 | 4.49 | 8 | 0 |
| Aortic Stenosis [description not available] | 0 | 3.86 | 3 | 0 |
| Calcification, Pathologic [description not available] | 0 | 4.04 | 4 | 0 |
| Aortic Valve Stenosis A pathological constriction that can occur above (supravalvular stenosis), below (subvalvular stenosis), or at the AORTIC VALVE. It is characterized by restricted outflow from the LEFT VENTRICLE into the AORTA. | 0 | 3.86 | 3 | 0 |
| Calcinosis Pathologic deposition of calcium salts in tissues. | 0 | 4.04 | 4 | 0 |
| ANS (Autonomic Nervous System) Diseases [description not available] | 0 | 3.12 | 1 | 0 |
| Infections, Respiratory [description not available] | 0 | 3.04 | 4 | 0 |
| Respiratory Tract Infections Invasion of the host RESPIRATORY SYSTEM by microorganisms, usually leading to pathological processes or diseases. | 0 | 3.04 | 4 | 0 |
| Cronobacter Infections [description not available] | 0 | 2.21 | 1 | 0 |
| Enterobacteriaceae Infections Infections with bacteria of the family ENTEROBACTERIACEAE. | 0 | 2.21 | 1 | 0 |
| Asthma, Bronchial [description not available] | 0 | 10.48 | 29 | 2 |
| Asthma A form of bronchial disorder with three distinct components: airway hyper-responsiveness (RESPIRATORY HYPERSENSITIVITY), airway INFLAMMATION, and intermittent AIRWAY OBSTRUCTION. It is characterized by spasmodic contraction of airway smooth muscle, WHEEZING, and dyspnea (DYSPNEA, PAROXYSMAL). | 0 | 15.48 | 29 | 2 |
| Autoimmune Diabetes [description not available] | 0 | 4.95 | 14 | 0 |
| Diabetes Mellitus, Type 1 A subtype of DIABETES MELLITUS that is characterized by INSULIN deficiency. It is manifested by the sudden onset of severe HYPERGLYCEMIA, rapid progression to DIABETIC KETOACIDOSIS, and DEATH unless treated with insulin. The disease may occur at any age, but is most common in childhood or adolescence. | 0 | 4.95 | 14 | 0 |
| Kidney, Polycystic [description not available] | 0 | 2.21 | 1 | 0 |
| Polycystic Kidney Diseases Hereditary diseases that are characterized by the progressive expansion of a large number of tightly packed CYSTS within the KIDNEYS. They include diseases with autosomal dominant and autosomal recessive inheritance. | 0 | 2.21 | 1 | 0 |
| Thrombocythemia [description not available] | 0 | 3.07 | 4 | 0 |
| Blood Clot [description not available] | 0 | 6.23 | 18 | 0 |
| Thrombosis Formation and development of a thrombus or blood clot in the blood vessel. | 0 | 6.23 | 18 | 0 |
| Genome Instability [description not available] | 0 | 6.24 | 22 | 0 |
| Chronic Hepatitis B [description not available] | 0 | 6.25 | 6 | 2 |
| Hepatitis B, Chronic INFLAMMATION of the LIVER in humans caused by HEPATITIS B VIRUS lasting six months or more. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact. | 0 | 6.25 | 6 | 2 |
| Hematologic Malignancies [description not available] | 0 | 4.1 | 5 | 0 |
| Myeloproliferative Disorders Conditions which cause proliferation of hemopoietically active tissue or of tissue which has embryonic hemopoietic potential. They all involve dysregulation of multipotent MYELOID PROGENITOR CELLS, most often caused by a mutation in the JAK2 PROTEIN TYROSINE KINASE. | 0 | 5.17 | 10 | 0 |
| Hematologic Neoplasms Neoplasms located in the blood and blood-forming tissue (the bone marrow and lymphatic tissue). The commonest forms are the various types of LEUKEMIA, of LYMPHOMA, and of the progressive, life-threatening forms of the MYELODYSPLASTIC SYNDROMES. | 0 | 4.1 | 5 | 0 |
| Tuberculosis, Drug-Resistant [description not available] | 0 | 4.29 | 18 | 0 |
| Tuberculosis, Multidrug-Resistant Tuberculosis resistant to chemotherapy with two or more ANTITUBERCULAR AGENTS, including at least ISONIAZID and RIFAMPICIN. The problem of resistance is particularly troublesome in tuberculous OPPORTUNISTIC INFECTIONS associated with HIV INFECTIONS. It requires the use of second line drugs which are more toxic than the first line regimens. TB with isolates that have developed further resistance to at least three of the six classes of second line drugs is defined as EXTENSIVELY DRUG-RESISTANT TUBERCULOSIS. | 0 | 4.29 | 18 | 0 |
| Infections, Orthomyxoviridae [description not available] | 0 | 3.35 | 6 | 0 |
| Orthomyxoviridae Infections Virus diseases caused by the ORTHOMYXOVIRIDAE. | 0 | 3.35 | 6 | 0 |
| Genetic Predisposition [description not available] | 0 | 7.07 | 29 | 0 |
| Lassitude [description not available] | 0 | 5.5 | 5 | 3 |
| Fatigue The state of weariness following a period of exertion, mental or physical, characterized by a decreased capacity for work and reduced efficiency to respond to stimuli. | 0 | 5.5 | 5 | 3 |
| Acute Hypercapnic Respiratory Failure [description not available] | 0 | 5.08 | 5 | 0 |
| Respiratory Insufficiency Failure to adequately provide oxygen to cells of the body and to remove excess carbon dioxide from them. (Stedman, 25th ed) | 0 | 5.08 | 5 | 0 |
| Injuries, Spinal Cord [description not available] | 0 | 3.18 | 5 | 0 |
| Spinal Cord Injuries Penetrating and non-penetrating injuries to the spinal cord resulting from traumatic external forces (e.g., WOUNDS, GUNSHOT; WHIPLASH INJURIES; etc.). | 0 | 3.18 | 5 | 0 |
| Cancer of Colon [description not available] | 0 | 7.71 | 58 | 1 |
| Colonic Neoplasms Tumors or cancer of the COLON. | 0 | 7.71 | 58 | 1 |
| Cardiomyopathies, Primary [description not available] | 0 | 8.5 | 9 | 1 |
| Cardiomyopathies A group of diseases in which the dominant feature is the involvement of the CARDIAC MUSCLE itself. Cardiomyopathies are classified according to their predominant pathophysiological features (DILATED CARDIOMYOPATHY; HYPERTROPHIC CARDIOMYOPATHY; RESTRICTIVE CARDIOMYOPATHY) or their etiological/pathological factors (CARDIOMYOPATHY, ALCOHOLIC; ENDOCARDIAL FIBROELASTOSIS). | 0 | 8.5 | 9 | 1 |
| ER-Negative PR-Negative HER2-Negative Breast Cancer [description not available] | 0 | 3.41 | 6 | 0 |
| Triple Negative Breast Neoplasms Breast neoplasms that do not express ESTROGEN RECEPTORS; PROGESTERONE RECEPTORS; and do not overexpress the NEU RECEPTOR/HER-2 PROTO-ONCOGENE PROTEIN. | 0 | 3.41 | 6 | 0 |
| Hemorrhagic Thrombocythemia [description not available] | 0 | 7.98 | 6 | 2 |
| Thrombocythemia, Essential A clinical syndrome characterized by repeated spontaneous hemorrhages and a remarkable increase in the number of circulating platelets. | 0 | 7.98 | 6 | 2 |
| Genetic Diseases [description not available] | 0 | 7.59 | 23 | 0 |
| Adult Neuronal Ceroid Lipofuscinosis [description not available] | 0 | 2.52 | 2 | 0 |
| Neuronal Ceroid-Lipofuscinoses A group of severe neurodegenerative diseases characterized by intracellular accumulation of autofluorescent wax-like lipid materials (CEROID; LIPOFUSCIN) in neurons. There are several subtypes based on mutations of the various genes, time of disease onset, and severity of the neurological defects such as progressive DEMENTIA; SEIZURES; and visual failure. | 0 | 2.52 | 2 | 0 |
| Genetic Diseases, Inborn Diseases that are caused by genetic mutations present during embryo or fetal development, although they may be observed later in life. The mutations may be inherited from a parent's genome or they may be acquired in utero. | 0 | 7.59 | 23 | 0 |
| Diffuse Mixed Small and Large Cell Lymphoma [description not available] | 0 | 5.65 | 13 | 0 |
| Lymphoma, Non-Hodgkin Any of a group of malignant tumors of lymphoid tissue that differ from HODGKIN DISEASE, being more heterogeneous with respect to malignant cell lineage, clinical course, prognosis, and therapy. The only common feature among these tumors is the absence of giant REED-STERNBERG CELLS, a characteristic of Hodgkin's disease. | 0 | 5.65 | 13 | 0 |
| Anemia With Multinucleated Erythroblasts [description not available] | 0 | 2.25 | 1 | 0 |
| Glomerulonephritis, Lupus [description not available] | 0 | 10.63 | 20 | 4 |
| Lupus Nephritis Glomerulonephritis associated with autoimmune disease SYSTEMIC LUPUS ERYTHEMATOSUS. Lupus nephritis is histologically classified into 6 classes: class I - normal glomeruli, class II - pure mesangial alterations, class III - focal segmental glomerulonephritis, class IV - diffuse glomerulonephritis, class V - diffuse membranous glomerulonephritis, and class VI - advanced sclerosing glomerulonephritis (The World Health Organization classification 1982). | 0 | 10.63 | 20 | 4 |
| Colitis, Granulomatous [description not available] | 0 | 10.57 | 21 | 6 |
| Crohn Disease A chronic transmural inflammation that may involve any part of the DIGESTIVE TRACT from MOUTH to ANUS, mostly found in the ILEUM, the CECUM, and the COLON. In Crohn disease, the inflammation, extending through the intestinal wall from the MUCOSA to the serosa, is characteristically asymmetric and segmental. Epithelioid GRANULOMAS may be seen in some patients. | 0 | 10.57 | 21 | 6 |
| Ambulation Difficulty [description not available] | 0 | 12.79 | 26 | 26 |
| Metastase [description not available] | 0 | 12.09 | 53 | 8 |
| Neoplasm Metastasis The transfer of a neoplasm from one organ or part of the body to another remote from the primary site. | 0 | 12.09 | 53 | 8 |
| Germinoblastoma [description not available] | 0 | 8.96 | 25 | 4 |
| Lymphoma A general term for various neoplastic diseases of the lymphoid tissue. | 0 | 8.96 | 25 | 4 |
| Decreased Muscle Tone [description not available] | 0 | 2.66 | 2 | 0 |
| Congenital Hand Deformities [description not available] | 0 | 2.25 | 1 | 0 |
| Infections, Salmonella [description not available] | 0 | 2.82 | 3 | 0 |
| E coli Infections [description not available] | 0 | 3.52 | 8 | 0 |
| Escherichia coli Infections Infections with bacteria of the species ESCHERICHIA COLI. | 0 | 3.52 | 8 | 0 |
| Arrhythmia [description not available] | 0 | 5.35 | 4 | 0 |
| AL Amyloidosis [description not available] | 0 | 4.99 | 2 | 0 |
| Immunoglobulin Light-chain Amyloidosis A nonproliferative disorder of the PLASMA CELL characterized by excessive production and misfolding of IMMUNOGLOBULIN LIGHT CHAINS that form insoluble amyloid fibrils (see AMYLOID DEPOSITS) in various tissues. Clinical features include LIVER FAILURE; MULTIPLE MYELOMA; NEPHROTIC SYNDROME; RESTRICTIVE CARDIOMYOPATHY, and neuropathies. | 0 | 4.99 | 2 | 0 |
| Arrhythmias, Cardiac Any disturbances of the normal rhythmic beating of the heart or MYOCARDIAL CONTRACTION. Cardiac arrhythmias can be classified by the abnormalities in HEART RATE, disorders of electrical impulse generation, or impulse conduction. | 0 | 5.35 | 4 | 0 |
| DDPAC [description not available] | 0 | 3.66 | 8 | 0 |
| Frontotemporal Dementia The most common clinical form of FRONTOTEMPORAL LOBAR DEGENERATION, this dementia presents with personality and behavioral changes often associated with disinhibition, apathy, and lack of insight. | 0 | 3.66 | 8 | 0 |
| Bordetella pertussis Infection, Respiratory [description not available] | 0 | 2.42 | 2 | 0 |
| Whooping Cough A respiratory infection caused by BORDETELLA PERTUSSIS and characterized by paroxysmal coughing ending in a prolonged crowing intake of breath. | 0 | 2.42 | 2 | 0 |
| Cancer of Mouth [description not available] | 0 | 4.18 | 6 | 0 |
| Mouth Neoplasms Tumors or cancer of the MOUTH. | 0 | 4.18 | 6 | 0 |
| Chronic Hepatitis C [description not available] | 0 | 9.29 | 13 | 6 |
| Hepatitis C, Chronic INFLAMMATION of the LIVER in humans that is caused by HEPATITIS C VIRUS lasting six months or more. Chronic hepatitis C can lead to LIVER CIRRHOSIS. | 0 | 9.29 | 13 | 6 |
| Pneumonia, Viral Inflammation of the lung parenchyma that is caused by a viral infection. | 0 | 6.85 | 9 | 0 |
| Bowel Diseases, Inflammatory [description not available] | 0 | 6.34 | 11 | 0 |
| Inflammatory Bowel Diseases Chronic, non-specific inflammation of the GASTROINTESTINAL TRACT. Etiology may be genetic or environmental. This term includes CROHN DISEASE and ULCERATIVE COLITIS. | 0 | 6.34 | 11 | 0 |
| Human T-lymphotropic Virus 1 Infection [description not available] | 0 | 4.03 | 5 | 0 |
| HTLV-I Infections Diseases caused by HUMAN T-LYMPHOTROPIC VIRUS 1. | 0 | 4.03 | 5 | 0 |
| Canine Diseases [description not available] | 0 | 4.68 | 6 | 1 |
| Trypanosomiasis Infection with protozoa of the genus TRYPANOSOMA. | 0 | 2.25 | 1 | 0 |
| Cardiac Remodeling, Ventricular [description not available] | 0 | 3.81 | 10 | 0 |
| Injury, Ischemia-Reperfusion [description not available] | 0 | 5.06 | 15 | 0 |
| Reperfusion Injury Adverse functional, metabolic, or structural changes in tissues that result from the restoration of blood flow to the tissue (REPERFUSION) following ISCHEMIA. | 0 | 5.06 | 15 | 0 |
| Erythrohepatic Protoporphyria [description not available] | 0 | 2.25 | 1 | 0 |
| Protoporphyria, Erythropoietic An autosomal dominant porphyria that is due to a deficiency of FERROCHELATASE (heme synthetase) in both the LIVER and the BONE MARROW, the last enzyme in the 8-enzyme biosynthetic pathway of HEME. Clinical features include mainly neurological symptoms, rarely cutaneous lesions, and elevated levels of protoporphyrin and COPROPORPHYRINS in the feces. | 0 | 2.25 | 1 | 0 |
| Bronchopulmonary Dysplasia A chronic lung disease developed after OXYGEN INHALATION THERAPY or mechanical ventilation (VENTILATION, MECHANICAL) usually occurring in certain premature infants (INFANT, PREMATURE) or newborn infants with respiratory distress syndrome (RESPIRATORY DISTRESS SYNDROME, NEWBORN). Histologically, it is characterized by the unusual abnormalities of the bronchioles, such as METAPLASIA, decrease in alveolar number, and formation of CYSTS. | 0 | 2.25 | 1 | 0 |
| Minimal Disease, Residual [description not available] | 0 | 5.24 | 18 | 0 |
| Appetite Disorders [description not available] | 0 | 2.4 | 2 | 0 |
| Dysphagia [description not available] | 0 | 2.25 | 1 | 0 |
| Feeding and Eating Disorders A group of disorders characterized by physiological and psychological disturbances in appetite or food intake. | 0 | 2.4 | 2 | 0 |
| Deglutition Disorders Difficulty in SWALLOWING which may result from neuromuscular disorder or mechanical obstruction. Dysphagia is classified into two distinct types: oropharyngeal dysphagia due to malfunction of the PHARYNX and UPPER ESOPHAGEAL SPHINCTER; and esophageal dysphagia due to malfunction of the ESOPHAGUS. | 0 | 2.25 | 1 | 0 |
| Acid Alpha-Glucosidase Deficiency [description not available] | 0 | 3.71 | 3 | 0 |
| Diseases of Immune System [description not available] | 0 | 4.97 | 6 | 0 |
| Amyotonia Congenita [description not available] | 0 | 4.31 | 3 | 0 |
| Glycogen Storage Disease Type II An autosomal recessively inherited glycogen storage disease caused by GLUCAN 1,4-ALPHA-GLUCOSIDASE deficiency. Large amounts of GLYCOGEN accumulate in the LYSOSOMES of skeletal muscle (MUSCLE, SKELETAL); HEART; LIVER; SPINAL CORD; and BRAIN. Three forms have been described: infantile, childhood, and adult. The infantile form is fatal in infancy and presents with hypotonia and a hypertrophic cardiomyopathy (CARDIOMYOPATHY, HYPERTROPHIC). The childhood form usually presents in the second year of life with proximal weakness and respiratory symptoms. The adult form consists of a slowly progressive proximal myopathy. (From Muscle Nerve 1995;3:S61-9; Menkes, Textbook of Child Neurology, 5th ed, pp73-4) | 0 | 3.71 | 3 | 0 |
| Immune System Diseases Disorders caused by abnormal or absent immunologic mechanisms, whether humoral, cell-mediated, or both. | 0 | 4.97 | 6 | 0 |
| Neuromuscular Diseases A general term encompassing lower MOTOR NEURON DISEASE; PERIPHERAL NERVOUS SYSTEM DISEASES; and certain MUSCULAR DISEASES. Manifestations include MUSCLE WEAKNESS; FASCICULATION; muscle ATROPHY; SPASM; MYOKYMIA; MUSCLE HYPERTONIA, myalgias, and MUSCLE HYPOTONIA. | 0 | 4.31 | 3 | 0 |
| Cytokine Release Syndrome A severe immune reaction characterized by excessive release of CYTOKINES. Symptoms include DYSPNEA; FEVER; HEADACHE; HYPOTENSION; NAUSEA; RASH; TACHYCARDIA; HYPOXIA; HYPERFERRITINEMIA, and MULTIPLE ORGAN FAILURE. It is associated with viral infections, SEPSIS; AUTOIMMUNE DISEASES and a variety of factors used in IMMUNOTHERAPY. | 0 | 4.08 | 1 | 0 |
| Sarcopenia Progressive decline in muscle mass due to aging which results in decreased functional capacity of muscles. | 0 | 2.25 | 1 | 0 |
| Acute Edematous Pancreatitis [description not available] | 0 | 5.65 | 9 | 0 |
| Pancreatitis INFLAMMATION of the PANCREAS. Pancreatitis is classified as acute unless there are computed tomographic or endoscopic retrograde cholangiopancreatographic findings of CHRONIC PANCREATITIS (International Symposium on Acute Pancreatitis, Atlanta, 1992). The two most common forms of acute pancreatitis are ALCOHOLIC PANCREATITIS and gallstone pancreatitis. | 0 | 5.65 | 9 | 0 |
| Respiration Disorders Diseases of the respiratory system in general or unspecified or for a specific respiratory disease not available. | 0 | 2.25 | 1 | 0 |
| Cardiac Diseases [description not available] | 0 | 6.41 | 5 | 1 |
| Dermatoses [description not available] | 0 | 5.14 | 7 | 0 |
| Heart Diseases Pathological conditions involving the HEART including its structural and functional abnormalities. | 0 | 6.41 | 5 | 1 |
| Osteomyelitis INFLAMMATION of the bone as a result of infection. It may be caused by a variety of infectious agents, especially pyogenic (PUS - producing) BACTERIA. | 0 | 2.25 | 1 | 0 |
| Skin Diseases Diseases involving the DERMIS or EPIDERMIS. | 0 | 5.14 | 7 | 0 |
| Bladder Cancer [description not available] | 0 | 9.88 | 13 | 0 |
| Invasiveness, Neoplasm [description not available] | 0 | 9.39 | 31 | 2 |
| Urinary Bladder Neoplasms Tumors or cancer of the URINARY BLADDER. | 0 | 4.88 | 13 | 0 |
| Bilateral Headache [description not available] | 0 | 4.55 | 1 | 1 |
| Leukocytosis A transient increase in the number of leukocytes in a body fluid. | 0 | 4.55 | 1 | 1 |
| Headache The symptom of PAIN in the cranial region. It may be an isolated benign occurrence or manifestation of a wide variety of HEADACHE DISORDERS. | 0 | 4.55 | 1 | 1 |
| Muscular Weakness [description not available] | 0 | 4.55 | 1 | 1 |
| Muscle Weakness A vague complaint of debility, fatigue, or exhaustion attributable to weakness of various muscles. The weakness can be characterized as subacute or chronic, often progressive, and is a manifestation of many muscle and neuromuscular diseases. (From Wyngaarden et al., Cecil Textbook of Medicine, 19th ed, p2251) | 0 | 4.55 | 1 | 1 |
| Acute Coronary Syndrome An episode of MYOCARDIAL ISCHEMIA that generally lasts longer than a transient anginal episode that ultimately may lead to MYOCARDIAL INFARCTION. | 0 | 5.89 | 4 | 2 |
| Carcinoma, Ductal, Breast An invasive (infiltrating) CARCINOMA of the mammary ductal system (MAMMARY GLANDS) in the human BREAST. | 0 | 5.03 | 3 | 1 |
| Adenocarcinoma, Basal Cell [description not available] | 0 | 10.04 | 45 | 4 |
| Adenocarcinoma A malignant epithelial tumor with a glandular organization. | 0 | 10.04 | 45 | 4 |
| Dissociation [description not available] | 0 | 2.25 | 1 | 0 |
| Aseptic Meningitis [description not available] | 0 | 2.44 | 2 | 0 |
| Meningitis, Aseptic A syndrome characterized by headache, neck stiffness, low grade fever, and CSF lymphocytic pleocytosis in the absence of an acute bacterial pathogen. Viral meningitis is the most frequent cause although MYCOPLASMA INFECTIONS; RICKETTSIA INFECTIONS; diagnostic or therapeutic procedures; NEOPLASTIC PROCESSES; septic perimeningeal foci; and other conditions may result in this syndrome. (From Adams et al., Principles of Neurology, 6th ed, p745) | 0 | 2.44 | 2 | 0 |
| Dermatomyositis, Adult Type [description not available] | 0 | 3.7 | 1 | 1 |
| Dermatomyositis A subacute or chronic inflammatory disease of muscle and skin, marked by proximal muscle weakness and a characteristic skin rash. The illness occurs with approximately equal frequency in children and adults. The skin lesions usually take the form of a purplish rash (or less often an exfoliative dermatitis) involving the nose, cheeks, forehead, upper trunk, and arms. The disease is associated with a complement mediated intramuscular microangiopathy, leading to loss of capillaries, muscle ischemia, muscle-fiber necrosis, and perifascicular atrophy. The childhood form of this disease tends to evolve into a systemic vasculitis. Dermatomyositis may occur in association with malignant neoplasms. (From Adams et al., Principles of Neurology, 6th ed, pp1405-6) | 0 | 3.7 | 1 | 1 |
| Angiogenesis, Pathologic [description not available] | 0 | 10.65 | 42 | 1 |
| Dysmyelopoietic Syndromes [description not available] | 0 | 7.4 | 9 | 1 |
| Myelodysplastic Syndromes Clonal hematopoietic stem cell disorders characterized by dysplasia in one or more hematopoietic cell lineages. They predominantly affect patients over 60, are considered preleukemic conditions, and have high probability of transformation into ACUTE MYELOID LEUKEMIA. | 0 | 7.4 | 9 | 1 |
| Lipodystrophy A collection of heterogenous conditions resulting from defective LIPID METABOLISM and characterized by ADIPOSE TISSUE atrophy. Often there is redistribution of body fat resulting in peripheral fat wasting and central adiposity. They include generalized, localized, congenital, and acquired lipodystrophy. | 0 | 3.17 | 1 | 0 |
| Obesity A status with BODY WEIGHT that is grossly above the recommended standards, usually due to accumulation of excess FATS in the body. The standards may vary with age, sex, genetic or cultural background. In the BODY MASS INDEX, a BMI greater than 30.0 kg/m2 is considered obese, and a BMI greater than 40.0 kg/m2 is considered morbidly obese (MORBID OBESITY). | 0 | 7.41 | 16 | 1 |
| Muscular Dystrophy [description not available] | 0 | 9.8 | 7 | 0 |
| Sclerosis A pathological process consisting of hardening or fibrosis of an anatomical structure, often a vessel or a nerve. | 0 | 2.52 | 2 | 0 |
| Muscular Dystrophies A heterogeneous group of inherited MYOPATHIES, characterized by wasting and weakness of the SKELETAL MUSCLE. They are categorized by the sites of MUSCLE WEAKNESS; AGE OF ONSET; and INHERITANCE PATTERNS. | 0 | 4.8 | 7 | 0 |
| T-Cell Lymphoma [description not available] | 0 | 7.71 | 3 | 0 |
| Lymphoma, T-Cell A group of heterogeneous lymphoid tumors representing malignant transformations of T-lymphocytes. | 0 | 2.71 | 3 | 0 |
| Diabetes Mellitus, Adult-Onset [description not available] | 0 | 5.39 | 13 | 0 |
| Diabetes Mellitus, Type 2 A subclass of DIABETES MELLITUS that is not INSULIN-responsive or dependent (NIDDM). It is characterized initially by INSULIN RESISTANCE and HYPERINSULINEMIA; and eventually by GLUCOSE INTOLERANCE; HYPERGLYCEMIA; and overt diabetes. Type II diabetes mellitus is no longer considered a disease exclusively found in adults. Patients seldom develop KETOSIS but often exhibit OBESITY. | 0 | 5.39 | 13 | 0 |
| Insulin Sensitivity [description not available] | 0 | 6.36 | 14 | 1 |
| Insulin Resistance Diminished effectiveness of INSULIN in lowering blood sugar levels: requiring the use of 200 units or more of insulin per day to prevent HYPERGLYCEMIA or KETOSIS. | 0 | 6.36 | 14 | 1 |
| Acute Respiratory Distress Syndrome [description not available] | 0 | 2.44 | 2 | 0 |
| Respiratory Distress Syndrome A syndrome characterized by progressive life-threatening RESPIRATORY INSUFFICIENCY in the absence of known LUNG DISEASES, usually following a systemic insult such as surgery or major TRAUMA. | 0 | 2.44 | 2 | 0 |
| B. burgdorferi Infection [description not available] | 0 | 3.26 | 6 | 0 |
| Lyme Disease An infectious disease caused by a spirochete, BORRELIA BURGDORFERI, which is transmitted chiefly by Ixodes dammini (see IXODES) and pacificus ticks in the United States and Ixodes ricinis (see IXODES) in Europe. It is a disease with early and late cutaneous manifestations plus involvement of the nervous system, heart, eye, and joints in variable combinations. The disease was formerly known as Lyme arthritis and first discovered at Old Lyme, Connecticut. | 0 | 8.26 | 6 | 0 |
| Mycoplasma dispar Infection [description not available] | 0 | 2.73 | 3 | 0 |
| Hypercoagulability [description not available] | 0 | 3.88 | 4 | 0 |
| Thrombophilia A disorder of HEMOSTASIS in which there is a tendency for the occurrence of THROMBOSIS. | 0 | 3.88 | 4 | 0 |
| Osteoarthritis of Knee [description not available] | 0 | 2.31 | 1 | 0 |
| ACL Injuries [description not available] | 0 | 2.31 | 1 | 0 |
| Adjuvant Arthritis [description not available] | 0 | 3.42 | 7 | 0 |
| Osteoarthritis, Knee Noninflammatory degenerative disease of the knee joint consisting of three large categories: conditions that block normal synchronous movement, conditions that produce abnormal pathways of motion, and conditions that cause stress concentration resulting in changes to articular cartilage. (Crenshaw, Campbell's Operative Orthopaedics, 8th ed, p2019) | 0 | 2.31 | 1 | 0 |
| Carcinoma, Squamous Cell of Head and Neck [description not available] | 0 | 5.89 | 4 | 2 |
| Cell Transformation, Neoplastic Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill. | 0 | 8.59 | 58 | 0 |
| Squamous Cell Carcinoma of Head and Neck The most common type of head and neck carcinoma that originates from cells on the surface of the NASAL CAVITY; MOUTH; PARANASAL SINUSES, SALIVARY GLANDS, and LARYNX. Mutations in TNFRSF10B, PTEN, and ING1 genes are associated with this cancer. | 0 | 5.89 | 4 | 2 |
| Diffuse Large B-Cell Lymphoma [description not available] | 0 | 4.98 | 3 | 2 |
| Lymphoma, Large B-Cell, Diffuse Malignant lymphoma composed of large B lymphoid cells whose nuclear size can exceed normal macrophage nuclei, or more than twice the size of a normal lymphocyte. The pattern is predominantly diffuse. Most of these lymphomas represent the malignant counterpart of B-lymphocytes at midstage in the process of differentiation. | 0 | 4.98 | 3 | 2 |
| Apnea, Obstructive Sleep [description not available] | 0 | 2.25 | 1 | 0 |
| Sleep Apnea, Obstructive A disorder characterized by recurrent apneas during sleep despite persistent respiratory efforts. It is due to upper airway obstruction. The respiratory pauses may induce HYPERCAPNIA or HYPOXIA. Cardiac arrhythmias and elevation of systemic and pulmonary arterial pressures may occur. Frequent partial arousals occur throughout sleep, resulting in relative SLEEP DEPRIVATION and daytime tiredness. Associated conditions include OBESITY; ACROMEGALY; MYXEDEMA; micrognathia; MYOTONIC DYSTROPHY; adenotonsilar dystrophy; and NEUROMUSCULAR DISEASES. (From Adams et al., Principles of Neurology, 6th ed, p395) | 0 | 2.25 | 1 | 0 |
| Adhesions, Tissue [description not available] | 0 | 2.48 | 2 | 0 |
| Endometrial Diseases [description not available] | 0 | 2.78 | 3 | 0 |
| Uterine Diseases Pathological processes involving any part of the UTERUS. | 0 | 2.78 | 3 | 0 |
| Erythremia [description not available] | 0 | 5.93 | 3 | 1 |
| Polycythemia Vera A myeloproliferative disorder of unknown etiology, characterized by abnormal proliferation of all hematopoietic bone marrow elements and an absolute increase in red cell mass and total blood volume, associated frequently with splenomegaly, leukocytosis, and thrombocythemia. Hematopoiesis is also reactive in extramedullary sites (liver and spleen). In time myelofibrosis occurs. | 0 | 5.93 | 3 | 1 |
| Cerebral Infarction, Middle Cerebral Artery [description not available] | 0 | 2.83 | 3 | 0 |
| Infarction, Middle Cerebral Artery NECROSIS occurring in the MIDDLE CEREBRAL ARTERY distribution system which brings blood to the entire lateral aspects of each CEREBRAL HEMISPHERE. Clinical signs include impaired cognition; APHASIA; AGRAPHIA; weak and numbness in the face and arms, contralaterally or bilaterally depending on the infarction. | 0 | 2.83 | 3 | 0 |
| Pulmonary Arterial Remodeling [description not available] | 0 | 3.8 | 3 | 0 |
| Pulmonary Arterial Hypertension A progressive rare pulmonary disease characterized by high blood pressure in the PULMONARY ARTERY. | 0 | 3.17 | 1 | 0 |
| Skin Aging The process of aging due to changes in the structure and elasticity of the skin over time. It may be a part of physiological aging or it may be due to the effects of ultraviolet radiation, usually through exposure to sunlight. | 0 | 3.42 | 2 | 0 |
| Muscle Disorders [description not available] | 0 | 3.67 | 3 | 0 |
| Muscular Diseases Acquired, familial, and congenital disorders of SKELETAL MUSCLE and SMOOTH MUSCLE. | 0 | 3.67 | 3 | 0 |
| Fish Diseases Diseases of freshwater, marine, hatchery or aquarium fish. This term includes diseases of both teleosts (true fish) and elasmobranchs (sharks, rays and skates). | 0 | 3.52 | 8 | 0 |
| Bronze Diabetes [description not available] | 0 | 3.86 | 4 | 0 |
| Hemochromatosis A disorder of iron metabolism characterized by a triad of HEMOSIDEROSIS; LIVER CIRRHOSIS; and DIABETES MELLITUS. It is caused by massive iron deposits in parenchymal cells that may develop after a prolonged increase of iron absorption. (Jablonski's Dictionary of Syndromes & Eponymic Diseases, 2d ed) | 0 | 3.86 | 4 | 0 |
| alpha 1-Antitrypsin Deficiency Deficiency of the protease inhibitor ALPHA 1-ANTITRYPSIN that manifests primarily as PULMONARY EMPHYSEMA and LIVER CIRRHOSIS. | 0 | 9.15 | 6 | 0 |
| Aneurysm, Aortic [description not available] | 0 | 2.31 | 1 | 0 |
| Dilatation, Pathologic The condition of an anatomical structure's being dilated beyond normal dimensions. | 0 | 2.31 | 1 | 0 |
| Marfan Syndrome, Type I [description not available] | 0 | 2.72 | 2 | 0 |
| Aortic Aneurysm An abnormal balloon- or sac-like dilatation in the wall of AORTA. | 0 | 2.31 | 1 | 0 |
| Marfan Syndrome An autosomal dominant disorder of CONNECTIVE TISSUE with abnormal features in the heart, the eye, and the skeleton. Cardiovascular manifestations include MITRAL VALVE PROLAPSE, dilation of the AORTA, and aortic dissection. Other features include lens displacement (ectopia lentis), disproportioned long limbs and enlarged DURA MATER (dural ectasia). Marfan syndrome (type 1) is associated with mutations in the gene encoding FIBRILLIN-1 (FBN1), a major element of extracellular microfibrils of connective tissue. Mutations in the gene encoding TYPE II TGF-BETA RECEPTOR (TGFBR2) are associated with Marfan syndrome type 2. | 0 | 2.72 | 2 | 0 |
| Koch's Disease [description not available] | 0 | 6.67 | 51 | 0 |
| Tuberculosis Any of the infectious diseases of man and other animals caused by species of MYCOBACTERIUM TUBERCULOSIS. | 0 | 11.67 | 51 | 0 |
| Lung Adenocarcinoma [description not available] | 0 | 2.83 | 3 | 0 |
| Adenocarcinoma of Lung A carcinoma originating in the lung and the most common lung cancer type in never-smokers. Malignant cells exhibit distinct features such as glandular epithelial, or tubular morphology. Mutations in KRAS, EGFR, BRAF, and ERBB2 genes are associated with this cancer. | 0 | 2.83 | 3 | 0 |
| Anesthesia A state characterized by loss of feeling or sensation. This depression of nerve function is usually the result of pharmacologic action and is induced to allow performance of surgery or other painful procedures. | 0 | 2.52 | 2 | 0 |
| Chronic Hepatitis [description not available] | 0 | 3.36 | 2 | 0 |
| Hepatitis, Chronic INFLAMMATION of the LIVER with ongoing hepatocellular injury for 6 months or more, characterized by NECROSIS of HEPATOCYTES and inflammatory cell (LEUKOCYTES) infiltration. Chronic hepatitis can be caused by viruses, medications, autoimmune diseases, and other unknown factors. | 0 | 3.36 | 2 | 0 |
| Hepatitis, Viral, Non-A, Non-B, Parenterally-Transmitted [description not available] | 0 | 7.67 | 25 | 0 |
| Hepatitis C INFLAMMATION of the LIVER in humans caused by HEPATITIS C VIRUS, a single-stranded RNA virus. Its incubation period is 30-90 days. Hepatitis C is transmitted primarily by contaminated blood parenterally and is often associated with transfusion and intravenous drug abuse. However, in a significant number of cases, the source of hepatitis C infection is unknown. | 0 | 7.67 | 25 | 0 |
| Neovascularization, Optic Disc [description not available] | 0 | 8.03 | 6 | 2 |
| Retinal Neovascularization Formation of new blood vessels originating from the retinal veins and extending along the inner (vitreal) surface of the retina. | 0 | 8.03 | 6 | 2 |
| Diabetic Glomerulosclerosis [description not available] | 0 | 3.18 | 5 | 0 |
| Diabetic Nephropathies KIDNEY injuries associated with diabetes mellitus and affecting KIDNEY GLOMERULUS; ARTERIOLES; KIDNEY TUBULES; and the interstitium. Clinical signs include persistent PROTEINURIA, from microalbuminuria progressing to ALBUMINURIA of greater than 300 mg/24 h, leading to reduced GLOMERULAR FILTRATION RATE and END-STAGE RENAL DISEASE. | 0 | 3.18 | 5 | 0 |
| Myeloproliferative-Myelodisplastic Diseases [description not available] | 0 | 2.31 | 1 | 0 |
| Myelodysplastic-Myeloproliferative Diseases Clonal myeloid disorders that possess both dysplastic and proliferative features but are not properly classified as either MYELODYSPLASTIC SYNDROMES or MYELOPROLIFERATIVE DISORDERS. | 0 | 2.31 | 1 | 0 |
| Extravascular Hemolysis [description not available] | 0 | 3.96 | 13 | 0 |
| Hemolysis The destruction of ERYTHROCYTES by many different causal agents such as antibodies, bacteria, chemicals, temperature, and changes in tonicity. | 0 | 8.96 | 13 | 0 |
| Kahler Disease [description not available] | 0 | 5.99 | 26 | 0 |
| Multiple Myeloma A malignancy of mature PLASMA CELLS engaging in monoclonal immunoglobulin production. It is characterized by hyperglobulinemia, excess Bence-Jones proteins (free monoclonal IMMUNOGLOBULIN LIGHT CHAINS) in the urine, skeletal destruction, bone pain, and fractures. Other features include ANEMIA; HYPERCALCEMIA; and RENAL INSUFFICIENCY. | 0 | 5.99 | 26 | 0 |
| Depression, Involutional Form of depression in those MIDDLE AGE with feelings of ANXIETY. | 0 | 3.5 | 2 | 0 |
| Depressive Disorder, Major Disorder in which five (or more) of the following symptoms have been present during the same 2-week period and represent a change from previous functioning; at least one of the symptoms is either (1) depressed mood or (2) loss of interest or pleasure. Symptoms include: depressed mood most of the day, nearly every daily; markedly diminished interest or pleasure in activities most of the day, nearly every day; significant weight loss when not dieting or weight gain; Insomnia or hypersomnia nearly every day; psychomotor agitation or retardation nearly every day; fatigue or loss of energy nearly every day; feelings of worthlessness or excessive or inappropriate guilt; diminished ability to think or concentrate, or indecisiveness, nearly every day; or recurrent thoughts of death, recurrent suicidal ideation without a specific plan, or a suicide attempt. (DSM-5) | 0 | 3.5 | 2 | 0 |
| Psoriasis Arthropathica [description not available] | 0 | 2.49 | 2 | 0 |
| Arthritis, Psoriatic A type of inflammatory arthritis associated with PSORIASIS, often involving the axial joints and the peripheral terminal interphalangeal joints. It is characterized by the presence of HLA-B27-associated SPONDYLARTHROPATHY, and the absence of rheumatoid factor. | 0 | 2.49 | 2 | 0 |
| Carcinoma, Transitional Cell A malignant neoplasm derived from TRANSITIONAL EPITHELIAL CELLS, occurring chiefly in the URINARY BLADDER; URETERS; or RENAL PELVIS. | 0 | 4.18 | 3 | 1 |
| Left Ventricular Hypertrophy [description not available] | 0 | 3.08 | 4 | 0 |
| Hypertrophy, Left Ventricular Enlargement of the LEFT VENTRICLE of the heart. This increase in ventricular mass is attributed to sustained abnormal pressure or volume loads and is a contributor to cardiovascular morbidity and mortality. | 0 | 3.08 | 4 | 0 |
| Hepatitis INFLAMMATION of the LIVER. | 0 | 8.71 | 3 | 0 |
| Liver Steatosis [description not available] | 0 | 5.21 | 7 | 0 |
| Fatty Liver Lipid infiltration of the hepatic parenchymal cells resulting in a yellow-colored liver. The abnormal lipid accumulation is usually in the form of TRIGLYCERIDES, either as a single large droplet or multiple small droplets. Fatty liver is caused by an imbalance in the metabolism of FATTY ACIDS. | 0 | 5.21 | 7 | 0 |
| Amnesic Shellfish Poisoning A condition caused by ingestion of shellfish contaminated by domoic acid-producing diatoms of the genus Pseudo-nitzschia. | 0 | 2.31 | 1 | 0 |
| Alcaptonuria [description not available] | 0 | 2.31 | 1 | 0 |
| Ochronosis The yellowish discoloration of connective tissue due to deposition of HOMOGENTISIC ACID (a brown-black pigment). This is due to defects in the metabolism of PHENYLALANINE and TYROSINE. Ochronosis occurs in ALKAPTONURIA, but has also been associated with exposure to certain chemicals (e.g., PHENOL, trinitrophenol, BENZENE DERIVATIVES). | 0 | 2.31 | 1 | 0 |
| Alkaptonuria An inborn error of amino acid metabolism resulting from a defect in the enzyme HOMOGENTISATE 1,2-DIOXYGENASE, an enzyme involved in the breakdown of PHENYLALANINE and TYROSINE. It is characterized by accumulation of HOMOGENTISIC ACID in the urine, OCHRONOSIS in various tissues, and ARTHRITIS. | 0 | 2.31 | 1 | 0 |
| Acute Disease Disease having a short and relatively severe course. | 0 | 6.38 | 15 | 1 |
| Neuroblastoma A common neoplasm of early childhood arising from neural crest cells in the sympathetic nervous system, and characterized by diverse clinical behavior, ranging from spontaneous remission to rapid metastatic progression and death. This tumor is the most common intraabdominal malignancy of childhood, but it may also arise from thorax, neck, or rarely occur in the central nervous system. Histologic features include uniform round cells with hyperchromatic nuclei arranged in nests and separated by fibrovascular septa. Neuroblastomas may be associated with the opsoclonus-myoclonus syndrome. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, pp2099-2101; Curr Opin Oncol 1998 Jan;10(1):43-51) | 0 | 10.7 | 19 | 1 |
| Shingles [description not available] | 0 | 2.31 | 1 | 0 |
| Herpes Zoster An acute infectious, usually self-limited, disease believed to represent activation of latent varicella-zoster virus (HERPESVIRUS 3, HUMAN) in those who have been rendered partially immune after a previous attack of CHICKENPOX. It involves the SENSORY GANGLIA and their areas of innervation and is characterized by severe neuralgic pain along the distribution of the affected nerve and crops of clustered vesicles over the area. (From Dorland, 27th ed) | 0 | 2.31 | 1 | 0 |
| Dementias, Transmissible [description not available] | 0 | 4.08 | 5 | 0 |
| Altitude Hypoxia Low ambient oxygen tension associated with ALTITUDE. | 0 | 2.13 | 1 | 0 |
| Brain Swelling [description not available] | 0 | 2.13 | 1 | 0 |
| Altitude Sickness Multiple symptoms associated with reduced oxygen at high ALTITUDE. | 0 | 2.13 | 1 | 0 |
| Brain Edema Increased intracellular or extracellular fluid in brain tissue. Cytotoxic brain edema (swelling due to increased intracellular fluid) is indicative of a disturbance in cell metabolism, and is commonly associated with hypoxic or ischemic injuries (see HYPOXIA, BRAIN). An increase in extracellular fluid may be caused by increased brain capillary permeability (vasogenic edema), an osmotic gradient, local blockages in interstitial fluid pathways, or by obstruction of CSF flow (e.g., obstructive HYDROCEPHALUS). (From Childs Nerv Syst 1992 Sep; 8(6):301-6) | 0 | 2.13 | 1 | 0 |
| Chromosomal Breakage [description not available] | 0 | 4.44 | 8 | 0 |
| Acquired Immune Deficiency Syndrome [description not available] | 0 | 6.52 | 21 | 0 |
| Acquired Immunodeficiency Syndrome An acquired defect of cellular immunity associated with infection by the human immunodeficiency virus (HIV), a CD4-positive T-lymphocyte count under 200 cells/microliter or less than 14% of total lymphocytes, and increased susceptibility to opportunistic infections and malignant neoplasms. Clinical manifestations also include emaciation (wasting) and dementia. These elements reflect criteria for AIDS as defined by the CDC in 1993. | 0 | 6.52 | 21 | 0 |
| Age-Related Macular Degeneration [description not available] | 0 | 11.95 | 21 | 7 |
| Hepatic Veno Occlusive Disease [description not available] | 0 | 3.06 | 1 | 0 |
| Cytomegaloviral Retinitis [description not available] | 0 | 3.36 | 2 | 0 |
| Hepatic Veno-Occlusive Disease Liver disease that is caused by injuries to the ENDOTHELIAL CELLS of the vessels and subendothelial EDEMA, but not by THROMBOSIS. Extracellular matrix, rich in FIBRONECTINS, is usually deposited around the HEPATIC VEINS leading to venous outflow occlusion and sinusoidal obstruction. | 0 | 3.06 | 1 | 0 |
| Macular Degeneration Degenerative changes in the RETINA usually of older adults which results in a loss of vision in the center of the visual field (the MACULA LUTEA) because of damage to the retina. It occurs in dry and wet forms. | 0 | 11.95 | 21 | 7 |
| Cytomegalovirus Retinitis Infection of the retina by cytomegalovirus characterized by retinal necrosis, hemorrhage, vessel sheathing, and retinal edema. Cytomegalovirus retinitis is a major opportunistic infection in AIDS patients and can cause blindness. | 0 | 3.36 | 2 | 0 |
| Blood Pressure, High [description not available] | 0 | 8.64 | 20 | 2 |
| Hypertension Persistently high systemic arterial BLOOD PRESSURE. Based on multiple readings (BLOOD PRESSURE DETERMINATION), hypertension is currently defined as when SYSTOLIC PRESSURE is consistently greater than 140 mm Hg or when DIASTOLIC PRESSURE is consistently 90 mm Hg or more. | 0 | 8.64 | 20 | 2 |
| Acute Post-operative Pain [description not available] | 0 | 2.15 | 1 | 0 |
| Pain, Postoperative Pain during the period after surgery. | 0 | 2.15 | 1 | 0 |
| Acute Pain Intensely discomforting, distressful, or agonizing sensation associated with trauma or disease, with well-defined location, character, and timing. | 0 | 2.15 | 1 | 0 |
| Chronic Kidney Failure [description not available] | 0 | 4.47 | 3 | 0 |
| ADPKD [description not available] | 0 | 3.06 | 1 | 0 |
| Kidney Failure, Chronic The end-stage of CHRONIC RENAL INSUFFICIENCY. It is characterized by the severe irreversible kidney damage (as measured by the level of PROTEINURIA) and the reduction in GLOMERULAR FILTRATION RATE to less than 15 ml per min (Kidney Foundation: Kidney Disease Outcome Quality Initiative, 2002). These patients generally require HEMODIALYSIS or KIDNEY TRANSPLANTATION. | 0 | 4.47 | 3 | 0 |
| Polycystic Kidney, Autosomal Dominant Kidney disorders with autosomal dominant inheritance and characterized by multiple CYSTS in both KIDNEYS with progressive deterioration of renal function. | 0 | 3.06 | 1 | 0 |
| Acute Brain Injuries [description not available] | 0 | 3.42 | 7 | 0 |
| Brain Injuries Acute and chronic (see also BRAIN INJURIES, CHRONIC) injuries to the brain, including the cerebral hemispheres, CEREBELLUM, and BRAIN STEM. Clinical manifestations depend on the nature of injury. Diffuse trauma to the brain is frequently associated with DIFFUSE AXONAL INJURY or COMA, POST-TRAUMATIC. Localized injuries may be associated with NEUROBEHAVIORAL MANIFESTATIONS; HEMIPARESIS, or other focal neurologic deficits. | 0 | 3.42 | 7 | 0 |
| Arteriosclerosis, Coronary [description not available] | 0 | 10.17 | 15 | 6 |
| Coronary Artery Disease Pathological processes of CORONARY ARTERIES that may derive from a congenital abnormality, atherosclerotic, or non-atherosclerotic cause. | 0 | 10.17 | 15 | 6 |
| Child Development Deviations [description not available] | 0 | 3.56 | 1 | 1 |
| Developmental Disabilities Disorders in which there is a delay in development based on that expected for a given age level or stage of development. These impairments or disabilities originate before age 18, may be expected to continue indefinitely, and constitute a substantial impairment. Biological and nonbiological factors are involved in these disorders. (From American Psychiatric Glossary, 6th ed) | 0 | 3.56 | 1 | 1 |
| Inflammatory Response Syndrome, Systemic [description not available] | 0 | 2.74 | 3 | 0 |
| Systemic Inflammatory Response Syndrome A systemic inflammatory response to a variety of clinical insults, characterized by two or more of the following conditions: (1) fever | 0 | 2.74 | 3 | 0 |
| Bacterial Disease [description not available] | 0 | 4.67 | 6 | 0 |
| Microbial Superinvasion [description not available] | 0 | 2.15 | 1 | 0 |
| Bacterial Infections Infections by bacteria, general or unspecified. | 0 | 4.67 | 6 | 0 |
| Plasmodium vivax Malaria [description not available] | 0 | 2.54 | 2 | 0 |
| Malaria, Vivax Malaria caused by PLASMODIUM VIVAX. This form of malaria is less severe than MALARIA, FALCIPARUM, but there is a higher probability for relapses to occur. Febrile paroxysms often occur every other day. | 0 | 2.54 | 2 | 0 |
| Kidney Diseases Pathological processes of the KIDNEY or its component tissues. | 0 | 5 | 6 | 0 |
| Cryptogenic Fibrosing Alveolitis [description not available] | 0 | 3.71 | 3 | 0 |
| Alveolitis, Fibrosing [description not available] | 0 | 2.99 | 4 | 0 |
| Pulmonary Fibrosis A process in which normal lung tissues are progressively replaced by FIBROBLASTS and COLLAGEN causing an irreversible loss of the ability to transfer oxygen into the bloodstream via PULMONARY ALVEOLI. Patients show progressive DYSPNEA finally resulting in death. | 0 | 2.99 | 4 | 0 |
| Idiopathic Pulmonary Fibrosis A common interstitial lung disease of unknown etiology, usually occurring between 50-70 years of age. Clinically, it is characterized by an insidious onset of breathlessness with exertion and a nonproductive cough, leading to progressive DYSPNEA. Pathological features show scant interstitial inflammation, patchy collagen fibrosis, prominent fibroblast proliferation foci, and microscopic honeycomb change. | 0 | 3.71 | 3 | 0 |
| Colitis Gravis [description not available] | 0 | 4.69 | 6 | 0 |
| Colitis, Ulcerative Inflammation of the COLON that is predominantly confined to the MUCOSA. Its major symptoms include DIARRHEA, rectal BLEEDING, the passage of MUCUS, and ABDOMINAL PAIN. | 0 | 4.69 | 6 | 0 |
| Heart Disease, Ischemic [description not available] | 0 | 3.01 | 4 | 0 |
| Myocardial Ischemia A disorder of cardiac function caused by insufficient blood flow to the muscle tissue of the heart. The decreased blood flow may be due to narrowing of the coronary arteries (CORONARY ARTERY DISEASE), to obstruction by a thrombus (CORONARY THROMBOSIS), or less commonly, to diffuse narrowing of arterioles and other small vessels within the heart. Severe interruption of the blood supply to the myocardial tissue may result in necrosis of cardiac muscle (MYOCARDIAL INFARCTION). | 0 | 3.01 | 4 | 0 |
| Ebola Hemorrhagic Fever [description not available] | 0 | 3.05 | 4 | 0 |
| Hemorrhagic Fever, Ebola A highly fatal, acute hemorrhagic fever caused by EBOLAVIRUS. | 0 | 3.05 | 4 | 0 |
| Blood Diseases [description not available] | 0 | 5.5 | 3 | 1 |
| Hematologic Diseases Disorders of the blood and blood forming tissues. | 0 | 10.5 | 3 | 1 |
| Lymph Node Metastasis [description not available] | 0 | 5.85 | 8 | 1 |
| Malnourishment [description not available] | 0 | 2.15 | 1 | 0 |
| Polycystic Ovarian Syndrome [description not available] | 0 | 2.53 | 2 | 0 |
| Polycystic Ovary Syndrome A complex disorder characterized by infertility, HIRSUTISM; OBESITY; and various menstrual disturbances such as OLIGOMENORRHEA; AMENORRHEA; ANOVULATION. Polycystic ovary syndrome is usually associated with bilateral enlarged ovaries studded with atretic follicles, not with cysts. The term, polycystic ovary, is misleading. | 0 | 2.53 | 2 | 0 |
| Malnutrition An imbalanced nutritional status resulting from insufficient intake of nutrients to meet normal physiological requirement. | 0 | 2.15 | 1 | 0 |
| Limb-Girdle Muscular Dystrophies [description not available] | 0 | 2.17 | 1 | 0 |
| Muscular Dystrophies, Limb-Girdle A heterogenous group of inherited muscular dystrophy that can be autosomal dominant or autosomal recessive. There are many forms (called LGMDs) involving genes encoding muscle membrane proteins such as the sarcoglycan (SARCOGLYCANS) complex that interacts with DYSTROPHIN. The disease is characterized by progressing wasting and weakness of the proximal muscles of arms and legs around the HIPS and SHOULDERS (the pelvic and shoulder girdles). | 0 | 2.17 | 1 | 0 |
| Necrosis The death of cells in an organ or tissue due to disease, injury or failure of the blood supply. | 0 | 3.88 | 11 | 0 |
| Endotoxemia A condition characterized by the presence of ENDOTOXINS in the blood. On lysis, the outer cell wall of gram-negative bacteria enters the systemic circulation and initiates a pathophysiologic cascade of pro-inflammatory mediators. | 0 | 2.73 | 3 | 0 |
| Chronic Primary Open Angle Glaucoma [description not available] | 0 | 3.85 | 2 | 1 |
| Glaucoma, Open-Angle Glaucoma in which the angle of the anterior chamber is open and the trabecular meshwork does not encroach on the base of the iris. | 0 | 3.85 | 2 | 1 |
| Androgen-Independent Prostatic Cancer [description not available] | 0 | 4.97 | 4 | 2 |
| Prostatic Neoplasms, Castration-Resistant Tumors or cancer of the PROSTATE which can grow in the presence of low or residual amount of androgen hormones such as TESTOSTERONE. | 0 | 4.97 | 4 | 2 |
| Infusion Site Adverse Event [description not available] | 0 | 5.19 | 3 | 1 |
| Abnormalities, Autosome [description not available] | 0 | 6.27 | 34 | 0 |
| Duncan Disease [description not available] | 0 | 2.93 | 4 | 0 |
| Lymphoproliferative Disorders Disorders characterized by proliferation of lymphoid tissue, general or unspecified. | 0 | 2.93 | 4 | 0 |
| B-Cell Lymphoma [description not available] | 0 | 5.37 | 22 | 0 |
| Lymphoma, B-Cell A group of heterogeneous lymphoid tumors generally expressing one or more B-cell antigens or representing malignant transformations of B-lymphocytes. | 0 | 5.37 | 22 | 0 |
| Acute Promyelocytic Leukemia [description not available] | 0 | 3.89 | 12 | 0 |
| Leukemia, Promyelocytic, Acute An acute myeloid leukemia in which abnormal PROMYELOCYTES predominate. It is frequently associated with DISSEMINATED INTRAVASCULAR COAGULATION. | 0 | 3.89 | 12 | 0 |
| Angioimmunoblastic Lymphadenopathy [description not available] | 0 | 2.17 | 1 | 0 |
| Lymphoma, T Cell, Peripheral [description not available] | 0 | 2.17 | 1 | 0 |
| Immunoblastic Lymphadenopathy A disorder characterized by proliferation of arborizing small vessels, prominent immunoblastic proliferations and amorphous acidophilic interstitial material. Clinical manifestations include fever, sweats, weight loss, generalized lymphadenopathy and frequently hepatosplenomegaly. | 0 | 2.17 | 1 | 0 |
| Lymphoma, T-Cell, Peripheral A group of malignant lymphomas thought to derive from peripheral T-lymphocytes in lymph nodes and other nonlymphoid sites. They include a broad spectrum of lymphocyte morphology, but in all instances express T-cell markers admixed with epithelioid histiocytes, plasma cells, and eosinophils. Although markedly similar to large-cell immunoblastic lymphoma (LYMPHOMA, LARGE-CELL, IMMUNOBLASTIC), this group's unique features warrant separate treatment. | 0 | 2.17 | 1 | 0 |
| Anterior Horn Cell Disease [description not available] | 0 | 2.74 | 3 | 0 |
| Motor Neuron Disease Diseases characterized by a selective degeneration of the motor neurons of the spinal cord, brainstem, or motor cortex. Clinical subtypes are distinguished by the major site of degeneration. In AMYOTROPHIC LATERAL SCLEROSIS there is involvement of upper, lower, and brainstem motor neurons. In progressive muscular atrophy and related syndromes (see MUSCULAR ATROPHY, SPINAL) the motor neurons in the spinal cord are primarily affected. With progressive bulbar palsy (BULBAR PALSY, PROGRESSIVE), the initial degeneration occurs in the brainstem. In primary lateral sclerosis, the cortical neurons are affected in isolation. (Adams et al., Principles of Neurology, 6th ed, p1089) | 0 | 2.74 | 3 | 0 |
| Diabetic Cardiomyopathies Diabetes complications in which VENTRICULAR REMODELING in the absence of CORONARY ATHEROSCLEROSIS and hypertension results in cardiac dysfunctions, typically LEFT VENTRICULAR DYSFUNCTION. The changes also result in myocardial hypertrophy, myocardial necrosis and fibrosis, and collagen deposition due to impaired glucose tolerance. | 0 | 3.45 | 2 | 0 |
| Active Hyperemia [description not available] | 0 | 3.09 | 1 | 0 |
| Hyperemia The presence of an increased amount of blood in a body part or an organ leading to congestion or engorgement of blood vessels. Hyperemia can be due to increase of blood flow into the area (active or arterial), or due to obstruction of outflow of blood from the area (passive or venous). | 0 | 3.09 | 1 | 0 |
| Hemoglobinuria The presence of free HEMOGLOBIN in the URINE, indicating hemolysis of ERYTHROCYTES within the vascular system. After saturating the hemoglobin-binding proteins (HAPTOGLOBINS), free hemoglobin begins to appear in the urine. | 0 | 2.17 | 1 | 0 |
| Aneurysm, Ruptured The tearing or bursting of the weakened wall of the aneurysmal sac, usually heralded by sudden worsening pain. The great danger of a ruptured aneurysm is the large amount of blood spilling into the surrounding tissues and cavities, causing HEMORRHAGIC SHOCK. | 0 | 2.17 | 1 | 0 |
| Aneurysm, Anterior Cerebral Artery [description not available] | 0 | 2.17 | 1 | 0 |
| Intracranial Aneurysm Abnormal outpouching in the wall of intracranial blood vessels. Most common are the saccular (berry) aneurysms located at branch points in CIRCLE OF WILLIS at the base of the brain. Vessel rupture results in SUBARACHNOID HEMORRHAGE or INTRACRANIAL HEMORRHAGES. Giant aneurysms ( | 0 | 2.17 | 1 | 0 |
| Cockayne Syndrome A syndrome characterized by multiple system abnormalities including DWARFISM; PHOTOSENSITIVITY DISORDERS; PREMATURE AGING; and HEARING LOSS. It is caused by mutations of a number of autosomal recessive genes encoding proteins that involve transcriptional-coupled DNA REPAIR processes. Cockayne syndrome is classified by the severity and age of onset. Type I (classical; CSA) is early childhood onset in the second year of life; type II (congenital; CSB) is early onset at birth with severe symptoms; type III (xeroderma pigmentosum; XP) is late childhood onset with mild symptoms. | 0 | 7.17 | 1 | 0 |
| Dermatosclerosis [description not available] | 0 | 2.17 | 1 | 0 |
| Scleroderma, Localized A term used to describe a variety of localized asymmetrical SKIN thickening that is similar to those of SYSTEMIC SCLERODERMA but without the disease features in the multiple internal organs and BLOOD VESSELS. Lesions may be characterized as patches or plaques (morphea), bands (linear), or nodules. | 0 | 2.17 | 1 | 0 |
| Yellow Fever An acute infectious disease primarily of the tropics, caused by a virus and transmitted to man by mosquitoes of the genera Aedes and Haemagogus. The severe form is characterized by fever, HEMOLYTIC JAUNDICE, and renal damage. | 0 | 4.79 | 2 | 1 |
| Leishmania Infection [description not available] | 0 | 2.96 | 4 | 0 |
| Leishmaniasis A disease caused by any of a number of species of protozoa in the genus LEISHMANIA. There are four major clinical types of this infection: cutaneous (Old and New World) (LEISHMANIASIS, CUTANEOUS), diffuse cutaneous (LEISHMANIASIS, DIFFUSE CUTANEOUS), mucocutaneous (LEISHMANIASIS, MUCOCUTANEOUS), and visceral (LEISHMANIASIS, VISCERAL). | 0 | 2.96 | 4 | 0 |
| Colitis Inflammation of the COLON section of the large intestine (INTESTINE, LARGE), usually with symptoms such as DIARRHEA (often with blood and mucus), ABDOMINAL PAIN, and FEVER. | 0 | 3.89 | 4 | 0 |
| African Swine Fever A sometimes fatal ASFIVIRUS infection of pigs, characterized by fever, cough, diarrhea, hemorrhagic lymph nodes, and edema of the gallbladder. It is transmitted between domestic swine by direct contact, ingestion of infected meat, or fomites, or mechanically by biting flies or soft ticks (genus Ornithodoros). | 0 | 2.46 | 2 | 0 |
| Amazon Black Fever [description not available] | 0 | 3.09 | 5 | 0 |
| Hepatitis D INFLAMMATION of the LIVER in humans caused by HEPATITIS DELTA VIRUS, a defective RNA virus that can only infect HEPATITIS B patients. For its viral coating, hepatitis delta virus requires the HEPATITIS B SURFACE ANTIGENS produced by these patients. Hepatitis D can occur either concomitantly with (coinfection) or subsequent to (superinfection) hepatitis B infection. Similar to hepatitis B, it is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact. | 0 | 3.09 | 5 | 0 |
| Ocular Tuberculosis [description not available] | 0 | 2.17 | 1 | 0 |
| Uveitis Inflammation of part or all of the uvea, the middle (vascular) tunic of the eye, and commonly involving the other tunics (sclera and cornea, and the retina). (Dorland, 27th ed) | 0 | 2.17 | 1 | 0 |
| Cancer of the Urinary Tract [description not available] | 0 | 3.56 | 1 | 1 |
| Rhabdomyosarcoma A malignant solid tumor arising from mesenchymal tissues which normally differentiate to form striated muscle. It can occur in a wide variety of sites. It is divided into four distinct types: pleomorphic, predominantly in male adults; alveolar (RHABDOMYOSARCOMA, ALVEOLAR), mainly in adolescents and young adults; embryonal (RHABDOMYOSARCOMA, EMBRYONAL), predominantly in infants and children; and botryoidal, also in young children. It is one of the most frequently occurring soft tissue sarcomas and the most common in children under 15. (From Dorland, 27th ed; Holland et al., Cancer Medicine, 3d ed, p2186; DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, pp1647-9) | 0 | 3.1 | 5 | 0 |
| Bleeding [description not available] | 0 | 8.98 | 12 | 3 |
| Atypical Chronic Myeloid Leukemia [description not available] | 0 | 2.48 | 2 | 0 |
| Hemorrhage Bleeding or escape of blood from a vessel. | 0 | 8.98 | 12 | 3 |
| Inappropriate GH Secretion Syndrome (Acromegaly) [description not available] | 0 | 3.56 | 1 | 1 |
| Acromegaly A condition caused by prolonged exposure to excessive HUMAN GROWTH HORMONE in adults. It is characterized by bony enlargement of the FACE; lower jaw (PROGNATHISM); hands; FEET; HEAD; and THORAX. The most common etiology is a GROWTH HORMONE-SECRETING PITUITARY ADENOMA. (From Joynt, Clinical Neurology, 1992, Ch36, pp79-80) | 0 | 3.56 | 1 | 1 |
| Sinus Infections [description not available] | 0 | 2.17 | 1 | 0 |
| Nasal Polyps Focal accumulations of EDEMA fluid in the NASAL MUCOSA accompanied by HYPERPLASIA of the associated submucosal connective tissue. Polyps may be NEOPLASMS, foci of INFLAMMATION, degenerative lesions, or malformations. | 0 | 2.74 | 3 | 0 |
| Sinusitis Inflammation of the NASAL MUCOSA in one or more of the PARANASAL SINUSES. | 0 | 2.17 | 1 | 0 |
| Chromosome Inversion An aberration in which a chromosomal segment is deleted and reinserted in the same place but turned 180 degrees from its original orientation, so that the gene sequence for the segment is reversed with respect to that of the rest of the chromosome. | 0 | 3.6 | 9 | 0 |
| Infection, Toxoplasma gondii [description not available] | 0 | 2.52 | 2 | 0 |
| Toxoplasmosis The acquired form of infection by Toxoplasma gondii in animals and man. | 0 | 2.52 | 2 | 0 |
| Autosomal Dominant Cerebellar Ataxia, Type II [description not available] | 0 | 3.91 | 4 | 0 |
| Spinocerebellar Ataxias A group of predominately late-onset, cerebellar ataxias which have been divided into multiple subtypes based on clinical features and genetic mapping. Progressive ataxia is a central feature of these conditions, and in certain subtypes POLYNEUROPATHY; DYSARTHRIA; visual loss; and other disorders may develop. (From Joynt, Clinical Neurology, 1997, Ch65, pp 12-17; J Neuropathol Exp Neurol 1998 Jun;57(6):531-43) | 0 | 3.91 | 4 | 0 |
| BH4 Deficiency [description not available] | 0 | 2.43 | 2 | 0 |
| Phenylketonurias A group of autosomal recessive disorders marked by a deficiency of the hepatic enzyme PHENYLALANINE HYDROXYLASE or less frequently by reduced activity of DIHYDROPTERIDINE REDUCTASE (i.e., atypical phenylketonuria). Classical phenylketonuria is caused by a severe deficiency of phenylalanine hydroxylase and presents in infancy with developmental delay; SEIZURES; skin HYPOPIGMENTATION; ECZEMA; and demyelination in the central nervous system. (From Adams et al., Principles of Neurology, 6th ed, p952). | 0 | 2.43 | 2 | 0 |
| Infant, Newborn, Diseases Diseases of newborn infants present at birth (congenital) or developing within the first month of birth. It does not include hereditary diseases not manifesting at birth or within the first 30 days of life nor does it include inborn errors of metabolism. Both HEREDITARY DISEASES and METABOLISM, INBORN ERRORS are available as general concepts. | 0 | 2.17 | 1 | 0 |
| Bone Cancer [description not available] | 0 | 5.38 | 13 | 1 |
| Osteogenic Sarcoma [description not available] | 0 | 4.18 | 16 | 0 |
| Bone Neoplasms Tumors or cancer located in bone tissue or specific BONES. | 0 | 5.38 | 13 | 1 |
| Osteosarcoma A sarcoma originating in bone-forming cells, affecting the ends of long bones. It is the most common and most malignant of sarcomas of the bones, and occurs chiefly among 10- to 25-year-old youths. (From Stedman, 25th ed) | 0 | 9.18 | 16 | 0 |
| Abdominal Aortic Aneurysm [description not available] | 0 | 7.75 | 3 | 0 |
| Aortic Aneurysm, Abdominal An abnormal balloon- or sac-like dilatation in the wall of the ABDOMINAL AORTA which gives rise to the visceral, the parietal, and the terminal (iliac) branches below the aortic hiatus at the diaphragm. | 0 | 2.75 | 3 | 0 |
| Cutaneous T-Cell Lymphoma [description not available] | 0 | 2.17 | 1 | 0 |
| Lymphoma, T-Cell, Cutaneous A group of lymphomas exhibiting clonal expansion of malignant T-lymphocytes arrested at varying stages of differentiation as well as malignant infiltration of the skin. MYCOSIS FUNGOIDES; SEZARY SYNDROME; LYMPHOMATOID PAPULOSIS; and PRIMARY CUTANEOUS ANAPLASTIC LARGE CELL LYMPHOMA are the best characterized of these disorders. | 0 | 2.17 | 1 | 0 |
| Viral Diseases [description not available] | 0 | 6.67 | 15 | 0 |
| Virus Diseases A general term for diseases caused by viruses. | 0 | 6.67 | 15 | 0 |
| Granulocytic Leukemia, Chronic [description not available] | 0 | 4.96 | 14 | 0 |
| Leukemia, Myelogenous, Chronic, BCR-ABL Positive Clonal hematopoetic disorder caused by an acquired genetic defect in PLURIPOTENT STEM CELLS. It starts in MYELOID CELLS of the bone marrow, invades the blood and then other organs. The condition progresses from a stable, more indolent, chronic phase (LEUKEMIA, MYELOID, CHRONIC PHASE) lasting up to 7 years, to an advanced phase composed of an accelerated phase (LEUKEMIA, MYELOID, ACCELERATED PHASE) and BLAST CRISIS. | 0 | 4.96 | 14 | 0 |
| Group A Strep Infection [description not available] | 0 | 2.71 | 3 | 0 |
| Streptococcal Infections Infections with bacteria of the genus STREPTOCOCCUS. | 0 | 2.71 | 3 | 0 |
| Cicatrization The formation of fibrous tissue in the place of normal tissue during the process of WOUND HEALING. It includes scar tissue formation occurring in healing internal organs as well as in the skin after surface injuries. | 0 | 2.17 | 1 | 0 |
| Cicatrix The fibrous tissue that replaces normal tissue during the process of WOUND HEALING. | 0 | 2.17 | 1 | 0 |
| Aspiration, Respiratory [description not available] | 0 | 3.09 | 1 | 0 |
| Hypoventilation A reduction in the amount of air entering the pulmonary alveoli. | 0 | 3.09 | 1 | 0 |
| Experimental Lung Inflammation Inflammation of any part, segment or lobe, of the lung parenchyma. | 0 | 4.53 | 5 | 0 |
| Pneumonia Infection of the lung often accompanied by inflammation. | 0 | 4.53 | 5 | 0 |
| Arthritis, Degenerative [description not available] | 0 | 3.16 | 5 | 0 |
| Osteoarthritis A progressive, degenerative joint disease, the most common form of arthritis, especially in older persons. The disease is thought to result not from the aging process but from biochemical changes and biomechanical stresses affecting articular cartilage. In the foreign literature it is often called osteoarthrosis deformans. | 0 | 3.16 | 5 | 0 |
| B16 Melanoma [description not available] | 0 | 5.17 | 17 | 0 |
| Lung Injury, Acute [description not available] | 0 | 2.54 | 2 | 0 |
| Acute Lung Injury A condition of lung damage that is characterized by bilateral pulmonary infiltrates (PULMONARY EDEMA) rich in NEUTROPHILS, and in the absence of clinical HEART FAILURE. This can represent a spectrum of pulmonary lesions, endothelial and epithelial, due to numerous factors (physical, chemical, or biological). | 0 | 2.54 | 2 | 0 |
| Lassa Virus Infection [description not available] | 0 | 2.21 | 1 | 0 |
| Lassa Fever An acute febrile human disease caused by the LASSA VIRUS. | 0 | 2.21 | 1 | 0 |
| Autosomal Dominant Hereditary Spastic Paraplegia [description not available] | 0 | 2.21 | 1 | 0 |
| Spastic Paraplegia, Hereditary A group of inherited diseases that share similar phenotypes but are genetically diverse. Different genetic loci for autosomal recessive, autosomal dominant, and x-linked forms of hereditary spastic paraplegia have been identified. Clinically, patients present with slowly progressive distal limb weakness and lower extremity spasticity. Peripheral sensory neurons may be affected in the later stages of the disease. (J Neurol Neurosurg Psychiatry 1998 Jan;64(1):61-6; Curr Opin Neurol 1997 Aug;10(4):313-8) | 0 | 2.21 | 1 | 0 |
| Autosomal Dominant Myotubular Myopathy [description not available] | 0 | 3.12 | 1 | 0 |
| Electron Transport Chain Deficiencies, Mitochondrial [description not available] | 0 | 3.42 | 2 | 0 |
| Mitochondrial Diseases Diseases caused by abnormal function of the MITOCHONDRIA. They may be caused by mutations, acquired or inherited, in mitochondrial DNA or in nuclear genes that code for mitochondrial components. They may also be the result of acquired mitochondria dysfunction due to adverse effects of drugs, infections, or other environmental causes. | 0 | 3.42 | 2 | 0 |
| TDP-43 Proteinopathies Diseases characterized by the presence of abnormally phosphorylated, ubiquitinated, and cleaved DNA-binding protein TDP-43 in affected brain and spinal cord. Inclusions of the pathologic protein in neurons and glia, without the presence of AMYLOID, is the major feature of these conditions, thus making these proteinopathies distinct from most other neurogenerative disorders in which protein misfolding leads to brain amyloidosis. Both frontotemporal lobar degeneration and AMYOTROPHIC LATERAL SCLEROSIS exhibit this common method of pathogenesis and thus they may represent two extremes of a continuous clinicopathological spectrum of one disease. | 0 | 2.21 | 1 | 0 |
| Disease Resistance The capacity of an organism to defend itself against pathological processes or the agents of those processes. This most often involves innate immunity whereby the organism responds to pathogens in a generic way. The term disease resistance is used most frequently when referring to plants. | 0 | 2.8 | 3 | 0 |
| Amyloid Neuropathies Disorders of the peripheral nervous system associated with the deposition of AMYLOID in nerve tissue. Familial, primary (nonfamilial), and secondary forms have been described. Some familial subtypes demonstrate an autosomal dominant pattern of inheritance. Clinical manifestations include sensory loss, mild weakness, autonomic dysfunction, and CARPAL TUNNEL SYNDROME. (Adams et al., Principles of Neurology, 6th ed, p1349) | 0 | 5.09 | 3 | 0 |
| HIV Human immunodeficiency virus. A non-taxonomic and historical term referring to any of two species, specifically HIV-1 and/or HIV-2. Prior to 1986, this was called human T-lymphotropic virus type III/lymphadenopathy-associated virus (HTLV-III/LAV). From 1986-1990, it was an official species called HIV. Since 1991, HIV was no longer considered an official species name; the two species were designated HIV-1 and HIV-2. | 0 | 6.19 | 32 | 0 |
| Carotid Arteriopathies, Traumatic [description not available] | 0 | 3.13 | 5 | 0 |
| Arterial Obstructive Diseases [description not available] | 0 | 3.87 | 4 | 0 |
| Arterial Occlusive Diseases Pathological processes which result in the partial or complete obstruction of ARTERIES. They are characterized by greatly reduced or absence of blood flow through these vessels. They are also known as arterial insufficiency. | 0 | 3.87 | 4 | 0 |
| Gastric Diseases [description not available] | 0 | 2.21 | 1 | 0 |
| Dunnigan Syndrome [description not available] | 0 | 3.53 | 2 | 0 |
| Lipodystrophy, Familial Partial Inherited conditions characterized by the partial loss of ADIPOSE TISSUE, either confined to the extremities with normal or increased fat deposits on the face, neck and trunk (type 1), or confined to the loss of SUBCUTANEOUS FAT from the limbs and trunk (type 2). Type 3 is associated with mutation in the gene encoding PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR GAMMA. | 0 | 3.53 | 2 | 0 |
| Pigmentary Retinopathy [description not available] | 0 | 4.02 | 5 | 0 |
| Retinitis Pigmentosa Hereditary, progressive degeneration of the retina due to death of ROD PHOTORECEPTORS initially and subsequent death of CONE PHOTORECEPTORS. It is characterized by deposition of pigment in the retina. | 0 | 4.02 | 5 | 0 |
| Atrophy, Muscular, Spinobulbar [description not available] | 0 | 3.12 | 1 | 0 |
| Bulbo-Spinal Atrophy, X-Linked An X-linked recessive form of spinal muscular atrophy. It is due to a mutation of the gene encoding the ANDROGEN RECEPTOR. | 0 | 3.12 | 1 | 0 |
| Hyperlipoproteinemia [description not available] | 0 | 3.93 | 2 | 0 |
| Hyperlipoproteinemias Conditions with abnormally elevated levels of LIPOPROTEINS in the blood. They may be inherited, acquired, primary, or secondary. Hyperlipoproteinemias are classified according to the pattern of lipoproteins on electrophoresis or ultracentrifugation. | 0 | 3.93 | 2 | 0 |
| Ciliopathies Genetic disorders caused by defects in genes related to the primary CILIUM; BASAL BODY; or CENTROSOME. Primary features may include obesity, SKELETAL DYSPLASIA; POLYDACTYLY and malformations that primarily involve the liver, eye or kidneys. | 0 | 3.12 | 1 | 0 |
| Pleural Effusion Presence of fluid in the pleural cavity resulting from excessive transudation or exudation from the pleural surfaces. It is a sign of disease and not a diagnosis in itself. | 0 | 2.43 | 2 | 0 |
| Chromosome Deletion Actual loss of portion of a chromosome. | 0 | 7.52 | 72 | 0 |
| Leukemia, Lymphocytic, T Cell [description not available] | 0 | 3.7 | 10 | 0 |
| Leukemia, T-Cell A malignant disease of the T-LYMPHOCYTES in the bone marrow, thymus, and/or blood. | 0 | 3.7 | 10 | 0 |
| Hepatitis B Virus Infection [description not available] | 0 | 7.18 | 19 | 2 |
| Hepatitis B INFLAMMATION of the LIVER in humans caused by a member of the ORTHOHEPADNAVIRUS genus, HEPATITIS B VIRUS. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact. | 0 | 7.18 | 19 | 2 |
| Metabolic Acidosis [description not available] | 0 | 2.48 | 2 | 0 |
| Acidosis A pathologic condition of acid accumulation or depletion of base in the body. The two main types are RESPIRATORY ACIDOSIS and metabolic acidosis, due to metabolic acid build up. | 0 | 2.48 | 2 | 0 |
| B-Cell Chronic Lymphocytic Leukemia [description not available] | 0 | 5.64 | 28 | 0 |
| Leukemia, Lymphocytic, Chronic, B-Cell A chronic leukemia characterized by abnormal B-lymphocytes and often generalized lymphadenopathy. In patients presenting predominately with blood and bone marrow involvement it is called chronic lymphocytic leukemia (CLL); in those predominately with enlarged lymph nodes it is called small lymphocytic lymphoma. These terms represent spectrums of the same disease. | 0 | 5.64 | 28 | 0 |
| Angiitis [description not available] | 0 | 3.34 | 2 | 0 |
| Carotid Artery Narrowing [description not available] | 0 | 2.95 | 4 | 0 |
| Aortic Diseases Pathological processes involving any part of the AORTA. | 0 | 2.08 | 1 | 0 |
| Vasculitis Inflammation of any one of the blood vessels, including the ARTERIES; VEINS; and rest of the vasculature system in the body. | 0 | 3.34 | 2 | 0 |
| Carotid Stenosis Narrowing or stricture of any part of the CAROTID ARTERIES, most often due to atherosclerotic plaque formation. Ulcerations may form in atherosclerotic plaques and induce THROMBUS formation. Platelet or cholesterol emboli may arise from stenotic carotid lesions and induce a TRANSIENT ISCHEMIC ATTACK; CEREBROVASCULAR ACCIDENT; or temporary blindness (AMAUROSIS FUGAX). (From Adams et al., Principles of Neurology, 6th ed, pp 822-3) | 0 | 2.95 | 4 | 0 |
| Hyperglycemia, Postprandial Abnormally high BLOOD GLUCOSE level after a meal. | 0 | 2.49 | 2 | 0 |
| Hyperglycemia Abnormally high BLOOD GLUCOSE level. | 0 | 2.49 | 2 | 0 |
| Ewing Sarcoma [description not available] | 0 | 4.83 | 7 | 1 |
| Sarcoma, Ewing A malignant tumor of the bone which always arises in the medullary tissue, occurring more often in cylindrical bones. The tumor occurs usually before the age of 20, about twice as frequently in males as in females. | 0 | 4.83 | 7 | 1 |
| Ciliary Dyskinesia, Primary, 1 [description not available] | 0 | 2.08 | 1 | 0 |
| Leukemia, Lymphoblastic, Acute, T Cell [description not available] | 0 | 2.08 | 1 | 0 |
| Precursor T-Cell Lymphoblastic Leukemia-Lymphoma A leukemia/lymphoma found predominately in children and young adults and characterized LYMPHADENOPATHY and THYMUS GLAND involvement. It most frequently presents as a lymphoma, but a leukemic progression in the bone marrow is common. | 0 | 2.08 | 1 | 0 |
| CJD (Creutzfeldt-Jakob Disease) [description not available] | 0 | 3.1 | 5 | 0 |
| Encephalopathy, Subacute Spongiform, Gerstmann-Straussler Type [description not available] | 0 | 2.08 | 1 | 0 |
| Creutzfeldt-Jakob Syndrome A rare transmissible encephalopathy most prevalent between the ages of 50 and 70 years. Affected individuals may present with sleep disturbances, personality changes, ATAXIA; APHASIA, visual loss, weakness, muscle atrophy, MYOCLONUS, progressive dementia, and death within one year of disease onset. A familial form exhibiting autosomal dominant inheritance and a new variant CJD (potentially associated with ENCEPHALOPATHY, BOVINE SPONGIFORM) have been described. Pathological features include prominent cerebellar and cerebral cortical spongiform degeneration and the presence of PRIONS. (From N Engl J Med, 1998 Dec 31;339(27)) | 0 | 3.1 | 5 | 0 |
| Adenocarcinoma Of Kidney [description not available] | 0 | 4.66 | 6 | 1 |
| Cancer of Kidney [description not available] | 0 | 4.92 | 8 | 1 |
| Carcinoma, Renal Cell A heterogeneous group of sporadic or hereditary carcinoma derived from cells of the KIDNEYS. There are several subtypes including the clear cells, the papillary, the chromophobe, the collecting duct, the spindle cells (sarcomatoid), or mixed cell-type carcinoma. | 0 | 4.66 | 6 | 1 |
| Kidney Neoplasms Tumors or cancers of the KIDNEY. | 0 | 4.92 | 8 | 1 |
| Flavobacteriaceae Infections Infections with bacteria of the family FLAVOBACTERIACEAE. | 0 | 2.08 | 1 | 0 |
| Avian Diseases [description not available] | 0 | 2.08 | 1 | 0 |
| Actinic Reticuloid Syndrome [description not available] | 0 | 2.43 | 2 | 0 |
| Barrett Epithelium [description not available] | 0 | 2.46 | 2 | 0 |
| Cancer of Esophagus [description not available] | 0 | 3.85 | 11 | 0 |
| Barrett Esophagus A condition with damage to the lining of the lower ESOPHAGUS resulting from chronic acid reflux (ESOPHAGITIS, REFLUX). Through the process of metaplasia, the squamous cells are replaced by a columnar epithelium with cells resembling those of the INTESTINE or the salmon-pink mucosa of the STOMACH. Barrett's columnar epithelium is a marker for severe reflux and precursor to ADENOCARCINOMA of the esophagus. | 0 | 2.46 | 2 | 0 |
| Esophageal Neoplasms Tumors or cancer of the ESOPHAGUS. | 0 | 3.85 | 11 | 0 |
| Latent Tuberculosis The dormant form of TUBERCULOSIS where the person shows no obvious symptoms and no sign of the causative agent (Mycobacterium tuberculosis) in the SPUTUM despite being positive for tuberculosis infection skin test. | 0 | 2.08 | 1 | 0 |
| Bone Loss, Osteoclastic [description not available] | 0 | 3.44 | 7 | 0 |
| Central Nervous System Neoplasm [description not available] | 0 | 3.89 | 2 | 1 |
| Central Nervous System Neoplasms Benign and malignant neoplastic processes that arise from or secondarily involve the brain, spinal cord, or meninges. | 0 | 3.89 | 2 | 1 |
| Bacterial Pneumonia [description not available] | 0 | 2.08 | 1 | 0 |
| Acinetobacter Infections Infections with bacteria of the genus ACINETOBACTER. | 0 | 2.76 | 3 | 0 |
| Pneumonia, Bacterial Inflammation of the lung parenchyma that is caused by bacterial infections. | 0 | 2.08 | 1 | 0 |
| Cancer of Head [description not available] | 0 | 8.42 | 16 | 2 |
| Head and Neck Neoplasms Soft tissue tumors or cancer arising from the mucosal surfaces of the LIP; oral cavity; PHARYNX; LARYNX; and cervical esophagus. Other sites included are the NOSE and PARANASAL SINUSES; SALIVARY GLANDS; THYROID GLAND and PARATHYROID GLANDS; and MELANOMA and non-melanoma skin cancers of the head and neck. (from Holland et al., Cancer Medicine, 4th ed, p1651) | 0 | 8.42 | 16 | 2 |
| B-Cell Leukemia [description not available] | 0 | 3.39 | 7 | 0 |
| Cirrhoses, Experimental Liver [description not available] | 0 | 2.47 | 2 | 0 |
| Left Ventricular Dysfunction [description not available] | 0 | 2.79 | 3 | 0 |
| Injury, Myocardial Reperfusion [description not available] | 0 | 3.67 | 9 | 0 |
| Ventricular Dysfunction, Left A condition in which the LEFT VENTRICLE of the heart was functionally impaired. This condition usually leads to HEART FAILURE; MYOCARDIAL INFARCTION; and other cardiovascular complications. Diagnosis is made by measuring the diminished ejection fraction and a depressed level of motility of the left ventricular wall. | 0 | 2.79 | 3 | 0 |
| Lipid Metabolism, Inborn Error [description not available] | 0 | 3.33 | 2 | 0 |
| Leukemia, Lymphocytic [description not available] | 0 | 4.21 | 18 | 0 |
| Leukemia, Lymphoid Leukemia associated with HYPERPLASIA of the lymphoid tissues and increased numbers of circulating malignant LYMPHOCYTES and lymphoblasts. | 0 | 4.21 | 18 | 0 |
| Bacteremia The presence of viable bacteria circulating in the blood. Fever, chills, tachycardia, and tachypnea are common acute manifestations of bacteremia. The majority of cases are seen in already hospitalized patients, most of whom have underlying diseases or procedures which render their bloodstreams susceptible to invasion. | 0 | 3.29 | 6 | 0 |
| Esophageal Squamous Cell Carcinoma A carcinoma that originates usually from cells on the surface of the middle and lower third of the ESOPHAGUS. Tumor cells exhibit typical squamous morphology and form large polypoid lesions. Mutations in RNF6, LZTS1, TGFBR2, DEC1, and WWOX1 genes are associated with this cancer. | 0 | 2.8 | 3 | 0 |
| Sclerosis, Systemic [description not available] | 0 | 4.53 | 9 | 0 |
| Keloid A sharply elevated, irregularly shaped, progressively enlarging scar resulting from formation of excessive amounts of collagen in the dermis during connective tissue repair. It is differentiated from a hypertrophic scar (CICATRIX, HYPERTROPHIC) in that the former does not spread to surrounding tissues. | 0 | 3 | 1 | 0 |
| Scleroderma, Systemic A chronic multi-system disorder of CONNECTIVE TISSUE. It is characterized by SCLEROSIS in the SKIN, the LUNGS, the HEART, the GASTROINTESTINAL TRACT, the KIDNEYS, and the MUSCULOSKELETAL SYSTEM. Other important features include diseased small BLOOD VESSELS and AUTOANTIBODIES. The disorder is named for its most prominent feature (hard skin), and classified into subsets by the extent of skin thickening: LIMITED SCLERODERMA and DIFFUSE SCLERODERMA. | 0 | 4.53 | 9 | 0 |
| Infections, Plasmodium [description not available] | 0 | 4.01 | 5 | 0 |
| Malaria A protozoan disease caused in humans by four species of the PLASMODIUM genus: PLASMODIUM FALCIPARUM; PLASMODIUM VIVAX; PLASMODIUM OVALE; and PLASMODIUM MALARIAE; and transmitted by the bite of an infected female mosquito of the genus ANOPHELES. Malaria is endemic in parts of Asia, Africa, Central and South America, Oceania, and certain Caribbean islands. It is characterized by extreme exhaustion associated with paroxysms of high FEVER; SWEATING; shaking CHILLS; and ANEMIA. Malaria in ANIMALS is caused by other species of plasmodia. | 0 | 4.01 | 5 | 0 |
| Infections, Picornaviridae [description not available] | 0 | 2.7 | 3 | 0 |
| Nodular Goiter [description not available] | 0 | 2.1 | 1 | 0 |
| Goiter, Nodular An enlarged THYROID GLAND containing multiple nodules (THYROID NODULE), usually resulting from recurrent thyroid HYPERPLASIA and involution over many years to produce the irregular enlargement. Multinodular goiters may be nontoxic or may induce THYROTOXICOSIS. | 0 | 2.1 | 1 | 0 |
| Cyst [description not available] | 0 | 2.08 | 1 | 0 |
| Complications, Pregnancy [description not available] | 0 | 2.49 | 2 | 0 |
| Coronary Heart Disease [description not available] | 0 | 7.4 | 6 | 3 |
| Coronary Disease An imbalance between myocardial functional requirements and the capacity of the CORONARY VESSELS to supply sufficient blood flow. It is a form of MYOCARDIAL ISCHEMIA (insufficient blood supply to the heart muscle) caused by a decreased capacity of the coronary vessels. | 0 | 7.4 | 6 | 3 |
| Arachnoidal Cerebellar Sarcoma, Circumscribed [description not available] | 0 | 2.08 | 1 | 0 |
| Medulloblastoma A malignant neoplasm that may be classified either as a glioma or as a primitive neuroectodermal tumor of childhood (see NEUROECTODERMAL TUMOR, PRIMITIVE). The tumor occurs most frequently in the first decade of life with the most typical location being the cerebellar vermis. Histologic features include a high degree of cellularity, frequent mitotic figures, and a tendency for the cells to organize into sheets or form rosettes. Medulloblastoma have a high propensity to spread throughout the craniospinal intradural axis. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, pp2060-1) | 0 | 2.08 | 1 | 0 |
| Acute Post-Traumatic Stress Disorder [description not available] | 0 | 3.47 | 1 | 1 |
| Stress Disorders, Post-Traumatic A class of traumatic stress disorders with symptoms that last more than one month. | 0 | 3.47 | 1 | 1 |
| Encephalitis, Venezuelan Equine [description not available] | 0 | 2.69 | 3 | 0 |
| Dyspareunia Recurrent genital pain occurring during, before, or after SEXUAL INTERCOURSE in either the male or the female. | 0 | 2.1 | 1 | 0 |
| Cancer of Intestines [description not available] | 0 | 2.1 | 1 | 0 |
| Intestinal Neoplasms Tumors or cancer of the INTESTINES. | 0 | 2.1 | 1 | 0 |
| Pyomyositis An intramuscular suppuration of the large skeletal muscle groups. It is associated with INFECTION such as STAPHYLOCOCCUS AUREUS and PYODERMA. It was known as a tropical disease but is increasing among the immunocompromised (IMMUNOCOMPROMISED HOST). Symptoms include muscle pain, FEVER, and leucocytosis. It has been diagnosed by MRI SCANS. | 0 | 2.1 | 1 | 0 |
| Palmoplantaris Pustulosis [description not available] | 0 | 5.12 | 10 | 1 |
| Psoriasis A common genetically determined, chronic, inflammatory skin disease characterized by rounded erythematous, dry, scaling patches. The lesions have a predilection for nails, scalp, genitalia, extensor surfaces, and the lumbosacral region. Accelerated epidermopoiesis is considered to be the fundamental pathologic feature in psoriasis. | 0 | 5.12 | 10 | 1 |
| Ataxia Impairment of the ability to perform smoothly coordinated voluntary movements. This condition may affect the limbs, trunk, eyes, pharynx, larynx, and other structures. Ataxia may result from impaired sensory or motor function. Sensory ataxia may result from posterior column injury or PERIPHERAL NERVE DISEASES. Motor ataxia may be associated with CEREBELLAR DISEASES; CEREBRAL CORTEX diseases; THALAMIC DISEASES; BASAL GANGLIA DISEASES; injury to the RED NUCLEUS; and other conditions. | 0 | 2.1 | 1 | 0 |
| Action Tremor [description not available] | 0 | 2.1 | 1 | 0 |
| Tremor Cyclical movement of a body part that can represent either a physiologic process or a manifestation of disease. Intention or action tremor, a common manifestation of CEREBELLAR DISEASES, is aggravated by movement. In contrast, resting tremor is maximal when there is no attempt at voluntary movement, and occurs as a relatively frequent manifestation of PARKINSON DISEASE. | 0 | 2.1 | 1 | 0 |
| Retinal Degeneration A retrogressive pathological change in the retina, focal or generalized, caused by genetic defects, inflammation, trauma, vascular disease, or aging. Degeneration affecting predominantly the macula lutea of the retina is MACULAR DEGENERATION. (Newell, Ophthalmology: Principles and Concepts, 7th ed, p304) | 0 | 3.1 | 5 | 0 |
| Bright Disease A historical classification which is no longer used. It described acute glomerulonephritis, acute nephritic syndrome, or acute nephritis. Named for Richard Bright. | 0 | 5.57 | 9 | 0 |
| Glomerulonephritis, Minimal Change [description not available] | 0 | 3.01 | 1 | 0 |
| Extramembranous Glomerulopathy [description not available] | 0 | 3.01 | 1 | 0 |
| Glomerulonephritis Inflammation of the renal glomeruli (KIDNEY GLOMERULUS) that can be classified by the type of glomerular injuries including antibody deposition, complement activation, cellular proliferation, and glomerulosclerosis. These structural and functional abnormalities usually lead to HEMATURIA; PROTEINURIA; HYPERTENSION; and RENAL INSUFFICIENCY. | 0 | 5.57 | 9 | 0 |
| Nephrosis, Lipoid A kidney disease with no or minimal histological glomerular changes on light microscopy and with no immune deposits. It is characterized by lipid accumulation in the epithelial cells of KIDNEY TUBULES and in the URINE. Patients usually show NEPHROTIC SYNDROME indicating the presence of PROTEINURIA with accompanying EDEMA. | 0 | 3.01 | 1 | 0 |
| Glomerulonephritis, Membranous A type of glomerulonephritis that is characterized by the accumulation of immune deposits (COMPLEMENT MEMBRANE ATTACK COMPLEX) on the outer aspect of the GLOMERULAR BASEMENT MEMBRANE. It progresses from subepithelial dense deposits, to basement membrane reaction and eventual thickening of the basement membrane. | 0 | 3.01 | 1 | 0 |
| Diffuse Lymphocytic Lymphoma, Poorly-Differentiated [description not available] | 0 | 2.1 | 1 | 0 |
| Brill-Symmers Disease [description not available] | 0 | 3.1 | 5 | 0 |
| Lymphoma, Follicular Malignant lymphoma in which the lymphomatous cells are clustered into identifiable nodules within the LYMPH NODES. The nodules resemble to some extent the GERMINAL CENTER of lymph node follicles and most likely represent neoplastic proliferation of lymph node-derived follicular center B-LYMPHOCYTES. | 0 | 3.1 | 5 | 0 |
| Lymphoma, Mantle-Cell A form of non-Hodgkin lymphoma having a usually diffuse pattern with both small and medium lymphocytes and small cleaved cells. It accounts for about 5% of adult non-Hodgkin lymphomas in the United States and Europe. The majority of mantle-cell lymphomas are associated with a t(11;14) translocation resulting in overexpression of the CYCLIN D1 gene (GENES, BCL-1). | 0 | 2.1 | 1 | 0 |
| Feline Infectious Peritonitis Common coronavirus infection of cats caused by the feline infectious peritonitis virus (CORONAVIRUS, FELINE). The disease is characterized by a long incubation period, fever, depression, loss of appetite, wasting, and progressive abdominal enlargement. Infection of cells of the monocyte-macrophage lineage appears to be essential in FIP pathogenesis. | 0 | 2.1 | 1 | 0 |
| Hydrophobia [description not available] | 0 | 2.1 | 1 | 0 |
| Health Care Associated Infection [description not available] | 0 | 2.71 | 3 | 0 |
| Cross Infection Any infection which a patient contracts in a health-care institution. | 0 | 2.71 | 3 | 0 |
| Corneal Angiogenesis [description not available] | 0 | 6.79 | 8 | 3 |
| Keratitis Inflammation of the cornea. | 0 | 4.58 | 5 | 1 |
| Corneal Neovascularization New blood vessels originating from the corneal blood vessels and extending from the limbus into the adjacent CORNEAL STROMA. Neovascularization in the superficial and/or deep corneal stroma is a sequel to numerous inflammatory diseases of the ocular anterior segment, such as TRACHOMA, viral interstitial KERATITIS, microbial KERATOCONJUNCTIVITIS, and the immune response elicited by CORNEAL TRANSPLANTATION. | 0 | 6.79 | 8 | 3 |
| Cicatrix, Hypertrophic An elevated scar, resembling a KELOID, but which does not spread into surrounding tissues. It is formed by enlargement and overgrowth of cicatricial tissue and regresses spontaneously. | 0 | 2.51 | 2 | 0 |
| Eczema, Atopic [description not available] | 0 | 4.06 | 5 | 0 |
| Dermatitis, Atopic A chronic inflammatory genetically determined disease of the skin marked by increased ability to form reagin (IgE), with increased susceptibility to allergic rhinitis and asthma, and hereditary disposition to a lowered threshold for pruritus. It is manifested by lichenification, excoriation, and crusting, mainly on the flexural surfaces of the elbow and knee. In infants it is known as infantile eczema. | 0 | 4.06 | 5 | 0 |
| Bile Duct Obstruction [description not available] | 0 | 2.75 | 3 | 0 |
| Bile Duct Obstruction, Intrahepatic [description not available] | 0 | 2.1 | 1 | 0 |
| Water-Electrolyte Imbalance Disturbances in the body's WATER-ELECTROLYTE BALANCE. | 0 | 2.1 | 1 | 0 |
| Cholestasis Impairment of bile flow due to obstruction in small bile ducts (INTRAHEPATIC CHOLESTASIS) or obstruction in large bile ducts (EXTRAHEPATIC CHOLESTASIS). | 0 | 2.75 | 3 | 0 |
| Cholestasis, Intrahepatic Impairment of bile flow due to injury to the HEPATOCYTES; BILE CANALICULI; or the intrahepatic bile ducts (BILE DUCTS, INTRAHEPATIC). | 0 | 2.1 | 1 | 0 |
| Anemia, Cooley's [description not available] | 0 | 5 | 9 | 0 |
| beta-Thalassemia A disorder characterized by reduced synthesis of the beta chains of hemoglobin. There is retardation of hemoglobin A synthesis in the heterozygous form (thalassemia minor), which is asymptomatic, while in the homozygous form (thalassemia major, Cooley's anemia, Mediterranean anemia, erythroblastic anemia), which can result in severe complications and even death, hemoglobin A synthesis is absent. | 0 | 5 | 9 | 0 |
| Swine Diseases Diseases of domestic swine and of the wild boar of the genus Sus. | 0 | 3.51 | 8 | 0 |
| Circoviridae Infections Virus diseases caused by the CIRCOVIRIDAE. | 0 | 2.1 | 1 | 0 |
| Cancer, Embryonal [description not available] | 0 | 2.1 | 1 | 0 |
| Cancer of Testis [description not available] | 0 | 2.1 | 1 | 0 |
| Neoplasms, Germ Cell and Embryonal Neoplasms composed of primordial GERM CELLS of embryonic GONADS or of elements of the germ layers of the EMBRYO, MAMMALIAN. The concept does not refer to neoplasms located in the gonads or present in an embryo or FETUS. | 0 | 2.1 | 1 | 0 |
| Testicular Neoplasms Tumors or cancer of the TESTIS. Germ cell tumors (GERMINOMA) of the testis constitute 95% of all testicular neoplasms. | 0 | 2.1 | 1 | 0 |
| Absence Status [description not available] | 0 | 2.77 | 3 | 0 |
| Status Epilepticus A prolonged seizure or seizures repeated frequently enough to prevent recovery between episodes occurring over a period of 20-30 minutes. The most common subtype is generalized tonic-clonic status epilepticus, a potentially fatal condition associated with neuronal injury and respiratory and metabolic dysfunction. Nonconvulsive forms include petit mal status and complex partial status, which may manifest as behavioral disturbances. Simple partial status epilepticus consists of persistent motor, sensory, or autonomic seizures that do not impair cognition (see also EPILEPSIA PARTIALIS CONTINUA). Subclinical status epilepticus generally refers to seizures occurring in an unresponsive or comatose individual in the absence of overt signs of seizure activity. (From N Engl J Med 1998 Apr 2;338(14):970-6; Neurologia 1997 Dec;12 Suppl 6:25-30) | 0 | 2.77 | 3 | 0 |
| Response Evaluation Criteria in Solid Tumors An internationally recognized set of published rules used for evaluation of cancer treatment that define when tumors found in cancer patients improve, worsen, or remain stable during treatment. These criteria are based specifically on the response of the tumor(s) to treatment, and not on the overall health status of the patient resulting from treatment. | 0 | 4.4 | 1 | 1 |
| Graft Occlusion, Vascular Obstruction of flow in biological or prosthetic vascular grafts. | 0 | 15.64 | 56 | 29 |
| Cholera Infantum [description not available] | 0 | 4.09 | 3 | 0 |
| Brain Hemorrhage, Cerebral [description not available] | 0 | 2.1 | 1 | 0 |
| Cerebral Hemorrhage Bleeding into one or both CEREBRAL HEMISPHERES including the BASAL GANGLIA and the CEREBRAL CORTEX. It is often associated with HYPERTENSION and CRANIOCEREBRAL TRAUMA. | 0 | 2.1 | 1 | 0 |
| Herpes Simplex Virus Infection [description not available] | 0 | 3.1 | 5 | 0 |
| Herpes Simplex A group of acute infections caused by herpes simplex virus type 1 or type 2 that is characterized by the development of one or more small fluid-filled vesicles with a raised erythematous base on the skin or mucous membrane. It occurs as a primary infection or recurs due to a reactivation of a latent infection. (Dorland, 27th ed.) | 0 | 8.1 | 5 | 0 |
| Acute-Phase Reaction An early local inflammatory reaction to insult or injury that consists of fever, an increase in inflammatory humoral factors, and an increased synthesis by hepatocytes of a number of proteins or glycoproteins usually found in the plasma. | 0 | 3.84 | 2 | 1 |
| Classic Galactosemia [description not available] | 0 | 2.11 | 1 | 0 |
| Galactosemias A group of inherited enzyme deficiencies which feature elevations of GALACTOSE in the blood. This condition may be associated with deficiencies of GALACTOKINASE; UDPGLUCOSE-HEXOSE-1-PHOSPHATE URIDYLYLTRANSFERASE; or UDPGLUCOSE 4-EPIMERASE. The classic form is caused by UDPglucose-Hexose-1-Phosphate Uridylyltransferase deficiency, and presents in infancy with FAILURE TO THRIVE; VOMITING; and INTRACRANIAL HYPERTENSION. Affected individuals also may develop MENTAL RETARDATION; JAUNDICE; hepatosplenomegaly; ovarian failure (PRIMARY OVARIAN INSUFFICIENCY); and cataracts. (From Menkes, Textbook of Child Neurology, 5th ed, pp61-3) | 0 | 2.11 | 1 | 0 |
| Thromboembolism, Venous [description not available] | 0 | 2.1 | 1 | 0 |
| Venous Thromboembolism Obstruction of a vein or VEINS (embolism) by a blood clot (THROMBUS) in the blood stream. | 0 | 2.1 | 1 | 0 |
| Protein Aggregation, Pathological A biochemical phenomenon in which misfolded proteins aggregate either intra- or extracellularly. Triggered by factors such as MUTATION; POST-TRANSLATIONAL MODIFICATIONS, and environmental stress, it is generally associated with ALZHEIMER DISEASE; PARKINSON DISEASE; HUNTINGTON DISEASE; and TYPE 2 DIABETES MELLITUS. | 0 | 2.1 | 1 | 0 |
| Genetic Diseases, X-Chromosome Linked [description not available] | 0 | 2.1 | 1 | 0 |
| Hypogammaglobulinemia [description not available] | 0 | 2.69 | 3 | 0 |
| Agammaglobulinemia An immunologic deficiency state characterized by an extremely low level of generally all classes of gamma-globulin in the blood. | 0 | 7.69 | 3 | 0 |
| Autoimmune Chronic Hepatitis [description not available] | 0 | 2.11 | 1 | 0 |
| Hepatitis, Autoimmune A chronic self-perpetuating hepatocellular INFLAMMATION of unknown cause, usually with HYPERGAMMAGLOBULINEMIA and serum AUTOANTIBODIES. | 0 | 2.11 | 1 | 0 |
| Anaplastic Ependymoma [description not available] | 0 | 2.1 | 1 | 0 |
| Ependymoma Glioma derived from EPENDYMOGLIAL CELLS that tend to present as malignant intracranial tumors in children and as benign intraspinal neoplasms in adults. It may arise from any level of the ventricular system or central canal of the spinal cord. Intracranial ependymomas most frequently originate in the FOURTH VENTRICLE and histologically are densely cellular tumors which may contain ependymal tubules and perivascular pseudorosettes. Spinal ependymomas are usually benign papillary or myxopapillary tumors. (From DeVita et al., Principles and Practice of Oncology, 5th ed, p2018; Escourolle et al., Manual of Basic Neuropathology, 2nd ed, pp28-9) | 0 | 2.1 | 1 | 0 |
| Cardiometabolic Syndrome A cluster of symptoms that are risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components not only include metabolic dysfunctions of METABOLIC SYNDROME but also HYPERTENSION, and ABDOMINAL OBESITY. | 0 | 2.52 | 2 | 0 |
| Metabolic Syndrome A cluster of symptoms that are risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components of metabolic syndrome include ABDOMINAL OBESITY; atherogenic DYSLIPIDEMIA; HYPERTENSION; HYPERGLYCEMIA; INSULIN RESISTANCE; a proinflammatory state; and a prothrombotic (THROMBOSIS) state. | 0 | 2.52 | 2 | 0 |
| Hemoptysis Expectoration or spitting of blood originating from any part of the RESPIRATORY TRACT, usually from hemorrhage in the lung parenchyma (PULMONARY ALVEOLI) and the BRONCHIAL ARTERIES. | 0 | 4.4 | 1 | 1 |
| Nasopharyngeal Carcinoma A carcinoma that originates in the EPITHELIUM of the NASOPHARYNX and includes four subtypes: keratinizing squamous cell, non-keratinizing, basaloid squamous cell, and PAPILLARY ADENOCARCINOMA. It is most prevalent in Southeast Asian populations and is associated with EPSTEIN-BARR VIRUS INFECTIONS. Somatic mutations associated with this cancer have been identified in NPCR, BAP1, UBAP1, ERBB2, ERBB3, MLL2, PIK3CA, KRAS, NRAS, and ARID1A genes. | 0 | 2.79 | 3 | 0 |
| Carcinoma, Anaplastic [description not available] | 0 | 5.94 | 40 | 0 |
| Cancer of Nasopharynx [description not available] | 0 | 3.26 | 6 | 0 |
| Carcinoma A malignant neoplasm made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. It is a histological type of neoplasm and not a synonym for cancer. | 0 | 10.94 | 40 | 0 |
| Nasopharyngeal Neoplasms Tumors or cancer of the NASOPHARYNX. | 0 | 3.26 | 6 | 0 |
| Choroid Neovascularization [description not available] | 0 | 10.88 | 15 | 7 |
| Neoplasms, Bone Marrow [description not available] | 0 | 2.1 | 1 | 0 |
| Bone Marrow Neoplasms Neoplasms located in the bone marrow. They are differentiated from neoplasms composed of bone marrow cells, such as MULTIPLE MYELOMA. Most bone marrow neoplasms are metastatic. | 0 | 2.1 | 1 | 0 |
| Sterility, Male [description not available] | 0 | 2.42 | 2 | 0 |
| Infertility, Male The inability of the male to effect FERTILIZATION of an OVUM after a specified period of unprotected intercourse. Male sterility is permanent infertility. | 0 | 2.42 | 2 | 0 |
| Sexually Transmitted Disease, Viral [description not available] | 0 | 3.03 | 1 | 0 |
| Experimental Mammary Neoplasms [description not available] | 0 | 3.25 | 6 | 0 |
| Anterior Cerebral Circulation Infarction [description not available] | 0 | 2.11 | 1 | 0 |
| Brain Infarction Tissue NECROSIS in any area of the brain, including the CEREBRAL HEMISPHERES, the CEREBELLUM, and the BRAIN STEM. Brain infarction is the result of a cascade of events initiated by inadequate blood flow through the brain that is followed by HYPOXIA and HYPOGLYCEMIA in brain tissue. Damage may be temporary, permanent, selective or pan-necrosis. | 0 | 2.11 | 1 | 0 |
| Rhabdoid Tumor A rare but highly lethal childhood tumor found almost exclusively in infants. Histopathologically, it resembles RHABDOMYOSARCOMA but the tumor cells are not of myogenic origin. Although it arises primarily in the kidney, it may be found in other parts of the body. The rhabdoid cytomorphology is believed to be the expression of a very primitive malignant cell. (From Holland et al., Cancer Medicine, 3d ed, p2210) | 0 | 2.1 | 1 | 0 |
| Brucella Infection [description not available] | 0 | 3.4 | 2 | 0 |
| Brucellosis Infection caused by bacteria of the genus BRUCELLA mainly involving the MONONUCLEAR PHAGOCYTE SYSTEM. This condition is characterized by fever, weakness, malaise, and weight loss. | 0 | 3.4 | 2 | 0 |
| Experimental Hepatoma [description not available] | 0 | 3.6 | 9 | 0 |
| Deep Vein Thrombosis [description not available] | 0 | 6.82 | 7 | 2 |
| Venous Thrombosis The formation or presence of a blood clot (THROMBUS) within a vein. | 0 | 6.82 | 7 | 2 |
| Allergic Reaction [description not available] | 0 | 6.49 | 14 | 0 |
| Hypersensitivity Altered reactivity to an antigen, which can result in pathologic reactions upon subsequent exposure to that particular antigen. | 0 | 6.49 | 14 | 0 |
| Pulmonary Hypertension [description not available] | 0 | 3.18 | 5 | 0 |
| Hypertension, Pulmonary Increased VASCULAR RESISTANCE in the PULMONARY CIRCULATION, usually secondary to HEART DISEASES or LUNG DISEASES. | 0 | 3.18 | 5 | 0 |
| Atypical Mycobacterial Infection, Disseminated [description not available] | 0 | 2.11 | 1 | 0 |
| Cancer of the Thyroid [description not available] | 0 | 12.32 | 30 | 6 |
| Thyroid Neoplasms Tumors or cancer of the THYROID GLAND. | 0 | 12.32 | 30 | 6 |
| Bovine Diseases [description not available] | 0 | 3.7 | 10 | 0 |
| Bovine Virus Diarrhea Mucosal Disease [description not available] | 0 | 2.69 | 3 | 0 |
| Newcastle Disease An acute febrile, contagious, viral disease of birds caused by an AVULAVIRUS called NEWCASTLE DISEASE VIRUS. It is characterized by respiratory and nervous symptoms in fowl and is transmissible to man causing a severe, but transient conjunctivitis. | 0 | 2.11 | 1 | 0 |
| Herpes Simplex Keratitis [description not available] | 0 | 3.65 | 3 | 0 |
| Keratitis, Herpetic A superficial, epithelial Herpesvirus hominis infection of the cornea, characterized by the presence of small vesicles which may break down and coalesce to form dendritic ulcers (KERATITIS, DENDRITIC). (Dictionary of Visual Science, 3d ed) | 0 | 3.65 | 3 | 0 |
| Eye Cancer, Retinoblastoma [description not available] | 0 | 2.72 | 3 | 0 |
| Retinoblastoma A malignant tumor arising from the nuclear layer of the retina that is the most common primary tumor of the eye in children. The tumor tends to occur in early childhood or infancy and may be present at birth. The majority are sporadic, but the condition may be transmitted as an autosomal dominant trait. Histologic features include dense cellularity, small round polygonal cells, and areas of calcification and necrosis. An abnormal pupil reflex (leukokoria); NYSTAGMUS, PATHOLOGIC; STRABISMUS; and visual loss represent common clinical characteristics of this condition. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, p2104) | 0 | 2.72 | 3 | 0 |
| Allergy, Egg [description not available] | 0 | 2.11 | 1 | 0 |
| Bronchial Hyperreactivity Tendency of the smooth muscle of the tracheobronchial tree to contract more intensely in response to a given stimulus than it does in the response seen in normal individuals. This condition is present in virtually all symptomatic patients with asthma. The most prominent manifestation of this smooth muscle contraction is a decrease in airway caliber that can be readily measured in the pulmonary function laboratory. | 0 | 2.73 | 3 | 0 |
| Depression Depressive states usually of moderate intensity in contrast with MAJOR DEPRESSIVE DISORDER present in neurotic and psychotic disorders. | 0 | 2.11 | 1 | 0 |
| DNA Degradation, Necrotic The random catabolism of DNA accompanying the irreversible damage to tissue which leads to the pathological death of one or more cells. | 0 | 2.11 | 1 | 0 |
| Neointima The new and thickened layer of scar tissue that forms on a PROSTHESIS, or as a result of vessel injury especially following ANGIOPLASTY or stent placement. | 0 | 7.52 | 2 | 0 |
| Hyperplasia An increase in the number of cells in a tissue or organ without tumor formation. It differs from HYPERTROPHY, which is an increase in bulk without an increase in the number of cells. | 0 | 17.93 | 36 | 25 |
| Burns Injuries to tissues caused by contact with heat, steam, chemicals (BURNS, CHEMICAL), electricity (BURNS, ELECTRIC), or the like. | 0 | 2.11 | 1 | 0 |
| Ankylosing Spondylarthritis [description not available] | 0 | 2.48 | 2 | 0 |
| Spondylitis, Ankylosing A chronic inflammatory condition affecting the axial joints, such as the SACROILIAC JOINT and other intervertebral or costovertebral joints. It occurs predominantly in young males and is characterized by pain and stiffness of joints (ANKYLOSIS) with inflammation at tendon insertions. | 0 | 2.48 | 2 | 0 |
| Hyperdactyly [description not available] | 0 | 2.11 | 1 | 0 |
| Abnormalities, Multiple Congenital abnormalities that affect more than one organ or body structure. | 0 | 3.43 | 7 | 0 |
| Vascular Injuries [description not available] | 0 | 2.11 | 1 | 0 |
| Aortitis Inflammation of the wall of the AORTA. | 0 | 2.11 | 1 | 0 |
| Experimental Spinal Cord Ischemia [description not available] | 0 | 2.11 | 1 | 0 |
| Anemia, Megaloblastic A disorder characterized by the presence of ANEMIA, abnormally large red blood cells (megalocytes or macrocytes), and MEGALOBLASTS. | 0 | 2.11 | 1 | 0 |
| CBS Deficiency [description not available] | 0 | 2.11 | 1 | 0 |
| Homocystinuria Autosomal recessive inborn error of methionine metabolism usually caused by a deficiency of CYSTATHIONINE BETA-SYNTHASE and associated with elevations of homocysteine in plasma and urine. Clinical features include a tall slender habitus, SCOLIOSIS, arachnodactyly, MUSCLE WEAKNESS, genu varus, thin blond hair, malar flush, lens dislocations, an increased incidence of MENTAL RETARDATION, and a tendency to develop fibrosis of arteries, frequently complicated by CEREBROVASCULAR ACCIDENTS and MYOCARDIAL INFARCTION. (From Adams et al., Principles of Neurology, 6th ed, p979) | 0 | 2.11 | 1 | 0 |
| Muscle Pain [description not available] | 0 | 3.03 | 1 | 0 |
| Myalgia Painful sensation in the muscles. | 0 | 3.03 | 1 | 0 |
| Blood Loss, Postoperative [description not available] | 0 | 6.42 | 10 | 0 |
| Complication, Intraoperative [description not available] | 0 | 2.13 | 1 | 0 |
| Chondrosarcoma A slowly growing malignant neoplasm derived from cartilage cells, occurring most frequently in pelvic bones or near the ends of long bones, in middle-aged and old people. Most chondrosarcomas arise de novo, but some may develop in a preexisting benign cartilaginous lesion or in patients with ENCHONDROMATOSIS. (Stedman, 25th ed) | 0 | 2.11 | 1 | 0 |
| Cornea Injuries [description not available] | 0 | 2.42 | 2 | 0 |
| Burns, Chemical Burns caused by contact with or exposure to CAUSTICS or strong ACIDS. | 0 | 2.11 | 1 | 0 |
| Leukoma [description not available] | 0 | 2.46 | 2 | 0 |
| Corneal Opacity Disorder occurring in the central or peripheral area of the cornea. The usual degree of transparency becomes relatively opaque. | 0 | 2.46 | 2 | 0 |
| Corneal Injuries Damage or trauma inflicted to the CORNEA by external means. | 0 | 2.42 | 2 | 0 |
| Experimental Leukemia [description not available] | 0 | 4.76 | 12 | 0 |
| Respiratory Tract Diseases Diseases involving the RESPIRATORY SYSTEM. | 0 | 3.4 | 2 | 0 |
| Silicosis A form of pneumoconiosis resulting from inhalation of dust containing crystalline form of SILICON DIOXIDE, usually in the form of quartz. Amorphous silica is relatively nontoxic. | 0 | 2.47 | 2 | 0 |
| Di Guglielmo Disease [description not available] | 0 | 3.59 | 9 | 0 |
| Leukemia, Erythroblastic, Acute A myeloproliferative disorder characterized by neoplastic proliferation of erythroblastic and myeloblastic elements with atypical erythroblasts and myeloblasts in the peripheral blood. | 0 | 3.59 | 9 | 0 |
| Carcinoma, Neuroendocrine A group of carcinomas which share a characteristic morphology, often being composed of clusters and trabecular sheets of round blue cells, granular chromatin, and an attenuated rim of poorly demarcated cytoplasm. Neuroendocrine tumors include carcinoids, small (oat) cell carcinomas, medullary carcinoma of the thyroid, Merkel cell tumor, cutaneous neuroendocrine carcinoma, pancreatic islet cell tumors, and pheochromocytoma. Neurosecretory granules are found within the tumor cells. (Segen, Dictionary of Modern Medicine, 1992) | 0 | 3.71 | 3 | 0 |
| Carcinoma, Small Cell Lung [description not available] | 0 | 2.53 | 2 | 0 |
| Small Cell Lung Carcinoma A form of highly malignant lung cancer that is composed of small ovoid cells (SMALL CELL CARCINOMA). | 0 | 2.53 | 2 | 0 |
| Polyarthritis [description not available] | 0 | 5.1 | 7 | 0 |
| Arthritis Acute or chronic inflammation of JOINTS. | 0 | 5.1 | 7 | 0 |
| Thyroid Nodule A small circumscribed mass in the THYROID GLAND that can be of neoplastic growth or non-neoplastic abnormality. It lacks a well-defined capsule or glandular architecture. Thyroid nodules are often benign but can be malignant. The growth of nodules can lead to a multinodular goiter (GOITER, NODULAR). | 0 | 7.77 | 3 | 0 |
| Autosomal Chromosome Disorders [description not available] | 0 | 4.98 | 9 | 0 |
| Primary Peritonitis [description not available] | 0 | 2.43 | 2 | 0 |
| Intestinal Perforation Opening or penetration through the wall of the INTESTINES. | 0 | 2.13 | 1 | 0 |
| Peritonitis INFLAMMATION of the PERITONEUM lining the ABDOMINAL CAVITY as the result of infectious, autoimmune, or chemical processes. Primary peritonitis is due to infection of the PERITONEAL CAVITY via hematogenous or lymphatic spread and without intra-abdominal source. Secondary peritonitis arises from the ABDOMINAL CAVITY itself through RUPTURE or ABSCESS of intra-abdominal organs. | 0 | 2.43 | 2 | 0 |
| B cepacia Infection [description not available] | 0 | 2.11 | 1 | 0 |
| Allergic Rhinitis [description not available] | 0 | 3.03 | 1 | 0 |
| Rhinitis, Allergic An inflammation of the NASAL MUCOSA triggered by ALLERGENS. | 0 | 3.03 | 1 | 0 |
| Allergy, Drug [description not available] | 0 | 4.43 | 1 | 1 |
| Drug Hypersensitivity Immunologically mediated adverse reactions to medicinal substances used legally or illegally. | 0 | 4.43 | 1 | 1 |
| Acinar Carcinoma [description not available] | 0 | 2.11 | 1 | 0 |
| Carcinoma, Acinar Cell A malignant tumor arising from secreting cells of a racemose gland, particularly the salivary glands. Racemose (Latin racemosus, full of clusters) refers, as does acinar (Latin acinus, grape), to small saclike dilatations in various glands. Acinar cell carcinomas are usually well differentiated and account for about 13% of the cancers arising in the parotid gland. Lymph node metastasis occurs in about 16% of cases. Local recurrences and distant metastases many years after treatment are common. This tumor appears in all age groups and is most common in women. (Stedman, 25th ed; Holland et al., Cancer Medicine, 3d ed, p1240; from DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p575) | 0 | 2.11 | 1 | 0 |
| Bacillus anthracis Infection [description not available] | 0 | 2.74 | 3 | 0 |
| Anthrax An acute infection caused by the spore-forming bacteria BACILLUS ANTHRACIS. It commonly affects hoofed animals such as sheep and goats. Infection in humans often involves the skin (cutaneous anthrax), the lungs (inhalation anthrax), or the gastrointestinal tract. Anthrax is not contagious and can be treated with antibiotics. | 0 | 7.74 | 3 | 0 |
| Acromegaly Due To Pituitary Adenoma [description not available] | 0 | 3.96 | 1 | 0 |
| Adenoma, Basal Cell [description not available] | 0 | 5.2 | 7 | 0 |
| Adenoma A benign epithelial tumor with a glandular organization. | 0 | 5.2 | 7 | 0 |
| Cognition Disorders Disorders characterized by disturbances in mental processes related to learning, thinking, reasoning, and judgment. | 0 | 3.45 | 2 | 0 |
| Leukemia, Megakaryocytic [description not available] | 0 | 2.71 | 3 | 0 |
| Leukemia, Megakaryoblastic, Acute An acute myeloid leukemia in which 20-30% of the bone marrow or peripheral blood cells are of megakaryocyte lineage. MYELOFIBROSIS or increased bone marrow RETICULIN is common. | 0 | 2.71 | 3 | 0 |
| Familial Waldenstrom's Macroglobulinaemia [description not available] | 0 | 2.5 | 2 | 0 |
| Benign Monoclonal Gammopathies [description not available] | 0 | 2.13 | 1 | 0 |
| Waldenstrom Macroglobulinemia A lymphoproliferative disorder characterized by pleomorphic B-LYMPHOCYTES including PLASMA CELLS, with increased levels of monoclonal serum IMMUNOGLOBULIN M. There is lymphoplasmacytic cells infiltration into bone marrow and often other tissues, also known as lymphoplasmacytic lymphoma. Clinical features include ANEMIA; HEMORRHAGES; and hyperviscosity. | 0 | 2.5 | 2 | 0 |
| Anoxia-Ischemia, Brain [description not available] | 0 | 2.95 | 4 | 0 |
| Hypoxia-Ischemia, Brain A disorder characterized by a reduction of oxygen in the blood combined with reduced blood flow (ISCHEMIA) to the brain from a localized obstruction of a cerebral artery or from systemic hypoperfusion. Prolonged hypoxia-ischemia is associated with ISCHEMIC ATTACK, TRANSIENT; BRAIN INFARCTION; BRAIN EDEMA; COMA; and other conditions. | 0 | 2.95 | 4 | 0 |
| Harelip [description not available] | 0 | 2.13 | 1 | 0 |
| Cleft Palate, Isolated [description not available] | 0 | 2.46 | 2 | 0 |
| Anhidrotic Ectodermal Dysplasia [description not available] | 0 | 2.13 | 1 | 0 |
| Cleft Lip Congenital defect in the upper lip where the maxillary prominence fails to merge with the merged medial nasal prominences. It is thought to be caused by faulty migration of the mesoderm in the head region. | 0 | 2.13 | 1 | 0 |
| Cleft Palate Congenital fissure of the soft and/or hard palate, due to faulty fusion. | 0 | 2.46 | 2 | 0 |
| Infections, Listeria [description not available] | 0 | 2.95 | 4 | 0 |
| Ovine Diseases [description not available] | 0 | 2.7 | 3 | 0 |
| Encephalitis, Japanese B [description not available] | 0 | 2.97 | 4 | 0 |
| Encephalitis, Japanese A mosquito-borne encephalitis caused by the Japanese B encephalitis virus (ENCEPHALITIS VIRUS, JAPANESE) occurring throughout Eastern Asia and Australia. The majority of infections occur in children and are subclinical or have features limited to transient fever and gastrointestinal symptoms. Inflammation of the brain, spinal cord, and meninges may occur and lead to transient or permanent neurologic deficits (including a POLIOMYELITIS-like presentation); SEIZURES; COMA; and death. (From Adams et al., Principles of Neurology, 6th ed, p751; Lancet 1998 Apr 11;351(9109):1094-7) | 0 | 2.97 | 4 | 0 |
| Colon Cancer, Familial Nonpolyposis [description not available] | 0 | 2.46 | 2 | 0 |
| Colorectal Neoplasms, Hereditary Nonpolyposis A group of autosomal-dominant inherited diseases in which COLON CANCER arises in discrete adenomas. Unlike FAMILIAL POLYPOSIS COLI with hundreds of polyps, hereditary nonpolyposis colorectal neoplasms occur much later, in the fourth and fifth decades. HNPCC has been associated with germline mutations in mismatch repair (MMR) genes. It has been subdivided into Lynch syndrome I or site-specific colonic cancer, and LYNCH SYNDROME II which includes extracolonic cancer. | 0 | 2.46 | 2 | 0 |
| Airway Hyper-Responsiveness [description not available] | 0 | 4.34 | 4 | 0 |
| Refractory Anemia [description not available] | 0 | 2.13 | 1 | 0 |
| Anemia, Sideroblastic Anemia characterized by the presence of erythroblasts containing excessive deposits of iron in the marrow. | 0 | 2.13 | 1 | 0 |
| Anemia, Refractory A severe sometimes chronic anemia, usually macrocytic in type, that does not respond to ordinary antianemic therapy. | 0 | 2.13 | 1 | 0 |
| Chordoma A malignant tumor arising from the embryonic remains of the notochord. It is also called chordocarcinoma, chordoepithelioma, and notochordoma. (Dorland, 27th ed) | 0 | 2.13 | 1 | 0 |
| Dermatitis Medicamentosa [description not available] | 0 | 3.04 | 1 | 0 |
| Viral Hepatitis, Human [description not available] | 0 | 3.04 | 1 | 0 |
| Hepatitis, Viral, Human INFLAMMATION of the LIVER in humans due to infection by VIRUSES. There are several significant types of human viral hepatitis with infection caused by enteric-transmission (HEPATITIS A; HEPATITIS E) or blood transfusion (HEPATITIS B; HEPATITIS C; and HEPATITIS D). | 0 | 3.04 | 1 | 0 |
| Thyroiditis Inflammatory diseases of the THYROID GLAND. Thyroiditis can be classified into acute (THYROIDITIS, SUPPURATIVE), subacute (granulomatous and lymphocytic), chronic fibrous (Riedel's), chronic lymphocytic (HASHIMOTO DISEASE), transient (POSTPARTUM THYROIDITIS), and other AUTOIMMUNE THYROIDITIS subtypes. | 0 | 2.13 | 1 | 0 |
| Contracture Prolonged shortening of the muscle or other soft tissue around a joint, preventing movement of the joint. | 0 | 7.13 | 1 | 0 |
| Cholangitis Inflammation of the biliary ductal system (BILE DUCTS); intrahepatic, extrahepatic, or both. | 0 | 2.13 | 1 | 0 |
| Bacterial Infections, Gram-Positive [description not available] | 0 | 2.13 | 1 | 0 |
| Gram-Positive Bacterial Infections Infections caused by bacteria that retain the crystal violet stain (positive) when treated by the gram-staining method. | 0 | 2.13 | 1 | 0 |
| Parasitemia The presence of parasites (especially malarial parasites) in the blood. (Dorland, 27th ed) | 0 | 2.13 | 1 | 0 |
| Community Acquired Infection [description not available] | 0 | 2.15 | 1 | 0 |
| Femoral Neoplasms New abnormal growth of tissue in the FEMUR. | 0 | 2.13 | 1 | 0 |
| Zoonoses Diseases of non-human animals that may be transmitted to HUMANS or may be transmitted from humans to non-human animals. | 0 | 2.13 | 1 | 0 |
| Chromosomal Instability An increased tendency to acquire CHROMOSOME ABERRATIONS when various processes involved in chromosome replication, repair, or segregation are dysfunctional. | 0 | 2.15 | 1 | 0 |
| Pterygium An abnormal triangular fold of membrane in the interpalpebral fissure, extending from the conjunctiva to the cornea, being immovably united to the cornea at its apex, firmly attached to the sclera throughout its middle portion, and merged with the conjunctiva at its base. (Dorland, 27th ed) | 0 | 2.15 | 1 | 0 |
| Aura [description not available] | 0 | 4.32 | 4 | 1 |
| Epilepsy A disorder characterized by recurrent episodes of paroxysmal brain dysfunction due to a sudden, disorderly, and excessive neuronal discharge. Epilepsy classification systems are generally based upon: (1) clinical features of the seizure episodes (e.g., motor seizure), (2) etiology (e.g., post-traumatic), (3) anatomic site of seizure origin (e.g., frontal lobe seizure), (4) tendency to spread to other structures in the brain, and (5) temporal patterns (e.g., nocturnal epilepsy). (From Adams et al., Principles of Neurology, 6th ed, p313) | 0 | 4.32 | 4 | 1 |
| Airflow Obstruction, Chronic [description not available] | 0 | 5 | 6 | 0 |
| Pulmonary Disease, Chronic Obstructive A disease of chronic diffuse irreversible airflow obstruction. Subcategories of COPD include CHRONIC BRONCHITIS and PULMONARY EMPHYSEMA. | 0 | 5 | 6 | 0 |
| Onchocerciasis, Ocular Filarial infection of the eyes transmitted from person to person by bites of Onchocerca volvulus-infected black flies. The microfilariae of Onchocerca are thus deposited beneath the skin. They migrate through various tissues including the eye. Those persons infected have impaired vision and up to 20% are blind. The incidence of eye lesions has been reported to be as high as 30% in Central America and parts of Africa. | 0 | 2.15 | 1 | 0 |
| Infections, Vibrio [description not available] | 0 | 2.15 | 1 | 0 |
| Polyploid [description not available] | 0 | 2.66 | 3 | 0 |
| Branch Vein Occlusion [description not available] | 0 | 4.45 | 1 | 1 |
| Intraocular Pressure The pressure of the fluids in the eye. | 0 | 4.77 | 2 | 1 |
| Retinal Vein Occlusion Blockage of the RETINAL VEIN. Those at high risk for this condition include patients with HYPERTENSION; DIABETES MELLITUS; ATHEROSCLEROSIS; and other CARDIOVASCULAR DISEASES. | 0 | 4.45 | 1 | 1 |
| Glaucoma, Neovascular A form of secondary glaucoma which develops as a consequence of another ocular disease and is attributed to the forming of new vessels in the angle of the anterior chamber. | 0 | 4.45 | 1 | 1 |
| Pulmonary Consumption [description not available] | 0 | 5.02 | 39 | 0 |
| Tuberculosis, Pulmonary MYCOBACTERIUM infections of the lung. | 0 | 5.02 | 39 | 0 |
| Arterial Diseases, Carotid [description not available] | 0 | 2.93 | 4 | 0 |
| Carotid Artery Diseases Pathological conditions involving the CAROTID ARTERIES, including the common, internal, and external carotid arteries. ATHEROSCLEROSIS and TRAUMA are relatively frequent causes of carotid artery pathology. | 0 | 2.93 | 4 | 0 |
| AIDS Seroconversion [description not available] | 0 | 3.08 | 5 | 0 |
| Muscular Dystrophy, Animal MUSCULAR DYSTROPHY that occurs in VERTEBRATE animals. | 0 | 3.85 | 4 | 0 |
| Adenoma, Oxyphilic A usually benign glandular tumor composed of oxyphil cells, large cells with small irregular nuclei and dense acidophilic granules due to the presence of abundant MITOCHONDRIA. Oxyphil cells, also known as oncocytes, are found in oncocytomas of the kidney, salivary glands, and endocrine glands. In the thyroid gland, oxyphil cells are known as Hurthle cells and Askanazy cells. | 0 | 7.47 | 4 | 4 |
| Follicular Thyroid Carcinoma [description not available] | 0 | 7.8 | 6 | 4 |
| Carcinoma, Papillary A malignant neoplasm characterized by the formation of numerous, irregular, finger-like projections of fibrous stroma that is covered with a surface layer of neoplastic epithelial cells. (Stedman, 25th ed) | 0 | 8.98 | 8 | 4 |
| Adenocarcinoma, Follicular An adenocarcinoma of the thyroid gland, in which the cells are arranged in the form of follicles. (From Dorland, 27th ed) | 0 | 7.8 | 6 | 4 |
| Tuberculosis, Bovine An infection of cattle caused by MYCOBACTERIUM BOVIS. It is transmissible to man and other animals. | 0 | 4.64 | 10 | 0 |
| Bronchitis Inflammation of the large airways in the lung including any part of the BRONCHI, from the PRIMARY BRONCHI to the TERTIARY BRONCHI. | 0 | 2.04 | 1 | 0 |
| Abnormality, Heart [description not available] | 0 | 2.71 | 3 | 0 |
| Abnormalities, Jaw [description not available] | 0 | 2.04 | 1 | 0 |
| Heart Defects, Congenital Developmental abnormalities involving structures of the heart. These defects are present at birth but may be discovered later in life. | 0 | 2.71 | 3 | 0 |
| Encephalitis, Viral Inflammation of brain parenchymal tissue as a result of viral infection. Encephalitis may occur as primary or secondary manifestation of TOGAVIRIDAE INFECTIONS; HERPESVIRIDAE INFECTIONS; ADENOVIRIDAE INFECTIONS; FLAVIVIRIDAE INFECTIONS; BUNYAVIRIDAE INFECTIONS; PICORNAVIRIDAE INFECTIONS; PARAMYXOVIRIDAE INFECTIONS; ORTHOMYXOVIRIDAE INFECTIONS; RETROVIRIDAE INFECTIONS; and ARENAVIRIDAE INFECTIONS. | 0 | 2.04 | 1 | 0 |
| Cardiovirus Infections Infections caused by viruses of the genus CARDIOVIRUS, family PICORNAVIRIDAE. | 0 | 2.04 | 1 | 0 |
| Gastroenteritis INFLAMMATION of any segment of the GASTROINTESTINAL TRACT from ESOPHAGUS to RECTUM. Causes of gastroenteritis are many including genetic, infection, HYPERSENSITIVITY, drug effects, and CANCER. | 0 | 3.11 | 5 | 0 |
| Anaplastic Astrocytoma [description not available] | 0 | 3.27 | 6 | 0 |
| Astrocytoma Neoplasms of the brain and spinal cord derived from glial cells which vary from histologically benign forms to highly anaplastic and malignant tumors. Fibrillary astrocytomas are the most common type and may be classified in order of increasing malignancy (grades I through IV). In the first two decades of life, astrocytomas tend to originate in the cerebellar hemispheres; in adults, they most frequently arise in the cerebrum and frequently undergo malignant transformation. (From Devita et al., Cancer: Principles and Practice of Oncology, 5th ed, pp2013-7; Holland et al., Cancer Medicine, 3d ed, p1082) | 0 | 3.27 | 6 | 0 |
| Bloom Syndrome An autosomal recessive disorder characterized by telangiectatic ERYTHEMA of the face, photosensitivity, DWARFISM and other abnormalities, and a predisposition toward developing cancer. The Bloom syndrome gene (BLM) encodes a RecQ-like DNA helicase. | 0 | 2.95 | 4 | 0 |
| Fibrosarcoma A sarcoma derived from deep fibrous tissue, characterized by bundles of immature proliferating fibroblasts with variable collagen formation, which tends to invade locally and metastasize by the bloodstream. (Stedman, 25th ed) | 0 | 3.51 | 8 | 0 |
| Neoplasms, Pleural [description not available] | 0 | 2.05 | 1 | 0 |
| Carcinoma, Thymic [description not available] | 0 | 2.68 | 3 | 0 |
| Cancer of the Thymus [description not available] | 0 | 2.69 | 3 | 0 |
| Thymoma A neoplasm originating from thymic tissue, usually benign, and frequently encapsulated. Although it is occasionally invasive, metastases are extremely rare. It consists of any type of thymic epithelial cell as well as lymphocytes that are usually abundant. Malignant lymphomas that involve the thymus, e.g., lymphosarcoma, Hodgkin's disease (previously termed granulomatous thymoma), should not be regarded as thymoma. (From Stedman, 25th ed) | 0 | 2.68 | 3 | 0 |
| Thymus Neoplasms Tumors or cancer of the THYMUS GLAND. | 0 | 2.69 | 3 | 0 |
| Francisella tularensis Infection [description not available] | 0 | 2.42 | 2 | 0 |
| Tularemia A plague-like disease of rodents, transmissible to man. It is caused by FRANCISELLA TULARENSIS and is characterized by fever, chills, headache, backache, and weakness. | 0 | 2.42 | 2 | 0 |
| Electrolytes Substances that dissociate into two or more ions, to some extent, in water. Solutions of electrolytes thus conduct an electric current and can be decomposed by it (ELECTROLYSIS). (Grant & Hackh's Chemical Dictionary, 5th ed) | 0 | 9.95 | 14 | 0 |
| Li-Fraumeni Syndrome Rare autosomal dominant syndrome characterized by mesenchymal and epithelial neoplasms at multiple sites. MUTATION of the p53 tumor suppressor gene, a component of the DNA DAMAGE response pathway, apparently predisposes family members who inherit it to develop certain cancers. The spectrum of cancers in the syndrome was shown to include, in addition to BREAST CANCER and soft tissue sarcomas (SARCOMA); BRAIN TUMORS; OSTEOSARCOMA; LEUKEMIA; and ADRENOCORTICAL CARCINOMA. | 0 | 2.05 | 1 | 0 |
| Diseases, Peripheral Vascular [description not available] | 0 | 6.46 | 5 | 1 |
| Peripheral Vascular Diseases Pathological processes involving any one of the BLOOD VESSELS in the vasculature outside the HEART. | 0 | 6.46 | 5 | 1 |
| Enterically-Transmitted Non-A, Non-B Hepatitis [description not available] | 0 | 2.05 | 1 | 0 |
| Hepatitis E Acute INFLAMMATION of the LIVER in humans; caused by HEPATITIS E VIRUS, a non-enveloped single-stranded RNA virus. Similar to HEPATITIS A, its incubation period is 15-60 days and is enterically transmitted, usually by fecal-oral transmission. | 0 | 2.05 | 1 | 0 |
| Thalassemias [description not available] | 0 | 6.06 | 29 | 0 |
| Thalassemia A group of hereditary hemolytic anemias in which there is decreased synthesis of one or more hemoglobin polypeptide chains. There are several genetic types with clinical pictures ranging from barely detectable hematologic abnormality to severe and fatal anemia. | 0 | 6.06 | 29 | 0 |
| Adnexitis Inflammation of the uterine appendages (ADNEXA UTERI) including infection of the FALLOPIAN TUBES (SALPINGITIS), the ovaries (OOPHORITIS), or the supporting ligaments (PARAMETRITIS). | 0 | 2.05 | 1 | 0 |
| Aberrant Tissue [description not available] | 0 | 2.05 | 1 | 0 |
| Pelvic Inflammatory Disease A spectrum of inflammation involving the female upper genital tract and the supporting tissues. It is usually caused by an ascending infection of organisms from the endocervix. Infection may be confined to the uterus (ENDOMETRITIS), the FALLOPIAN TUBES; (SALPINGITIS); the ovaries (OOPHORITIS), the supporting ligaments (PARAMETRITIS), or may involve several of the above uterine appendages. Such inflammation can lead to functional impairment and infertility. | 0 | 2.05 | 1 | 0 |
| Dehydration The condition that results from excessive loss of water from a living organism. | 0 | 2.05 | 1 | 0 |
| Cancer of Gallbladder [description not available] | 0 | 2.05 | 1 | 0 |
| Gallbladder Neoplasms Tumors or cancer of the gallbladder. | 0 | 2.05 | 1 | 0 |
| Alpers Diffuse Degeneration of Cerebral Gray Matter with Hepatic Cirrhosis [description not available] | 0 | 2.05 | 1 | 0 |
| Condition, Preneoplastic [description not available] | 0 | 3.11 | 5 | 0 |
| Precancerous Conditions Pathological conditions that tend eventually to become malignant. | 0 | 3.11 | 5 | 0 |
| Sarcoma 180 An experimental sarcoma of mice. | 0 | 2.38 | 2 | 0 |
| Avian Flu [description not available] | 0 | 2.75 | 3 | 0 |
| Influenza in Birds Infection of domestic and wild fowl and other BIRDS with INFLUENZA A VIRUS. Avian influenza usually does not sicken birds, but can be highly pathogenic and fatal in domestic POULTRY. | 0 | 2.75 | 3 | 0 |
| Carcinoma, Medullary A carcinoma composed mainly of epithelial elements with little or no stroma. Medullary carcinomas of the breast constitute 5%-7% of all mammary carcinomas; medullary carcinomas of the thyroid comprise 3%-10% of all thyroid malignancies. (From Dorland, 27th ed; DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1141; Segen, Dictionary of Modern Medicine, 1992) | 0 | 7.21 | 4 | 2 |
| Genital Warts [description not available] | 0 | 2.05 | 1 | 0 |
| Fibroma, Shope [description not available] | 0 | 4.77 | 12 | 0 |
| Condylomata Acuminata Sexually transmitted form of anogenital warty growth caused by the human papillomaviruses. | 0 | 2.05 | 1 | 0 |
| Gammapathy, Monoclonal [description not available] | 0 | 2.05 | 1 | 0 |
| Paraproteinemias A group of related diseases characterized by an unbalanced or disproportionate proliferation of immunoglobulin-producing cells, usually from a single clone. These cells frequently secrete a structurally homogeneous immunoglobulin (M-component) and/or an abnormal immunoglobulin. | 0 | 2.05 | 1 | 0 |
| Granulocytic Leukemia [description not available] | 0 | 5.76 | 21 | 1 |
| Peripheral Nerve Diseases [description not available] | 0 | 3.82 | 2 | 1 |
| Leukemia, Myeloid Form of leukemia characterized by an uncontrolled proliferation of the myeloid lineage and their precursors (MYELOID PROGENITOR CELLS) in the bone marrow and other sites. | 0 | 5.76 | 21 | 1 |
| Peripheral Nervous System Diseases Diseases of the peripheral nerves external to the brain and spinal cord, which includes diseases of the nerve roots, ganglia, plexi, autonomic nerves, sensory nerves, and motor nerves. | 0 | 3.82 | 2 | 1 |
| Bacterial Meningitides [description not available] | 0 | 2.94 | 4 | 0 |
| Meningitis, Bacterial Bacterial infections of the leptomeninges and subarachnoid space, frequently involving the cerebral cortex, cranial nerves, cerebral blood vessels, spinal cord, and nerve roots. | 0 | 2.94 | 4 | 0 |
| Gastrointestinal Stromal Neoplasm [description not available] | 0 | 10.17 | 10 | 5 |
| Gastrointestinal Stromal Tumors All tumors in the GASTROINTESTINAL TRACT arising from mesenchymal cells (MESODERM) except those of smooth muscle cells (LEIOMYOMA) or Schwann cells (SCHWANNOMA). | 0 | 10.17 | 10 | 5 |
| Lung Injury, Ventilator-Induced [description not available] | 0 | 2.05 | 1 | 0 |
| African Lymphoma [description not available] | 0 | 3.99 | 14 | 0 |
| Burkitt Lymphoma A form of undifferentiated malignant LYMPHOMA usually found in central Africa, but also reported in other parts of the world. It is commonly manifested as a large osteolytic lesion in the jaw or as an abdominal mass. B-cell antigens are expressed on the immature cells that make up the tumor in virtually all cases of Burkitt lymphoma. The Epstein-Barr virus (HERPESVIRUS 4, HUMAN) has been isolated from Burkitt lymphoma cases in Africa and it is implicated as the causative agent in these cases; however, most non-African cases are EBV-negative. | 0 | 3.99 | 14 | 0 |
| Rida [description not available] | 0 | 3.25 | 6 | 0 |
| Muscle Contraction A process leading to shortening and/or development of tension in muscle tissue. Muscle contraction occurs by a sliding filament mechanism whereby actin filaments slide inward among the myosin filaments. | 0 | 4.15 | 6 | 0 |
| Aspergillus Infection [description not available] | 0 | 2.45 | 2 | 0 |
| Aspergillosis Infections with fungi of the genus ASPERGILLUS. | 0 | 2.45 | 2 | 0 |
| Extensively Drug-Resistant Tuberculosis Tuberculosis resistant to ISONIAZID and RIFAMPIN and at least three of the six main classes of second-line drugs (AMINOGLYCOSIDES; polypeptide agents; FLUOROQUINOLONES; THIOAMIDES; CYCLOSERINE; and PARA-AMINOSALICYLIC ACID) as defined by the CDC. | 0 | 2.05 | 1 | 0 |
| Viremia The presence of viruses in the blood. | 0 | 3.1 | 5 | 0 |
| A-Thalassemia [description not available] | 0 | 2.69 | 3 | 0 |
| alpha-Thalassemia A disorder characterized by reduced synthesis of the alpha chains of hemoglobin. The severity of this condition can vary from mild anemia to death, depending on the number of genes deleted. | 0 | 2.69 | 3 | 0 |
| Coronary Restenosis Recurrent narrowing or constriction of a coronary artery following surgical procedures performed to alleviate a prior obstruction. | 0 | 6.63 | 7 | 1 |
| ALDOB Deficiency [description not available] | 0 | 2.05 | 1 | 0 |
| Carcinoma, Large Cell A tumor of undifferentiated (anaplastic) cells of large size. It is usually bronchogenic. (From Dorland, 27th ed) | 0 | 2.05 | 1 | 0 |
| Indigestion [description not available] | 0 | 2.97 | 1 | 0 |
| Dyspepsia Impaired digestion, especially after eating. | 0 | 2.97 | 1 | 0 |
| Bilateral Wilms Tumor [description not available] | 0 | 2.69 | 3 | 0 |
| Wilms Tumor A malignant kidney tumor, caused by the uncontrolled multiplication of renal stem (blastemal), stromal (STROMAL CELLS), and epithelial (EPITHELIAL CELLS) elements. However, not all three are present in every case. Several genes or chromosomal areas have been associated with Wilms tumor which is usually found in childhood as a firm lump in a child's side or ABDOMEN. | 0 | 2.69 | 3 | 0 |
| Colonic Inertia Symptom characterized by the passage of stool once a week or less. | 0 | 3.44 | 1 | 1 |
| Constipation Infrequent or difficult evacuation of FECES. These symptoms are associated with a variety of causes, including low DIETARY FIBER intake, emotional or nervous disturbances, systemic and structural disorders, drug-induced aggravation, and infections. | 0 | 3.44 | 1 | 1 |
| Nausea An unpleasant sensation in the stomach usually accompanied by the urge to vomit. Common causes are early pregnancy, sea and motion sickness, emotional stress, intense pain, food poisoning, and various enteroviruses. | 0 | 5.95 | 3 | 3 |
| Dermatitis Any inflammation of the skin. | 0 | 3.87 | 4 | 0 |
| Cystic Kidney Diseases [description not available] | 0 | 2.05 | 1 | 0 |
| Aqueductal Stenosis [description not available] | 0 | 2.05 | 1 | 0 |
| Situs Inversus A congenital abnormality in which organs in the THORAX and the ABDOMEN are opposite to their normal positions (situs solitus) due to lateral transposition. Normally the STOMACH and SPLEEN are on the left, LIVER on the right, the three-lobed right lung is on the right, and the two-lobed left lung on the left. Situs inversus has a familial pattern and has been associated with a number of genes related to microtubule-associated proteins. | 0 | 2.05 | 1 | 0 |
| Kidney Diseases, Cystic A heterogeneous group of hereditary and acquired disorders in which the KIDNEY contains one or more CYSTS unilaterally or bilaterally (KIDNEY, CYSTIC). | 0 | 2.05 | 1 | 0 |
| Polyomavirus Infections Infections with POLYOMAVIRUS, which are often cultured from the urine of kidney transplant patients. Excretion of BK VIRUS is associated with ureteral strictures and CYSTITIS, and that of JC VIRUS with progressive multifocal leukoencephalopathy (LEUKOENCEPHALOPATHY, PROGRESSIVE MULTIFOCAL). | 0 | 3.38 | 2 | 0 |
| Coccidioides immitis Infection [description not available] | 0 | 2.05 | 1 | 0 |
| Fungal Lung Diseases [description not available] | 0 | 2.05 | 1 | 0 |
| Coccidioidomycosis Infection with a fungus of the genus COCCIDIOIDES, endemic to the SOUTHWESTERN UNITED STATES. It is sometimes called valley fever but should not be confused with RIFT VALLEY FEVER. Infection is caused by inhalation of airborne, fungal particles known as arthroconidia, a form of FUNGAL SPORES. A primary form is an acute, benign, self-limited respiratory infection. A secondary form is a virulent, severe, chronic, progressive granulomatous disease with systemic involvement. It can be detected by use of COCCIDIOIDIN. | 0 | 2.05 | 1 | 0 |
| Groenblad-Strandberg Syndrome [description not available] | 0 | 2.05 | 1 | 0 |
| Pseudoxanthoma Elasticum An inherited disorder of connective tissue with extensive degeneration and calcification of ELASTIC TISSUE primarily in the skin, eye, and vasculature. At least two forms exist, autosomal recessive and autosomal dominant. This disorder is caused by mutations of one of the ATP-BINDING CASSETTE TRANSPORTERS. Patients are predisposed to MYOCARDIAL INFARCTION and GASTROINTESTINAL HEMORRHAGE. | 0 | 2.05 | 1 | 0 |
| Dysembryoma [description not available] | 0 | 3.08 | 5 | 0 |
| Teratoma A true neoplasm composed of a number of different types of tissue, none of which is native to the area in which it occurs. It is composed of tissues that are derived from three germinal layers, the endoderm, mesoderm, and ectoderm. They are classified histologically as mature (benign) or immature (malignant). (From DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1642) | 0 | 3.08 | 5 | 0 |
| Besnier-Boeck Disease [description not available] | 0 | 2.44 | 2 | 0 |
| Sarcoidosis An idiopathic systemic inflammatory granulomatous disorder comprised of epithelioid and multinucleated giant cells with little necrosis. It usually invades the lungs with fibrosis and may also involve lymph nodes, skin, liver, spleen, eyes, phalangeal bones, and parotid glands. | 0 | 2.44 | 2 | 0 |
| Bacterial Conjunctivitides [description not available] | 0 | 2.05 | 1 | 0 |
| Conjunctivitis, Bacterial Purulent infections of the conjunctiva by several species of gram-negative, gram-positive, or acid-fast organisms. Some of the more commonly found genera causing conjunctival infections are Haemophilus, Streptococcus, Neisseria, and Chlamydia. | 0 | 2.05 | 1 | 0 |
| Bile Duct Obstruction, Extrahepatic [description not available] | 0 | 2.05 | 1 | 0 |
| Brain Dead [description not available] | 0 | 2.05 | 1 | 0 |
| Animal Mammary Carcinoma [description not available] | 0 | 2.71 | 3 | 0 |
| Encephalopathy, Toxic [description not available] | 0 | 2.47 | 2 | 0 |
| Cardiac Edema [description not available] | 0 | 2.06 | 1 | 0 |
| Edema, Cardiac Abnormal fluid retention by the body due to impaired cardiac function or heart failure. It is usually characterized by increase in venous and capillary pressure, and swollen legs when standing. It is different from the generalized edema caused by renal dysfunction (NEPHROTIC SYNDROME). | 0 | 2.06 | 1 | 0 |
| Enterovirus Infections Diseases caused by ENTEROVIRUS. | 0 | 3.08 | 5 | 0 |
| HbS Disease [description not available] | 0 | 5.45 | 15 | 0 |
| Anemia, Sickle Cell A disease characterized by chronic hemolytic anemia, episodic painful crises, and pathologic involvement of many organs. It is the clinical expression of homozygosity for hemoglobin S. | 0 | 5.45 | 15 | 0 |
| Cancer of Eye [description not available] | 0 | 2.06 | 1 | 0 |
| Weight Gain Increase in BODY WEIGHT over existing weight. | 0 | 2.95 | 4 | 0 |
| Christmas Disease [description not available] | 0 | 3.08 | 5 | 0 |
| Hemophilia B A deficiency of blood coagulation factor IX inherited as an X-linked disorder. (Also known as Christmas Disease, after the first patient studied in detail, not the holy day.) Historical and clinical features resemble those in classic hemophilia (HEMOPHILIA A), but patients present with fewer symptoms. Severity of bleeding is usually similar in members of a single family. Many patients are asymptomatic until the hemostatic system is stressed by surgery or trauma. Treatment is similar to that for hemophilia A. (From Cecil Textbook of Medicine, 19th ed, p1008) | 0 | 3.08 | 5 | 0 |
| Epithelial Ovarian Cancer [description not available] | 0 | 2.06 | 1 | 0 |
| Epithelial Neoplasms [description not available] | 0 | 2.44 | 2 | 0 |
| Carcinoma, Ovarian Epithelial A malignant neoplasm that originates in cells on the surface EPITHELIUM of the ovary and is the most common form of ovarian cancer. There are five histologic subtypes: papillary serous, endometrioid, mucinous, clear cell, and transitional cell. Mutations in BRCA1, OPCML, PRKN, PIK3CA, AKT1, CTNNB1, RRAS2, and CDH1 genes are associated with this cancer. | 0 | 2.06 | 1 | 0 |
| Phlegmon [description not available] | 0 | 2.05 | 1 | 0 |
| Dental Focal Infection [description not available] | 0 | 2.05 | 1 | 0 |
| Cellulitis An acute, diffuse, and suppurative inflammation of loose connective tissue, particularly the deep subcutaneous tissues, and sometimes muscle, which is most commonly seen as a result of infection of a wound, ulcer, or other skin lesions. | 0 | 2.05 | 1 | 0 |
| Hypothermia, Accidental [description not available] | 0 | 2.42 | 2 | 0 |
| Hypothermia Lower than normal body temperature, especially in warm-blooded animals. | 0 | 2.42 | 2 | 0 |
| Mastitis, Bovine INFLAMMATION of the UDDER in cows. | 0 | 2.44 | 2 | 0 |
| Allodynia [description not available] | 0 | 2.72 | 3 | 0 |
| Pemphigus Foliaceus [description not available] | 0 | 2.06 | 1 | 0 |
| Pemphigus Group of chronic blistering diseases characterized histologically by ACANTHOLYSIS and blister formation within the EPIDERMIS. | 0 | 2.06 | 1 | 0 |
| Familial Nonmedullary Thyroid Cancer [description not available] | 0 | 2.47 | 2 | 0 |
| Ph 1 Chromosome [description not available] | 0 | 3.11 | 5 | 0 |
| Hutchinson Gilford Progeria Syndrome [description not available] | 0 | 2.98 | 1 | 0 |
| Progeria An abnormal congenital condition, associated with defects in the LAMIN TYPE A gene, which is characterized by premature aging in children, where all the changes of cell senescence occur. It is manifested by premature graying; hair loss; hearing loss (DEAFNESS); cataracts (CATARACT); ARTHRITIS; OSTEOPOROSIS; DIABETES MELLITUS; atrophy of subcutaneous fat; skeletal hypoplasia; elevated urinary HYALURONIC ACID; and accelerated ATHEROSCLEROSIS. Many affected individuals develop malignant tumors, especially SARCOMA. | 0 | 2.98 | 1 | 0 |
| Behavior Disorders [description not available] | 0 | 2.07 | 1 | 0 |
| Mental Disorders Psychiatric illness or diseases manifested by breakdowns in the adaptational process expressed primarily as abnormalities of thought, feeling, and behavior producing either distress or impairment of function. | 0 | 2.07 | 1 | 0 |
| Allergic Conjunctivitis [description not available] | 0 | 4.37 | 1 | 1 |
| Rhinitis, Allergic, Nonseasonal [description not available] | 0 | 4.37 | 1 | 1 |
| Conjunctivitis, Allergic Conjunctivitis due to hypersensitivity to various allergens. | 0 | 4.37 | 1 | 1 |
| Rhinitis, Allergic, Perennial Inflammation of the mucous membrane of the nose similar to that found in hay fever except that symptoms persist throughout the year. The causes are usually air-borne allergens, particularly dusts, feathers, molds, animal fur, etc. | 0 | 4.37 | 1 | 1 |
| Injuries Used with anatomic headings, animals, and sports for wounds and injuries. Excludes cell damage, for which pathology is used. | 0 | 2.43 | 2 | 0 |
| Wounds and Injuries Damage inflicted on the body as the direct or indirect result of an external force, with or without disruption of structural continuity. | 0 | 2.43 | 2 | 0 |
| Adult Premature Aging Syndrome [description not available] | 0 | 2.06 | 1 | 0 |
| Berger Disease [description not available] | 0 | 2.06 | 1 | 0 |
| Glomerulonephritis, IGA A chronic form of glomerulonephritis characterized by deposits of predominantly IMMUNOGLOBULIN A in the mesangial area (GLOMERULAR MESANGIUM). Deposits of COMPLEMENT C3 and IMMUNOGLOBULIN G are also often found. Clinical features may progress from asymptomatic HEMATURIA to END-STAGE KIDNEY DISEASE. | 0 | 2.06 | 1 | 0 |
| Emesis [description not available] | 0 | 5.3 | 2 | 2 |
| Vomiting The forcible expulsion of the contents of the STOMACH through the MOUTH. | 0 | 5.3 | 2 | 2 |
| Monosomy The condition in which one chromosome of a pair is missing. In a normally diploid cell it is represented symbolically as 2N-1. | 0 | 2.69 | 3 | 0 |
| Plasmodium falciparum Malaria [description not available] | 0 | 2.42 | 2 | 0 |
| Malaria, Falciparum Malaria caused by PLASMODIUM FALCIPARUM. This is the severest form of malaria and is associated with the highest levels of parasites in the blood. This disease is characterized by irregularly recurring febrile paroxysms that in extreme cases occur with acute cerebral, renal, or gastrointestinal manifestations. | 0 | 2.42 | 2 | 0 |
| Enlarged Spleen [description not available] | 0 | 3.51 | 8 | 0 |
| Fibrous Tissue Neoplasms [description not available] | 0 | 2.06 | 1 | 0 |
| Chromosomal Duplication [description not available] | 0 | 2.06 | 1 | 0 |
| 17p11.2 Monosomy [description not available] | 0 | 2.06 | 1 | 0 |
| Smith-Magenis Syndrome Complex neurobehavioral disorder characterized by distinctive facial features (FACIES), developmental delay and INTELLECTUAL DISABILITY. Behavioral phenotypes include sleep disturbance, maladaptive, self-injurious and attention-seeking behaviors. The sleep disturbance is linked to an abnormal circadian secretion pattern of MELATONIN. The syndrome is associated with de novo deletion or mutation and HAPLOINSUFFICIENCY of the retinoic acid-induced 1 protein on chromosome 17p11.2. | 0 | 2.06 | 1 | 0 |
| Celiac Sprue [description not available] | 0 | 2.07 | 1 | 0 |
| Celiac Disease A malabsorption syndrome that is precipitated by the ingestion of foods containing GLUTEN, such as wheat, rye, and barley. It is characterized by INFLAMMATION of the SMALL INTESTINE, loss of MICROVILLI structure, failed INTESTINAL ABSORPTION, and MALNUTRITION. | 0 | 2.07 | 1 | 0 |
| Encephalitis, West Nile Fever [description not available] | 0 | 2.44 | 2 | 0 |
| West Nile Fever A mosquito-borne viral illness caused by the WEST NILE VIRUS, a FLAVIVIRUS and endemic to regions of Africa, Asia, and Europe. Common clinical features include HEADACHE; FEVER; maculopapular rash; gastrointestinal symptoms; and lymphadenopathy. MENINGITIS; ENCEPHALITIS; and MYELITIS may also occur. The disease may occasionally be fatal or leave survivors with residual neurologic deficits. (From Joynt, Clinical Neurology, 1996, Ch26, p13; Lancet 1998 Sep 5;352(9130):767-71) | 0 | 2.44 | 2 | 0 |
| Albuminuria The presence of albumin in the urine, an indicator of KIDNEY DISEASES. | 0 | 2.07 | 1 | 0 |
| Proteinuria The presence of proteins in the urine, an indicator of KIDNEY DISEASES. | 0 | 4.5 | 5 | 1 |
| Cranial Nerve II Diseases [description not available] | 0 | 2.07 | 1 | 0 |
| Optic Nerve Diseases Conditions which produce injury or dysfunction of the second cranial or optic nerve, which is generally considered a component of the central nervous system. Damage to optic nerve fibers may occur at or near their origin in the retina, at the optic disk, or in the nerve, optic chiasm, optic tract, or lateral geniculate nuclei. Clinical manifestations may include decreased visual acuity and contrast sensitivity, impaired color vision, and an afferent pupillary defect. | 0 | 2.07 | 1 | 0 |
| 46, XY Gonadal Dysgenesis [description not available] | 0 | 2.07 | 1 | 0 |
| Anoxia, Brain [description not available] | 0 | 2.07 | 1 | 0 |
| Complications, Infectious Pregnancy [description not available] | 0 | 2.07 | 1 | 0 |
| Xeroderma [description not available] | 0 | 2.45 | 2 | 0 |
| Ichthyosis Any of several generalized skin disorders characterized by dryness, roughness, and scaliness, due to hypertrophy of the stratum corneum epidermis. Most are genetic, but some are acquired, developing in association with other systemic disease or genetic syndrome. | 0 | 2.45 | 2 | 0 |
| Neisseria gonorrhoeae Infection [description not available] | 0 | 2.4 | 2 | 0 |
| Gonorrhea Acute infectious disease characterized by primary invasion of the urogenital tract. The etiologic agent, NEISSERIA GONORRHOEAE, was isolated by Neisser in 1879. | 0 | 2.4 | 2 | 0 |
| Hereditary Optic Neuroretinopathy [description not available] | 0 | 2.07 | 1 | 0 |
| Optic Atrophy, Hereditary, Leber A maternally linked genetic disorder that presents in mid-life as acute or subacute central vision loss leading to central scotoma and blindness. The disease has been associated with missense mutations in the mtDNA, in genes for Complex I, III, and IV polypeptides, that can act autonomously or in association with each other to cause the disease. (from Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim/, MIM#535000 (April 17, 2001)) | 0 | 2.07 | 1 | 0 |
| Dementia Praecox [description not available] | 0 | 4.79 | 7 | 1 |
| Schizophrenia A severe emotional disorder of psychotic depth characteristically marked by a retreat from reality with delusion formation, HALLUCINATIONS, emotional disharmony, and regressive behavior. | 0 | 4.79 | 7 | 1 |
| Cataract, Membranous [description not available] | 0 | 2.99 | 1 | 0 |
| Cataract Partial or complete opacity on or in the lens or capsule of one or both eyes, impairing vision or causing blindness. The many kinds of cataract are classified by their morphology (size, shape, location) or etiology (cause and time of occurrence). (Dorland, 27th ed) | 0 | 2.99 | 1 | 0 |
| Black Fever [description not available] | 0 | 2.71 | 3 | 0 |
| Leishmaniasis, Visceral A chronic disease caused by LEISHMANIA DONOVANI and transmitted by the bite of several sandflies of the genera Phlebotomus and Lutzomyia. It is commonly characterized by fever, chills, vomiting, anemia, hepatosplenomegaly, leukopenia, hypergammaglobulinemia, emaciation, and an earth-gray color of the skin. The disease is classified into three main types according to geographic distribution: Indian, Mediterranean (or infantile), and African. | 0 | 2.71 | 3 | 0 |
| Coxsackie Virus Infections [description not available] | 0 | 2.93 | 4 | 0 |
| Infections, RNA Virus [description not available] | 0 | 3.65 | 3 | 0 |
| DNA Virus Infections Diseases caused by DNA VIRUSES. | 0 | 3.35 | 2 | 0 |
| Classical Niemann-Pick Disease [description not available] | 0 | 2.07 | 1 | 0 |
| Niemann-Pick Disease, Type A The classic infantile form of Niemann-Pick Disease, caused by mutation in SPHINGOMYELIN PHOSPHODIESTERASE. It is characterized by accumulation of SPHINGOMYELINS in the cells of the MONONUCLEAR PHAGOCYTE SYSTEM and other cell throughout the body leading to cell death. Clinical signs include JAUNDICE, hepatosplenomegaly, and severe brain damage. | 0 | 2.07 | 1 | 0 |
| Sexually Transmitted Diseases Diseases due to or propagated by sexual contact. | 0 | 2.07 | 1 | 0 |
| Astroviridae Infections Infections with ASTROVIRIDAE, causing gastroenteritis in human infants, calves, lambs, and piglets. | 0 | 2.07 | 1 | 0 |
| Stunted Growth [description not available] | 0 | 2.41 | 2 | 0 |
| Poultry Diseases Diseases of birds which are raised as a source of meat or eggs for human consumption and are usually found in barnyards, hatcheries, etc. The concept is differentiated from BIRD DISEASES which is for diseases of birds not considered poultry and usually found in zoos, parks, and the wild. | 0 | 4.32 | 4 | 1 |
| Symptom Cluster [description not available] | 0 | 4.42 | 8 | 0 |
| Growth Disorders Deviations from the average values for a specific age and sex in any or all of the following: height, weight, skeletal proportions, osseous development, or maturation of features. Included here are both acceleration and retardation of growth. | 0 | 2.41 | 2 | 0 |
| Syndrome A characteristic symptom complex. | 0 | 4.42 | 8 | 0 |
| Salmonella Infections, Animal Infections in animals with bacteria of the genus SALMONELLA. | 0 | 2.42 | 2 | 0 |
| Cancer of the Retina [description not available] | 0 | 2.07 | 1 | 0 |
| Benign Psychomotor Epilepsy, Childhood [description not available] | 0 | 2.07 | 1 | 0 |
| Epilepsy, Temporal Lobe A localization-related (focal) form of epilepsy characterized by recurrent seizures that arise from foci within the TEMPORAL LOBE, most commonly from its mesial aspect. A wide variety of psychic phenomena may be associated, including illusions, hallucinations, dyscognitive states, and affective experiences. The majority of complex partial seizures (see EPILEPSY, COMPLEX PARTIAL) originate from the temporal lobes. Temporal lobe seizures may be classified by etiology as cryptogenic, familial, or symptomatic. (From Adams et al., Principles of Neurology, 6th ed, p321). | 0 | 2.07 | 1 | 0 |
| Female Genital Neoplasms [description not available] | 0 | 3.32 | 2 | 0 |
| Genital Neoplasms, Female Tumor or cancer of the female reproductive tract (GENITALIA, FEMALE). | 0 | 3.32 | 2 | 0 |
| Lymphocytosis Excess of normal lymphocytes in the blood or in any effusion. | 0 | 2.07 | 1 | 0 |
| Albinism General term for a number of inherited defects of amino acid metabolism in which there is a deficiency or absence of pigment in the eyes, skin, or hair. | 0 | 4.03 | 5 | 0 |
| Vitiligo A disorder consisting of areas of macular depigmentation, commonly on extensor aspects of extremities, on the face or neck, and in skin folds. Age of onset is often in young adulthood and the condition tends to progress gradually with lesions enlarging and extending until a quiescent state is reached. | 0 | 2.07 | 1 | 0 |
| Aneurysm, Thoracic Aortic [description not available] | 0 | 2.08 | 1 | 0 |
| Aortic Dissection [description not available] | 0 | 2.08 | 1 | 0 |
| Aortic Aneurysm, Thoracic An abnormal balloon- or sac-like dilatation in the wall of the THORACIC AORTA. This proximal descending portion of aorta gives rise to the visceral and the parietal branches above the aortic hiatus at the diaphragm. | 0 | 2.08 | 1 | 0 |
| Deafness, Transitory [description not available] | 0 | 2.07 | 1 | 0 |
| Hearing Loss A general term for the complete or partial loss of the ability to hear from one or both ears. | 0 | 2.07 | 1 | 0 |
| Chronic Progressive Multiple Sclerosis [description not available] | 0 | 3 | 1 | 0 |
| Acute Relapsing Multiple Sclerosis [description not available] | 0 | 3 | 1 | 0 |
| Multiple Sclerosis, Chronic Progressive A form of multiple sclerosis characterized by a progressive deterioration in neurologic function which is in contrast to the more typical relapsing remitting form. If the clinical course is free of distinct remissions, it is referred to as primary progressive multiple sclerosis. When the progressive decline is punctuated by acute exacerbations, it is referred to as progressive relapsing multiple sclerosis. The term secondary progressive multiple sclerosis is used when relapsing remitting multiple sclerosis evolves into the chronic progressive form. (From Ann Neurol 1994;36 Suppl:S73-S79; Adams et al., Principles of Neurology, 6th ed, pp903-914) | 0 | 3 | 1 | 0 |
| Multiple Sclerosis, Relapsing-Remitting The most common clinical variant of MULTIPLE SCLEROSIS, characterized by recurrent acute exacerbations of neurologic dysfunction followed by partial or complete recovery. Common clinical manifestations include loss of visual (see OPTIC NEURITIS), motor, sensory, or bladder function. Acute episodes of demyelination may occur at any site in the central nervous system, and commonly involve the optic nerves, spinal cord, brain stem, and cerebellum. (Adams et al., Principles of Neurology, 6th ed, pp903-914) | 0 | 3 | 1 | 0 |
| Hepatoblastoma A malignant neoplasm occurring in young children, primarily in the liver, composed of tissue resembling embryonal or fetal hepatic epithelium, or mixed epithelial and mesenchymal tissues. (Stedman, 25th ed) | 0 | 2.44 | 2 | 0 |
| Nerve Degeneration Loss of functional activity and trophic degeneration of nerve axons and their terminal arborizations following the destruction of their cells of origin or interruption of their continuity with these cells. The pathology is characteristic of neurodegenerative diseases. Often the process of nerve degeneration is studied in research on neuroanatomical localization and correlation of the neurophysiology of neural pathways. | 0 | 3.84 | 4 | 0 |
| Constitutional Liver Dysfunction [description not available] | 0 | 2.08 | 1 | 0 |
| Dysgeusia A condition characterized by alterations of the sense of taste which may range from mild to severe, including gross distortions of taste quality. | 0 | 2.08 | 1 | 0 |
| Peritoneal Carcinomatosis [description not available] | 0 | 3.82 | 2 | 1 |
| Cancer of the Fallopian Tube [description not available] | 0 | 3.47 | 1 | 1 |
| Fallopian Tube Neoplasms Benign or malignant neoplasms of the FALLOPIAN TUBES. They are uncommon. If they develop, they may be located in the wall or within the lumen as a growth attached to the wall by a stalk. | 0 | 3.47 | 1 | 1 |
| Peritoneal Neoplasms Tumors or cancer of the PERITONEUM. | 0 | 3.82 | 2 | 1 |
| Urinary Tract Infections Inflammatory responses of the epithelium of the URINARY TRACT to microbial invasions. They are often bacterial infections with associated BACTERIURIA and PYURIA. | 0 | 2.08 | 1 | 0 |
| Infections, Mycobacterium [description not available] | 0 | 2.42 | 2 | 0 |
| Rodent Diseases Diseases of rodents of the order RODENTIA. This term includes diseases of Sciuridae (squirrels), Geomyidae (gophers), Heteromyidae (pouched mice), Castoridae (beavers), Cricetidae (rats and mice), Muridae (Old World rats and mice), Erethizontidae (porcupines), and Caviidae (guinea pigs). | 0 | 2.01 | 1 | 0 |
| Mycobacterium Infections Infections with bacteria of the genus MYCOBACTERIUM. | 0 | 2.42 | 2 | 0 |
| Arthritis, Post-Infectious [description not available] | 0 | 2.42 | 2 | 0 |
| Arthritis, Reactive An aseptic, inflammatory arthritis developing secondary to a primary extra-articular infection, most typically of the GASTROINTESTINAL TRACT or UROGENITAL SYSTEM. The initiating trigger pathogens are usually SHIGELLA; SALMONELLA; YERSINIA; CAMPYLOBACTER; or CHLAMYDIA TRACHOMATIS. Reactive arthritis is strongly associated with HLA-B27 ANTIGEN. | 0 | 2.42 | 2 | 0 |
| Genital Herpes [description not available] | 0 | 7.71 | 3 | 0 |
| Herpes Genitalis Infection of the genitals (GENITALIA) with HERPES SIMPLEX VIRUS in either the males or the females. | 0 | 2.71 | 3 | 0 |
| Albinism, Cutaneous [description not available] | 0 | 2.39 | 2 | 0 |
| Mesothelioma A tumor derived from mesothelial tissue (peritoneum, pleura, pericardium). It appears as broad sheets of cells, with some regions containing spindle-shaped, sarcoma-like cells and other regions showing adenomatous patterns. Pleural mesotheliomas have been linked to exposure to asbestos. (Dorland, 27th ed) | 0 | 7.01 | 1 | 0 |
| Anemia, Hypoplastic [description not available] | 0 | 2.38 | 2 | 0 |
| Dyskeratosis Congenita, X-Linked [description not available] | 0 | 2.01 | 1 | 0 |
| Anemia, Aplastic A form of anemia in which the bone marrow fails to produce adequate numbers of peripheral blood elements. | 0 | 2.38 | 2 | 0 |
| Dyskeratosis Congenita A predominantly X-linked recessive syndrome characterized by a triad of reticular skin pigmentation, nail dystrophy and leukoplakia of mucous membranes. Oral and dental abnormalities may also be present. Complications are a predisposition to malignancy and bone marrow involvement with pancytopenia. (from Int J Paediatr Dent 2000 Dec;10(4):328-34) The X-linked form is also known as Zinsser-Cole-Engman syndrome and involves the gene which encodes a highly conserved protein called dyskerin. | 0 | 2.01 | 1 | 0 |
| Hepatic Failure [description not available] | 0 | 2.01 | 1 | 0 |
| Liver Failure Severe inability of the LIVER to perform its normal metabolic functions, as evidenced by severe JAUNDICE and abnormal serum levels of AMMONIA; BILIRUBIN; ALKALINE PHOSPHATASE; ASPARTATE AMINOTRANSFERASE; LACTATE DEHYDROGENASES; and albumin/globulin ratio. (Blakiston's Gould Medical Dictionary, 4th ed) | 0 | 2.01 | 1 | 0 |
| Ataxia Telangiectasia Syndrome [description not available] | 0 | 2.69 | 3 | 0 |
| Ataxia Telangiectasia An autosomal recessive inherited disorder characterized by choreoathetosis beginning in childhood, progressive CEREBELLAR ATAXIA; TELANGIECTASIS of CONJUNCTIVA and SKIN; DYSARTHRIA; B- and T-cell immunodeficiency, and RADIOSENSITIVITY to IONIZING RADIATION. Affected individuals are prone to recurrent sinobronchopulmonary infections, lymphoreticular neoplasms, and other malignancies. Serum ALPHA-FETOPROTEINS are usually elevated. (Menkes, Textbook of Child Neurology, 5th ed, p688) The gene for this disorder (ATM) encodes a cell cycle checkpoint protein kinase and has been mapped to chromosome 11 (11q22-q23). | 0 | 2.69 | 3 | 0 |
| Embryopathies [description not available] | 0 | 3.68 | 10 | 0 |
| Cardiovascular Pregnancy Complications [description not available] | 0 | 2.01 | 1 | 0 |
| Exertional Heat Illness [description not available] | 0 | 2.41 | 2 | 0 |
| Peripheral Nerve Injury [description not available] | 0 | 2.01 | 1 | 0 |
| Peripheral Nerve Injuries Injuries to the PERIPHERAL NERVES. | 0 | 2.01 | 1 | 0 |
| Nasal Catarrh [description not available] | 0 | 3.35 | 2 | 0 |
| Rhinitis Inflammation of the NASAL MUCOSA, the mucous membrane lining the NASAL CAVITIES. | 0 | 3.35 | 2 | 0 |
| Infection [description not available] | 0 | 3.34 | 2 | 0 |
| Infections Invasion of the host organism by microorganisms or their toxins or by parasites that can cause pathological conditions or diseases. | 0 | 3.34 | 2 | 0 |
| Neoplasms, Bronchial [description not available] | 0 | 2.01 | 1 | 0 |
| Bronchial Neoplasms Tumors or cancer of the BRONCHI. | 0 | 2.01 | 1 | 0 |
| Cancer of Spleen [description not available] | 0 | 2.01 | 1 | 0 |
| Bilirubinemia [description not available] | 0 | 2.93 | 1 | 0 |
| Leukostasis Abnormal intravascular leukocyte aggregation and clumping often seen in leukemia patients. The brain and lungs are the two most commonly affected organs. This acute syndrome requires aggressive cytoreductive modalities including chemotherapy and/or leukophoresis. It is differentiated from LEUKEMIC INFILTRATION which is a neoplastic process where leukemic cells invade organs. | 0 | 2.93 | 1 | 0 |
| Leukemia P388 An experimental lymphocytic leukemia originally induced in DBA/2 mice by painting with methylcholanthrene. | 0 | 2.69 | 3 | 0 |
| Gargoylism, Hunter Syndrome [description not available] | 0 | 2.4 | 2 | 0 |
| Mucopolysaccharidosis II Systemic lysosomal storage disease marked by progressive physical deterioration and caused by a deficiency of L-sulfoiduronate sulfatase. This disease differs from MUCOPOLYSACCHARIDOSIS I by slower progression, lack of corneal clouding, and X-linked rather than autosomal recessive inheritance. The mild form produces near-normal intelligence and life span. The severe form usually causes death by age 15. | 0 | 2.4 | 2 | 0 |
| Dyskinesia, Medication-Induced [description not available] | 0 | 2.01 | 1 | 0 |
| Dyskinesia, Drug-Induced Abnormal movements, including HYPERKINESIS; HYPOKINESIA; TREMOR; and DYSTONIA, associated with the use of certain medications or drugs. Muscles of the face, trunk, neck, and extremities are most commonly affected. Tardive dyskinesia refers to abnormal hyperkinetic movements of the muscles of the face, tongue, and neck associated with the use of neuroleptic agents (see ANTIPSYCHOTIC AGENTS). (Adams et al., Principles of Neurology, 6th ed, p1199) | 0 | 2.01 | 1 | 0 |
| Elaeophoriasis [description not available] | 0 | 2.01 | 1 | 0 |
| Granulomas [description not available] | 0 | 2.42 | 2 | 0 |
| Lung Diseases, Parasitic Infections of the lungs with parasites, most commonly by parasitic worms (HELMINTHS). | 0 | 2.01 | 1 | 0 |
| Filariasis Infections with nematodes of the superfamily FILARIOIDEA. The presence of living worms in the body is mainly asymptomatic but the death of adult worms leads to granulomatous inflammation and permanent fibrosis. Organisms of the genus Elaeophora infect wild elk and domestic sheep causing ischemic necrosis of the brain, blindness, and dermatosis of the face. | 0 | 2.01 | 1 | 0 |
| Granuloma A relatively small nodular inflammatory lesion containing grouped mononuclear phagocytes, caused by infectious and noninfectious agents. | 0 | 2.42 | 2 | 0 |
| Contact Dermatitis [description not available] | 0 | 4.02 | 5 | 0 |
| Dermatitis, Contact A type of acute or chronic skin reaction in which sensitivity is manifested by reactivity to materials or substances coming in contact with the skin. It may involve allergic or non-allergic mechanisms. | 0 | 4.02 | 5 | 0 |
| Arteriosclerosis Thickening and loss of elasticity of the walls of ARTERIES of all sizes. There are many forms classified by the types of lesions and arteries involved, such as ATHEROSCLEROSIS with fatty lesions in the ARTERIAL INTIMA of medium and large muscular arteries. | 0 | 5.81 | 8 | 1 |
| Congenital Adrenal Hyperplasia [description not available] | 0 | 8.59 | 9 | 0 |
| Adrenal Hyperplasia, Congenital A group of inherited disorders of the ADRENAL GLANDS, caused by enzyme defects in the synthesis of cortisol (HYDROCORTISONE) and/or ALDOSTERONE leading to accumulation of precursors for ANDROGENS. Depending on the hormone imbalance, congenital adrenal hyperplasia can be classified as salt-wasting, hypertensive, virilizing, or feminizing. Defects in STEROID 21-HYDROXYLASE; STEROID 11-BETA-HYDROXYLASE; STEROID 17-ALPHA-HYDROXYLASE; 3-beta-hydroxysteroid dehydrogenase (3-HYDROXYSTEROID DEHYDROGENASES); TESTOSTERONE 5-ALPHA-REDUCTASE; or steroidogenic acute regulatory protein; among others, underlie these disorders. | 0 | 3.59 | 9 | 0 |
| Protozoan Infections, Animal Infections with unicellular organisms formerly members of the subkingdom Protozoa. The infections may be experimental or veterinary. | 0 | 2.01 | 1 | 0 |
| Rhabdomyosarcoma, Embryonal A form of RHABDOMYOSARCOMA arising primarily in the head and neck, especially the orbit, of children below the age of 10. The cells are smaller than those of other rhabdomyosarcomas and are of two basic cell types: spindle cells and round cells. This cancer is highly sensitive to chemotherapy and has a high cure rate with multi-modality therapy. (From Holland et al., Cancer Medicine, 3d ed, p2188) | 0 | 2.01 | 1 | 0 |
| Sycosis [description not available] | 0 | 1.93 | 1 | 0 |
| Folliculitis Inflammation of follicles, primarily hair follicles. | 0 | 1.93 | 1 | 0 |
| Atopic Hypersensitivity [description not available] | 0 | 2.93 | 1 | 0 |
| Abdominal Migraine [description not available] | 0 | 2.71 | 3 | 0 |
| Migraine Disorders A class of disabling primary headache disorders, characterized by recurrent unilateral pulsatile headaches. The two major subtypes are common migraine (without aura) and classic migraine (with aura or neurological symptoms). (International Classification of Headache Disorders, 2nd ed. Cephalalgia 2004: suppl 1) | 0 | 2.71 | 3 | 0 |
| Constriction, Pathological [description not available] | 0 | 2.42 | 2 | 0 |
| Constriction, Pathologic The condition of an anatomical structure's being constricted beyond normal dimensions. | 0 | 2.42 | 2 | 0 |
| American Trypanosomiasis [description not available] | 0 | 2.01 | 1 | 0 |
| Chagas Disease Infection with the protozoan parasite TRYPANOSOMA CRUZI, a form of TRYPANOSOMIASIS endemic in Central and South America. It is named after the Brazilian physician Carlos Chagas, who discovered the parasite. Infection by the parasite (positive serologic result only) is distinguished from the clinical manifestations that develop years later, such as destruction of PARASYMPATHETIC GANGLIA; CHAGAS CARDIOMYOPATHY; and dysfunction of the ESOPHAGUS or COLON. | 0 | 2.01 | 1 | 0 |
| Vaccinia The cutaneous and occasional systemic reactions associated with vaccination using smallpox (variola) vaccine. | 0 | 2.68 | 3 | 0 |
| Cerebral Pseudosclerosis [description not available] | 0 | 2.01 | 1 | 0 |
| Hepatolenticular Degeneration A rare autosomal recessive disease characterized by the deposition of copper in the BRAIN; LIVER; CORNEA; and other organs. It is caused by defects in the ATP7B gene encoding copper-transporting ATPase 2 (EC 3.6.3.4), also known as the Wilson disease protein. The overload of copper inevitably leads to progressive liver and neurological dysfunction such as LIVER CIRRHOSIS; TREMOR; ATAXIA and intellectual deterioration. Hepatic dysfunction may precede neurologic dysfunction by several years. | 0 | 2.01 | 1 | 0 |
| Cancer of Pituitary [description not available] | 0 | 3.23 | 6 | 0 |
| Pituitary Neoplasms Neoplasms which arise from or metastasize to the PITUITARY GLAND. The majority of pituitary neoplasms are adenomas, which are divided into non-secreting and secreting forms. Hormone producing forms are further classified by the type of hormone they secrete. Pituitary adenomas may also be characterized by their staining properties (see ADENOMA, BASOPHIL; ADENOMA, ACIDOPHIL; and ADENOMA, CHROMOPHOBE). Pituitary tumors may compress adjacent structures, including the HYPOTHALAMUS, several CRANIAL NERVES, and the OPTIC CHIASM. Chiasmal compression may result in bitemporal HEMIANOPSIA. | 0 | 3.23 | 6 | 0 |
| Kaposi Disease [description not available] | 0 | 3.5 | 8 | 0 |
| Xeroderma Pigmentosum A rare, pigmentary, and atrophic autosomal recessive disease. It is manifested as an extreme photosensitivity to ULTRAVIOLET RAYS as the result of a deficiency in the enzyme that permits excisional repair of ultraviolet-damaged DNA. | 0 | 3.5 | 8 | 0 |
| Circulatory Collapse [description not available] | 0 | 2.02 | 1 | 0 |
| Shock A pathological condition manifested by failure to perfuse or oxygenate vital organs. | 0 | 2.02 | 1 | 0 |
| Eosinophilia, Tropical [description not available] | 0 | 4.72 | 2 | 1 |
| Hay Fever [description not available] | 0 | 4.72 | 2 | 1 |
| Eosinophilia Abnormal increase of EOSINOPHILS in the blood, tissues or organs. | 0 | 4.72 | 2 | 1 |
| Rhinitis, Allergic, Seasonal Allergic rhinitis that occurs at the same time every year. It is characterized by acute CONJUNCTIVITIS with lacrimation and ITCHING, and regarded as an allergic condition triggered by specific ALLERGENS. | 0 | 4.72 | 2 | 1 |
| Angor Pectoris [description not available] | 0 | 2.02 | 1 | 0 |
| Angina Pectoris The symptom of paroxysmal pain consequent to MYOCARDIAL ISCHEMIA usually of distinctive character, location and radiation. It is thought to be provoked by a transient stressful situation during which the oxygen requirements of the MYOCARDIUM exceed that supplied by the CORONARY CIRCULATION. | 0 | 2.02 | 1 | 0 |
| Adenocarcinoma, Alveolar [description not available] | 0 | 2.68 | 3 | 0 |
| Leiomyosarcoma, Epithelioid [description not available] | 0 | 2.42 | 2 | 0 |
| Sarcoma, Epithelioid [description not available] | 0 | 2.42 | 2 | 0 |
| Adenocarcinoma, Bronchiolo-Alveolar A carcinoma derived from epithelium of terminal bronchioles, in which the neoplastic tissue extends along the alveolar walls and grows in small masses within the alveoli. Involvement may be uniformly diffuse and massive, or nodular, or lobular. The neoplastic cells are cuboidal or columnar and form papillary structures. Mucin may be demonstrated in some of the cells and in the material in the alveoli, which also includes denuded cells. Metastases in regional lymph nodes, and in even more distant sites, are known to occur, but are infrequent. (From Stedman, 25th ed) | 0 | 2.68 | 3 | 0 |
| Leiomyosarcoma A sarcoma containing large spindle cells of smooth muscle. Although it rarely occurs in soft tissue, it is common in the viscera. It is the most common soft tissue sarcoma of the gastrointestinal tract and uterus. The median age of patients is 60 years. (From Dorland, 27th ed; Holland et al., Cancer Medicine, 3d ed, p1865) | 0 | 2.42 | 2 | 0 |
| Sarcoma A connective tissue neoplasm formed by proliferation of mesodermal cells; it is usually highly malignant. | 0 | 7.42 | 2 | 0 |
| Infections, Chlamydia [description not available] | 0 | 2.91 | 4 | 0 |
| Chlamydia Infections Infections with bacteria of the genus CHLAMYDIA. | 0 | 2.91 | 4 | 0 |
| Cholangiocellular Carcinoma [description not available] | 0 | 2.42 | 2 | 0 |
| Bile Duct Cancer [description not available] | 0 | 2.42 | 2 | 0 |
| Bile Duct Neoplasms Tumors or cancer of the BILE DUCTS. | 0 | 2.42 | 2 | 0 |
| Cholangiocarcinoma A malignant tumor arising from the epithelium of the BILE DUCTS. | 0 | 2.42 | 2 | 0 |
| Kaposi Sarcoma [description not available] | 0 | 2.42 | 2 | 0 |
| Sarcoma, Kaposi A multicentric, malignant neoplastic vascular proliferation characterized by the development of bluish-red cutaneous nodules, usually on the lower extremities, most often on the toes or feet, and slowly increasing in size and number and spreading to more proximal areas. The tumors have endothelium-lined channels and vascular spaces admixed with variably sized aggregates of spindle-shaped cells, and often remain confined to the skin and subcutaneous tissue, but widespread visceral involvement may occur. Kaposi's sarcoma occurs spontaneously in Jewish and Italian males in Europe and the United States. An aggressive variant in young children is endemic in some areas of Africa. A third form occurs in about 0.04% of kidney transplant patients. There is also a high incidence in AIDS patients. (From Dorland, 27th ed & Holland et al., Cancer Medicine, 3d ed, pp2105-7) HHV-8 is the suspected cause. | 0 | 2.42 | 2 | 0 |
| Adult Pelizaeus-Merzbacher Disease [description not available] | 0 | 2.02 | 1 | 0 |
| Sphingolipid Storage Diseases [description not available] | 0 | 2.02 | 1 | 0 |
| Anti-Phospholipid Antibody Syndrome [description not available] | 0 | 3.62 | 3 | 0 |
| Antiphospholipid Syndrome The presence of antibodies directed against phospholipids (ANTIBODIES, ANTIPHOSPHOLIPID). The condition is associated with a variety of diseases, notably systemic lupus erythematosus and other connective tissue diseases, thrombopenia, and arterial or venous thromboses. In pregnancy it can cause abortion. Of the phospholipids, the cardiolipins show markedly elevated levels of anticardiolipin antibodies (ANTIBODIES, ANTICARDIOLIPIN). Present also are high levels of lupus anticoagulant (LUPUS COAGULATION INHIBITOR). | 0 | 3.62 | 3 | 0 |
| Centriacinar Emphysema [description not available] | 0 | 2.02 | 1 | 0 |
| Anasarca [description not available] | 0 | 2.68 | 3 | 0 |
| Edema Abnormal fluid accumulation in TISSUES or body cavities. Most cases of edema are present under the SKIN in SUBCUTANEOUS TISSUE. | 0 | 2.68 | 3 | 0 |
| Carotid Artery Thrombosis Blood clot formation in any part of the CAROTID ARTERIES. This may produce CAROTID STENOSIS or occlusion of the vessel, leading to TRANSIENT ISCHEMIC ATTACK; CEREBRAL INFARCTION; or AMAUROSIS FUGAX. | 0 | 2.42 | 2 | 0 |
| Cancer of Gastrointestinal Tract [description not available] | 0 | 2.02 | 1 | 0 |
| Niemann-Pick Disease [description not available] | 0 | 2.68 | 3 | 0 |
| Niemann-Pick Diseases A group of autosomal recessive disorders in which harmful quantities of lipids accumulate in the viscera and the central nervous system. They can be caused by deficiencies of enzyme activities (SPHINGOMYELIN PHOSPHODIESTERASE) or defects in intracellular transport, resulting in the accumulation of SPHINGOMYELINS and CHOLESTEROL. There are various subtypes based on their clinical and genetic differences. | 0 | 2.68 | 3 | 0 |
| Birnaviridae Infections Virus diseases caused by the BIRNAVIRIDAE. | 0 | 3.81 | 2 | 1 |
| Encephalitis, JC Polyomavirus [description not available] | 0 | 2.68 | 3 | 0 |
| Leukoencephalopathy, Progressive Multifocal An opportunistic viral infection of the central nervous system associated with conditions that impair cell-mediated immunity (e.g., ACQUIRED IMMUNODEFICIENCY SYNDROME and other IMMUNOLOGIC DEFICIENCY SYNDROMES; HEMATOLOGIC NEOPLASMS; IMMUNOSUPPRESSION; and COLLAGEN DISEASES). The causative organism is JC Polyomavirus (JC VIRUS) which primarily affects oligodendrocytes, resulting in multiple areas of demyelination. Clinical manifestations include DEMENTIA; ATAXIA; visual disturbances; and other focal neurologic deficits, generally progressing to a vegetative state within 6 months. (From Joynt, Clinical Neurology, 1996, Ch26, pp36-7) | 0 | 2.68 | 3 | 0 |
| Cardiomyopathy, Congestive [description not available] | 0 | 2.71 | 3 | 0 |
| Cardiomyopathy, Dilated A form of CARDIAC MUSCLE disease that is characterized by ventricular dilation, VENTRICULAR DYSFUNCTION, and HEART FAILURE. Risk factors include SMOKING; ALCOHOL DRINKING; HYPERTENSION; INFECTION; PREGNANCY; and mutations in the LMNA gene encoding LAMIN TYPE A, a NUCLEAR LAMINA protein. | 0 | 2.71 | 3 | 0 |
| Leukemia, Acute Monocytic [description not available] | 0 | 2.02 | 1 | 0 |
| Leukemia, Monocytic, Acute An acute myeloid leukemia in which 80% or more of the leukemic cells are of monocytic lineage including monoblasts, promonocytes, and MONOCYTES. | 0 | 2.02 | 1 | 0 |
| Empyema, Thoracic [description not available] | 0 | 2.02 | 1 | 0 |
| Empyema, Pleural Suppurative inflammation of the pleural space. | 0 | 2.02 | 1 | 0 |
| Choriocarcinoma A malignant metastatic form of trophoblastic tumors. Unlike the HYDATIDIFORM MOLE, choriocarcinoma contains no CHORIONIC VILLI but rather sheets of undifferentiated cytotrophoblasts and syncytiotrophoblasts (TROPHOBLASTS). It is characterized by the large amounts of CHORIONIC GONADOTROPIN produced. Tissue origins can be determined by DNA analyses: placental (fetal) origin or non-placental origin (CHORIOCARCINOMA, NON-GESTATIONAL). | 0 | 2.69 | 3 | 0 |
| Corynebacterium diphtheriae Infection [description not available] | 0 | 2.02 | 1 | 0 |
| Diphtheria A localized infection of mucous membranes or skin caused by toxigenic strains of CORYNEBACTERIUM DIPHTHERIAE. It is characterized by the presence of a pseudomembrane at the site of infection. DIPHTHERIA TOXIN, produced by C. diphtheriae, can cause myocarditis, polyneuritis, and other systemic toxic effects. | 0 | 2.02 | 1 | 0 |
| Vascular Diseases Pathological processes involving any of the BLOOD VESSELS in the cardiac or peripheral circulation. They include diseases of ARTERIES; VEINS; and rest of the vasculature system in the body. | 0 | 3.32 | 2 | 0 |
| Sickle Cell Trait The condition of being heterozygous for hemoglobin S. | 0 | 2.02 | 1 | 0 |
| Besnoitiasis [description not available] | 0 | 2.02 | 1 | 0 |
| Weight Reduction [description not available] | 0 | 2.02 | 1 | 0 |
| Weight Loss Decrease in existing BODY WEIGHT. | 0 | 2.02 | 1 | 0 |
| Schistosoma mansoni Infection [description not available] | 0 | 2.02 | 1 | 0 |
| Schistosomiasis mansoni Schistosomiasis caused by Schistosoma mansoni. It is endemic in Africa, the Middle East, South America, and the Caribbean and affects mainly the bowel, spleen, and liver. | 0 | 2.02 | 1 | 0 |
| Heroin Abuse [description not available] | 0 | 2.02 | 1 | 0 |
| Heroin Dependence Strong dependence or addiction, both physiological and emotional, upon HEROIN. | 0 | 2.02 | 1 | 0 |
| Bone Marrow Diseases Diseases involving the BONE MARROW. | 0 | 2.02 | 1 | 0 |
| Chondrodystrophic Myotonia [description not available] | 0 | 2.02 | 1 | 0 |
| Pancreatic Insufficiency [description not available] | 0 | 2.02 | 1 | 0 |
| Exocrine Pancreatic Insufficiency A malabsorption condition resulting from greater than 10% reduction in the secretion of pancreatic digestive enzymes (LIPASE; PROTEASES; and AMYLASE) by the EXOCRINE PANCREAS into the DUODENUM. This condition is often associated with CYSTIC FIBROSIS and with chronic PANCREATITIS. | 0 | 2.02 | 1 | 0 |
| Allergy, Food [description not available] | 0 | 2.02 | 1 | 0 |
| Food Hypersensitivity Gastrointestinal disturbances, skin eruptions, or shock due to allergic reactions to allergens in food. | 0 | 2.02 | 1 | 0 |
| Hyperkeratosis Palmaris et Plantaris [description not available] | 0 | 2.02 | 1 | 0 |
| Rachitis [description not available] | 0 | 2.02 | 1 | 0 |
| Day Blindness [description not available] | 0 | 2.02 | 1 | 0 |
| Campylobacter Infection [description not available] | 0 | 2.7 | 3 | 0 |
| Cancer of the Uterus [description not available] | 0 | 2.4 | 2 | 0 |
| Uterine Neoplasms Tumors or cancer of the UTERUS. | 0 | 2.4 | 2 | 0 |
| Impotence [description not available] | 0 | 2.02 | 1 | 0 |
| Erectile Dysfunction The inability in the male to have a PENILE ERECTION due to psychological or organ dysfunction. | 0 | 2.02 | 1 | 0 |
| Carcinoma, Oat Cell [description not available] | 0 | 3.38 | 7 | 0 |
| Carcinoma, Small Cell An anaplastic, highly malignant, and usually bronchogenic carcinoma composed of small ovoid cells with scanty neoplasm. It is characterized by a dominant, deeply basophilic nucleus, and absent or indistinct nucleoli. (From Stedman, 25th ed; Holland et al., Cancer Medicine, 3d ed, p1286-7) | 0 | 3.38 | 7 | 0 |
| Congenital Limb Deformities [description not available] | 0 | 2.42 | 2 | 0 |
| Body Weight, Fetal [description not available] | 0 | 2.03 | 1 | 0 |
| Craniofacial Abnormalities Congenital structural deformities, malformations, or other abnormalities of the cranium and facial bones. | 0 | 2.42 | 2 | 0 |
| Fetal Death Death of the developing young in utero. BIRTH of a dead FETUS is STILLBIRTH. | 0 | 2.03 | 1 | 0 |
| Fetal Resorption The disintegration and assimilation of the dead FETUS in the UTERUS at any stage after the completion of organogenesis which, in humans, is after the 9th week of GESTATION. It does not include embryo resorption (see EMBRYO LOSS). | 0 | 2.03 | 1 | 0 |
| Central Retinal Edema, Cystoid [description not available] | 0 | 11.27 | 16 | 16 |
| Macular Edema Fluid accumulation in the outer layer of the MACULA LUTEA that results from intraocular or systemic insults. It may develop in a diffuse pattern where the macula appears thickened or it may acquire the characteristic petaloid appearance referred to as cystoid macular edema. Although macular edema may be associated with various underlying conditions, it is most commonly seen following intraocular surgery, venous occlusive disease, DIABETIC RETINOPATHY, and posterior segment inflammatory disease. (From Survey of Ophthalmology 2004; 49(5) 470-90) | 0 | 11.27 | 16 | 16 |
| Aujeszky Disease [description not available] | 0 | 2.03 | 1 | 0 |
| Atypical Ductal Hyperplasia [description not available] | 0 | 2.41 | 2 | 0 |
| Carcinoma, Intraductal, Noninfiltrating A noninvasive (noninfiltrating) carcinoma of the breast characterized by a proliferation of malignant epithelial cells confined to the mammary ducts or lobules, without light-microscopy evidence of invasion through the basement membrane into the surrounding stroma. | 0 | 2.41 | 2 | 0 |
| Adenocarcinoma, Clear Cell An adenocarcinoma characterized by the presence of varying combinations of clear and hobnail-shaped tumor cells. There are three predominant patterns described as tubulocystic, solid, and papillary. These tumors, usually located in the female reproductive organs, have been seen more frequently in young women since 1970 as a result of the association with intrauterine exposure to diethylstilbestrol. (From Holland et al., Cancer Medicine, 3d ed) | 0 | 2.41 | 2 | 0 |
| Granuloma, Hodgkin [description not available] | 0 | 3.25 | 6 | 0 |
| Hodgkin Disease A malignant disease characterized by progressive enlargement of the lymph nodes, spleen, and general lymphoid tissue. In the classical variant, giant usually multinucleate Hodgkin's and REED-STERNBERG CELLS are present; in the nodular lymphocyte predominant variant, lymphocytic and histiocytic cells are seen. | 0 | 3.25 | 6 | 0 |
| Caprine Diseases [description not available] | 0 | 2.41 | 2 | 0 |
| Congenital Poikiloderma [description not available] | 0 | 2.03 | 1 | 0 |
| Lupus Vulgaris A form of cutaneous tuberculosis. It is seen predominantly in women and typically involves the NASAL MUCOSA; BUCCAL MUCOSA; and conjunctival mucosa. | 0 | 2.94 | 1 | 0 |
| Hemorrhage, Subarachnoid [description not available] | 0 | 2.94 | 1 | 0 |
| Subarachnoid Hemorrhage Bleeding into the intracranial or spinal SUBARACHNOID SPACE, most resulting from INTRACRANIAL ANEURYSM rupture. It can occur after traumatic injuries (SUBARACHNOID HEMORRHAGE, TRAUMATIC). Clinical features include HEADACHE; NAUSEA; VOMITING, nuchal rigidity, variable neurological deficits and reduced mental status. | 0 | 2.94 | 1 | 0 |
| Anemia, Fanconi [description not available] | 0 | 2.44 | 2 | 0 |
| Fanconi Anemia Congenital disorder affecting all bone marrow elements, resulting in ANEMIA; LEUKOPENIA; and THROMBOPENIA, and associated with cardiac, renal, and limb malformations as well as dermal pigmentary changes. Spontaneous CHROMOSOME BREAKAGE is a feature of this disease along with predisposition to LEUKEMIA. There are at least 7 complementation groups in Fanconi anemia: FANCA, FANCB, FANCC, FANCD1, FANCD2, FANCE, FANCF, FANCG, and FANCL. (from Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=227650, August 20, 2004) | 0 | 2.44 | 2 | 0 |
| Angiohemophilia [description not available] | 0 | 3.23 | 6 | 0 |
| von Willebrand Diseases Group of hemorrhagic disorders in which the VON WILLEBRAND FACTOR is either quantitatively or qualitatively abnormal. They are usually inherited as an autosomal dominant trait though rare kindreds are autosomal recessive. Symptoms vary depending on severity and disease type but may include prolonged bleeding time, deficiency of factor VIII, and impaired platelet adhesion. | 0 | 3.23 | 6 | 0 |
| Infections, Reoviridae [description not available] | 0 | 2.03 | 1 | 0 |
| Meningitis, Tuberculous [description not available] | 0 | 2.41 | 2 | 0 |
| Tuberculosis, Meningeal A form of bacterial meningitis caused by MYCOBACTERIUM TUBERCULOSIS or rarely MYCOBACTERIUM BOVIS. The organism seeds the meninges and forms microtuberculomas which subsequently rupture. The clinical course tends to be subacute, with progressions occurring over a period of several days or longer. Headache and meningeal irritation may be followed by SEIZURES, cranial neuropathies, focal neurologic deficits, somnolence, and eventually COMA. The illness may occur in immunocompetent individuals or as an OPPORTUNISTIC INFECTION in the ACQUIRED IMMUNODEFICIENCY SYNDROME and other immunodeficiency syndromes. (From Adams et al., Principles of Neurology, 6th ed, pp717-9) | 0 | 2.41 | 2 | 0 |
| Foot and Mouth Disease [description not available] | 0 | 2.9 | 4 | 0 |
| Neutropenia A decrease in the number of NEUTROPHILS found in the blood. | 0 | 4.37 | 2 | 2 |
| Extravasation of Contrast Media [description not available] | 0 | 2.03 | 1 | 0 |
| Adrenal Cortex Cancer [description not available] | 0 | 2.03 | 1 | 0 |
| Adrenal Cortex Neoplasms Tumors or cancers of the ADRENAL CORTEX. | 0 | 2.03 | 1 | 0 |
| Clear Cell Sarcoma of Soft Tissue [description not available] | 0 | 2.41 | 2 | 0 |
| Soft Tissue Neoplasms Neoplasms of whatever cell type or origin, occurring in the extraskeletal connective tissue framework of the body including the organs of locomotion and their various component structures, such as nerves, blood vessels, lymphatics, etc. | 0 | 2.69 | 3 | 0 |
| Sarcoma, Clear Cell A sarcoma of young adults occurring in the lower extremities and acral regions. It is found intimately bound to tendons as a circumscribed but unencapsulated melanin-bearing tumor of neuroectodermal origin. Clear cell sarcoma is associated with a specific t(12;22)(q13;q12) translocation. | 0 | 2.41 | 2 | 0 |
| Wasting Disease [description not available] | 0 | 2.03 | 1 | 0 |
| Middle Ear Effusion [description not available] | 0 | 2.93 | 4 | 0 |
| Otitis Media with Effusion Inflammation of the middle ear with a clear pale yellow-colored transudate. | 0 | 2.93 | 4 | 0 |
| Dominant Hereditary Sensory Neuropathy, Type III [description not available] | 0 | 2.03 | 1 | 0 |
| Dysautonomia, Familial An autosomal disorder of the peripheral and autonomic nervous systems limited to individuals of Ashkenazic Jewish descent. Clinical manifestations are present at birth and include diminished lacrimation, defective thermoregulation, orthostatic hypotension (HYPOTENSION, ORTHOSTATIC), fixed pupils, excessive SWEATING, loss of pain and temperature sensation, and absent reflexes. Pathologic features include reduced numbers of small diameter peripheral nerve fibers and autonomic ganglion neurons. (From Adams et al., Principles of Neurology, 6th ed, p1348; Nat Genet 1993;4(2):160-4) | 0 | 2.03 | 1 | 0 |
| Anterior Circulation Transient Ischemic Attack [description not available] | 0 | 2.03 | 1 | 0 |
| Ischemic Attack, Transient Brief reversible episodes of focal, nonconvulsive ischemic dysfunction of the brain having a duration of less than 24 hours, and usually less than one hour, caused by transient thrombotic or embolic blood vessel occlusion or stenosis. Events may be classified by arterial distribution, temporal pattern, or etiology (e.g., embolic vs. thrombotic). (From Adams et al., Principles of Neurology, 6th ed, pp814-6) | 0 | 2.03 | 1 | 0 |
| Infections, Parvoviridae [description not available] | 0 | 2.03 | 1 | 0 |
| AIDS, Simian [description not available] | 0 | 3.08 | 5 | 0 |
| Distal Muscular Dystrophies [description not available] | 0 | 2.03 | 1 | 0 |
| Distal Myopathies A heterogeneous group of genetic disorders characterized by progressive MUSCULAR ATROPHY and MUSCLE WEAKNESS beginning in the hands, the legs, or the feet. Most are adult-onset autosomal dominant forms. Others are autosomal recessive. | 0 | 2.03 | 1 | 0 |
| Arachnidism [description not available] | 0 | 2.03 | 1 | 0 |
| Cystitis Inflammation of the URINARY BLADDER, either from bacterial or non-bacterial causes. Cystitis is usually associated with painful urination (dysuria), increased frequency, urgency, and suprapubic pain. | 0 | 2.03 | 1 | 0 |
| Infections, Poxviridae [description not available] | 0 | 2.03 | 1 | 0 |
| Hereditary Optic Atrophy [description not available] | 0 | 2.68 | 3 | 0 |
| Eye Disorders [description not available] | 0 | 2.94 | 1 | 0 |
| Eye Diseases Diseases affecting the eye. | 0 | 2.94 | 1 | 0 |
| Brain Inflammation [description not available] | 0 | 2.69 | 3 | 0 |
| Astrocytosis [description not available] | 0 | 2.03 | 1 | 0 |
| Encephalitis Inflammation of the BRAIN due to infection, autoimmune processes, toxins, and other conditions. Viral infections (see ENCEPHALITIS, VIRAL) are a relatively frequent cause of this condition. | 0 | 2.69 | 3 | 0 |
| Obstructive Lung Diseases [description not available] | 0 | 2.03 | 1 | 0 |
| Lung Diseases, Obstructive Any disorder marked by obstruction of conducting airways of the lung. AIRWAY OBSTRUCTION may be acute, chronic, intermittent, or persistent. | 0 | 2.03 | 1 | 0 |
| Aprosodia [description not available] | 0 | 2.03 | 1 | 0 |
| Labhart-Willi Syndrome [description not available] | 0 | 2.03 | 1 | 0 |
| Happy Puppet Syndrome [description not available] | 0 | 2.03 | 1 | 0 |
| Prader-Willi Syndrome An autosomal dominant disorder caused by deletion of the proximal long arm of the paternal chromosome 15 (15q11-q13) or by inheritance of both of the pair of chromosomes 15 from the mother (UNIPARENTAL DISOMY) which are imprinted (GENETIC IMPRINTING) and hence silenced. Clinical manifestations include MENTAL RETARDATION; MUSCULAR HYPOTONIA; HYPERPHAGIA; OBESITY; short stature; HYPOGONADISM; STRABISMUS; and HYPERSOMNOLENCE. (Menkes, Textbook of Child Neurology, 5th ed, p229) | 0 | 2.03 | 1 | 0 |
| Angelman Syndrome A syndrome characterized by multiple abnormalities, MENTAL RETARDATION, and movement disorders. Present usually are skull and other abnormalities, frequent infantile spasms (SPASMS, INFANTILE); easily provoked and prolonged paroxysms of laughter (hence happy); jerky puppetlike movements (hence puppet); continuous tongue protrusion; motor retardation; ATAXIA; MUSCLE HYPOTONIA; and a peculiar facies. It is associated with maternal deletions of chromosome 15q11-13 and other genetic abnormalities. (From Am J Med Genet 1998 Dec 4;80(4):385-90; Hum Mol Genet 1999 Jan;8(1):129-35) | 0 | 2.03 | 1 | 0 |
| Palsy [description not available] | 0 | 2.03 | 1 | 0 |
| Paralysis A general term most often used to describe severe or complete loss of muscle strength due to motor system disease from the level of the cerebral cortex to the muscle fiber. This term may also occasionally refer to a loss of sensory function. (From Adams et al., Principles of Neurology, 6th ed, p45) | 0 | 2.03 | 1 | 0 |
| ATLL [description not available] | 0 | 2.9 | 4 | 0 |
| Leukemia-Lymphoma, Adult T-Cell Aggressive T-Cell malignancy with adult onset, caused by HUMAN T-LYMPHOTROPIC VIRUS 1. It is endemic in Japan, the Caribbean basin, Southeastern United States, Hawaii, and parts of Central and South America and sub-Saharan Africa. | 0 | 2.9 | 4 | 0 |
| Chronic Wasting Disease [description not available] | 0 | 2.03 | 1 | 0 |
| Uremia A clinical syndrome associated with the retention of renal waste products or uremic toxins in the blood. It is usually the result of RENAL INSUFFICIENCY. Most uremic toxins are end products of protein or nitrogen CATABOLISM, such as UREA or CREATININE. Severe uremia can lead to multiple organ dysfunctions with a constellation of symptoms. | 0 | 2.03 | 1 | 0 |
| Bannayan-Riley-Ruvalcaba Syndrome [description not available] | 0 | 2.03 | 1 | 0 |
| Hamartoma Syndrome, Multiple A hereditary disease characterized by multiple ectodermal, mesodermal, and endodermal nevoid and neoplastic anomalies. Facial trichilemmomas and papillomatous papules of the oral mucosa are the most characteristic lesions. Individuals with this syndrome have a high risk of BREAST CANCER; THYROID CANCER; and ENDOMETRIAL CANCER. This syndrome is associated with mutations in the gene for PTEN PHOSPHATASE. | 0 | 2.03 | 1 | 0 |
| Amaurotic Familial Idiocy An outdated term for Tay-Sachs disease. | 0 | 3.61 | 3 | 0 |
| Tay-Sachs Disease An autosomal recessive neurodegenerative disorder characterized by the onset in infancy of an exaggerated startle response, followed by paralysis, dementia, and blindness. It is caused by mutation in the alpha subunit of the HEXOSAMINIDASE A resulting in lipid-laden ganglion cells. It is also known as the B variant (with increased HEXOSAMINIDASE B but absence of hexosaminidase A) and is strongly associated with Ashkenazic Jewish ancestry. | 0 | 3.61 | 3 | 0 |
| Edema-Proteinuria-Hypertension Gestosis [description not available] | 0 | 2.03 | 1 | 0 |
| Pre-Eclampsia A complication of PREGNANCY, characterized by a complex of symptoms including maternal HYPERTENSION and PROTEINURIA with or without pathological EDEMA. Symptoms may range between mild and severe. Pre-eclampsia usually occurs after the 20th week of gestation, but may develop before this time in the presence of trophoblastic disease. | 0 | 2.03 | 1 | 0 |
| Aganglionic Megacolon [description not available] | 0 | 2.42 | 2 | 0 |
| Hirschsprung Disease Congenital MEGACOLON resulting from the absence of ganglion cells (aganglionosis) in a distal segment of the LARGE INTESTINE. The aganglionic segment is permanently contracted thus causing dilatation proximal to it. In most cases, the aganglionic segment is within the RECTUM and SIGMOID COLON. | 0 | 2.42 | 2 | 0 |
| Bladder Neck Obstruction [description not available] | 0 | 2.03 | 1 | 0 |
| Alcohol Abuse [description not available] | 0 | 2.03 | 1 | 0 |
| Alcoholism A primary, chronic disease with genetic, psychosocial, and environmental factors influencing its development and manifestations. The disease is often progressive and fatal. It is characterized by impaired control over drinking, preoccupation with the drug alcohol, use of alcohol despite adverse consequences, and distortions in thinking, most notably denial. Each of these symptoms may be continuous or periodic. (Morse & Flavin for the Joint Commission of the National Council on Alcoholism and Drug Dependence and the American Society of Addiction Medicine to Study the Definition and Criteria for the Diagnosis of Alcoholism: in JAMA 1992;268:1012-4) | 0 | 2.03 | 1 | 0 |
| Critical Illness A disease or state in which death is possible or imminent. | 0 | 3.42 | 1 | 1 |
| Pheochromocytoma, Extra-Adrenal [description not available] | 0 | 2.4 | 2 | 0 |
| Pheochromocytoma A usually benign, well-encapsulated, lobular, vascular tumor of chromaffin tissue of the ADRENAL MEDULLA or sympathetic paraganglia. The cardinal symptom, reflecting the increased secretion of EPINEPHRINE and NOREPINEPHRINE, is HYPERTENSION, which may be persistent or intermittent. During severe attacks, there may be HEADACHE; SWEATING, palpitation, apprehension, TREMOR; PALLOR or FLUSHING of the face, NAUSEA and VOMITING, pain in the CHEST and ABDOMEN, and paresthesias of the extremities. The incidence of malignancy is as low as 5% but the pathologic distinction between benign and malignant pheochromocytomas is not clear. (Dorland, 27th ed; DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1298) | 0 | 2.4 | 2 | 0 |
| Anaplastic Oligodendroglioma [description not available] | 0 | 2.04 | 1 | 0 |
| Oligodendroglioma A relatively slow-growing glioma that is derived from oligodendrocytes and tends to occur in the cerebral hemispheres, thalamus, or lateral ventricle. They may present at any age, but are most frequent in the third to fifth decades, with an earlier incidence peak in the first decade. Histologically, these tumors are encapsulated, relatively avascular, and tend to form cysts and microcalcifications. Neoplastic cells tend to have small round nuclei surrounded by unstained nuclei. The tumors may vary from well-differentiated to highly anaplastic forms. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, p2052; Adams et al., Principles of Neurology, 6th ed, p655) | 0 | 2.04 | 1 | 0 |
| Infection, Postoperative Wound [description not available] | 0 | 6.32 | 9 | 0 |
| Hematoma A collection of blood outside the BLOOD VESSELS. Hematoma can be localized in an organ, space, or tissue. | 0 | 6.32 | 9 | 0 |
| Aggressive Systemic Mastocytosis A form of systemic mastocytosis in which patients have impaired organ functions due to multifocal infiltrates of pathological MAST CELLS in bone marrow, liver, spleen, gastrointestinal tract, or skeletal system. The cytomorphology shows a low to high grade. | 0 | 2.04 | 1 | 0 |
| Mastocytosis, Systemic A group of disorders caused by the abnormal proliferation of MAST CELLS in a variety of extracutaneous tissues including bone marrow, liver, spleen, lymph nodes, and gastrointestinal tract. Systemic mastocytosis is commonly seen in adults. These diseases are categorized on the basis of clinical features, pathologic findings, and prognosis. | 0 | 2.04 | 1 | 0 |
| Hemorrhagic Shock [description not available] | 0 | 2.03 | 1 | 0 |
| MELAS [description not available] | 0 | 2.04 | 1 | 0 |
| MELAS Syndrome A mitochondrial disorder characterized by focal or generalized seizures, episodes of transient or persistent neurologic dysfunction resembling strokes, and ragged-red fibers on muscle biopsy. Affected individuals tend to be normal at birth through early childhood, then experience growth failure, episodic vomiting, and recurrent cerebral insults resulting in visual loss and hemiparesis. The cortical lesions tend to occur in the parietal and occipital lobes and are not associated with vascular occlusion. VASCULAR HEADACHE is frequently associated and the disorder tends to be familial. (From Joynt, Clinical Neurology, 1992, Ch56, p117) | 0 | 2.04 | 1 | 0 |
| Atrophy, Muscular, Peroneal [description not available] | 0 | 2.04 | 1 | 0 |
| Charcot-Marie-Tooth Disease A hereditary motor and sensory neuropathy transmitted most often as an autosomal dominant trait and characterized by progressive distal wasting and loss of reflexes in the muscles of the legs (and occasionally involving the arms). Onset is usually in the second to fourth decade of life. This condition has been divided into two subtypes, hereditary motor and sensory neuropathy (HMSN) types I and II. HMSN I is associated with abnormal nerve conduction velocities and nerve hypertrophy, features not seen in HMSN II. (Adams et al., Principles of Neurology, 6th ed, p1343) | 0 | 2.04 | 1 | 0 |
| Infections, Retroviridae [description not available] | 0 | 2.69 | 3 | 0 |
| Retroviridae Infections Virus diseases caused by the RETROVIRIDAE. | 0 | 2.69 | 3 | 0 |
| Cancer of Rectum [description not available] | 0 | 2.04 | 1 | 0 |
| Rectal Neoplasms Tumors or cancer of the RECTUM. | 0 | 2.04 | 1 | 0 |
| Cell Transformation, Viral An inheritable change in cells manifested by changes in cell division and growth and alterations in cell surface properties. It is induced by infection with a transforming virus. | 0 | 5.37 | 23 | 0 |
| Carcinoma, Krebs 2 A transplantable neoplasm of mice. | 0 | 3.46 | 8 | 0 |
| Encephalitis, Polio [description not available] | 0 | 3.22 | 6 | 0 |
| Poliomyelitis An acute infectious disease of humans, particularly children, caused by any of three serotypes of human poliovirus (POLIOVIRUS). Usually the infection is limited to the gastrointestinal tract and nasopharynx, and is often asymptomatic. The central nervous system, primarily the spinal cord, may be affected, leading to rapidly progressive paralysis, coarse FASCICULATION and hyporeflexia. Motor neurons are primarily affected. Encephalitis may also occur. The virus replicates in the nervous system, and may cause significant neuronal loss, most notably in the spinal cord. A rare related condition, nonpoliovirus poliomyelitis, may result from infections with nonpoliovirus enteroviruses. (From Adams et al., Principles of Neurology, 6th ed, pp764-5) | 0 | 3.22 | 6 | 0 |
| Carcinoma, Ehrlich Tumor A transplantable, poorly differentiated malignant tumor which appeared originally as a spontaneous breast carcinoma in a mouse. It grows in both solid and ascitic forms. | 0 | 3.9 | 13 | 0 |
| Plasma Cell Tumor [description not available] | 0 | 2.87 | 4 | 0 |
| Plasmacytoma Any discrete, presumably solitary, mass of neoplastic PLASMA CELLS either in BONE MARROW or various extramedullary sites. | 0 | 2.87 | 4 | 0 |
| Avian Leukosis A group of transmissible viral diseases of chickens and turkeys. Liver tumors are found in most forms, but tumors can be found elsewhere. | 0 | 1.96 | 1 | 0 |
| Blue Tongue [description not available] | 0 | 1.96 | 1 | 0 |
| Pink Eye [description not available] | 0 | 1.96 | 1 | 0 |
| Conjunctivitis INFLAMMATION of the CONJUNCTIVA. | 0 | 1.96 | 1 | 0 |
| Leukemia L 1210 [description not available] | 0 | 5.71 | 11 | 0 |
| Hemoglobinopathies A group of inherited disorders characterized by structural alterations within the hemoglobin molecule. | 0 | 5.17 | 8 | 0 |
| Leukemia L5178 An experimental lymphocytic leukemia of mice. | 0 | 1.96 | 1 | 0 |
| Autosomal Hemophilia A [description not available] | 0 | 2.89 | 4 | 0 |
| Hemophilia A The classic hemophilia resulting from a deficiency of factor VIII. It is an inherited disorder of blood coagulation characterized by a permanent tendency to hemorrhage. | 0 | 2.89 | 4 | 0 |
| Hemorrhagic Fevers, Viral A group of viral diseases of diverse etiology but having many similar clinical characteristics; increased capillary permeability, leukopenia, and thrombocytopenia are common to all. Hemorrhagic fevers are characterized by sudden onset, fever, headache, generalized myalgia, backache, conjunctivitis, and severe prostration, followed by various hemorrhagic symptoms. Hemorrhagic fever with kidney involvement is HEMORRHAGIC FEVER WITH RENAL SYNDROME. | 0 | 2.37 | 2 | 0 |
| Menopause The last menstrual period. Permanent cessation of menses (MENSTRUATION) is usually defined after 6 to 12 months of AMENORRHEA in a woman over 45 years of age. In the United States, menopause generally occurs in women between 48 and 55 years of age. | 0 | 1.96 | 1 | 0 |
| Encephalitis, Equine [description not available] | 0 | 1.96 | 1 | 0 |
| Congenital Hypocupremia [description not available] | 0 | 1.98 | 1 | 0 |
| Menkes Kinky Hair Syndrome An inherited disorder of copper metabolism transmitted as an X-linked trait and characterized by the infantile onset of HYPOTHERMIA, feeding difficulties, hypotonia, SEIZURES, bony deformities, pili torti (twisted hair), and severely impaired intellectual development. Defective copper transport across plasma and endoplasmic reticulum membranes results in copper being unavailable for the synthesis of several copper containing enzymes, including PROTEIN-LYSINE 6-OXIDASE; CERULOPLASMIN; and SUPEROXIDE DISMUTASE. Pathologic changes include defects in arterial elastin, neuronal loss, and gliosis. (From Menkes, Textbook of Child Neurology, 5th ed, p125) | 0 | 1.98 | 1 | 0 |
| Bruise [description not available] | 0 | 1.98 | 1 | 0 |
| Contusions Injuries resulting in hemorrhage, usually manifested in the skin. | 0 | 1.98 | 1 | 0 |
| Keratoconus A noninflammatory, usually bilateral protrusion of the cornea, the apex being displaced downward and nasally. It occurs most commonly in females at about puberty. The cause is unknown but hereditary factors may play a role. The -conus refers to the cone shape of the corneal protrusion. (From Dorland, 27th ed) | 0 | 1.98 | 1 | 0 |
| Goldblatt Syndrome [description not available] | 0 | 1.98 | 1 | 0 |
| Hypertension, Renovascular Hypertension due to RENAL ARTERY OBSTRUCTION or compression. | 0 | 1.98 | 1 | 0 |
| Argentaffinoma [description not available] | 0 | 1.98 | 1 | 0 |
| Carcinoid Tumor A usually small, slow-growing neoplasm composed of islands of rounded, oxyphilic, or spindle-shaped cells of medium size, with moderately small vesicular nuclei, and covered by intact mucosa with a yellow cut surface. The tumor can occur anywhere in the gastrointestinal tract (and in the lungs and other sites); approximately 90% arise in the appendix. It is now established that these tumors are of neuroendocrine origin and derive from a primitive stem cell. (From Stedman, 25th ed & Holland et al., Cancer Medicine, 3d ed, p1182) | 0 | 1.98 | 1 | 0 |
| Adenovirus Infections [description not available] | 0 | 2.4 | 2 | 0 |
| Adenoviridae Infections Virus diseases caused by the ADENOVIRIDAE. | 0 | 2.4 | 2 | 0 |
| P carinii Infection [description not available] | 0 | 1.98 | 1 | 0 |
| Pneumocystis Infections Infections with species in the genus PNEUMOCYSTIS, a fungus causing interstitial plasma cell pneumonia (PNEUMONIA, PNEUMOCYSTIS) and other infections in humans and other MAMMALS. Immunocompromised patients, especially those with AIDS, are particularly susceptible to these infections. Extrapulmonary sites are rare but seen occasionally. | 0 | 1.98 | 1 | 0 |
| Mast-Cell Sarcoma A unifocal malignant tumor that consists of atypical pathological MAST CELLS without systemic involvement. It causes local destructive growth in organs other than in skin or bone marrow. | 0 | 1.98 | 1 | 0 |
| Ambiguous Genitalia [description not available] | 0 | 2.67 | 3 | 0 |
| Abnormalities, Sex Chromosome [description not available] | 0 | 2.39 | 2 | 0 |
| Disorders of Sex Development In gonochoristic organisms, congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. Effects from exposure to abnormal levels of GONADAL HORMONES in the maternal environment, or disruption of the function of those hormones by ENDOCRINE DISRUPTORS are included. | 0 | 2.67 | 3 | 0 |
| Lysosomal Enzyme Disorders [description not available] | 0 | 1.98 | 1 | 0 |
| AGA Deficiency [description not available] | 0 | 1.98 | 1 | 0 |
| Bone Diseases Diseases of BONES. | 0 | 2.4 | 2 | 0 |
| Hepatitis, Viral, Animal INFLAMMATION of the LIVER in animals due to viral infection. | 0 | 2.38 | 2 | 0 |
| Convulsions, Febrile [description not available] | 0 | 1.98 | 1 | 0 |
| Seizures, Febrile Seizures that occur during a febrile episode. It is a common condition, affecting 2-5% of children aged 3 months to five years. An autosomal dominant pattern of inheritance has been identified in some families. The majority are simple febrile seizures (generally defined as generalized onset, single seizures with a duration of less than 30 minutes). Complex febrile seizures are characterized by focal onset, duration greater than 30 minutes, and/or more than one seizure in a 24 hour period. The likelihood of developing epilepsy (i.e., a nonfebrile seizure disorder) following simple febrile seizures is low. Complex febrile seizures are associated with a moderately increased incidence of epilepsy. (From Menkes, Textbook of Child Neurology, 5th ed, p784) | 0 | 1.98 | 1 | 0 |
| Tachyarrhythmia [description not available] | 0 | 1.98 | 1 | 0 |
| Tachycardia Abnormally rapid heartbeat, usually with a HEART RATE above 100 beats per minute for adults. Tachycardia accompanied by disturbance in the cardiac depolarization (cardiac arrhythmia) is called tachyarrhythmia. | 0 | 1.98 | 1 | 0 |
| B Virus Infection [description not available] | 0 | 2.67 | 3 | 0 |
| AIDS-Associated Lymphoma [description not available] | 0 | 2.38 | 2 | 0 |
| Lymphoma, AIDS-Related B-cell lymphoid tumors that occur in association with AIDS. Patients often present with an advanced stage of disease and highly malignant subtypes including BURKITT LYMPHOMA; IMMUNOBLASTIC LARGE-CELL LYMPHOMA; PRIMARY EFFUSION LYMPHOMA; and DIFFUSE, LARGE B-CELL, LYMPHOMA. The tumors are often disseminated in unusual extranodal sites and chromosomal abnormalities are frequently present. It is likely that polyclonal B-cell lymphoproliferation in AIDS is a complex result of EBV infection, HIV antigenic stimulation, and T-cell-dependent HIV activation. | 0 | 2.38 | 2 | 0 |
| Ataxias, Hereditary [description not available] | 0 | 3.6 | 3 | 0 |
| Bulbar Palsy [description not available] | 0 | 2.9 | 1 | 0 |
| Elliptocytosis, Hereditary An intrinsic defect of erythrocytes inherited as an autosomal dominant trait. The erythrocytes assume an oval or elliptical shape. | 0 | 2.89 | 4 | 0 |
| Leukemia, Myeloid, Acute, M4 [description not available] | 0 | 2.38 | 2 | 0 |
| Leukemia, Myelomonocytic, Acute A pediatric acute myeloid leukemia involving both myeloid and monocytoid precursors. At least 20% of non-erythroid cells are of monocytic origin. | 0 | 2.38 | 2 | 0 |
| Deficiency, Factor 10 [description not available] | 0 | 1.98 | 1 | 0 |
| Factor X Deficiency Blood coagulation disorder usually inherited as an autosomal recessive trait, though it can be acquired. It is characterized by defective activity in both the intrinsic and extrinsic pathways, impaired thromboplastin time, and impaired prothrombin consumption. | 0 | 1.98 | 1 | 0 |
| Hairy Cell Leukemia [description not available] | 0 | 1.98 | 1 | 0 |
| Leukemia, Hairy Cell A neoplastic disease of the lymphoreticular cells which is considered to be a rare type of chronic leukemia; it is characterized by an insidious onset, splenomegaly, anemia, granulocytopenia, thrombocytopenia, little or no lymphadenopathy, and the presence of hairy or flagellated cells in the blood and bone marrow. | 0 | 1.98 | 1 | 0 |
| Cafe-au-Lait Spots with Pulmonic Stenosis [description not available] | 0 | 1.98 | 1 | 0 |
| Neurofibromatosis 1 An autosomal dominant inherited disorder (with a high frequency of spontaneous mutations) that features developmental changes in the nervous system, muscles, bones, and skin, most notably in tissue derived from the embryonic NEURAL CREST. Multiple hyperpigmented skin lesions and subcutaneous tumors are the hallmark of this disease. Peripheral and central nervous system neoplasms occur frequently, especially OPTIC NERVE GLIOMA and NEUROFIBROSARCOMA. NF1 is caused by mutations which inactivate the NF1 gene (GENES, NEUROFIBROMATOSIS 1) on chromosome 17q. The incidence of learning disabilities is also elevated in this condition. (From Adams et al., Principles of Neurology, 6th ed, pp1014-18) There is overlap of clinical features with NOONAN SYNDROME in a syndrome called neurofibromatosis-Noonan syndrome. Both the PTPN11 and NF1 gene products are involved in the SIGNAL TRANSDUCTION pathway of Ras (RAS PROTEINS). | 0 | 1.98 | 1 | 0 |
| Drug Abuse, Intravenous [description not available] | 0 | 1.98 | 1 | 0 |
| Autosomal Recessive Chronic Granulomatous Disease [description not available] | 0 | 1.98 | 1 | 0 |
| Granulomatous Disease, Chronic A defect of leukocyte function in which phagocytic cells ingest but fail to digest bacteria, resulting in recurring bacterial infections with granuloma formation. When chronic granulomatous disease is caused by mutations in the CYBB gene, the condition is inherited in an X-linked recessive pattern. When chronic granulomatous disease is caused by CYBA, NCF1, NCF2, or NCF4 gene mutations, the condition is inherited in an autosomal recessive pattern. | 0 | 1.98 | 1 | 0 |
| Acute Porphyria [description not available] | 0 | 1.98 | 1 | 0 |
| Porphyria, Acute Intermittent An autosomal dominant porphyria that is due to a deficiency of HYDROXYMETHYLBILANE SYNTHASE in the LIVER, the third enzyme in the 8-enzyme biosynthetic pathway of HEME. Clinical features are recurrent and life-threatening neurologic disturbances, ABDOMINAL PAIN, and elevated level of AMINOLEVULINIC ACID and PORPHOBILINOGEN in the urine. | 0 | 1.98 | 1 | 0 |
| Common Variable Hypogammaglobulinemia [description not available] | 0 | 2.39 | 2 | 0 |
| Common Variable Immunodeficiency Heterogeneous group of immunodeficiency syndromes characterized by hypogammaglobulinemia of most isotypes, variable B-cell defects, and the presence of recurrent bacterial infections. | 0 | 2.39 | 2 | 0 |
| Basedow Disease [description not available] | 0 | 2.38 | 2 | 0 |
| Orbital Diseases Diseases of the bony orbit and contents except the eyeball. | 0 | 1.98 | 1 | 0 |
| Graves Disease A common form of hyperthyroidism with a diffuse hyperplastic GOITER. It is an autoimmune disorder that produces antibodies against the THYROID STIMULATING HORMONE RECEPTOR. These autoantibodies activate the TSH receptor, thereby stimulating the THYROID GLAND and hypersecretion of THYROID HORMONES. These autoantibodies can also affect the eyes (GRAVES OPHTHALMOPATHY) and the skin (Graves dermopathy). | 0 | 2.38 | 2 | 0 |
| Eperythrozoonosis [description not available] | 0 | 2.38 | 2 | 0 |
| Infections, Ureaplasma [description not available] | 0 | 1.98 | 1 | 0 |
| Adenomatous Polyposis Coli, Familial [description not available] | 0 | 2.89 | 4 | 0 |
| Adenomatous Polyposis Coli A polyposis syndrome due to an autosomal dominant mutation of the APC genes (GENES, APC) on CHROMOSOME 5. The syndrome is characterized by the development of hundreds of ADENOMATOUS POLYPS in the COLON and RECTUM of affected individuals by early adulthood. | 0 | 2.89 | 4 | 0 |
| Diabetes, Phosphate [description not available] | 0 | 1.98 | 1 | 0 |
| Hypophosphatemia, Familial An inherited condition of abnormally low serum levels of PHOSPHATES (below 1 mg/liter) which can occur in a number of genetic diseases with defective reabsorption of inorganic phosphorus by the PROXIMAL RENAL TUBULES. This leads to phosphaturia, HYPOPHOSPHATEMIA, and disturbances of cellular and organ functions such as those in X-LINKED HYPOPHOSPHATEMIC RICKETS; OSTEOMALACIA; and FANCONI SYNDROME. | 0 | 1.98 | 1 | 0 |
| Angioneurotic Edema [description not available] | 0 | 1.98 | 1 | 0 |
| Angioedema Swelling involving the deep DERMIS, subcutaneous, or submucosal tissues, representing localized EDEMA. Angioedema often occurs in the face, lips, tongue, and larynx. | 0 | 1.98 | 1 | 0 |
| Thyroid Diseases Pathological processes involving the THYROID GLAND. | 0 | 2.38 | 2 | 0 |
| Delayed Effects, Prenatal Exposure [description not available] | 0 | 1.98 | 1 | 0 |
| Acrocephaly Premature closing of the lambdoid and coronal sutures. | 0 | 1.98 | 1 | 0 |
| Craniosynostoses Premature closure of one or more CRANIAL SUTURES. It often results in plagiocephaly. Craniosynostoses that involve multiple sutures are sometimes associated with congenital syndromes such as ACROCEPHALOSYNDACTYLIA; and CRANIOFACIAL DYSOSTOSIS. | 0 | 1.98 | 1 | 0 |
| Acroosteolysis, Giaccai Type [description not available] | 0 | 1.98 | 1 | 0 |
| Hereditary Sensory and Autonomic Neuropathies A group of inherited disorders characterized by degeneration of dorsal root and autonomic ganglion cells, and clinically by loss of sensation and autonomic dysfunction. There are five subtypes. Type I features autosomal dominant inheritance and distal sensory involvement. Type II is characterized by autosomal inheritance and distal and proximal sensory loss. Type III is DYSAUTONOMIA, FAMILIAL. Type IV features insensitivity to pain, heat intolerance, and mental deficiency. Type V is characterized by a selective loss of pain with intact light touch and vibratory sensation. (From Joynt, Clinical Neurology, 1995, Ch51, pp142-4) | 0 | 1.98 | 1 | 0 |
| Neoplasms, Otorhinolaryngologic [description not available] | 0 | 1.99 | 1 | 0 |
| Granulocytic Leukemia, Chronic, Stable Phase [description not available] | 0 | 1.99 | 1 | 0 |
| Albinism, Tyrosinase-Negative [description not available] | 0 | 1.98 | 1 | 0 |
| Albinism, Oculocutaneous Heterogeneous group of autosomal recessive disorders comprising at least four recognized types, all having in common varying degrees of hypopigmentation of the skin, hair, and eyes. The two most common are the tyrosinase-positive and tyrosinase-negative types. | 0 | 1.98 | 1 | 0 |
| Onchocerciasis Infection with nematodes of the genus ONCHOCERCA. Characteristics include the presence of firm subcutaneous nodules filled with adult worms, PRURITUS, and ocular lesions. | 0 | 2.39 | 2 | 0 |
| Acquired Nephrogenic Diabetes Insipidus [description not available] | 0 | 1.99 | 1 | 0 |
| Anti-MuSK Myasthenia Gravis [description not available] | 0 | 1.99 | 1 | 0 |
| Myasthenia Gravis A disorder of neuromuscular transmission characterized by fatigable weakness of cranial and skeletal muscles with elevated titers of ACETYLCHOLINE RECEPTORS or muscle-specific receptor tyrosine kinase (MuSK) autoantibodies. Clinical manifestations may include ocular muscle weakness (fluctuating, asymmetric, external ophthalmoplegia; diplopia; ptosis; and weakness of eye closure) and extraocular fatigable weakness of facial, bulbar, respiratory, and proximal limb muscles. The disease may remain limited to the ocular muscles (ocular myasthenia). THYMOMA is commonly associated with this condition. | 0 | 1.99 | 1 | 0 |
| Feline Leukemia [description not available] | 0 | 1.99 | 1 | 0 |
| Amebiasis, Intestinal [description not available] | 0 | 1.99 | 1 | 0 |
| Atrophy Decrease in the size of a cell, tissue, organ, or multiple organs, associated with a variety of pathological conditions such as abnormal cellular changes, ischemia, malnutrition, or hormonal changes. | 0 | 3.38 | 1 | 1 |
| Deficiency, Protein [description not available] | 0 | 1.99 | 1 | 0 |
| Adenoma, Prostatic [description not available] | 0 | 1.99 | 1 | 0 |
| Prostatic Hyperplasia Increase in constituent cells in the PROSTATE, leading to enlargement of the organ (hypertrophy) and adverse impact on the lower urinary tract function. This can be caused by increased rate of cell proliferation, reduced rate of cell death, or both. | 0 | 1.99 | 1 | 0 |
| Abortion, Veterinary Premature expulsion of the FETUS in animals. | 0 | 2.39 | 2 | 0 |
| Endomyometritis Inflammation of both the ENDOMETRIUM and the MYOMETRIUM, usually caused by infections after a CESAREAN SECTION. | 0 | 1.99 | 1 | 0 |
| Abortion, Septic Any type of abortion, induced or spontaneous, that is associated with infection of the UTERUS and its appendages. It is characterized by FEVER, uterine tenderness, and foul discharge. | 0 | 1.99 | 1 | 0 |
| Endometritis Inflammation of the ENDOMETRIUM, usually caused by intrauterine infections. Endometritis is the most common cause of postpartum fever. | 0 | 1.99 | 1 | 0 |
| Bacterial Infections, Gram-Negative [description not available] | 0 | 2.68 | 3 | 0 |
| Enteritis Inflammation of any segment of the SMALL INTESTINE. | 0 | 1.99 | 1 | 0 |
| Gram-Negative Bacterial Infections Infections caused by bacteria that show up as pink (negative) when treated by the gram-staining method. | 0 | 2.68 | 3 | 0 |
| Hypersensitivity, Type III [description not available] | 0 | 1.99 | 1 | 0 |
| Arthus Phenomenon [description not available] | 0 | 1.99 | 1 | 0 |
| Autosomal Dominant Striatonigral Degeneration [description not available] | 0 | 2.4 | 2 | 0 |
| Machado-Joseph Disease A dominantly-inherited ATAXIA first described in people of Azorean and Portuguese descent, and subsequently identified in Brazil, Japan, China, and Australia. This disorder is classified as one of the SPINOCEREBELLAR ATAXIAS (Type 3) and has been associated with a mutation of the MJD1 gene on chromosome 14. Clinical features include progressive ataxia, DYSARTHRIA, postural instability, nystagmus, eyelid retraction, and facial FASCICULATIONS. DYSTONIA is prominent in younger patients (referred to as Type I Machado-Joseph Disease). Type II features ataxia and ocular signs; Type III features MUSCULAR ATROPHY and a sensorimotor neuropathy; and Type IV features extrapyramidal signs combined with a sensorimotor neuropathy. (From Clin Neurosci 1995;3(1):17-22; Ann Neurol 1998 Mar;43(3):288-96) | 0 | 2.4 | 2 | 0 |
| Acetyl-CoA:alpha-Glucosaminide N-Acetyltransferase Deficiency [description not available] | 0 | 1.99 | 1 | 0 |
| Mucopolysaccharidosis III Mucopolysaccharidosis characterized by heparitin sulfate in the urine, progressive mental retardation, mild dwarfism, and other skeletal disorders. There are four clinically indistinguishable but biochemically distinct forms, each due to a deficiency of a different enzyme. | 0 | 1.99 | 1 | 0 |
| Rheumatism [description not available] | 0 | 1.99 | 1 | 0 |
| Rheumatic Diseases Disorders of connective tissue, especially the joints and related structures, characterized by inflammation, degeneration, or metabolic derangement. | 0 | 1.99 | 1 | 0 |
| Muscle Relaxation That phase of a muscle twitch during which a muscle returns to a resting position. | 0 | 2.4 | 2 | 0 |
| Nephritis Inflammation of any part of the KIDNEY. | 0 | 2 | 1 | 0 |
| Wounds, Penetrating Wounds caused by objects penetrating the skin. | 0 | 2 | 1 | 0 |
| Deaf Mutism [description not available] | 0 | 2.41 | 2 | 0 |
| Deafness A general term for the complete loss of the ability to hear from both ears. | 0 | 2.41 | 2 | 0 |
| Bone Tuberculosis [description not available] | 0 | 2 | 1 | 0 |
| Cachexia General ill health, malnutrition, and weight loss, usually associated with chronic disease. | 0 | 7.37 | 2 | 0 |
| Papilloma, Squamous Cell [description not available] | 0 | 2.39 | 2 | 0 |
| Papilloma A circumscribed benign epithelial tumor projecting from the surrounding surface; more precisely, a benign epithelial neoplasm consisting of villous or arborescent outgrowths of fibrovascular stroma covered by neoplastic cells. (Stedman, 25th ed) | 0 | 2.39 | 2 | 0 |
| ARSA Deficiency [description not available] | 0 | 2 | 1 | 0 |
| Leukodystrophy, Metachromatic An autosomal recessive metabolic disease caused by a deficiency of CEREBROSIDE-SULFATASE leading to intralysosomal accumulation of cerebroside sulfate (SULFOGLYCOSPHINGOLIPIDS) in the nervous system and other organs. Pathological features include diffuse demyelination, and metachromatically-staining granules in many cell types such as the GLIAL CELLS. There are several allelic and nonallelic forms with a variety of neurological symptoms. | 0 | 2 | 1 | 0 |
| Crigler Najjar Syndrome [description not available] | 0 | 2.4 | 2 | 0 |
| Cerebro-Hepato-Renal Syndrome [description not available] | 0 | 2 | 1 | 0 |
| Zellweger Syndrome An autosomal recessive disorder due to defects in PEROXISOME biogenesis which involves more than 13 genes encoding peroxin proteins of the peroxisomal membrane and matrix. Zellweger syndrome is typically seen in the neonatal period with features such as dysmorphic skull; MUSCLE HYPOTONIA; SENSORINEURAL HEARING LOSS; visual compromise; SEIZURES; progressive degeneration of the KIDNEYS and the LIVER. Zellweger-like syndrome refers to phenotypes resembling the neonatal Zellweger syndrome but seen in children or adults with apparently intact peroxisome biogenesis. | 0 | 2 | 1 | 0 |
| Interstitial Nephritis [description not available] | 0 | 2 | 1 | 0 |
| Nephritis, Interstitial Inflammation of the interstitial tissue of the kidney. This term is generally used for primary inflammation of KIDNEY TUBULES and/or surrounding interstitium. For primary inflammation of glomerular interstitium, see GLOMERULONEPHRITIS. Infiltration of the inflammatory cells into the interstitial compartment results in EDEMA, increased spaces between the tubules, and tubular renal dysfunction. | 0 | 2 | 1 | 0 |
| Lymphocytopenia [description not available] | 0 | 2 | 1 | 0 |
| Granuloma, Respiratory Tract Granulomatous disorders affecting one or more sites in the respiratory tract. | 0 | 2 | 1 | 0 |
| Lymphopenia Reduction in the number of lymphocytes. | 0 | 2 | 1 | 0 |
| Enteropathy, Exudative [description not available] | 0 | 2 | 1 | 0 |
| Protein-Losing Enteropathies Pathological conditions in the INTESTINES that are characterized by the gastrointestinal loss of serum proteins, including SERUM ALBUMIN; IMMUNOGLOBULINS; and at times LYMPHOCYTES. Severe condition can result in HYPOGAMMAGLOBULINEMIA or LYMPHOPENIA. Protein-losing enteropathies are associated with a number of diseases including INTESTINAL LYMPHANGIECTASIS; WHIPPLE'S DISEASE; and NEOPLASMS of the SMALL INTESTINE. | 0 | 2 | 1 | 0 |
| Autosomal Dominant Juvenile Parkinson Disease [description not available] | 0 | 2 | 1 | 0 |
| Amentia [description not available] | 0 | 2.41 | 2 | 0 |
| Dementia An acquired organic mental disorder with loss of intellectual abilities of sufficient severity to interfere with social or occupational functioning. The dysfunction is multifaceted and involves memory, behavior, personality, judgment, attention, spatial relations, language, abstract thought, and other executive functions. The intellectual decline is usually progressive, and initially spares the level of consciousness. | 0 | 2.41 | 2 | 0 |
| Parkinsonian Disorders A group of disorders which feature impaired motor control characterized by bradykinesia, MUSCLE RIGIDITY; TREMOR; and postural instability. Parkinsonian diseases are generally divided into primary parkinsonism (see PARKINSON DISEASE), secondary parkinsonism (see PARKINSON DISEASE, SECONDARY) and inherited forms. These conditions are associated with dysfunction of dopaminergic or closely related motor integration neuronal pathways in the BASAL GANGLIA. | 0 | 2 | 1 | 0 |
| Coagulation Disorders, Blood [description not available] | 0 | 2.91 | 1 | 0 |
| Blood Coagulation Disorders Hemorrhagic and thrombotic disorders that occur as a consequence of abnormalities in blood coagulation due to a variety of factors such as COAGULATION PROTEIN DISORDERS; BLOOD PLATELET DISORDERS; BLOOD PROTEIN DISORDERS or nutritional conditions. | 0 | 2.91 | 1 | 0 |
| Lymphatic Diseases Diseases of LYMPH; LYMPH NODES; or LYMPHATIC VESSELS. | 0 | 2.37 | 2 | 0 |
| Leishmaniasis, American [description not available] | 0 | 2 | 1 | 0 |
| Leishmaniasis, Cutaneous An endemic disease that is characterized by the development of single or multiple localized lesions on exposed areas of skin that typically ulcerate. The disease has been divided into Old and New World forms. Old World leishmaniasis is separated into three distinct types according to epidemiology and clinical manifestations and is caused by species of the L. tropica and L. aethiopica complexes as well as by species of the L. major genus. New World leishmaniasis, also called American leishmaniasis, occurs in South and Central America and is caused by species of the L. mexicana or L. braziliensis complexes. | 0 | 2 | 1 | 0 |
| Central Hypothyroidism [description not available] | 0 | 2.39 | 2 | 0 |
| Hypothyroidism A syndrome that results from abnormally low secretion of THYROID HORMONES from the THYROID GLAND, leading to a decrease in BASAL METABOLIC RATE. In its most severe form, there is accumulation of MUCOPOLYSACCHARIDES in the SKIN and EDEMA, known as MYXEDEMA. It may be primary or secondary due to other pituitary disease, or hypothalamic dysfunction. | 0 | 2.39 | 2 | 0 |
| Myxoid Liposarcoma [description not available] | 0 | 2 | 1 | 0 |
| Liposarcoma, Myxoid A liposarcoma containing round mesenchymal cells and a myxoid extracellular matrix in stroma. | 0 | 2 | 1 | 0 |
| Wounds, Stab Penetrating wounds caused by a pointed object. | 0 | 2 | 1 | 0 |
| Delayed Hypersensitivity [description not available] | 0 | 3.78 | 2 | 1 |
| Atrophic Muscular Disorders [description not available] | 0 | 2 | 1 | 0 |
| Action Myoclonus-Renal Failure Syndrome [description not available] | 0 | 2 | 1 | 0 |
| Acantholysis Bullosa [description not available] | 0 | 2 | 1 | 0 |
| Epidermolysis Bullosa Group of genetically determined disorders characterized by the blistering of skin and mucosae. There are four major forms: acquired, simple, junctional, and dystrophic. Each of the latter three has several varieties. | 0 | 2 | 1 | 0 |
| Intestinal Diseases Pathological processes in any segment of the INTESTINE from DUODENUM to RECTUM. | 0 | 2 | 1 | 0 |
| Abnormality, Torsion [description not available] | 0 | 2 | 1 | 0 |
| Female Genitourinary Diseases [description not available] | 0 | 2 | 1 | 0 |
| Achondroplasia, Severe, With Developmental Delay And Acanthosis Nigricans [description not available] | 0 | 2 | 1 | 0 |
| Achondroplasia An autosomal dominant disorder that is the most frequent form of short-limb dwarfism. Affected individuals exhibit short stature caused by rhizomelic shortening of the limbs, characteristic facies with frontal bossing and mid-face hypoplasia, exaggerated lumbar lordosis, limitation of elbow extension, GENU VARUM, and trident hand. (Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim, MIM#100800, April 20, 2001) | 0 | 2 | 1 | 0 |
| Cancer of Larynx [description not available] | 0 | 2 | 1 | 0 |
| Laryngeal Neoplasms Cancers or tumors of the LARYNX or any of its parts: the GLOTTIS; EPIGLOTTIS; LARYNGEAL CARTILAGES; LARYNGEAL MUSCLES; and VOCAL CORDS. | 0 | 2 | 1 | 0 |
| Sterility, Female [description not available] | 0 | 2 | 1 | 0 |
| Infertility, Female Diminished or absent ability of a female to achieve conception. | 0 | 2 | 1 | 0 |
| Depression, Endogenous [description not available] | 0 | 3.39 | 1 | 1 |
| Depressive Disorder An affective disorder manifested by either a dysphoric mood or loss of interest or pleasure in usual activities. The mood disturbance is prominent and relatively persistent. | 0 | 3.39 | 1 | 1 |
| Pyrexia [description not available] | 0 | 2 | 1 | 0 |
| Anesthesia Related Hyperthermia [description not available] | 0 | 2 | 1 | 0 |
| Fever An abnormal elevation of body temperature, usually as a result of a pathologic process. | 0 | 2 | 1 | 0 |
| Hematoma, Subdural Accumulation of blood in the SUBDURAL SPACE between the DURA MATER and the arachnoidal layer of the MENINGES. This condition primarily occurs over the surface of a CEREBRAL HEMISPHERE, but may develop in the spinal canal (HEMATOMA, SUBDURAL, SPINAL). Subdural hematoma can be classified as the acute or the chronic form, with immediate or delayed symptom onset, respectively. Symptoms may include loss of consciousness, severe HEADACHE, and deteriorating mental status. | 0 | 2 | 1 | 0 |
| alpha-Galactosidase A Deficiency [description not available] | 0 | 2.92 | 1 | 0 |
| Fabry Disease An X-linked inherited metabolic disease caused by a deficiency of lysosomal ALPHA-GALACTOSIDASE A. It is characterized by intralysosomal accumulation of globotriaosylceramide and other GLYCOSPHINGOLIPIDS in blood vessels throughout the body leading to multi-system complications including renal, cardiac, cerebrovascular, and skin disorders. | 0 | 2.92 | 1 | 0 |
| Diabetes Insipidus A disease that is characterized by frequent urination, excretion of large amounts of dilute URINE, and excessive THIRST. Etiologies of diabetes insipidus include deficiency of antidiuretic hormone (also known as ADH or VASOPRESSIN) secreted by the NEUROHYPOPHYSIS, impaired KIDNEY response to ADH, and impaired hypothalamic regulation of thirst. | 0 | 2.01 | 1 | 0 |
| Cochlear Hearing Loss [description not available] | 0 | 2.01 | 1 | 0 |
| Hearing Loss, Sensorineural Hearing loss resulting from damage to the COCHLEA and the sensorineural elements which lie internally beyond the oval and round windows. These elements include the AUDITORY NERVE and its connections in the BRAINSTEM. | 0 | 2.01 | 1 | 0 |
| Retrolental Fibroplasia [description not available] | 0 | 4.31 | 1 | 1 |
| Retinopathy of Prematurity A bilateral retinopathy occurring in premature infants treated with excessively high concentrations of oxygen, characterized by vascular dilatation, proliferation, and tortuosity, edema, and retinal detachment, with ultimate conversion of the retina into a fibrous mass that can be seen as a dense retrolental membrane. Usually growth of the eye is arrested and may result in microophthalmia, and blindness may occur. (Dorland, 27th ed) | 0 | 4.31 | 1 | 1 |
| Sunburn An injury to the skin causing erythema, tenderness, and sometimes blistering and resulting from excessive exposure to the sun. The reaction is produced by the ultraviolet radiation in sunlight. | 0 | 2.01 | 1 | 0 |
| Vesicular Exanthema of Swine A calicivirus infection of swine characterized by hydropic degeneration of the oral and cutaneous epithelia. | 0 | 1.95 | 1 | 0 |
| Anorexia The lack or loss of APPETITE accompanied by an aversion to food and the inability to eat. It is the defining characteristic of the disorder ANOREXIA NERVOSA. | 0 | 1.95 | 1 | 0 |
| Remission, Spontaneous A spontaneous diminution or abatement of a disease over time, without formal treatment. | 0 | 3.05 | 5 | 0 |
| Purpura, Thrombopenic [description not available] | 0 | 1.95 | 1 | 0 |
| Purpura, Thrombocytopenic Any form of purpura in which the PLATELET COUNT is decreased. Many forms are thought to be caused by immunological mechanisms. | 0 | 1.95 | 1 | 0 |
| Antibody Deficiency Syndrome [description not available] | 0 | 4.27 | 4 | 1 |
| Immunologic Deficiency Syndromes Syndromes in which there is a deficiency or defect in the mechanisms of immunity, either cellular or humoral. | 0 | 4.27 | 4 | 1 |
| Arterial Inflammation [description not available] | 0 | 1.98 | 1 | 0 |
| Equine Diseases [description not available] | 0 | 1.98 | 1 | 0 |
| Infections, Togaviridae [description not available] | 0 | 2.66 | 3 | 0 |
| Hemorrhagic Fever, Epidemic [description not available] | 0 | 2.38 | 2 | 0 |
| Hemorrhagic Fever with Renal Syndrome An acute febrile disease occurring predominately in Asia. It is characterized by fever, prostration, vomiting, hemorrhagic phenonema, shock, and renal failure. It is caused by any one of several closely related species of the genus Hantavirus. The most severe form is caused by HANTAAN VIRUS whose natural host is the rodent Apodemus agrarius. Milder forms are caused by SEOUL VIRUS and transmitted by the rodents Rattus rattus and R. norvegicus, and the PUUMALA VIRUS with transmission by Clethrionomys galreolus. | 0 | 2.38 | 2 | 0 |
| Adrenal Cancer [description not available] | 0 | 1.98 | 1 | 0 |
| Deficiency, Factor 13 [description not available] | 0 | 1.98 | 1 | 0 |
| Factor XIII Deficiency A deficiency of blood coagulation FACTOR XIII or fibrin stabilizing factor (FSF) that prevents blood clot formation and results in a clinical hemorrhagic diathesis. | 0 | 1.98 | 1 | 0 |
| Ascites Accumulation or retention of free fluid within the peritoneal cavity. | 0 | 1.98 | 1 | 0 |
| Wallerian Degeneration Degeneration of distal aspects of a nerve axon following injury to the cell body or proximal portion of the axon. The process is characterized by fragmentation of the axon and its MYELIN SHEATH. | 0 | 1.98 | 1 | 0 |
| Chromosomal Fragility [description not available] | 0 | 1.98 | 1 | 0 |
| Gelineau Syndrome [description not available] | 0 | 1.98 | 1 | 0 |
| Cataleptic Attacks [description not available] | 0 | 1.98 | 1 | 0 |
| Narcolepsy A condition characterized by recurrent episodes of daytime somnolence and lapses in consciousness (microsomnias) that may be associated with automatic behaviors and AMNESIA. CATAPLEXY; SLEEP PARALYSIS, and hypnagogic HALLUCINATIONS frequently accompany narcolepsy. The pathophysiology of this disorder includes sleep-onset rapid eye movement (REM) sleep, which normally follows stage III or IV sleep. (From Neurology 1998 Feb;50(2 Suppl 1):S2-S7) | 0 | 1.98 | 1 | 0 |
| Distorted Hearing [description not available] | 0 | 2.89 | 1 | 0 |
| Leukemia, Smoldering [description not available] | 0 | 1.98 | 1 | 0 |
| Anemia, Refractory, with Excess of Blasts Chronic refractory anemia with granulocytopenia, and/or thrombocytopenia. Myeloblasts and progranulocytes constitute 5 to 40 percent of the nucleated marrow cells. | 0 | 1.98 | 1 | 0 |
| Edema, Fetal [description not available] | 0 | 1.98 | 1 | 0 |
| Autoimmune Thyroiditis [description not available] | 0 | 1.98 | 1 | 0 |
| Transmissible Venereal Tumors [description not available] | 0 | 1.97 | 1 | 0 |
| Bare Lymphocyte Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Severe Combined Immunodeficiency Group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. It is inherited as an X-linked or autosomal recessive defect. Mutations occurring in many different genes cause human Severe Combined Immunodeficiency (SCID). | 0 | 1.97 | 1 | 0 |
| Adipocere [description not available] | 0 | 1.97 | 1 | 0 |
| ARC [description not available] | 0 | 2.38 | 2 | 0 |
| AIDS-Related Complex A prodromal phase of infection with the human immunodeficiency virus (HIV). Laboratory criteria separating AIDS-related complex (ARC) from AIDS include elevated or hyperactive B-cell humoral immune responses, compared to depressed or normal antibody reactivity in AIDS; follicular or mixed hyperplasia in ARC lymph nodes, leading to lymphocyte degeneration and depletion more typical of AIDS; evolving succession of histopathological lesions such as localization of Kaposi's sarcoma, signaling the transition to the full-blown AIDS. | 0 | 2.38 | 2 | 0 |
| Cholangioma [description not available] | 0 | 1.97 | 1 | 0 |
| Adenoma, Bile Duct A benign tumor of the intrahepatic bile ducts. | 0 | 1.97 | 1 | 0 |
| Acrania [description not available] | 0 | 2.38 | 2 | 0 |
| Neural Tube Defects Congenital malformations of the central nervous system and adjacent structures related to defective neural tube closure during the first trimester of pregnancy generally occurring between days 18-29 of gestation. Ectodermal and mesodermal malformations (mainly involving the skull and vertebrae) may occur as a result of defects of neural tube closure. (From Joynt, Clinical Neurology, 1992, Ch55, pp31-41) | 0 | 2.38 | 2 | 0 |
| Sicca Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Sjogren's Syndrome Chronic inflammatory and autoimmune disease in which the salivary and lacrimal glands undergo progressive destruction by lymphocytes and plasma cells resulting in decreased production of saliva and tears. The primary form, often called sicca syndrome, involves both KERATOCONJUNCTIVITIS SICCA and XEROSTOMIA. The secondary form includes, in addition, the presence of a connective tissue disease, usually rheumatoid arthritis. | 0 | 1.97 | 1 | 0 |
| Marchiafava-Micheli Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Hemoglobinuria, Paroxysmal A condition characterized by the recurrence of HEMOGLOBINURIA caused by intravascular HEMOLYSIS. In cases occurring upon cold exposure (paroxysmal cold hemoglobinuria), usually after infections, there is a circulating antibody which is also a cold hemolysin. In cases occurring during or after sleep (paroxysmal nocturnal hemoglobinuria), the clonal hematopoietic stem cells exhibit a global deficiency of cell membrane proteins. | 0 | 1.97 | 1 | 0 |
| BLV Infections [description not available] | 0 | 2.38 | 2 | 0 |
| Fibromatosis [description not available] | 0 | 1.97 | 1 | 0 |
| EHS Tumor [description not available] | 0 | 1.97 | 1 | 0 |
| Fibroma A benign tumor of fibrous or fully developed connective tissue. | 0 | 1.97 | 1 | 0 |
| EBS-DM [description not available] | 0 | 2.38 | 2 | 0 |
| Epidermolysis Bullosa Simplex A form of epidermolysis bullosa characterized by serous bullae that heal without scarring. Mutations in the genes that encode KERATIN-5 and KERATIN-14 have been associated with several subtypes of epidermolysis bullosa simplex. | 0 | 2.38 | 2 | 0 |
| Mycosis Fungoides A chronic, malignant T-cell lymphoma of the skin. In the late stages, the LYMPH NODES and viscera are affected. | 0 | 1.98 | 1 | 0 |
| Antithrombin 3 Deficiency [description not available] | 0 | 1.97 | 1 | 0 |
| Antithrombin III Deficiency An absence or reduced level of Antithrombin III leading to an increased risk for thrombosis. | 0 | 1.97 | 1 | 0 |
| Arthritis, Juvenile Chronic [description not available] | 0 | 1.97 | 1 | 0 |
| Plica Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Arthritis, Juvenile Arthritis in children, with onset before 16 years of age. The terms juvenile rheumatoid arthritis (JRA) and juvenile idiopathic arthritis (JIA) refer to classification systems for chronic arthritis in children. Only one subtype of juvenile arthritis (polyarticular-onset, rheumatoid factor-positive) clinically resembles adult rheumatoid arthritis and is considered its childhood equivalent. | 0 | 1.97 | 1 | 0 |
| Synovitis Inflammation of the SYNOVIAL MEMBRANE. | 0 | 1.97 | 1 | 0 |
| Leprosy, Cutaneous [description not available] | 0 | 1.97 | 1 | 0 |
| Leprosy, Macular [description not available] | 0 | 1.97 | 1 | 0 |
| Chicken Pox [description not available] | 0 | 1.97 | 1 | 0 |
| Chickenpox A highly contagious infectious disease caused by the varicella-zoster virus (HERPESVIRUS 3, HUMAN). It usually affects children, is spread by direct contact or respiratory route via droplet nuclei, and is characterized by the appearance on the skin and mucous membranes of successive crops of typical pruritic vesicular lesions that are easily broken and become scabbed. Chickenpox is relatively benign in children, but may be complicated by pneumonia and encephalitis in adults. (From Dorland, 27th ed) | 0 | 1.97 | 1 | 0 |
| Cervix Dysplasia [description not available] | 0 | 1.97 | 1 | 0 |
| Uterine Cervical Dysplasia Abnormal development of immature squamous EPITHELIAL CELLS of the UTERINE CERVIX, a term used to describe premalignant cytological changes in the cervical EPITHELIUM. These atypical cells do not penetrate the epithelial BASEMENT MEMBRANE. | 0 | 1.97 | 1 | 0 |
| Giant Cell Tumors Tumors of bone tissue or synovial or other soft tissue characterized by the presence of giant cells. The most common are giant cell tumor of tendon sheath and GIANT CELL TUMOR OF BONE. | 0 | 1.97 | 1 | 0 |
| Corridor Disease [description not available] | 0 | 1.97 | 1 | 0 |
| Cervix Diseases [description not available] | 0 | 1.97 | 1 | 0 |
| Anemia, Hemolytic, Hereditary [description not available] | 0 | 2.38 | 2 | 0 |
| Anemia, Hemolytic, Congenital Hemolytic anemia due to various intrinsic defects of the erythrocyte. | 0 | 2.38 | 2 | 0 |
| Acquired Autoimmune Hemolytic Anemia [description not available] | 0 | 1.97 | 1 | 0 |
| Anemia, Hemolytic, Autoimmune Acquired hemolytic anemia due to the presence of AUTOANTIBODIES which agglutinate or lyse the patient's own RED BLOOD CELLS. | 0 | 1.97 | 1 | 0 |
| Benign Infantile Myoclonic Epilepsy [description not available] | 0 | 1.97 | 1 | 0 |
| Epilepsies, Myoclonic A clinically diverse group of epilepsy syndromes characterized either by myoclonic seizures or by myoclonus in association with other seizure types. Myoclonic epilepsy syndromes are divided into three subtypes based on etiology: familial, cryptogenic, and symptomatic. | 0 | 1.97 | 1 | 0 |
| Adenoma, beta-Cell [description not available] | 0 | 1.97 | 1 | 0 |
| Insulinoma A benign tumor of the PANCREATIC BETA CELLS. Insulinoma secretes excess INSULIN resulting in HYPOGLYCEMIA. | 0 | 1.97 | 1 | 0 |
| Androgen Insensitivity Syndrome [description not available] | 0 | 2.38 | 2 | 0 |
| B-K Mole Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Nevi, Melanocytic [description not available] | 0 | 1.97 | 1 | 0 |
| Dysplastic Nevus Syndrome Clinically atypical nevi (usually exceeding 5 mm in diameter and having variable pigmentation and ill defined borders) with an increased risk for development of non-familial cutaneous malignant melanoma. Biopsies show melanocytic dysplasia. Nevi are clinically and histologically identical to the precursor lesions for melanoma in the B-K mole syndrome. (Stedman, 25th ed) | 0 | 1.97 | 1 | 0 |
| Nevus, Pigmented A nevus containing melanin. The term is usually restricted to nevocytic nevi (round or oval collections of melanin-containing nevus cells occurring at the dermoepidermal junction of the skin or in the dermis proper) or moles, but may be applied to other pigmented nevi. | 0 | 1.97 | 1 | 0 |
| Polyps Discrete abnormal tissue masses that protrude into the lumen of the DIGESTIVE TRACT or the RESPIRATORY TRACT. Polyps can be spheroidal, hemispheroidal, or irregular mound-shaped structures attached to the MUCOUS MEMBRANE of the lumen wall either by a stalk, pedunculus, or by a broad base. | 0 | 1.97 | 1 | 0 |
| Bessel-Hagen Disease [description not available] | 0 | 1.97 | 1 | 0 |
| Cystadenoma A benign neoplasm derived from glandular epithelium, in which cystic accumulations of retained secretions are formed. In some instances, considerable portions of the neoplasm, or even the entire mass, may be cystic. (Stedman, 25th ed) | 0 | 1.97 | 1 | 0 |
| Anemia, Hemolytic, Acquired [description not available] | 0 | 2.87 | 4 | 0 |
| Anemia, Hemolytic A condition of inadequate circulating red blood cells (ANEMIA) or insufficient HEMOGLOBIN due to premature destruction of red blood cells (ERYTHROCYTES). | 0 | 2.87 | 4 | 0 |
| External Ophthalmoplegia [description not available] | 0 | 1.97 | 1 | 0 |
| Anemia, Congenital Nonspherocytic Hemolytic [description not available] | 0 | 1.97 | 1 | 0 |
| Nanism [description not available] | 0 | 1.97 | 1 | 0 |
| Dwarfism A genetic or pathological condition that is characterized by short stature and undersize. Abnormal skeletal growth usually results in an adult who is significantly below the average height. | 0 | 1.97 | 1 | 0 |
| Idiopathic Inflammatory Myopathies [description not available] | 0 | 1.97 | 1 | 0 |
| Myositis Inflammation of a muscle or muscle tissue. | 0 | 1.97 | 1 | 0 |
| BCKD Deficiency [description not available] | 0 | 1.97 | 1 | 0 |
| Maple Syrup Urine Disease An autosomal recessive inherited disorder with multiple forms of phenotypic expression, caused by a defect in the oxidative decarboxylation of branched-chain amino acids (AMINO ACIDS, BRANCHED-CHAIN). These metabolites accumulate in body fluids and render a maple syrup odor. The disease is divided into classic, intermediate, intermittent, and thiamine responsive subtypes. The classic form presents in the first week of life with ketoacidosis, hypoglycemia, emesis, neonatal seizures, and hypertonia. The intermediate and intermittent forms present in childhood or later with acute episodes of ataxia and vomiting. (From Adams et al., Principles of Neurology, 6th ed, p936) | 0 | 1.97 | 1 | 0 |
| Human Trichinellosis [description not available] | 0 | 1.97 | 1 | 0 |
| Trichinellosis An infection with TRICHINELLA. It is caused by eating raw or undercooked meat that is infected with larvae of nematode worms TRICHINELLA genus. All members of the TRICHINELLA genus can infect human in addition to TRICHINELLA SPIRALIS, the traditional etiological agent. It is distributed throughout much of the world and is re-emerging in some parts as a public health hazard and a food safety problem. | 0 | 1.97 | 1 | 0 |
| Bonnevie-Ullrich Syndrome This syndrome that was originally observed by Ullrich, and designated as identical to TURNER SYNDROME, related the webbing of the neck, loose skin and other anomalies of the syndrome to accumulation of fluid in the embryo starting at the head and dispersing to the extremities (as observed by Bonnevie in mice). Commonly observed at birth in Turner Syndrome and NOONAN SYNDROME; EDEMA of the extremities usually recedes by one year and is an early sign of Turner syndrome, especially in female neonates. | 0 | 1.97 | 1 | 0 |
| Turner Syndrome A syndrome of defective gonadal development in phenotypic females associated with the karyotype 45,X (or 45,XO). Patients generally are of short stature with undifferentiated GONADS (streak gonads), SEXUAL INFANTILISM, HYPOGONADISM, webbing of the neck, cubitus valgus, elevated GONADOTROPINS, decreased ESTRADIOL level in blood, and CONGENITAL HEART DEFECTS. NOONAN SYNDROME (also called Pseudo-Turner Syndrome and Male Turner Syndrome) resembles this disorder; however, it occurs in males and females with a normal karyotype and is inherited as an autosomal dominant. | 0 | 1.97 | 1 | 0 |
| Eye Abnormalities Congenital absence of or defects in structures of the eye; may also be hereditary. | 0 | 1.97 | 1 | 0 |
| Abetalipoproteinemia An autosomal recessive disorder of lipid metabolism. It is caused by mutation of the microsomal triglyceride transfer protein that catalyzes the transport of lipids (TRIGLYCERIDES; CHOLESTEROL ESTERS; PHOSPHOLIPIDS) and is required in the secretion of BETA-LIPOPROTEINS (low density lipoproteins or LDL). Features include defective intestinal lipid absorption, very low serum cholesterol level, and near absent LDL. | 0 | 1.97 | 1 | 0 |
| Armstrong Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Jaundice, Spirochetal [description not available] | 0 | 1.97 | 1 | 0 |
| Hepatitis, Infectious [description not available] | 0 | 1.97 | 1 | 0 |
| Hepatitis A INFLAMMATION of the LIVER in humans caused by a member of the HEPATOVIRUS genus, HUMAN HEPATITIS A VIRUS. It can be transmitted through fecal contamination of food or water. | 0 | 1.97 | 1 | 0 |
| Glandular Fever [description not available] | 0 | 2.36 | 2 | 0 |
| Immunoproliferative Disorders Disorders characterized by abnormal proliferation of primary cells of the immune system or by excessive production of immunoglobulins. | 0 | 1.97 | 1 | 0 |
| Infectious Mononucleosis A common, acute infection usually caused by the Epstein-Barr virus (HERPESVIRUS 4, HUMAN). There is an increase in mononuclear white blood cells and other atypical lymphocytes, generalized lymphadenopathy, splenomegaly, and occasionally hepatomegaly with hepatitis. | 0 | 2.36 | 2 | 0 |
| Carcinoma, Basal Cell, Pigmented [description not available] | 0 | 1.97 | 1 | 0 |
| Carcinoma, Basal Cell A malignant skin neoplasm that seldom metastasizes but has potentialities for local invasion and destruction. Clinically it is divided into types: nodular, cicatricial, morphaic, and erythematoid (pagetoid). They develop on hair-bearing skin, most commonly on sun-exposed areas. Approximately 85% are found on the head and neck area and the remaining 15% on the trunk and limbs. (From DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1471) | 0 | 1.97 | 1 | 0 |
| Slow Virus Diseases Diseases of viral origin, characterized by incubation periods of months to years, insidious onset of clinical manifestations, and protracted clinical course. Though the disease process is protracted, viral multiplication may not be unusually slow. Conventional viruses produce slow virus diseases such as SUBACUTE SCLEROSING PANENCEPHALITIS, progressive multifocal leukoencephalopathy (LEUKOENCEPHALOPATHY, PROGRESSIVE MULTIFOCAL), and AIDS. Diseases produced by unconventional agents were originally considered part of this group. They are now called PRION DISEASES. | 0 | 1.97 | 1 | 0 |
| (pPNET) Peripheral Primitive Neuroectodermal Tumors [description not available] | 0 | 1.97 | 1 | 0 |
| Neuroectodermal Tumors, Primitive, Peripheral A group of highly cellular primitive round cell neoplasms which occur extracranially in soft tissue and bone and are derived from embryonal neural crest cells. These tumors occur primarily in children and adolescents and share a number of characteristics with EWING SARCOMA. | 0 | 1.97 | 1 | 0 |
| Experimental Radiation Injuries [description not available] | 0 | 1.97 | 1 | 0 |
| ARG1 Deficiency [description not available] | 0 | 1.97 | 1 | 0 |
| Amino Acid Metabolism Disorders, Inborn [description not available] | 0 | 1.97 | 1 | 0 |
| Hyperargininemia A rare autosomal recessive disorder of the urea cycle. It is caused by a deficiency of the hepatic enzyme ARGINASE. Arginine is elevated in the blood and cerebrospinal fluid, and periodic HYPERAMMONEMIA may occur. Disease onset is usually in infancy or early childhood. Clinical manifestations include seizures, microcephaly, progressive mental impairment, hypotonia, ataxia, spastic diplegia, and quadriparesis. (From Hum Genet 1993 Mar;91(1):1-5; Menkes, Textbook of Child Neurology, 5th ed, p51) | 0 | 1.97 | 1 | 0 |
| HTLV-II Infections Diseases caused by HUMAN T-LYMPHOTROPIC VIRUS 2. | 0 | 1.97 | 1 | 0 |
| Complications of Diabetes Mellitus [description not available] | 0 | 2.89 | 1 | 0 |
| Lipidoses Conditions characterized by abnormal lipid deposition due to disturbance in lipid metabolism, such as hereditary diseases involving lysosomal enzymes required for lipid breakdown. They are classified either by the enzyme defect or by the type of lipid involved. | 0 | 1.96 | 1 | 0 |
| Leukemia, Radiation-Induced Leukemia produced by exposure to IONIZING RADIATION or NON-IONIZING RADIATION. | 0 | 1.97 | 1 | 0 |
| Anal Cancer [description not available] | 0 | 1.97 | 1 | 0 |
| Male Genital Neoplasms [description not available] | 0 | 1.97 | 1 | 0 |
| Anus Neoplasms Tumors or cancer of the ANAL CANAL. | 0 | 1.97 | 1 | 0 |
| Genital Neoplasms, Male Tumor or cancer of the MALE GENITALIA. | 0 | 1.97 | 1 | 0 |
| Cancer of the Tongue [description not available] | 0 | 1.97 | 1 | 0 |
| Tongue Neoplasms Tumors or cancer of the TONGUE. | 0 | 1.97 | 1 | 0 |
| Verruca [description not available] | 0 | 1.97 | 1 | 0 |
| Warts Benign epidermal proliferations or tumors; some are viral in origin. | 0 | 1.97 | 1 | 0 |
| 47,XX,+21 [description not available] | 0 | 1.97 | 1 | 0 |
| Down Syndrome A chromosome disorder associated either with an extra chromosome 21 or an effective trisomy for chromosome 21. Clinical manifestations include hypotonia, short stature, brachycephaly, upslanting palpebral fissures, epicanthus, Brushfield spots on the iris, protruding tongue, small ears, short, broad hands, fifth finger clinodactyly, Simian crease, and moderate to severe INTELLECTUAL DISABILITY. Cardiac and gastrointestinal malformations, a marked increase in the incidence of LEUKEMIA, and the early onset of ALZHEIMER DISEASE are also associated with this condition. Pathologic features include the development of NEUROFIBRILLARY TANGLES in neurons and the deposition of AMYLOID BETA-PROTEIN, similar to the pathology of ALZHEIMER DISEASE. (Menkes, Textbook of Child Neurology, 5th ed, p213) | 0 | 1.97 | 1 | 0 |
| Equine Infectious Anemia Viral disease of horses caused by the equine infectious anemia virus (EIAV; INFECTIOUS ANEMIA VIRUS, EQUINE). It is characterized by intermittent fever, weakness, and anemia. Chronic infection consists of acute episodes with remissions. | 0 | 1.96 | 1 | 0 |
| Parodontosis [description not available] | 0 | 2.37 | 2 | 0 |
| Periodontal Diseases Pathological processes involving the PERIODONTIUM including the gum (GINGIVA), the alveolar bone (ALVEOLAR PROCESS), the DENTAL CEMENTUM, and the PERIODONTAL LIGAMENT. | 0 | 2.37 | 2 | 0 |
| Familial Felty Syndrome [description not available] | 0 | 1.97 | 1 | 0 |
| Broad Beta Disease [description not available] | 0 | 1.96 | 1 | 0 |
| Hyperlipoproteinemia Type III An autosomal recessively inherited disorder characterized by the accumulation of intermediate-density lipoprotein (IDL or broad-beta-lipoprotein). IDL has a CHOLESTEROL to TRIGLYCERIDES ratio greater than that of VERY-LOW-DENSITY LIPOPROTEINS. This disorder is due to mutation of APOLIPOPROTEINS E, a receptor-binding component of VLDL and CHYLOMICRONS, resulting in their reduced clearance and high plasma levels of both cholesterol and triglycerides. | 0 | 1.96 | 1 | 0 |
| Envenomation, Snakebite [description not available] | 0 | 1.95 | 1 | 0 |
| Fowl Paralysis [description not available] | 0 | 1.95 | 1 | 0 |