| Assay ID | Title | Year | Journal | Article |
|---|
| AID542442 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 100 uM after 14 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID536854 | Cytotoxicity against human MT2 cells assessed as concentration required to 50% inhibition of cell growth relative to control | 2010 | Journal of medicinal chemistry, Nov-25, Volume: 53, Issue:22
| Design, synthesis, and biological evaluation of novel hybrid dicaffeoyltartaric/diketo acid and tetrazole-substituted L-chicoric acid analogue inhibitors of human immunodeficiency virus type 1 integrase. |
| AID104984 | Effective concentration required to reduce the exponential growth of MT-4/KB cells | 2004 | Bioorganic & medicinal chemistry letters, Apr-05, Volume: 14, Issue:7
| 6-aryl-2,4-dioxo-5-hexenoic acids, novel integrase inhibitors active against HIV-1 multiplication in cell-based assays. |
| AID161727 | In vitro inhibition of (HIV-1 IIIB) replication. | 2000 | Journal of medicinal chemistry, Dec-28, Volume: 43, Issue:26
| 4-Aryl-2,4-dioxobutanoic acid inhibitors of HIV-1 integrase and viral replication in cells. |
| AID536856 | Antiviral activity against HIV LAI infected in human MT2 cells assessed as protection against virus-induced cytopathic effect | 2010 | Journal of medicinal chemistry, Nov-25, Volume: 53, Issue:22
| Design, synthesis, and biological evaluation of novel hybrid dicaffeoyltartaric/diketo acid and tetrazole-substituted L-chicoric acid analogue inhibitors of human immunodeficiency virus type 1 integrase. |
| AID542452 | Inhibition of HTLV-1 integrase strand transfer activity in PBMC cells at 50 uM measured on day 21 | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID542444 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 50 uM after 21 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID542445 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 100 uM after 21 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID542438 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 50 uM after 7 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID365653 | Antiviral activity against HIV1-infected in human H9/HTLV 3B cells after 4 days | 2008 | Journal of medicinal chemistry, Aug-14, Volume: 51, Issue:15
| Novel quinolinonyl diketo acid derivatives as HIV-1 integrase inhibitors: design, synthesis, and biological activities. |
| AID542441 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 50 uM after 14 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID394566 | Cytotoxicity against p53 deficient human HCT116 cells after 72 hrs by MTT assay | 2009 | Bioorganic & medicinal chemistry, Apr-01, Volume: 17, Issue:7
| Design and synthesis of novel dihydroquinoline-3-carboxylic acids as HIV-1 integrase inhibitors. |
| AID394562 | Inhibition of HIV1 integrase 3' processing activity by PAGE | 2009 | Bioorganic & medicinal chemistry, Apr-01, Volume: 17, Issue:7
| Design and synthesis of novel dihydroquinoline-3-carboxylic acids as HIV-1 integrase inhibitors. |
| AID310942 | Antiviral activity against human immunodeficiency virus 1 in cell culture | 2007 | European journal of medicinal chemistry, Sep, Volume: 42, Issue:9
| Development of integrase inhibitors for treatment of AIDS: an overview. |
| AID232776 | Selectivity index was determined | 2004 | Bioorganic & medicinal chemistry letters, Apr-05, Volume: 14, Issue:7
| 6-aryl-2,4-dioxo-5-hexenoic acids, novel integrase inhibitors active against HIV-1 multiplication in cell-based assays. |
| AID93678 | Inhibitory activity against HIV-1 integrase. | 2004 | Bioorganic & medicinal chemistry letters, Apr-05, Volume: 14, Issue:7
| 6-aryl-2,4-dioxo-5-hexenoic acids, novel integrase inhibitors active against HIV-1 multiplication in cell-based assays. |
| AID394563 | Inhibition of HIV1 integrase strand transfer activity by PAGE | 2009 | Bioorganic & medicinal chemistry, Apr-01, Volume: 17, Issue:7
| Design and synthesis of novel dihydroquinoline-3-carboxylic acids as HIV-1 integrase inhibitors. |
| AID542446 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 250 uM after 21 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID394565 | Cytotoxicity against human HCT116 cells expressing p53 after 72 hrs by MTT assay | 2009 | Bioorganic & medicinal chemistry, Apr-01, Volume: 17, Issue:7
| Design and synthesis of novel dihydroquinoline-3-carboxylic acids as HIV-1 integrase inhibitors. |
| AID542437 | Cytotoxic activity against human PBMC cells | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID542450 | Inhibition of HTLV-1 integrase strand transfer activity in PBMC cells at 100 uM measured on day 14 | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID212877 | Cytotoxic concentration required to reduce the viability of mock-infected cells was determined by using MTT assay | 2004 | Bioorganic & medicinal chemistry letters, Apr-05, Volume: 14, Issue:7
| 6-aryl-2,4-dioxo-5-hexenoic acids, novel integrase inhibitors active against HIV-1 multiplication in cell-based assays. |
| AID542443 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 250 uM after 14 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID1628228 | Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-Cy5) substrate | 2016 | Journal of medicinal chemistry, Mar-24, Volume: 59, Issue:6
| 3-Hydroxypyrimidine-2,4-diones as Selective Active Site Inhibitors of HIV Reverse Transcriptase-Associated RNase H: Design, Synthesis, and Biochemical Evaluations. |
| AID542451 | Inhibition of HTLV-1 integrase strand transfer activity in PBMC cells at 100 uM measured on day 21 | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID536857 | Inhibition of HIV NL4-3 recombinant histidine-tagged integrase strand transfer activity expressed in Escherichia coli BL21 (DE3) | 2010 | Journal of medicinal chemistry, Nov-25, Volume: 53, Issue:22
| Design, synthesis, and biological evaluation of novel hybrid dicaffeoyltartaric/diketo acid and tetrazole-substituted L-chicoric acid analogue inhibitors of human immunodeficiency virus type 1 integrase. |
| AID264930 | Inhibition of HIV integrase | 2006 | Bioorganic & medicinal chemistry letters, Jun-01, Volume: 16, Issue:11
| Triketoacid inhibitors of HIV-integrase: a new chemotype useful for probing the integrase pharmacophore. |
| AID93359 | Inhibition of recombinant HIV-1 Integrase in strand transfer enzyme assay. | 2000 | Journal of medicinal chemistry, Dec-28, Volume: 43, Issue:26
| 4-Aryl-2,4-dioxobutanoic acid inhibitors of HIV-1 integrase and viral replication in cells. |
| AID542440 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 250 uM after 7 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID536853 | Cytotoxicity against human MT2 cells assessed as concentration required to 5% inhibition of cell growth relative to control | 2010 | Journal of medicinal chemistry, Nov-25, Volume: 53, Issue:22
| Design, synthesis, and biological evaluation of novel hybrid dicaffeoyltartaric/diketo acid and tetrazole-substituted L-chicoric acid analogue inhibitors of human immunodeficiency virus type 1 integrase. |
| AID394564 | Selectivity index, ratio of IC50 for HIV1 integrase 3' processing activity to IC50 for HIV1 integrase strand transfer activity | 2009 | Bioorganic & medicinal chemistry, Apr-01, Volume: 17, Issue:7
| Design and synthesis of novel dihydroquinoline-3-carboxylic acids as HIV-1 integrase inhibitors. |
| AID264920 | Inhibition of HIV1 recombinant integrase | 2006 | Bioorganic & medicinal chemistry letters, Jun-01, Volume: 16, Issue:11
| Triketoacid inhibitors of HIV-integrase: a new chemotype useful for probing the integrase pharmacophore. |
| AID666263 | Inhibition of HIV1 integrase-mediated strand transfer | 2011 | ACS medicinal chemistry letters, Oct-05, Volume: 2, Issue:12
| Discovery of a Potent HIV Integrase Inhibitor that Leads to a Prodrug with Significant anti-HIV Activity. |
| AID666287 | Antiviral activity against HIV1 infected in human MT4 cells | 2011 | ACS medicinal chemistry letters, Oct-05, Volume: 2, Issue:12
| Discovery of a Potent HIV Integrase Inhibitor that Leads to a Prodrug with Significant anti-HIV Activity. |
| AID361637 | Inhibition of recombinant HIV1 integrase strand transfer activity by high throughput electrochemiluminescent assay in presence of magnesium | 2008 | Journal of medicinal chemistry, Aug-14, Volume: 51, Issue:15
| Novel quinolinonyl diketo acid derivatives as HIV-1 integrase inhibitors: design, synthesis, and biological activities. |
| AID542439 | Growth inhibition of human PBMC cells cocultured with irradiated HTLV-1 positive MT2 cells at 100 uM after 7 days | 2008 | Antimicrobial agents and chemotherapy, Oct, Volume: 52, Issue:10
| Inhibitors of strand transfer that prevent integration and inhibit human T-cell leukemia virus type 1 early replication. |
| AID536855 | Inhibition of HIV NL4-3 recombinant histidine-tagged integrase 3'-end processing activity expressed in Escherichia coli BL21 (DE3) | 2010 | Journal of medicinal chemistry, Nov-25, Volume: 53, Issue:22
| Design, synthesis, and biological evaluation of novel hybrid dicaffeoyltartaric/diketo acid and tetrazole-substituted L-chicoric acid analogue inhibitors of human immunodeficiency virus type 1 integrase. |
| AID1798319 | Integrase 3-End Joining Assay from Article 10.1016/j.jmb.2008.04.054: \\Modeling, analysis, and validation of a novel HIV integrase structure provide insights into the binding modes of potent integrase inhibitors.\\ | 2008 | Journal of molecular biology, Jul-11, Volume: 380, Issue:3
| Modeling, analysis, and validation of a novel HIV integrase structure provide insights into the binding modes of potent integrase inhibitors. |
| [information is prepared from bioassay data collected from National Library of Medicine (NLM), extracted Dec-2023] |