dolutegravir profile

ID Source	ID
PubMed CID	54726191
CHEMBL ID	1229211
CHEBI ID	76010
SCHEMBL ID	82071
MeSH ID	M0562621

Synonym
HY-13238
dolutegravir ,
chebi:76010 ,
s-349572
bdbm50062551
gsk1349572
gsk-1349572
s/gsk-1349572
1051375-16-6
dolutegravir (usan)
D10066
BCP9000620
S/GSK1349572 ,
dolutegravir [usan:inn]
s-gsk1349572
hsdb 8152
dko1w9h7m1 ,
2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide, n-((2,4-difluorophenyl)methyl)-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-, (4r,12as)-
gsk 1349572
unii-dko1w9h7m1
CHEMBL1229211
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-pyrido[1',2':4,5]pyrazino[2,1-b][1,3]oxazine-9-carboxamide
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.0^{3,8}]tetradeca-10,13-diene-13-carboxamide
s/gsk1349572,gsk1349572
NCGC00346629-01
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-7-hydroxy-4-methyl-6,8-dioxo-3,4,12,12a-tetrahydro-2h-pyrido[[?]:[?]]pyrazino[[?]][1,3]oxazine-9-carboxamide
CS-0454
dolutegravir [mi]
dolutegravir [inn]
dolutegravir [vandf]
(4r,12.alpha.s)-n-((2,4-difluorophenyl)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12.alpha.-hexahydro-2h-pyrido(1',2':4,5)pyrazino(2,1-.beta.)(1,3)oxazine-9-carboxamide
dolutegravir [usan]
dolutegravir [who-dd]
S2667
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2h-pyrido[1',2':4,5]pyrazino[2,1-b][1,3]oxazine-9-carboxamide
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-7-hydroxy-4-methyl-6,8-dioxo-3,4,12,12a-tetrahydro-2h-pyrido[5,6]pyrazino[2,6-b][1,3]oxazine-9-carboxamide
gtpl7365
DB08930
SCHEMBL82071
smr004702915
MLS006011137
3S3M
3S3N
3S3O
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2h-pyrido[1',2':4,5]pyrazino[2,1-b][1 ,3]oxazine-9-carboxamide
J-501471
dolutegravir (gsk1349572)
AC-28371
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-[1,3]oxazino[3,2-a]pyrido[1,2-d]pyrazine-9-carboxamide
AKOS025396657
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-13-carboxamide
mfcd20488027
RHWKPHLQXYSBKR-BMIGLBTASA-N
1051375-16-6 (free)
EX-A1695
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide
soltegravir
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.0(3),?]tetradeca-10,13-diene-13-carboxamide
AS-75277
Q937224
CCG-268876
NCGC00346629-02
DTXSID90909356
A854801
dolutegravir dtg
(4r,12as)-n-((2,4-difluorophenyl)methyl)-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide
dolutegravirum
(4r,12as)-n-
(4r,9as)-5-hydroxy-4-methyl-6,10-dioxo-3,4,6,9,9a,10-hexahydro-2h-1-oxa-4a,8a-diazaanthracene-7-carboxylic acid 2,4-difluorobenzylamide
(4r,9as)-5-hydroxy-4-methyl-6,10-dioxo-3,4,6,9,9a,10-hexahydro-2h-1-oxa-4a,8a-diaza-anthracene-7-carboxylic acid-2,4 difluorobenzylamide
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide
j05ax12
(4r,12alphas)-n-((2,4-difluorophenyl)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12alpha-hexahydro-2h-pyrido(1',2':4,5)pyrazino(2,1-beta)(1,3)oxazine-9-carboxamide
2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide, n-((2,4-difluorophenyl)methyl)-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-, (4r,12as)
Z2235801952
EN300-7409916
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.0,3,8]tetradeca-10,13-diene-13-carboxamide

Excerpt	Reference	Relevance
"Dolutegravir (DTG) is an antiretroviral drug of the integrase strand transfer inhibitor (INSTI) class used to treat human immunodeficiency virus infection. "	( Dolutegravir Impairs Stem Cell-Based 3D Morphogenesis Models in a Manner Dependent on Dose and Timing of Exposure: An Implication for Its Developmental Toxicity. Katayama, N; Kirkwood-Johnson, L; Marikawa, Y, 2021)	3.51
"Dolutegravir is a second-generation integrase strand transfer inhibitor of particular interest as a rescue treatment for people living with HIV (PLWHIV) who develop resistance to multiple antiretrovirals (ART). "	( COPEDOL: A two-year observational study in pretreated HIV-1-infected patients switching to a dolutegravir-based regimen. Bennani, M; Finkielsztejn, L; Kousignian, P; Landman, R; Marcelin, AG; Nachbaur, G; Philippe, C; Pourcher, V; Roustand, L, 2022)	2.38
"Dolutegravir (DTG) is a leading INSTI that is given, usually in combination with nucleoside reverse transcriptase inhibitors (NRTIs), to treat HIV-1 infections."	( INSTIs and NNRTIs Potently Inhibit HIV-1 Polypurine Tract Mutants in a Single Round Infection Assay. Burke, TR; Ferris, A; Hughes, SH; Pauly, G; Schneider, JP; Smith, SJ; Zhao, X, 2021)	1.34
"Dolutegravir is a widespread integrase strand-transfer inhibitor (INSTI) recommended for treatment of primary HIV infection (PHI). "	( HIV-1-RNA and total HIV-1-DNA loads in the genital compartment in men receiving dolutegravir- versus darunavir-based combined ART (cART) regimens during primary HIV infection. Ajana, F; Avettand-Fenoel, V; Bauer, R; Charre, C; Cheret, A; Cua, E; Gardiennet, E; Lacombe, K; Mariaggi, AA; Meiffredy, V; Meyer, L; Pialoux, G; Rouzioux, C, 2022)	2.39
"Dolutegravir is a component of preferred antiretroviral therapy (ART) regimens. "	( Pharmacogenetics of Dolutegravir Plasma Exposure Among Southern Africans With Human Immunodeficiency Virus. Bradford, Y; Chandiwana, N; Cindi, Z; Denti, P; Haas, DW; Kawuma, AN; Maartens, G; Ritchie, MD; Sinxadi, P; Sokhela, S; Venter, F; Wasmann, RE; Wiesner, L, 2022)	2.49
"Dolutegravir (DTG) is a second-generation integrase strand transfer inhibitor that is recommended by the World Health Organization as the preferred first-line and second-line antiretroviral therapy (ART) in patients with HIV. "	( Prevalence of neuropsychiatric adverse events and associated factors among adult patients on dolutegravir attending Mulago ISS clinic. Birungi, C; Meya, D; Musiime, V; Mwebaza, J, 2023)	2.57
"Dolutegravir (DTG) is an Integrase Strand Transfer Inhibitor (INSTI) indicated in combination with other antiretroviral agents for the treatment of HIV infection. "	( An evaluation of postmarketing reports of hyperglycaemia associated with dolutegravir for treatment of HIV in Eswatini. Duga, AL; Härmark, L; Ladwar, DO; Magongo, S; Nhlabatsi, S; Rolfes, L, 2022)	2.4
"Dolutegravir is a comparatively recent molecular entity that represents an advance over previous products."	( Preliminary Evaluation of Stability Data for Dolutegravir-Containing Triple Active Formulations Intended for PEPFAR. Degradation of Tenofovir Disoproxil Fumarate and Tenofovir Alafenamide as the Limiting Factor. Lunn, G, 2023)	1.89
"Dolutegravir (DTG) is a recommended first-line regimen for all people with Human Immunodeficiency Virus (HIV) infection. "	( Folate deficiency increases the incidence of dolutegravir-associated foetal defects in a mouse pregnancy model. Copp, AJ; De Young, T; Dontsova, V; Goddard, C; Greene, NDE; Laurette, EY; Leung, KY; MacKenzie, B; Mohan, H; Nguyen, J; Sanghvi, T; Serghides, L; Sled, JG; Tejada, O; Yee, A, 2023)	2.61
"Dolutegravir is a potent and well-tolerated, once-daily HIV-1 integrase inhibitor recommended for HIV-1 infection in both adults and children down to 4 weeks of age."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.9
"Dolutegravir-based ART is an excellent option for treatment of individuals with HIV-2 infection."	( Effectiveness of dolutegravir-based antiretroviral treatment for HIV-2 infection: retrospective observational study from Western India. Bele, V; Chitalikar, A; Dabhade, D; Gaikwad, S; Joshi, K; Patel, A; Patel, K; Pujari, S, 2020)	1.62
"Dolutegravir (DTG) is a potent integrase inhibitor of human immunodeficiency virus. "	( ABCG2 Deficiency Does Not Alter Dolutegravir Metabolism and Pharmacokinetics. Ma, X; McMahon, DK; Shehu, AI; Tian, X; Zhu, J, 2020)	2.28
"Dolutegravir is a widely used second-generation integrase strand transfer inhibitor: conflicting data suggest that neuropsychiatric side effects may present at a higher frequency in patients with higher dolutegravir serum concentrations."	( Older Age is Associated with Higher Dolutegravir Exposure in Plasma and Cerebrospinal Fluid of People Living with HIV. Alcantarini, C; Avataneo, V; Bonora, S; Borghetti, A; Calcagno, A; Cattaneo, D; D'Avolio, A; Di Giambenedetto, S; Di Perri, G; Gervasoni, C; Milesi, M; Moltó, J; Pla-Junca, F; Trunfio, M; Valle, M, 2021)	1.62
"Dolutegravir (DTG) is a preferred regimen for all people with HIV including pregnant women, but its effects on the fetus are not fully understood. "	( Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels. Cahill, LS; Copp, AJ; Delgado-Olguín, P; Greene, NDE; Laurette, EY; Lenis, MG; Leung, KY; Mohan, H; Sanghvi, T; Serghides, L; Sled, JG; Tejada, O, 2021)	3.51
"Dolutegravir is an integrase strand transfer inhibitor used for the treatment of human immuno-deficiency virus infections. "	( HPLC-MS identification of acid degradation products of dolutegravir. Krait, S; Peters, FT; Scriba, GKE; Wissenbach, DK, 2021)	2.31
"Dolutegravir (DTG) is a first-line antiretroviral drug (ARV) used in combination therapy for the treatment of human immunodeficiency virus type-1 (HIV-1) infection. "	( Dolutegravir Inhibition of Matrix Metalloproteinases Affects Mouse Neurodevelopment. Bade, AN; Edagwa, BJ; Gendelman, HE; Liu, Y; McMillan, JM, 2021)	3.51
"Dolutegravir is a once-daily integrase strand transfer inhibitor with no need for pharmacokinetic boosting that is approved for the treatment of HIV-1 infection. "	( Fixed-dose combination dolutegravir, abacavir, and lamivudine versus ritonavir-boosted atazanavir plus tenofovir disoproxil fumarate and emtricitabine in previously untreated women with HIV-1 infection (ARIA): week 48 results from a randomised, open-label Aboud, M; Aylott, A; Belonosova, E; Buchanan, AM; Falcó, V; Hagins, DP; Man, CY; Orrell, C; Porteiro, N; Smith, KY; Vavro, C; Walmsley, S; Wynne, B, 2017)	2.21
"Dolutegravir (DTG) is an integrase strand-transfer inhibitor (INSTI) used for treatment of human immunodeficiency virus (HIV)-infected individuals. "	( The S230R Integrase Substitution Associated With Virus Load Rebound During Dolutegravir Monotherapy Confers Low-Level Resistance to Integrase Strand-Transfer Inhibitors. Boucher, CA; Brenner, BG; Goring, ME; Han, Y; Hassounah, S; Labrie, L; Lok, KY; Lungu, C; Mesplède, T; Pham, HT; Portna, I; Rijnders, BJA; van der Ende, ME; van Kampen, JJA; Wainberg, MA; Wijting, IEA, 2018)	2.15
"Dolutegravir is an increasingly-used second-generation human immunodeficiency virus integrase strand transfer inhibitor. "	( Dolutegravir as a trigger for DRESS syndrome? De Wit, S; Martin, C; Payen, MC, 2018)	3.37
"Dolutegravir (DTG) is a second-generation integrase strand transfer inhibitor (InSTI) with an outstanding antiviral potency, good tolerability, good pharmacokinetic profile with a lack of major drug-drug interactions, and a barrier to resistance higher than the other compounds of the class (raltegravir and elvitegravir) and allegedly as high as that of boosted protease inhibitors. "	( Dolutegravir resistance mutations: lessons from monotherapy studies. Blanco, JL; Katlama, C; Marcelin, AG; Martinez, E, 2018)	3.37
"Dolutegravir (DTG) is a preferred drug for initial treatment of human immunodeficiency virus type 1 infection. "	( Emergence of Integrase Resistance Mutations During Initial Therapy Containing Dolutegravir. Du, Y; Fulcher, JA; Landovitz, RJ; Sun, R; Zhang, TH, 2018)	2.15
"Dolutegravir (DTG) is a next-generation HIV integrase inhibitor (INI) with an increased genetic barrier to resistance with respect to raltegravir (RAL) or elvitegravir (EVG). "	( Dolutegravir (DTG)-containing regimens after receiving raltegravir (RAL) or elvitegravir (EVG): Durability and virological response in a large Italian HIV drug resistance network (ARCA). Adorni, F; Borghi, V; Bruzzone, B; Di Biagio, A; Francisci, D; Mancon, A; Maserati, R; Meraviglia, P; Micheli, V; Monno, L; Paolucci, S; Pecorari, M; Punzi, G; Rusconi, S; Tau, P; Zazzi, M, 2018)	3.37
"Dolutegravir+lamivudine is a promising maintenance therapy in HIV-1-infected patients with controlled virological suppression."	( Dolutegravir and lamivudine maintenance therapy in HIV-1 virologically suppressed patients: results of the ANRS 167 trial (LAMIDOL). Amri, I; Argoud, AL; Benalycherif, A; Burdet, C; Cabié, A; Charpentier, C; Descamps, D; Joly, V; Katlama, C; Landman, R; Mentre, F; Peytavin, G; Vigan, M; Yazdanpanah, Y; Yeni, P, 2019)	3.4
"Dolutegravir is an integrase inhibitor that is a common component of HIV treatment regimens."	( Safety and efficacy of dolutegravir in hemodialysis. Kreft, KN; Raghuram, A; Spencer, CA, 2019)	1.55
"Dolutegravir (DTG) is a once-daily, unboosted integrase inhibitor that has been shown to be effective by once daily dosing. "	( [Pharmacokinetics and safety of dolutegravir in healthy Japanese subjects]. Fujiwara, T; Kobayashi, H; Koshiba, T; Nagashima, M; Nishimura, Y; Ohno, K; Wajima, T; Yoshida, N, 2013)	2.12
"Dolutegravir is a second-generation integrase strand transfer inhibitor (INSTI) currently under review by the US Food and Drug Administration for marketing approval. "	( Clinical pharmacokinetic, pharmacodynamic and drug-interaction profile of the integrase inhibitor dolutegravir. Cottrell, ML; Hadzic, T; Kashuba, AD, 2013)	2.05
"Dolutegravir (DTG) is an investigational integrase inhibitor for treatment of HIV infection. "	( Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects. Bala, U; Chen, S; Geoffroy, P; Mark, S; Peppercorn, A; Piscitelli, S; Savina, P; Song, I; Wajima, T, 2013)	3.28
"Dolutegravir is a new INSTI approved for combination treatment in HIV-1-infected adults and adolescent children. "	( Dolutegravir, a second-generation integrase inhibitor for the treatment of HIV-1 infection. Liedtke, MD; Lockhart, SM; Miller, MM; Rathbun, RC, 2014)	3.29
"Dolutegravir is a new-generation INSTI administered once/day without a pharmacokinetic booster and can be coformulated in a single-tablet regimen."	( Dolutegravir: a new integrase strand transfer inhibitor for the treatment of HIV. Desimone, JA; Schafer, JJ; Shah, BM, 2014)	2.57
"Dolutegravir, is a second generation integrase inhibitor that had recently received United States Food and Drug Administration and European Commission approval for the treatment of adult patients with HIV-1 infection. "	( Dolutegravir for the treatment of adult patients with HIV-1 infection. Abraham, T; Saad, N; Wu, G, 2014)	3.29
"Dolutegravir (Tivicay(®)) is a new-generation HIV-1 integrase strand transfer inhibitor recently approved in the EU and Japan for the treatment of HIV-1 infection in adolescents and adults in combination with other antiretroviral drugs. "	( Dolutegravir: a review of its use in the management of HIV-1 infection in adolescents and adults. McCormack, PL, 2014)	3.29
"Dolutegravir (DTG) is an unboosted, integrase inhibitor for the treatment of HIV infection. "	( Effects of enzyme inducers efavirenz and tipranavir/ritonavir on the pharmacokinetics of the HIV integrase inhibitor dolutegravir. Borland, J; Castellino, S; Chen, S; Guta, P; Hosking, L; Lou, Y; Mosteller, M; Peppercorn, A; Piscitelli, SC; Rubio, JP; Savina, P; Song, I; Wagner, D; Wajima, T; Wilfret, D, 2014)	2.05
"Dolutegravir (DTG) is an HIV integrase inhibitor (INI) with demonstrated activity in INI-naive and INI-resistant patients. "	( Effect of fosamprenavir-ritonavir on the pharmacokinetics of dolutegravir in healthy subjects. Borland, J; Chen, S; Peppercorn, A; Piscitelli, SC; Song, I; Wajima, T, 2014)	2.09
"Dolutegravir (DTG) is an HIV integrase inhibitor that was recently approved for therapy by the Food and Drug Administration in the United States. "	( Is resistance to dolutegravir possible when this drug is used in first-line therapy? Mesplède, T; Wainberg, MA, 2014)	2.18
"Dolutegravir is a second-generation INI that can overcome many prior raltegravir and elvitegravir failures."	( Evolution of a novel pathway leading to dolutegravir resistance in a patient harbouring N155H and multiclass drug resistance. Brenner, B; Hardy, I; Huang, W; Moisi, D; Petropoulos, C; Quashie, P; Roger, M; Thomas, R; Wainberg, MA, 2015)	1.41
"Dolutegravir is a second-generation integrase strand transfer inhibitor (InSTI) that has been recently approved by the FDA to treat antiretroviral therapy-naive as well as treatment-experienced HIV-infected individuals, including those already exposed to the first-generation InSTI. "	( High frequency of dolutegravir resistance in patients failing a raltegravir-containing salvage regimen. Brigido, LF; Cavalcanti, Jde S; Ferreira, JL; Guimarães, PM; Vidal, JE, 2015)	2.19
"Dolutegravir is a novel integrase strand-transfer inhibitor that displays potent in vitro activity and a remarkably different resistance profile. "	( Genetic barrier to resistance for dolutegravir. Blanco, JL; Delgado, R; García Deltoro, M; García, F; Llibre, JM; Pulido, F, )	1.85
"Dolutegravir is a second-generation integrase strand transfer inhibitor (INSTI), whose potential and binding half-life in the integrase are far superior to those of raltegravir and elvitegravir, conferring it with unique characteristics in terms of its genetic barrier to resistance and activity against viruses with one or more mutations in the integrase. "	( [Mechanisms of action, pharmacology and interactions of dolutegravir]. Podzamczer, D; Ribera, E, 2015)	2.11
"Dolutegravir is an HIV integrase inhibitor with a high genetic barrier to resistance and is active against raltegravir- and/or elvitegravir-resistant strains. "	( [Efficacy of dolutegravir in treatment-experienced patients: the SAILING and VIKING trials]. Berenguer, J; Moreno, S, 2015)	2.23
"Dolutegravir is an integrase strand-transfer inhibitor that has shown unprecedented robustness against the emergence of HIV drug-resistant strains in treatment-naive individuals. "	( The R263K substitution in HIV-1 subtype C is more deleterious for integrase enzymatic function and viral replication than in subtype B. Han, Y; Hassounah, S; Liang, J; Mesplède, T; Osman, N; Quashie, PK; Singhroy, DN; Wainberg, MA, 2015)	1.86
"Dolutegravir is a therapy that is unique in its ability to evade HIV drug resistance in treatment-naïve patients."	( The preclinical discovery and development of dolutegravir for the treatment of HIV. Bailly, F; Cotelle, P, 2015)	1.4
"Dolutegravir is a powerful, well-tolerated integrase inhibitor with a high genetic barrier to resistance and may thus constitute the backbone of lightened regimens."	( Dolutegravir-based monotherapy or dual therapy maintains a high proportion of viral suppression even in highly experienced HIV-1-infected patients. Avettand-Fènoël, V; Buret, J; Gubavu, C; Guinard, J; Hocqueloux, L; Mille, C; Niang, M; Prazuck, T, 2016)	3.32
"Dolutegravir (DTG) is an integrase strand transfer inhibitor, which is a newly approved antiretroviral drug used for the treatment of HIV-infected naive and experienced individuals. "	( A Validated Method for Quantification of Dolutegravir Using Ultra Performance Liquid Chromatography Coupled With UV Detection. Amara, A; Boffito, M; Else, L; McClure, M; Penchala, SD; Wang, X, 2016)	2.14
"Dolutegravir is an integrase strand transfer inhibitor (INSTI) licensed for use in HIV-1 infection and is an inhibitor of organic cation transporter 2 (OCT2). "	( The Effect of Dolutegravir on the Pharmacokinetics of Metformin in Healthy Subjects. Borland, J; Bowers, GD; Choukour, M; Humphreys, JE; Jerva, F; Song, IH; Wynne, B; Zamek-Gliszczynski, MJ; Zong, J, 2016)	2.24
"Dolutegravir (DTG) is a second-generation integrase strand transfer inhibitor (INSTI) related to the first-generation INSTIs raltegravir (RAL) and elvitegravir (EVG)."	( Might dolutegravir be part of a functional cure for HIV? Han, YS; Mesplède, T; Wainberg, MA, 2016)	1.64
"Dolutegravir is a preferred antiretroviral drug for human immunodeficiency virus (HIV)-infected patients following solid organ transplantation. "	( Serum creatinine elevation after switch to dolutegravir in a human immunodeficiency virus-positive kidney transplant recipient. Bias, TE; Doyle, AM; Harhay, MN; Lee, DH; Malat, GE; Ranganna, K, 2016)	2.14
"Dolutegravir (DTG) is a once-daily unboosted second-generation integrase-inhibitor that along with two nucleoside reverse transcriptase inhibitors is one of several regimens recommended by the United States, United Kingdom and European Union for first-line antiretroviral treatment of people with HIV infection. "	( Dolutegravir Plus Two Nucleoside Reverse Transcriptase Inhibitors versus Efavirenz Plus Two Nucleoside Reverse Transcriptase Inhibitors As Initial Antiretroviral Therapy for People with HIV: A Systematic Review. Horvath, H; Rutherford, GW, 2016)	3.32

Excerpt	Reference	Relevance
"Dolutegravir has a terminal elimination half-life of 13-14 h and maintains concentrations over the in vitro, protein-adjusted IC90 for more than 30 h following a single dose."	( Clinical pharmacokinetic, pharmacodynamic and drug-interaction profile of the integrase inhibitor dolutegravir. Cottrell, ML; Hadzic, T; Kashuba, AD, 2013)	1.33
"Dolutegravir has an excellent tolerability profile with no current evidence of long-term adverse effects."	( [Safety profile of dolutegravir]. Domingo, P; Rivero, A, 2015)	1.47
"Dolutegravir has been associated with neuropsychiatric adverse events (NPAEs), but relationships between dolutegravir concentrations and NPAEs are unclear."	( Pharmacokinetic and pharmacogenetic associations with dolutegravir neuropsychiatric adverse events in an African population. Akpomiemie, G; Denti, P; Griesel, R; Haas, DW; Joska, J; Kawuma, A; Maartens, G; Sinxadi, P; Sokhela, S; Venter, F, 2022)	2.41
"Dolutegravir has been associated with metabolic complications, including weight gain and rare events of hyperglycaemia, that could affect maternal, fetal, and postnatal health."	( Metabolic implications and safety of dolutegravir use in pregnancy. Blanco, C; Copp, AJ; Dontsova, V; Greene, NDE; Jao, J; Mohan, H; Serghides, L; Zash, R, 2023)	1.9
"Dolutegravir (DTG) has been the first-line drug in many human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) guidelines for the treatment of naïve and experienced HIV-infected individuals, which calls for cost-effective and convenient methods for quantitative detection of DTG in human plasma for pharmacokinetic studies and patient adherence evaluation. "	( Development and validation of an HPLC method for quantification of dolutegravir in human plasma. Du, X; Fu, Q; Li, D; Li, T, 2023)	2.59
"Dolutegravir (DTG) has shown effectiveness in combination with rilpivirine in with experience of antiretroviral therapy (ART) and with 3TC in naïve patients (GEMINI trial). "	( DOLAMA study: Effectiveness, safety and pharmacoeconomic analysis of dual therapy with dolutegravir and lamivudine in virologically suppressed HIV-1 patients. Cortés, LL; Fernández, E; Gálvez, C; García, C; Gutiérrez, A; Hidalgo-Tenorio, C; Jesús, SE; Omar, M; Pasquau, J; Santos, J; Sequera, S; Téllez, F, 2019)	2.18
"Dolutegravir in particular has been associated with more frequent AEs such as neuropsychiatric disorders, neural tube defect in newborns, and weight gain."	( Nothing is perfect: the safety issues of integrase inhibitor regimens. Podzamczer, D; Scévola, S; Tiraboschi, JM, 2020)	1.28
"Dolutegravir has been widely available in Brazil since 2017. "	( Dolutegravir and pregnancy outcomes in women on antiretroviral therapy in Brazil: a retrospective national cohort study. Beber, A; Castilho, JL; Corrêa, RG; Fernandes Fonseca, F; Grinsztejn, B; Jalil, EM; Kim, A; Lima, R; Maruri, F; McGowan, CC; Pereira, GFM; Pimenta, MC; Ribeiro, R; Rick, F; Schwartz Benzaken, A; Shepherd, BE; Veloso, VG, 2021)	3.51
"Dolutegravir has been approved in the USA for the treatment of HIV-1 infection in combination with other antiretroviral agents and has been filed for approval in the EU and Canada."	( Dolutegravir: first global approval. Ballantyne, AD; Perry, CM, 2013)	2.55
"Dolutegravir has been shown to be non-inferior to an integrase inhibitor and superior to a non-nucleoside reverse transcriptase inhibitor (NNRTI). "	( Once-daily dolutegravir versus darunavir plus ritonavir in antiretroviral-naive adults with HIV-1 infection (FLAMINGO): 48 week results from the randomised open-label phase 3b study. Antinori, A; Brennan, C; Clotet, B; Dumitru, I; Fehr, J; Feinberg, J; Fujiwara, T; Harris, J; Khuong-Josses, MA; Min, S; Ortiz, R; Pokrovskiy, V; Saag, M; van Lunzen, J, 2014)	2.23
"Dolutegravir has been recently approved for treatment-naive and -experienced HIV-infected subjects, including integrase inhibitor (INI)-experienced patients. "	( Evolution of a novel pathway leading to dolutegravir resistance in a patient harbouring N155H and multiclass drug resistance. Brenner, B; Hardy, I; Huang, W; Moisi, D; Petropoulos, C; Quashie, P; Roger, M; Thomas, R; Wainberg, MA, 2015)	2.13
"Dolutegravir (DTG) has been studied in three trials in HIV treatment-naive participants, showing noninferiority compared with raltegravir (RAL), and superiority compared with efavirenz and ritonavir-boosted darunavir. "	( Dolutegravir efficacy at 48 weeks in key subgroups of treatment-naive HIV-infected individuals in three randomized trials. Almond, S; Arasteh, K; Brennan, C; Brinson, C; Cuffe, RL; Eron, J; Górgolas, M; Granier, C; Nichols, WG; Pappa, K; Rachlis, A; Raffi, F; Walmsley, S, 2015)	3.3
"Dolutegravir has shown in vitro activity against human immunodeficiency virus type 2 (HIV-2). "	( Dolutegravir in HIV-2-Infected Patients With Resistant Virus to First-line Integrase Inhibitors From the French Named Patient Program. Campa, P; Charpentier, C; Damond, F; Descamps, D; Duvivier, C; Karmochkine, M; Khuong-Josses, MA; Lukiana, T; Matheron, S; Peytavin, G; Tubiana, R; Visseaux, B, 2015)	3.3

Excerpt	Reference	Relevance
"Dolutegravir (DTG) may inhibit organic cation transporter-2 in renal tubules and elevate serum creatinine levels without true renal function deterioration. "	( Performance of Creatinine- and Cystatin C-Based Equations for Glomerular Filtration Rate Estimation in HIV-1-Infected Individuals Receiving Dolutegravir + Tenofovir Disoproxil Fumarate + Lamivudine as Initial Antiretroviral Therapy: A Retrospective Observ Cai, L; Guo, Z; He, S; Wang, Y; Wang, Z; Yan, D; Yang, X; Zheng, Y, 2022)	2.37
"Dolutegravir may inhibit creatinine transporters in renal tubules and elevate serum creatinine levels. "	( Clinical benefits of using inulin clearance and cystatin C for determining glomerular filtration rate in HIV-1-infected individuals treated with dolutegravir. Shirasaka, T; Uehira, T; Watanabe, D; Yukawa, S, 2018)	2.12
"Dolutegravir exposure is lower in pregnancy compared with postpartum in the same women on once-daily dosing. "	( Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV. Acosta, EP; Barr, E; Best, BM; Burchett, S; Buschur, SL; Capparelli, EV; Chakhtoura, N; Mirochnick, M; Mulligan, N; Smith, E; Stek, A; Wang, J, 2018)	3.37
"Dolutegravir displays in vitro activity against mutant HIV-1 harboring any isolated resistance mutations selected during failures to raltegravir or elvitegravir (Y143C/H/, N155H, Q148H/K/R, E92G/Q, T66A/I/K, T97A, E138A/K, G140A/S)."	( [Resistance profile and genetic barrier of dolutegravir]. Clotet, B; Llibre, JM, 2015)	1.4

Excerpt	Reference	Relevance
"Dolutegravir-based treatment is being rolled out as the preferred first-line treatment for HIV in many low- and middle-income countries."	( A randomized comparison of health-related quality of life outcomes of dolutegravir versus efavirenz-based antiretroviral treatment initiated in the third trimester of pregnancy. Chen, T; Khoo, S; Kintu, K; Lamorde, M; Malaba, T; Myer, L; Ochanda, PN; Reynolds, H; Waitt, C; Wang, D, 2022)	1.68

Excerpt	Reference	Relevance
" Most adverse events (AEs) were mild, with a few moderate AEs reported."	( Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers. Borland, J; Chen, S; Fujiwara, T; Lou, Y; Min, S; Piscitelli, SC; Song, I, 2010)	0.36
" The most common adverse events were diarrhea, fatigue, and headache; the majority of adverse events were mild or moderate in severity."	( Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. Chen, S; DeJesus, E; Fujiwara, T; Hawkins, T; Lalezari, J; McCurdy, L; Min, S; Piscitelli, S; Sloan, L; Song, I; Stroder, R; Underwood, M, 2011)	0.6
" The no observed adverse effect level for immunotoxicity endpoints was 75mg/kg/day."	( Assessing a theoretical risk of dolutegravir-induced developmental immunotoxicity in juvenile rats. Bassiri, AE; Fukushima, T; Genell, C; Gower, J; Laffan, S; Maier, C; Nichols, G; Rhodes, M, 2012)	0.66
" However, data on the long-term exposure to these therapeutic options are needed, and a handful of case reports are emerging, reporting rare but potentially life-threatening adverse hepatic events in patients with hepatitis co-infection or taking other hepatotoxic drugs."	( Hepatoxicity of new antiretrovirals: a systematic review. Lacombe, K; Surgers, L, 2013)	0.39
" DTG was well tolerated with no adverse events reported throughout the study period."	( [Pharmacokinetics and safety of dolutegravir in healthy Japanese subjects]. Fujiwara, T; Kobayashi, H; Koshiba, T; Nagashima, M; Nishimura, Y; Ohno, K; Wajima, T; Yoshida, N, 2013)	0.67
" Bayesian fixed-effect network meta-analysis models adjusting for the type of nucleoside reverse transcriptase inhibitor backbone (tenofovir disoproxil fumarate/emtricitabine [TDF/FTC] or abacavir/lamivudine [ABC/3TC]) were used to evaluate week 48 efficacy (HIV-RNA suppression to <50 copies/mL and change in CD4+ cells/µL) and safety (lipid changes, adverse events, and discontinuations due to adverse events) of DTG relative to all other treatments."	( 48-week efficacy and safety of dolutegravir relative to commonly used third agents in treatment-naive HIV-1-infected patients: a systematic review and network meta-analysis. Camejo, RR; Cuffe, R; Gilchrist, KA; Lim, JW; Nichols, G; Patel, DA; Pulgar, S; Snedecor, SJ; Stephens, J; Sudharshan, L; Tang, WY, 2014)	0.69
" Dolutegravir had better or equivalent changes in total cholesterol, LDL, triglycerides, and lower odds of adverse events and discontinuation due to adverse events compared to all treatments."	( 48-week efficacy and safety of dolutegravir relative to commonly used third agents in treatment-naive HIV-1-infected patients: a systematic review and network meta-analysis. Camejo, RR; Cuffe, R; Gilchrist, KA; Lim, JW; Nichols, G; Patel, DA; Pulgar, S; Snedecor, SJ; Stephens, J; Sudharshan, L; Tang, WY, 2014)	1.6
" The proportion of individuals from DTG treatment arms who withdrew due to adverse events (AEs) was low (≤2%) compared to raltegravir (RAL; 2% SPRING-2, 4% SAILING), efavirenz (EFV)-containing comparator arm (10% SINGLE), and darunavir + ritonavir (DRV/r; 4% FLAMINGO)."	( Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients. Aylott, A; Bloch, M; Clark, A; Curtis, L; Lim, J; Maechler, G; Martin-Carpenter, L; Min, S; Nichols, G; Raffi, F; Stainsby, C; Wynne, B, )	1.57
" Discontinuation rates due to adverse effects were 2% and 3%, respectively."	( [Safety profile of dolutegravir]. Domingo, P; Rivero, A, 2015)	0.75
" This review summarizes the pharmacokinetics, adverse event profile, and efficacy of dolutegravir in the treatment of HIV."	( Dolutegravir - a review of the pharmacology, efficacy, and safety in the treatment of HIV. Kandel, CE; Walmsley, SL, 2015)	2.08
" Dolutegravir was well tolerated, with no grade 4 adverse events, serious adverse events or discontinuations because of serious adverse events."	( Safety, Pharmacokinetics and Efficacy of Dolutegravir in Treatment-experienced HIV-1 Infected Adolescents: Forty-eight-week Results from IMPAACT P1093. Acosta, EP; Alvero, C; Fenton, T; Hazra, R; Min, S; Steimers, D; Townley, E; Viani, RM; Wiznia, A, 2015)	1.59
" Dolutegravir was safe and well tolerated, providing good virologic efficacy through week 48."	( Safety, Pharmacokinetics and Efficacy of Dolutegravir in Treatment-experienced HIV-1 Infected Adolescents: Forty-eight-week Results from IMPAACT P1093. Acosta, EP; Alvero, C; Fenton, T; Hazra, R; Min, S; Steimers, D; Townley, E; Viani, RM; Wiznia, A, 2015)	1.59
" There was no statistically significant differences in the risk difference for serious adverse events (5."	( An Indirect Comparison of Efficacy and Safety of Elvitegravir/Cobicistat/Emtricitabine/Tenofovir Disoproxil Fumarate and Abacavir/Lamivudine + Dolutegravir in Initial Therapy. Behrens, G; Borg, P; Bouee, S; M Llibre, J; Moyle, G; Piontkowsky, D; Raffi, F; Reilly, G; Rogatto, F, 2016)	0.64
" We extracted data on trial and patient characteristics, and the following primary outcomes: viral suppression, mortality, AIDS defining illnesses, discontinuations, discontinuations due to adverse events, and serious adverse events."	( Comparative efficacy and safety of first-line antiretroviral therapy for the treatment of HIV infection: a systematic review and network meta-analysis. Bansback, N; Doherty, M; Ford, N; Forrest, JI; Kanters, S; Mills, EJ; Nsanzimana, S; Popoff, E; Socias, ME; Thorlund, K; Vitoria, M, 2016)	0.43
" Both low-dose efavirenz and integrase strand transfer inhibitors tended to be protective of discontinuations due to adverse events relative to normal-dose efavirenz."	( Comparative efficacy and safety of first-line antiretroviral therapy for the treatment of HIV infection: a systematic review and network meta-analysis. Bansback, N; Doherty, M; Ford, N; Forrest, JI; Kanters, S; Mills, EJ; Nsanzimana, S; Popoff, E; Socias, ME; Thorlund, K; Vitoria, M, 2016)	0.43
"There is no known reason to suspect an adverse drug interaction between dolutegravir-based antiretroviral therapy and sofosbuvir, simeprevir, or ledipasvir."	( Clinical experience with dolutegravir/abacavir/lamivudine in HIV-HCV co-infected patients treated with a sofosbuvir-based regimen-safety and efficacy. Bhattarai, S; Fallon, JP; Galang, H; Habeeb, R; Johnson, TM; Shukla, PP; Sison, R; Slim, J, 2016)	0.97
" No patients ended therapy secondary to adverse events."	( Clinical experience with dolutegravir/abacavir/lamivudine in HIV-HCV co-infected patients treated with a sofosbuvir-based regimen-safety and efficacy. Bhattarai, S; Fallon, JP; Galang, H; Habeeb, R; Johnson, TM; Shukla, PP; Sison, R; Slim, J, 2016)	0.74
" We compared discontinuation rates because of adverse events (AEs) within 2 years of starting treatment with dolutegravir, raltegravir or elvitegravir/cobicistat."	( Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients. Hoffmann, C; Kolb, M; Sabranski, M; Stellbrink, HJ; Welz, T; Wolf, E; Wyen, C, 2017)	0.91
"In this large cohort, the rate of discontinuation of dolutegravir because of neuropsychiatric adverse events was significantly higher than for other INSTIs, at almost 6% within 12 months."	( Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients. Hoffmann, C; Kolb, M; Sabranski, M; Stellbrink, HJ; Welz, T; Wolf, E; Wyen, C, 2017)	0.95
"5% of those treated with EVG discontinued due to adverse events (AE)."	( Clinical Experience with the Integrase Inhibitors Dolutegravir and Elvitegravir in HIV-infected Patients: Efficacy, Safety and Tolerance. Balboa-Barreiro, V; Castro-Iglesias, Á; Cid-Silva, P; Fernández-Bargiela, N; Llibre, JM; Margusino-Framiñán, L; Martín-Herranz, I; Pernas-Souto, B; Poveda, E, 2017)	0.71
" Safety (incidence of adverse events leading to discontinuation and laboratory abnormalities), adherence, and costs were analyzed."	( Effectiveness, Safety, and Costs of a Treatment Switch to Dolutegravir Plus Rilpivirine Dual Therapy in Treatment-Experienced HIV Patients. Alonso, R; Chamorro-de-Vega, E; Herranz-Alonso, A; Revuelta-Herrero, JL; Rodríguez-González, CG; Sanjurjo-Sáez, M, 2018)	0.73
"Switching to DTG plus RPV seems to be an effective and safe strategy."	( Effectiveness, Safety, and Costs of a Treatment Switch to Dolutegravir Plus Rilpivirine Dual Therapy in Treatment-Experienced HIV Patients. Alonso, R; Chamorro-de-Vega, E; Herranz-Alonso, A; Revuelta-Herrero, JL; Rodríguez-González, CG; Sanjurjo-Sáez, M, 2018)	0.73
" Recently, neuropsychiatric adverse events (NP-AEs) after the use of DTG have become a concern, so the association between UGT1A1 gene polymorphisms and selected NP-AEs was also investigated."	( Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1. Hirano, A; Hirota, K; Ikuma, M; Kasai, D; Kushida, H; Nishida, Y; Shirasaka, T; Takahashi, M; Togami, H; Tomishima, K; Uehira, T; Watanabe, D; Yagura, H; Yamazaki, K; Yoshino, M, 2017)	0.71
"Results from nonrandomized cohort studies suggest higher risks of CNS adverse events for dolutegravir, versus other ARVs."	( Risks of cardiovascular or central nervous system adverse events and immune reconstitution inflammatory syndrome, for dolutegravir versus other antiretrovirals: meta-analysis of randomized trials. Hill, AM; Hughes, S; Mitchell, N; Pozniak, AL, 2018)	0.91
"There was a higher risk of Grade 1-4 insomnia adverse events for DTG (6."	( Risks of cardiovascular or central nervous system adverse events and immune reconstitution inflammatory syndrome, for dolutegravir versus other antiretrovirals: meta-analysis of randomized trials. Hill, AM; Hughes, S; Mitchell, N; Pozniak, AL, 2018)	0.69
"In this meta-analysis, there was no significant effect of dolutegravir on the risk of cardiac, IRIS or suicide-related serious adverse events."	( Risks of cardiovascular or central nervous system adverse events and immune reconstitution inflammatory syndrome, for dolutegravir versus other antiretrovirals: meta-analysis of randomized trials. Hill, AM; Hughes, S; Mitchell, N; Pozniak, AL, 2018)	0.93
" Investigators monitored adverse events to assess safety."	( Efficacy, safety, and tolerability of dolutegravir-rilpivirine for the maintenance of virological suppression in adults with HIV-1: phase 3, randomised, non-inferiority SWORD-1 and SWORD-2 studies. Aboud, M; Angelis, K; Blair, EA; Brinson, C; Castelli, F; Gartland, M; Girard, PM; Hung, CC; Kahl, LP; Llibre, JM; Smith, K; Underwood, M; Vandermeulen, K; Wynne, B, 2018)	0.75
" 395 (77%) of 513 participants in the dolutegravir-rilpivirine group and 364 (71%) of 511 participants in the CAR group reported adverse events."	( Efficacy, safety, and tolerability of dolutegravir-rilpivirine for the maintenance of virological suppression in adults with HIV-1: phase 3, randomised, non-inferiority SWORD-1 and SWORD-2 studies. Aboud, M; Angelis, K; Blair, EA; Brinson, C; Castelli, F; Gartland, M; Girard, PM; Hung, CC; Kahl, LP; Llibre, JM; Smith, K; Underwood, M; Vandermeulen, K; Wynne, B, 2018)	1.02
" However, some patients may experience neurological or psychiatric adverse effects leading to DTG discontinuation."	( Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring. Brunel, F; Gagnieu, MC; Miailhes, P; Parant, F, 2018)	1.92
"This report describes a case of 29-year-old woman who developed neurological adverse events after starting the DTG-based antiretroviral therapy."	( Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring. Brunel, F; Gagnieu, MC; Miailhes, P; Parant, F, 2018)	1.92
" Efficacy (HIV RNA <50 copies/mL), adverse events, and metabolic changes at 24 weeks were analyzed."	( Safety and Efficacy of Dolutegravir Plus Rilpivirine in Treatment-Experienced HIV-Infected Patients: The DORIVIR Study. Castaño, M; de la Torre, J; Gálvez, C; González-Domenech, CM; Hidalgo-Tenorio, C; Lozano, A; Mayorga, M; Muñoz-Medina, L; Omar, M; Palacios, R; Santos, J, )	0.44
" No patient discontinued due to adverse events."	( Safety and Efficacy of Dolutegravir Plus Rilpivirine in Treatment-Experienced HIV-Infected Patients: The DORIVIR Study. Castaño, M; de la Torre, J; Gálvez, C; González-Domenech, CM; Hidalgo-Tenorio, C; Lozano, A; Mayorga, M; Muñoz-Medina, L; Omar, M; Palacios, R; Santos, J, )	0.44
"Dolutegravir/RPV is effective and safe in long-term HIV-infected patients under any prior ART."	( Safety and Efficacy of Dolutegravir Plus Rilpivirine in Treatment-Experienced HIV-Infected Patients: The DORIVIR Study. Castaño, M; de la Torre, J; Gálvez, C; González-Domenech, CM; Hidalgo-Tenorio, C; Lozano, A; Mayorga, M; Muñoz-Medina, L; Omar, M; Palacios, R; Santos, J, )	1.88
" Families were asked to report any suspected adverse events."	( Dolutegravir-based anti-retroviral therapy is effective and safe in HIV-infected paediatric patients. Bonadies, G; Bruzzese, E; Guarino, A; Lo Vecchio, A; Palmiero, G; Smarrazzo, A; Tambaro, O, 2018)	1.92
" INSTIs have also been demonstrated as safe and tolerable."	( Dolutegravir Neuropsychiatric Adverse Events: Specific Drug Effect or Class Effect. Yombi, JC, )	1.57
" The primary outcomes were the combined endpoints of any adverse outcome (stillbirth, preterm birth [<37 weeks' gestation], small for gestational age [SGA; less than the tenth percentile of birthweight by gestational age], or neonatal death [within 28 days of age]) and severe adverse outcomes (stillbirth, neonatal death, very preterm birth [<32 weeks' gestation], and very SGA [less than the third percentile of birthweight by gestational age])."	( Comparative safety of dolutegravir-based or efavirenz-based antiretroviral treatment started during pregnancy in Botswana: an observational study. Diseko, M; Essex, M; Gaolethe, T; Holmes, LB; Jacobson, DL; Lockman, S; Makhema, J; Mayondi, G; Mmalane, M; Petlo, C; Shapiro, RL; Zash, R, 2018)	0.8
" The risk for any adverse birth outcome among women on dolutegravir versus efavirenz was similar (33·2% vs 35·0%; aRR 0·95, 95% CI 0·88-1·03), as was the risk of any severe birth outcome (10·7% vs 11·3%; 0·94, 0·81-1·11)."	( Comparative safety of dolutegravir-based or efavirenz-based antiretroviral treatment started during pregnancy in Botswana: an observational study. Diseko, M; Essex, M; Gaolethe, T; Holmes, LB; Jacobson, DL; Lockman, S; Makhema, J; Mayondi, G; Mmalane, M; Petlo, C; Shapiro, RL; Zash, R, 2018)	1.04
"The change from a regimen of abacavir + lamivudine + dolutegravir seems to be safe and effective at 24 weeks."	( Efficacy and safety of the switch of Triumeq® to generic (abacavir + lamivudine) + Tivicay®: data at 24 weeks. De la Torre, J; Del Arco, A; García de Lomas, JM; García-Alegría, J; Márquez, E; Nieto, M; Olalla, J; Pérez-Stachowski, J; Prada, JL; Tortajada, B, 2018)	0.73
" The elvitegravir group showed more discontinuations because of renal adverse events (2."	( Efficacy and safety of switching to dolutegravir plus emtricitabine/tenofovir disoproxil fumarate (TDF) or elvitegravir/cobicistat/emtricitabine/TDF in virologically suppressed HIV-infected patients in clinical practice: results from a multicentre, observ Bagella, P; Baldin, G; Capetti, A; Ciccullo, A; Cossu, MV; De Luca, A; Di Giambenedetto, S; Giacomelli, A; Lagi, F; Latini, A; Madeddu, G; Rusconi, S; Sterrantino, G, 2019)	0.79
" Ten CNS toxicities were graded according to the ACTG adverse events scale."	( Tryptophan metabolism and its relationship with central nervous system toxicity in people living with HIV switching from efavirenz to dolutegravir. Boasso, A; Fuchs, D; Higgs, C; Keegan, MR; Nelson, M; Winston, A, 2019)	0.72
"To analyse the frequency and causes of treatment discontinuation in patients who were treated with an integrase strand transfer inhibitor (INSTI), with a focus on neuropsychiatric adverse events (NPAEs)."	( Integrase strand transfer inhibitors and neuropsychiatric adverse events in a large prospective cohort. Allavena, C; Bani-Sadr, F; Bregigeon, S; Cabié, A; Cuzin, L; Ferry, T; Katlama, C; Lourenco, J; Pugliese, P; Rey, D; Reynes, J, 2019)	0.51
"The aim of the study was to assess the rates of discontinuation of integrase inhibitor regimens because of any neuropsychiatric adverse event (NPAE) and the factors associated with discontinuation."	( Discontinuation of dolutegravir, elvitegravir/cobicistat and raltegravir because of toxicity in a prospective cohort. Abdulghani, N; Ambrosioni, J; Casabona, J; Curran, A; Domingo, P; Force, L; Homar, F; Llibre, JM; Miró, JM; Montoliu, A; Peraire, J; Riera, M; Tiraboschi, J, 2019)	0.84
" Every discontinuation because of adverse events (AEs) was double-checked directly with treating physicians."	( Discontinuation of dolutegravir, elvitegravir/cobicistat and raltegravir because of toxicity in a prospective cohort. Abdulghani, N; Ambrosioni, J; Casabona, J; Curran, A; Domingo, P; Force, L; Homar, F; Llibre, JM; Miró, JM; Montoliu, A; Peraire, J; Riera, M; Tiraboschi, J, 2019)	0.84
" The rate of discontinuations because of NPAEs was low, but was significantly higher for dolutegravir than for elvitegravir/cobicistat, with significant differences among centres, suggesting that greater predisposition to believe that a given adverse event is caused by a given drug of some treating physicians might play a role in the discordance seen between cohorts."	( Discontinuation of dolutegravir, elvitegravir/cobicistat and raltegravir because of toxicity in a prospective cohort. Abdulghani, N; Ambrosioni, J; Casabona, J; Curran, A; Domingo, P; Force, L; Homar, F; Llibre, JM; Miró, JM; Montoliu, A; Peraire, J; Riera, M; Tiraboschi, J, 2019)	1.06
"Neuropsychiatric adverse events (NPAEs) observed with the integrase strand transfer inhibitor (INSTI) dolutegravir (DTG) are usually mild to moderate."	( Neuropsychiatric Adverse Events with Dolutegravir and Other Integrase Strand Transfer Inhibitors Hoffmann, C; Llibre, JM, 2019)	1
" Dolutegravir was well tolerated, with grade 3 clinical adverse events in 5 participants, grade 3 laboratory abnormalities in 3, and grade 4 laboratory abnormalities in 1; none of the adverse events or abnormalities were judged to be treatment related."	( Long-Term Safety and Efficacy of Dolutegravir in Treatment-Experienced Adolescents With Human Immunodeficiency Virus Infection: Results of the IMPAACT P1093 Study. Acosta, EP; Alvero, C; Anthony, P; Buchanan, AM; Fenton, T; George, K; Graham, B; Hazra, R; Palumbo, P; Ruel, T; Singh, R; Townley, E; Vavro, C; Viani, RM; Wiznia, A, 2020)	1.75
" Therefore, we sought to evaluate the clinical correlates of safe and effective use of dolutegravir in hemodialysis."	( Safety and efficacy of dolutegravir in hemodialysis. Kreft, KN; Raghuram, A; Spencer, CA, 2019)	1.05
" At week 48, there were no virological failures, three patients discontinued the regimen due to neuropsychiatric adverse events, two were lost to follow-up, and therefore the efficacy was 90% (95% CI, 82, 99%, intention-to-treat analysis)."	( Efficacy and safety of dolutegravir plus boosted-darunavir dual therapy among highly treatment-experienced patients. Casado, JL; Fontecha, M; Monsalvo, M; Rojo, A; Vivancos, MJ; Vizcarra, P, 2019)	0.82
" Secondary outcomes included CD4 cell count change from baseline and safety (adverse events, serious adverse events, and drug-related adverse events) at Week 48."	( Comparative efficacy and safety and dolutegravir and lamivudine in treatment naive HIV patients. Ferrante, S; Parks, DC; Punekar, Y; Radford, M, 2019)	0.79
" With regard to other outcomes (CD4, adverse event, serious adverse event, drug-related adverse events) at 48 weeks, DTG+3TC was broadly similar to all regimens analysed."	( Comparative efficacy and safety and dolutegravir and lamivudine in treatment naive HIV patients. Ferrante, S; Parks, DC; Punekar, Y; Radford, M, 2019)	0.79
" Early embryonic exposure to DTG is developmentally toxic in zebrafish, and supplemental folic acid can mitigate DTG developmental toxicity."	( The antagonism of folate receptor by dolutegravir: developmental toxicity reduction by supplemental folic acid. Cabrera, RM; Finnell, RH; Gorelick, DA; Souder, JP; Steele, JW; Tukeman, G; Yeo, L, 2019)	0.79
" DTG was interrupted in 19/132 (14%) PLHIV: 13 (68%) for adverse events (5 intolerance, 4 gastrointestinal disorders and 4 neurological symptoms), 2 (11%) for proactive switch and 4 (21%) for medical/individual choice."	( Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study. Baldin, G; Capetti, A; Celani, L; Ciccullo, A; Colafigli, M; d'Ettorre, G; De Luca, A; De Vito, A; Di Giambenedetto, S; Gagliardini, R; Giacometti, A; Lagi, F; Madeddu, G; Rossetti, B; Rusconi, S; Sterrantino, G, 2019)	0.82
" Drug-related adverse events occurred in 103 (20%) participants in the early-switch group and 58 (12%) in the late-switch group."	( Efficacy and safety of dolutegravir-rilpivirine for maintenance of virological suppression in adults with HIV-1: 100-week data from the randomised, open-label, phase 3 SWORD-1 and SWORD-2 studies. Aboud, M; Adkison, K; Angelis, K; Baker, D; Blair, EA; Bogner, JR; Gartland, M; Kahl, LP; Khuong-Josses, MA; Matthews, JE; Orkin, C; Parks, D; Podzamczer, D; Smith, K; Underwood, M; Vandermeulen, K; Wynne, B, 2019)	0.82
" We gathered data on viral loads (VLs) during exposure to the DT, calculating the rate with VL < 50 copies/mL at week 48, and on associated adverse effects."	( DOLAMA study: Effectiveness, safety and pharmacoeconomic analysis of dual therapy with dolutegravir and lamivudine in virologically suppressed HIV-1 patients. Cortés, LL; Fernández, E; Gálvez, C; García, C; Gutiérrez, A; Hidalgo-Tenorio, C; Jesús, SE; Omar, M; Pasquau, J; Santos, J; Sequera, S; Téllez, F, 2019)	0.74
" Both regimens were well-tolerated with no significant differences in frequency of adverse events (two on DTG-ART, one on EFV-ART, all considered unrelated to drug)."	( Safety and pharmacokinetics of dolutegravir in pregnant mothers with HIV infection and their neonates: A randomised trial (DolPHIN-1 study). Amara, A; Byakika-Kibwika, P; Byamugisha, J; Coombs, JA; Else, L; Gini, J; Heiburg, C; Hill, A; Hodel, EM; Kaboggoza, J; Khoo, S; Kintu, K; Lamorde, M; Malaba, T; Mehta, U; Myer, L; Orrell, C; Reynolds, H; Sihlangu, M; Simmons, B; Singh, Y; Waitt, C; Walimbwa, S, 2019)	0.8
" Clinicians, patients, and pharmaceutical companies can report adverse drug reactions (ADRs) to pharmacovigilance databases."	( Analysis of Pharmacovigilance Databases for Dolutegravir Safety in Pregnancy. Clayden, P; Garratt, A; Hill, A; Levi, JA; Mofenson, LM; Pozniak, AL; Redd, C; van De Ven, NS, 2020)	0.82
"Four pharmacovigilance databases (World Health Organization [WHO] VigiAccess; United Kingdom Medicines Health Regulatory Authority [UK MHRA]; European Medicines Agency [EMA] EudraVigilance; US Food and Drug Administration Adverse Event Reporting System [FAERS]) with online data availability were analyzed for NTD reports for 4 integrase inhibitors (DTG, raltegravir, elvitegravir, bictegravir), 2 protease inhibitors (darunavir, atazanavir), and 2 nonnucleoside reverse transcriptase inhibitors (nevirapine, efavirenz)."	( Analysis of Pharmacovigilance Databases for Dolutegravir Safety in Pregnancy. Clayden, P; Garratt, A; Hill, A; Levi, JA; Mofenson, LM; Pozniak, AL; Redd, C; van De Ven, NS, 2020)	0.82
" Drug-related grade ≥2 adverse events and withdrawals due to adverse events occurred in 17 (4."	( Efficacy and Safety of Switching to Dolutegravir/Lamivudine Fixed-Dose 2-Drug Regimen vs Continuing a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen for Maintenance of Virologic Suppression in Adults Living With Human Immunodeficiency Virus Type 1: Phas Aboud, M; Ait-Khaled, M; Ajana, F; Bisshop, F; De Wit, S; Gartland, MJ; Nascimento, MC; Osiyemi, O; Pappa, KA; Portilla Sogorb, J; Routy, JP; Smith, KY; Tenorio, AR; van Wyk, J; Wang, R; Wright, J; Wyen, C; Wynne, B, 2020)	0.83
" Although in the pivotal trials the rate of adverse effects (AEs) was low (2-3%), in real-life studies it appears to be higher, especially neuropsychiatric AEs."	( Neuropsychiatric adverse effects of dolutegravir in real-life clinical practice. Arazo-Garcés, P; Comet-Bernad, M; Gasso-Sánchez, A; Ger-Buil, A; Martínez-Álvarez, R; Navarro-Aznarez, H; Povar-Echeverría, M, 2021)	0.9
" INSTIs are generally well tolerated, and reported rates of discontinuation due to drug-related adverse events (AEs) have been very low to date."	( Nothing is perfect: the safety issues of integrase inhibitor regimens. Podzamczer, D; Scévola, S; Tiraboschi, JM, 2020)	0.56
"Despite the high efficacy of antiretroviral treatment, no drug is free from adverse events (AEs)."	( Discontinuation due to neuropsychiatric adverse events with efavirenz- and dolutegravir-based antiretroviral therapy: a comparative real-life study. Balboa-Barreiro, V; Castro-Iglesias, Á; Cid-Silva, P; Fernández-Bargiela, N; López-Calvo, S; Margusino-Framiñán, L; Martín-Herranz, I; Mena-De-Cea, Á; Míguez-Rey, E; Rotea-Salvo, S; Vázquez-Rodríguez, P, 2022)	0.95
" Adverse events were monitored to assess safety."	( Efficacy and safety of dolutegravir plus emtricitabine versus standard ART for the maintenance of HIV-1 suppression: 48-week results of the factorial, randomized, non-inferiority SIMPL'HIV trial. Bernasconi, E; Braun, DL; Buzzi, M; Calmy, A; Cavassini, M; Decosterd, LA; Egger, M; Günthard, HF; Limacher, A; Marinosci, A; Metzner, KJ; Schmid, P; Sculier, D; Stoeckle, M; Vernazza, P; Wandeler, G; Yerly, S, 2020)	0.87
"The use of patient-reported outcomes (PROs) to systematically quantify adverse events (AE) will assist in the improvement of medical care and the QoL of patients living with HIV (PLWH)."	( Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study. Eriksson, LE; Marrone, G; Mellgren, Å; Reinius, M; Svedhem, V, 2020)	0.56
" Primary safety outcomes, compared pairwise among treatment groups, were the occurrence of a composite adverse pregnancy outcome (ie, either preterm delivery, the infant being born small for gestational age, stillbirth, or spontaneous abortion) in all participants with a pregnancy outcome, and the occurrence of grade 3 or higher maternal and infant adverse events in all randomised participants."	( Efficacy and safety of dolutegravir with emtricitabine and tenofovir alafenamide fumarate or tenofovir disoproxil fumarate, and efavirenz, emtricitabine, and tenofovir disoproxil fumarate HIV antiretroviral therapy regimens started in pregnancy (IMPAACT 2 Amico, KR; Brummel, SS; Cassim, H; Chakhtoura, N; Chinula, L; Coletti, A; Currier, J; Fairlie, L; Frenkel, LM; Hanley, S; Hoffman, RM; Holmes, LB; Jean-Philippe, P; João, E; Johnston, B; Korutaro, V; Krotje, C; Lockman, S; Masheto, G; McCarthy, K; Mmbaga, BT; Momper, JD; Moyo, S; Purdue, L; Rooney, JF; Sax, PE; Shapiro, RL; Stranix-Chibanda, L; Stringer, JS; Thoofer, NK; Ziemba, L, 2021)	0.93
" Significantly fewer participants in the dolutegravir, emtricitabine, and tenofovir alafenamide fumarate group (52 [24%] of 216) had a composite adverse pregnancy outcome than those in the dolutegravir, emtricitabine, and tenofovir disoproxil fumarate group (70 [33%] of 213; estimated difference -8·8% [95% CI -17·3 to -0·3], p=0·043) or the efavirenz, emtricitabine, and tenofovir disoproxil fumarate group (69 [33%] of 211; -8·6% [-17·1 to -0·1], p=0·047)."	( Efficacy and safety of dolutegravir with emtricitabine and tenofovir alafenamide fumarate or tenofovir disoproxil fumarate, and efavirenz, emtricitabine, and tenofovir disoproxil fumarate HIV antiretroviral therapy regimens started in pregnancy (IMPAACT 2 Amico, KR; Brummel, SS; Cassim, H; Chakhtoura, N; Chinula, L; Coletti, A; Currier, J; Fairlie, L; Frenkel, LM; Hanley, S; Hoffman, RM; Holmes, LB; Jean-Philippe, P; João, E; Johnston, B; Korutaro, V; Krotje, C; Lockman, S; Masheto, G; McCarthy, K; Mmbaga, BT; Momper, JD; Moyo, S; Purdue, L; Rooney, JF; Sax, PE; Shapiro, RL; Stranix-Chibanda, L; Stringer, JS; Thoofer, NK; Ziemba, L, 2021)	1.2
" The dolutegravir, emtricitabine, and tenofovir alafenamide fumarate regimen had the lowest frequency of composite adverse pregnancy outcomes and of neonatal deaths."	( Efficacy and safety of dolutegravir with emtricitabine and tenofovir alafenamide fumarate or tenofovir disoproxil fumarate, and efavirenz, emtricitabine, and tenofovir disoproxil fumarate HIV antiretroviral therapy regimens started in pregnancy (IMPAACT 2 Amico, KR; Brummel, SS; Cassim, H; Chakhtoura, N; Chinula, L; Coletti, A; Currier, J; Fairlie, L; Frenkel, LM; Hanley, S; Hoffman, RM; Holmes, LB; Jean-Philippe, P; João, E; Johnston, B; Korutaro, V; Krotje, C; Lockman, S; Masheto, G; McCarthy, K; Mmbaga, BT; Momper, JD; Moyo, S; Purdue, L; Rooney, JF; Sax, PE; Shapiro, RL; Stranix-Chibanda, L; Stringer, JS; Thoofer, NK; Ziemba, L, 2021)	1.45
" The secondary outcomes included CD4T cell recovery, lipids change from baseline, and adverse events (AEs)."	( Efficacy and Safety of Triple versus Dolutegravir-based Dual Therapy in Patients with HIV-1 Infection: A Meta-analysis of Randomized Controlled Trials. Deng, Y; Deng, Z; Qiu, C; Shi, Z; Shu, Y; Tu, X; Wang, H; Zhao, X, 2021)	0.89
" The safety was evaluated by incidence of adverse drug reactions (ADRs) and change in body weight."	( Safety and Effectiveness Analysis of Dolutegravir in Patients with HIV-1: Interim Report of Post-Marketing Surveillance in Japan. Fukuda, A; Hongo, H; Kitaichi, T; Koga, I; Maeno, Y; Nagao, T; Nakamura, K; Tokunaga, T, 2021)	0.89
" 73 (56%) of 131 participants allocated to dual therapy had 150 adverse effects, compared with 78 (58%) of 134 participants allocated to triple therapy who also had 150 adverse events (p=0·68)."	( Efficacy and safety of switching to dolutegravir plus lamivudine versus continuing triple antiretroviral therapy in virologically suppressed adults with HIV at 48 weeks (DOLAM): a randomised non-inferiority trial. Abdulghani, N; Blanco, JL; Clotet, B; de Lazzari, E; Domingo, P; Gatell, JM; Gutierrez, MM; Martínez, E; Mateo, MG; Negredo, E; Paredes, R; Podzamczer, D; Puig, J; Ribera, E; Rojas, J; Tiraboschi, J, 2021)	0.9
" This activity aims to establish an active pharmacovigilance system to monitor adverse events in patients on a TLD regimen to support the effectiveness of Mozambique's public health programmes in improving the process of care and treatment outcomes for people with HIV/AIDS."	( Protocol for active safety monitoring of a cohort of patients using a dolutegravir-based antiretroviral regimen in Mozambique. Couto, A; Gaspar, I; Hafner, T; Lemos, A; Mussá, M; Namburete, D; Namburete, L; Ogar, CK; Paulino, JM; Seni, ED; Sitoie, TV; Stergachis, A; Vilanculos, S, 2021)	0.86
" Patients are monitored to identify possible adverse events during the follow-up period."	( Protocol for active safety monitoring of a cohort of patients using a dolutegravir-based antiretroviral regimen in Mozambique. Couto, A; Gaspar, I; Hafner, T; Lemos, A; Mussá, M; Namburete, D; Namburete, L; Ogar, CK; Paulino, JM; Seni, ED; Sitoie, TV; Stergachis, A; Vilanculos, S, 2021)	0.86
" Here, we investigated the adverse effects of DTG using pluripotent stem cell-based in vitro morphogenesis models that have previously been validated as effective tools to assess the developmental toxicity of various chemicals."	( Dolutegravir Impairs Stem Cell-Based 3D Morphogenesis Models in a Manner Dependent on Dose and Timing of Exposure: An Implication for Its Developmental Toxicity. Katayama, N; Kirkwood-Johnson, L; Marikawa, Y, 2021)	2.06
" Drug-related adverse events were more frequent with DTG/3TC (15%; leading to discontinuation in 4%) than TAF-based regimens (5%; leading to discontinuation in 1%) through week 144, but rates were comparable after week 48 (4%; leading to discontinuation in 1% in both groups)."	( Efficacy and Safety of Switching to Dolutegravir/Lamivudine Versus Continuing a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen for Maintenance of Virologic Suppression in Adults Living With Human Immunodeficiency Virus Type 1: Results Through Week 144 F Aboud, M; Ait-Khaled, M; Ajana, F; Bisshop, F; De Wit, S; George, N; Leone, P; Osiyemi, O; Pappa, KA; Portilla, J; Routy, JP; Smith, KY; van Wyk, J; Wang, R; Wright, J; Wyen, C; Wynne, B, 2022)	1
" Drug-related adverse events were more frequent with DTG/3TC (20%) than CAR (6%) through week 48 but comparable post-week 24 (5% vs 2%, respectively)."	( Efficacy and Safety of Switching to the 2-Drug Regimen Dolutegravir/Lamivudine Versus Continuing a 3- or 4-Drug Regimen for Maintaining Virologic Suppression in Adults Living With Human Immunodeficiency Virus 1 (HIV-1): Week 48 Results From the Phase 3, N Blair, E; Bontempo, G; Brites, C; Cheng, CY; Curtis, L; Degen, O; Galera, C; Hocqueloux, L; Llibre, JM; Maggiolo, F; Man, C; Osiyemi, O; Oyee, J; Taylor, S; Underwood, M; van Wyk, J; Wynne, B, 2023)	1.16
" The proportions of participants with any grade 3-4 adverse event were similar between the dolutegravir (26 [11%]) and darunavir (28 [12%]) groups and between the tenofovir (22 [9%]) and zidovudine (32 [14%]) groups."	( Efficacy and safety of dolutegravir or darunavir in combination with lamivudine plus either zidovudine or tenofovir for second-line treatment of HIV infection (NADIA): week 96 results from a prospective, multicentre, open-label, factorial, randomised, non Asienzo, J; Ategeka, G; Balyegisawa, A; Borok, M; Castelnuovo, B; Hoppe, A; Kaimal, A; Kambugu, A; Kiragga, A; Kityo, C; Lugemwa, A; Mirembe, G; Mugerwa, H; Musaazi, J; Odongpiny, ELA; Paton, NI; Siika, A; Walimbwa, S, 2022)	1.25
" We aimed to select dosing for a dispersible tablet formulation of dolutegravir that achieved pharmacokinetic exposures similar to those in adults, and was safe and well tolerated in young children."	( Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. Acosta, EP; Anthony, P; Archary, M; Bartlett, M; Brothers, C; Buchanan, AM; Chokephaibulkit, K; Dayton, D; Deville, JG; Dobbels, EFM; George, K; Gray, KP; Hazra, R; Koech, L; Liu, JP; Mmbaga, BT; Montañez, N; Ounchanum, P; Pinto, JA; Popson, S; Ruel, TD; Singh, R; Townley, E; Vavro, C; Vhembo, T; Wiznia, A, 2022)	1.19
"In this study, the proposed once daily dosing of dolutegravir dispersible tablets provided drug exposures similar to those for adults, and was safe and well tolerated."	( Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. Acosta, EP; Anthony, P; Archary, M; Bartlett, M; Brothers, C; Buchanan, AM; Chokephaibulkit, K; Dayton, D; Deville, JG; Dobbels, EFM; George, K; Gray, KP; Hazra, R; Koech, L; Liu, JP; Mmbaga, BT; Montañez, N; Ounchanum, P; Pinto, JA; Popson, S; Ruel, TD; Singh, R; Townley, E; Vavro, C; Vhembo, T; Wiznia, A, 2022)	1.21
"A quantitative descriptive study based on Brazilian Active Pharmacovigilance of Dolutegravir (DTG) Project was performed to describe the adverse drug reactions (ADRs) to DTG reported and to evaluate the noncompleteness of data from DTG active pharmacovigilance in Brazil."	( Active Pharmacovigilance Project on the safety profile of Dolutegravir in Brazil. Ceccato, MDGB; Costa, AMGD; Crepalde-Ribeiro, K; Furtado Dos Santos, S; Mendes, JC; Pantuzza, LLN; Reis, AMM; Silveira, MR, 2023)	1.38
" We also assessed antiretroviral therapy safety, analyzing treatment discontinuation for adverse events."	( Brief Report: Efficacy and Safety of Efavirenz, Raltegravir, and Dolutegravir in HIV-1/TB Coinfection. A Multicenter Retrospective Cohort Study in France. Brun, A; de Castro, N; Hamet, G; Joly, V; Kherabi, Y; Méchaï, F; Molina, JM; Sellier, PO; Yazdanpanah, Y, 2022)	0.96
" Rate of treatment discontinuation for drug-related adverse events was 10."	( Brief Report: Efficacy and Safety of Efavirenz, Raltegravir, and Dolutegravir in HIV-1/TB Coinfection. A Multicenter Retrospective Cohort Study in France. Brun, A; de Castro, N; Hamet, G; Joly, V; Kherabi, Y; Méchaï, F; Molina, JM; Sellier, PO; Yazdanpanah, Y, 2022)	0.96
"Dolutegravir has been associated with neuropsychiatric adverse events (NPAEs), but relationships between dolutegravir concentrations and NPAEs are unclear."	( Pharmacokinetic and pharmacogenetic associations with dolutegravir neuropsychiatric adverse events in an African population. Akpomiemie, G; Denti, P; Griesel, R; Haas, DW; Joska, J; Kawuma, A; Maartens, G; Sinxadi, P; Sokhela, S; Venter, F, 2022)	2.41
" The safety data analysis of laboratory indicators showed that there was no significant difference in the incidence of adverse events between the 2 groups."	( Effectiveness and Safety of Dolutegravir Versus Efavirenz-Based Antiviral Regimen in People Living With HIV-1 in Sichuan Province of China: A Real-World Study. Chunrong, L; Huanxia, L; Ke, Y; Lin, C; Ruifeng, Z; Shenghua, H; Tongtong, Y; Xiaojing, Y; Yin, W; Yuan, Y; Yuanhong, H, 2022)	1.02
"In this multicenter, retrospective, observational study that included HIV-1-infected patients in China, baseline and follow-up data were collected to analyze the virological suppression rate, immune restoration, and adverse events during follow-up in HIV-1-infected patients who switched to the 3TC + DTG dual therapy."	( Efficacy and Safety of a Simplified Lamivudine Plus Dolutegravir Dual Therapy in HIV-1-Infected Patients: A Multicenter Cohort Study in China. Chen, C; Hu, Y; Huang, J; Lv, R; Ma, P; Pei, X; Qi, M; Su, Y; Wei, H; Yan, L; Ye, Z; Zhong, M; Zou, M, 2022)	0.97
"Thus, the 3TC + DTG dual therapy displayed an excellent virological efficacy against HIV-1 infections and had an acceptable safety profile, with predominantly mild adverse events in HIV-1-infected patients in China."	( Efficacy and Safety of a Simplified Lamivudine Plus Dolutegravir Dual Therapy in HIV-1-Infected Patients: A Multicenter Cohort Study in China. Chen, C; Hu, Y; Huang, J; Lv, R; Ma, P; Pei, X; Qi, M; Su, Y; Wei, H; Yan, L; Ye, Z; Zhong, M; Zou, M, 2022)	0.97
" DTG + 3TC achieved virological suppression more rapidly and stably versus TDF + 3TC + EFV in ART-naïve HIV-1-infected adults, with better immunological response and less adverse drug effect, and reduced total HIV-1 DNA effectively."	( Real-world efficacy and safety of dolutegravir plus lamivudine versus tenofovir plus lamivudine and efavirenz in ART-naïve HIV-1-infected adults. Chen, D; Du, Y; Huang, Z; Li, J; Wang, Y; Wen, Z; Yin, S; Zhong, H, 2022)	1
" Data on the occurrence of neuropsychiatric adverse events (NPAEs) and the associated factors among adult patients who are initiated on or switched to DTG-based first-line or second-line ART in Uganda are limited."	( Prevalence of neuropsychiatric adverse events and associated factors among adult patients on dolutegravir attending Mulago ISS clinic. Birungi, C; Meya, D; Musiime, V; Mwebaza, J, 2023)	1.13
" Outcomes included efficacy/effectiveness (CD4 counts and viral load) and/or safety outcomes (mortality, grade 3/4 adverse events and treatment discontinuation) through 6 months or more post-treatment initiation."	( Effectiveness and safety of dolutegravir and raltegravir for treating children and adolescents living with HIV: a systematic review. Castro, H; Collins, IJ; Jesson, J; Judd, A; Leroy, V; Milanzi, E; O'Rourke, J; Penazzato, M; Renaud, F; Townsend, CL; Vicari, M, 2022)	1.02
" Across all studies assessing dolutegravir or raltegravir, grade 3/4 adverse events (clinical and/or laboratory) were reported in 0-50% of subjects, few resulted in discontinuation, few were drug related and no deaths were attributed to either drug."	( Effectiveness and safety of dolutegravir and raltegravir for treating children and adolescents living with HIV: a systematic review. Castro, H; Collins, IJ; Jesson, J; Judd, A; Leroy, V; Milanzi, E; O'Rourke, J; Penazzato, M; Renaud, F; Townsend, CL; Vicari, M, 2022)	1.3
"These reassuring findings suggest that dolutegravir and raltegravir are effective and safe as preferred regimens in children and adolescents living with HIV."	( Effectiveness and safety of dolutegravir and raltegravir for treating children and adolescents living with HIV: a systematic review. Castro, H; Collins, IJ; Jesson, J; Judd, A; Leroy, V; Milanzi, E; O'Rourke, J; Penazzato, M; Renaud, F; Townsend, CL; Vicari, M, 2022)	1.28
" The safety was evaluated by incidence of adverse drug reactions (ADRs)."	( Safety and Effectiveness Analyses of Dolutegravir/Lamivudine in Patients with HIV: 2-Year Report of Post-Marketing Surveillance in Japan. Fukuda, A; Hongo, H; Kurosaki, E; Maeno, Y; Nagao, T; Sebata, A; Suzuki, M; Tofukuji, A; Watanabe, T, 2023)	1.18
"These results suggest that the 2-drug regimen DTG + 3TC offers comparable and durable efficacy with fewer serious adverse events vs BIC/FTC/TAF and DTG/ABC/3TC through 144 weeks of treatment in ART-naive PWH."	( An indirect comparison of 144-week efficacy, safety, and tolerability of dolutegravir plus lamivudine and second-generation integrase inhibitor-based, 3-drug, single-tablet regimens in therapy-naive people with HIV-1. Evitt, LA; Grove, RA; Nanji, S; Okoli, C; Snedecor, SJ; van Wyk, J, 2023)	1.14
" Efficacy, adverse events and metabolic changes at 48 weeks were analysed."	( Efficacy and safety of dolutegravir/rilpivirine in real-world clinical practice. GeSIDA study 1119. Casado, JL; Castaño, M; de la Torre, J; Fanjul, F; Fariñas, C; Galindo, MJ; Gómez-Ayerbe, C; Hidalgo, C; Montero, M; Montes, ML; Ocampo, A; Palacios, R; Payeras, T; Rial, D; Ribera, E; Santos, J; Tejerina, F, 2023)	1.22
" The switch to DTG/RPV was safe with few discontinuations due to adverse effects."	( Efficacy and safety of dolutegravir/rilpivirine in real-world clinical practice. GeSIDA study 1119. Casado, JL; Castaño, M; de la Torre, J; Fanjul, F; Fariñas, C; Galindo, MJ; Gómez-Ayerbe, C; Hidalgo, C; Montero, M; Montes, ML; Ocampo, A; Palacios, R; Payeras, T; Rial, D; Ribera, E; Santos, J; Tejerina, F, 2023)	1.22
" Adverse drug reactions were uncommon."	( Efficacy and Safety of Two-Drug Regimens with Dolutegravir plus Rilpivirine or Lamivudine in HIV-1 Virologically Suppressed People Living with HIV. Buzón, L; De la Fuente, S; De Los Santos, I; Dueñas-Gutiérrez, C; Ferreira, E; Gómez, J; Iribarren, JA; Moran, MA; Moreno, E; Pedrero-Tomé, R; Pousada, G; Troya, J, 2023)	1.17
"We conclude that DTG-based 2DRs (combined with 3TC or RPV) in clinical practice were effective and safe as a switching strategy, with a low VF and high viral suppression rates."	( Efficacy and Safety of Two-Drug Regimens with Dolutegravir plus Rilpivirine or Lamivudine in HIV-1 Virologically Suppressed People Living with HIV. Buzón, L; De la Fuente, S; De Los Santos, I; Dueñas-Gutiérrez, C; Ferreira, E; Gómez, J; Iribarren, JA; Moran, MA; Moreno, E; Pedrero-Tomé, R; Pousada, G; Troya, J, 2023)	1.17
" No grade III/IV adverse events were reported, and there was no worsening of blood counts, liver or renal function test parameters."	( Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy. Bhagat, N; Charak, S; De, A; Duseja, A; Goel, K; Premkumar, M; Rathi, S; Sharma, A; Singh, V; Taneja, S; Verma, N, 2023)	1.12
" The most common drug-related adverse events were headache and nausea."	( Safety and Efficacy of Triple Therapy With Dolutegravir Plus 2 Nucleoside Reverse Transcriptase Inhibitors in Treatment-Naive Human Immunodeficiency Virus Type 2 Patients: Results From a 48-Week Phase 2 Study. Aleixo, MJ; Alves, J; Araújo, V; Batista, J; Duque, L; Franco, C; Gomes, P; Janeiro, N; Lino, S; Lopes, C; Lopes, MJ; Maltez, F; Mansinho, K; Marques, N; Pacheco, P; Peres, S; Póvoas, D; Rodrigues, P; Silva, AR; Tavares, R; Trigo, D, 2023)	1.17
"DTG plus 2 NRTIs is safe and effective as first-line treatment for PWHIV-2 with a tolerability profile previously known."	( Safety and Efficacy of Triple Therapy With Dolutegravir Plus 2 Nucleoside Reverse Transcriptase Inhibitors in Treatment-Naive Human Immunodeficiency Virus Type 2 Patients: Results From a 48-Week Phase 2 Study. Aleixo, MJ; Alves, J; Araújo, V; Batista, J; Duque, L; Franco, C; Gomes, P; Janeiro, N; Lino, S; Lopes, C; Lopes, MJ; Maltez, F; Mansinho, K; Marques, N; Pacheco, P; Peres, S; Póvoas, D; Rodrigues, P; Silva, AR; Tavares, R; Trigo, D, 2023)	1.17
" In view of these benefits, particularly for pregnant women, an important question is if dolutegravir is safe in pregnancy."	( Metabolic implications and safety of dolutegravir use in pregnancy. Blanco, C; Copp, AJ; Dontsova, V; Greene, NDE; Jao, J; Mohan, H; Serghides, L; Zash, R, 2023)	1.4
" We also measured changes from baseline in CD4 + cell counts, CD4/CD8 ratio, lipid parameters, weight, creatinine (Cr), estimated glomerular filtration rate (eGFR), and drug-related adverse effects (DRAEs)."	( Efficacy and safety profiles of dolutegravir plus lamivudine vs . bictegravir/emtricitabine/tenofovir alafenamide in therapy-naïve adults with HIV-1. Deng, Y; He, L; Li, J; Wang, Y; Wei, Y; Wen, L; Xu, R; Zhong, H, 2023)	1.19

Excerpt	Reference	Relevance
"S/GSK1349572 is an unboosted, once daily, next generation integrase inhibitor with potent activity, low pharmacokinetic (PK) variability and a novel resistance profile."	( Effect of atazanavir and atazanavir/ritonavir on the pharmacokinetics of the next-generation HIV integrase inhibitor, S/GSK1349572. Borland, J; Chen, S; Lou, Y; Min, S; Peppercorn, A; Piscitelli, SC; Song, I; Wajima, T, 2011)	0.37
" The pharmacokinetic variability was low (coefficient of variation, range 25-50%)."	( Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. Chen, S; DeJesus, E; Fujiwara, T; Hawkins, T; Lalezari, J; McCurdy, L; Min, S; Piscitelli, S; Sloan, L; Song, I; Stroder, R; Underwood, M, 2011)	0.6
"Dolutegravir demonstrated potent antiviral activity, good short-term tolerability, low pharmacokinetic variability, and a predictable pharmacokinetics/pharmacodynamics relationship, which support once-daily dosing without a pharmacokinetic booster in integrase-naive patients in future studies."	( Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. Chen, S; DeJesus, E; Fujiwara, T; Hawkins, T; Lalezari, J; McCurdy, L; Min, S; Piscitelli, S; Sloan, L; Song, I; Stroder, R; Underwood, M, 2011)	2.05
"Phase I pharmacokinetic drug interaction study."	( Safety, tolerability, and pharmacokinetics of the HIV integrase inhibitor dolutegravir given twice daily with rifampin or once daily with rifabutin: results of a phase 1 study among healthy subjects. Borland, J; Chen, S; Dooley, KE; Everts, S; Flexner, C; Peppercorn, A; Piscitelli, S; Purdy, E; Sayre, P; Song, I, 2013)	0.62
" Pharmacokinetic parameters were determined using noncompartmental methods and geometric least-square mean ratios, and 90% confidence intervals were generated."	( Effect of prednisone on the pharmacokinetics of the integrase inhibitor dolutegravir. Borland, J; Chen, S; Peppercorn, AF; Piscitelli, S; Savina, P; Song, IH, 2013)	0.62
" Dolutegravir has a terminal elimination half-life of 13-14 h and maintains concentrations over the in vitro, protein-adjusted IC90 for more than 30 h following a single dose."	( Clinical pharmacokinetic, pharmacodynamic and drug-interaction profile of the integrase inhibitor dolutegravir. Cottrell, ML; Hadzic, T; Kashuba, AD, 2013)	1.52
" A Phase I open-label pharmacokinetic (PK) study was performed to describe first dose (PK1) and steady-state (PK2) PKs of the integrase inhibitor dolutegravir (DTG) in blood plasma (BP), cervicovaginal fluid (CVF), cervical tissue (CT) and vaginal tissue (VT) in HIV type-1-negative women."	( Single and multiple dose pharmacokinetics of dolutegravir in the genital tract of HIV-negative women. Adams, JL; Dumond, JB; Greener, BN; Kashuba, AD; Patterson, KB; Prince, HM; Sykes, C, 2013)	0.85
" Steady-state pharmacokinetic (PK) parameters were estimated using noncompartmental analysis of data collected on the last day of each period."	( Lack of pharmacokinetic interaction between rilpivirine and integrase inhibitors dolutegravir and GSK1265744. Chen, S; Crauwels, H; Ford, SL; Gould, E; Margolis, D; Piscitelli, S; Spreen, W, 2013)	0.62
" Pharmacodynamic (PD) measures and safety assessments were obtained throughout the study."	( Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects. Bala, U; Chen, S; Geoffroy, P; Mark, S; Peppercorn, A; Piscitelli, S; Savina, P; Song, I; Wajima, T, 2013)	1.83
" DTG mean exposure was lower in subjects with severe renal impairment compared to healthy, matched subjects: AUC(0-∞) and Cmax were 40 % and 23 % lower, while mean DTG-Gluc was increased."	( Pharmacokinetics of dolutegravir in HIV-seronegative subjects with severe renal impairment. Borland, J; Chen, S; Johnson, M; Peppercorn, AF; Piscitelli, SC; Savina, P; Wajima, T; Weller, S; Wynne, B, 2014)	0.73
" Coadministration of dolutegravir with telaprevir resulted in increased dolutegravir plasma exposures compared with those after administration of dolutegravir alone; AUC0- τ , Cmax and Cτ increased by 25, 19 and 37%, respectively."	( Effects of boceprevir and telaprevir on the pharmacokinetics of dolutegravir. Borland, J; Chen, S; Johnson, M; Piscitelli, S; Savina, P; Wynne, B, 2014)	0.96
" Co-administration with EFV resulted in decreases of 57, 39 and 75% in DTG AUC(0-τ), Cmax and Cτ, respectively."	( Effects of enzyme inducers efavirenz and tipranavir/ritonavir on the pharmacokinetics of the HIV integrase inhibitor dolutegravir. Borland, J; Castellino, S; Chen, S; Guta, P; Hosking, L; Lou, Y; Mosteller, M; Peppercorn, A; Piscitelli, SC; Rubio, JP; Savina, P; Song, I; Wagner, D; Wajima, T; Wilfret, D, 2014)	0.61
" Serial pharmacokinetic samples for DTG and amprenavir and safety assessments were obtained throughout the study."	( Effect of fosamprenavir-ritonavir on the pharmacokinetics of dolutegravir in healthy subjects. Borland, J; Chen, S; Peppercorn, A; Piscitelli, SC; Song, I; Wajima, T, 2014)	0.64
" Plasma dolutegravir AUC(0-∞), Cmax , and C24 were reduced by 39%, 37%, and 39%, respectively, when co-administered with calcium carbonate while fasting and were reduced by 54%, 57%, and 56%, respectively, when co-administered with ferrous fumarate while fasting."	( Pharmacokinetics of dolutegravir when administered with mineral supplements in healthy adult subjects. Arya, N; Borland, J; Piscitelli, S; Song, I; Wynne, B, 2015)	1.17
"A population pharmacokinetic model was developed using a non-linear mixed effect modelling approach based on data from 563 HIV-infected, treatment-naive adult patients in three phase 2/3 trials who received dolutegravir (ranging from 10-50 mg once daily) alone or in combination with abacavir/lamivudine or tenofovir/emtricitabine."	( Population pharmacokinetics of dolutegravir in HIV-infected treatment-naive patients. Brandt, J; Hayes, S; Min, S; Minto, I; Piscitelli, S; Sadler, BM; Song, IH; Zhang, J, 2015)	0.89
" From the interaction between atazanavir and DTG via CYP3A4 and UGT1A1 and placental efflux transporter inhibition and considering the infant's probable enzymatic immaturity, the DTG elimination half-life was estimated to be 4-fold longer in neonates than in adults."	( Pharmacokinetics of dolutegravir in a premature neonate after HIV treatment intensification during pregnancy. Amiel, C; Caseris, M; Charpentier, C; Descamps, D; Desnoyer, A; Farnoux, C; Lassel, L; Lê, MP; Pain, JB; Peytavin, G; Pialoux, G, 2015)	0.74
"The metabolic pathways of dolutegravir and nevirapine suggest a potential pharmacokinetic interaction between these drugs."	( Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. Allavena, C; Billaud, E; Bouchez, S; Bouquié, R; Dailly, E; Deslandes, G; Grégoire, M; Hall, N; Hernando, H; Jolliet, P; Raffi, F; Reliquet, V, 2015)	0.95
" Full pharmacokinetic profiles were assessed on the day of nevirapine discontinuation and 2 weeks after discontinuation of nevirapine."	( Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. Allavena, C; Billaud, E; Bouchez, S; Bouquié, R; Dailly, E; Deslandes, G; Grégoire, M; Hall, N; Hernando, H; Jolliet, P; Raffi, F; Reliquet, V, 2015)	0.65
"018) and terminal half-life (-15%, P = 0."	( Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. Allavena, C; Billaud, E; Bouchez, S; Bouquié, R; Dailly, E; Deslandes, G; Grégoire, M; Hall, N; Hernando, H; Jolliet, P; Raffi, F; Reliquet, V, 2015)	0.65
"Co-administration of dolutegravir 50 mg q24h increased metformin area under the curve(0-τ) by 79% and Cmax by 66%, whereas dolutegravir 50 mg q12h increased metformin area under the curve(0-τ) and Cmax by 145% and 111%, respectively."	( The Effect of Dolutegravir on the Pharmacokinetics of Metformin in Healthy Subjects. Borland, J; Bowers, GD; Choukour, M; Humphreys, JE; Jerva, F; Song, IH; Wynne, B; Zamek-Gliszczynski, MJ; Zong, J, 2016)	1.11
" A precise method is required to quantify the drug concentration in biological matrices to study pharmacokinetic behavior and tissue distribution profile in animals and/or humans."	( Simultaneous quantification of tenofovir, emtricitabine, rilpivirine, elvitegravir and dolutegravir in mouse biological matrices by LC-MS/MS and its application to a pharmacokinetic study. Destache, CJ; Mandal, S; Prathipati, PK, 2016)	0.66
" The pharmacokinetic interactions between these drugs were therefore assessed."	( A Two-Way Steady-State Pharmacokinetic Interaction Study of Doravirine (MK-1439) and Dolutegravir. Anderson, MS; Butterton, JR; Fan, L; Hussaini, A; Khalilieh, S; Liu, R; Rizk, ML; Ross, LL; Shah, V; Song, I; Yee, KL, 2017)	0.68
"The results of this study demonstrate that concomitant administration of doravirine and dolutegravir in healthy subjects causes no clinically significant alteration in the pharmacokinetic and safety profiles of the two drugs, thereby supporting further evaluation of co-administration of these agents for human immunodeficiency virus-1 treatment."	( A Two-Way Steady-State Pharmacokinetic Interaction Study of Doravirine (MK-1439) and Dolutegravir. Anderson, MS; Butterton, JR; Fan, L; Hussaini, A; Khalilieh, S; Liu, R; Rizk, ML; Ross, LL; Shah, V; Song, I; Yee, KL, 2017)	0.9
"EVG is currently available as a single tablet regimen and requires cobisistat, a pharmacokinetic booster and CYP3A inhibitor to allow QD dosing."	( How recent findings on the pharmacokinetics and pharmacodynamics of integrase inhibitors can inform clinical use. Boffito, M; Chirwa, M; Elliot, E, 2017)	0.46
"Intensive steady-state 24 h pharmacokinetic profiles after dolutegravir 50 mg once-daily were performed during the second trimester (2T), third trimester (3T) and postpartum."	( Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV. Acosta, EP; Barr, E; Best, BM; Burchett, S; Buschur, SL; Capparelli, EV; Chakhtoura, N; Mirochnick, M; Mulligan, N; Smith, E; Stek, A; Wang, J, 2018)	2.17
" Pharmacokinetic data were available for 15 (2T), 28 (3T) and 23 (postpartum) women."	( Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV. Acosta, EP; Barr, E; Best, BM; Burchett, S; Buschur, SL; Capparelli, EV; Chakhtoura, N; Mirochnick, M; Mulligan, N; Smith, E; Stek, A; Wang, J, 2018)	1.92
" Infant elimination is prolonged, with half-life over twice that of historical adult controls."	( Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV. Acosta, EP; Barr, E; Best, BM; Burchett, S; Buschur, SL; Capparelli, EV; Chakhtoura, N; Mirochnick, M; Mulligan, N; Smith, E; Stek, A; Wang, J, 2018)	1.92
"DTG Cmax was significantly higher in older PLWH."	( Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition. Boffito, M; Elliot, ER; Fitzpatrick, C; McClure, M; Miller, RF; Moyle, G; Simmons, B; Singh, S; Vera, JH; Wang, X, 2019)	0.92
"This Phase I, open-label, 57 day, crossover, pharmacokinetic (PK) study, enrolled healthy volunteers aged 18-65 years, who were randomized to one of two groups."	( Pharmacokinetics of dolutegravir with and without darunavir/cobicistat in healthy volunteers. Amara, A; Bisdomini, E; Boffito, M; Cerrone, M; Elliot, ER; Else, L; Khoo, S; Owen, A, 2019)	0.84
" The aim of this study was to characterize dolutegravir's pharmacokinetic profile and variability in a real-life setting and to identify individual factors and co-medications affecting dolutegravir disposition."	( Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. Aouri, M; Barcelo, C; Braun, DL; Buclin, T; Cavassini, M; Courlet, P; Csajka, C; Decosterd, LA; Guidi, M; Günthard, HF; Piso, RJ, 2019)	1.06
"A population pharmacokinetic model was developed using NONMEM®."	( Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. Aouri, M; Barcelo, C; Braun, DL; Buclin, T; Cavassini, M; Courlet, P; Csajka, C; Decosterd, LA; Guidi, M; Günthard, HF; Piso, RJ, 2019)	0.8
"Full pharmacokinetic profiling nested in a multicenter, observational, prospective cohort study."	( Pharmacokinetic profiles of boosted darunavir, dolutegravir and lamivudine in aging people living with HIV. Alves Saldanha, S; Battegay, M; Buclin, T; Cavassini, M; Courlet, P; Decosterd, LA; Guidi, M; Marzolini, C; Stader, F; Stoeckle, M, 2020)	0.82
"Nineteen PLWH with a median age of 64 years participated in the full pharmacokinetic investigations."	( Pharmacokinetic profiles of boosted darunavir, dolutegravir and lamivudine in aging people living with HIV. Alves Saldanha, S; Battegay, M; Buclin, T; Cavassini, M; Courlet, P; Decosterd, LA; Guidi, M; Marzolini, C; Stader, F; Stoeckle, M, 2020)	0.82
" Intensive pharmacokinetic sampling of DTG was undertaken at day 14 and 2wPP following administration of a medium-fat breakfast, with additional paired sampling between maternal plasma and cord blood, breastmilk and infant plasma."	( Safety and pharmacokinetics of dolutegravir in pregnant mothers with HIV infection and their neonates: A randomised trial (DolPHIN-1 study). Amara, A; Byakika-Kibwika, P; Byamugisha, J; Coombs, JA; Else, L; Gini, J; Heiburg, C; Hill, A; Hodel, EM; Kaboggoza, J; Khoo, S; Kintu, K; Lamorde, M; Malaba, T; Mehta, U; Myer, L; Orrell, C; Reynolds, H; Sihlangu, M; Simmons, B; Singh, Y; Waitt, C; Walimbwa, S, 2019)	0.8
"The physiologically based pharmacokinetic (PBPK) model was built incorporating the age-related changes observed in neonates."	( Prediction of dolutegravir pharmacokinetics and dose optimization in neonates via physiologically based pharmacokinetic (PBPK) modelling. Bunglawala, F; Mirochnick, M; Owen, A; Rajoli, RKR; Siccardi, M, 2020)	0.92
" We combined a pregnancy physiologically-based pharmacokinetic (PBPK) modeling approach with data on placental drug transfer to simulate maternal and fetal exposure to dolutegravir (DTG)."	( Assessment of Maternal and Fetal Dolutegravir Exposure by Integrating Ex Vivo Placental Perfusion Data and Physiologically-Based Pharmacokinetic Modeling. Abduljalil, K; Burger, DM; Colbers, AP; Freriksen, JJM; Greupink, R; Russel, FGM; Schalkwijk, S, 2020)	1.03
"63396C>T variants were associated with a 43% increase in Cmax (P = 0."	( Genetic influence of ABCG2, UGT1A1 and NR1I2 on dolutegravir plasma pharmacokinetics. Boffito, M; Carr, DF; Elliot, ER; Else, L; Khoo, S; Mcclure, M; Moyle, G; Neary, M; Owen, A; Wang, X, 2020)	0.81
"Within the multicenter Pharmacokinetics of ANtiretroviral agents in HIV-infected pregNAnt women (PANNA) study, pregnant women living with HIV and using dolutegravir once daily (50 mg, with food) underwent 24-hour pharmacokinetic profiling in their third trimester and postpartum."	( The Effect of Pregnancy on the Pharmacokinetics of Total and Unbound Dolutegravir and Its Main Metabolite in Women Living With Human Immunodeficiency Virus. Alba-Alejandre, I; Bollen, P; Burger, D; Colbers, A; Freriksen, J; Hidalgo Tenorio, C; Konopnicki, D; Moltó, J; Taylor, G; van Crevel, R; Weizsäcker, K, 2021)	1.05
"Seventeen women (76% black) were enrolled (25 evaluable pharmacokinetic profiles; 15 in the third trimester, 10 in postpartum)."	( The Effect of Pregnancy on the Pharmacokinetics of Total and Unbound Dolutegravir and Its Main Metabolite in Women Living With Human Immunodeficiency Virus. Alba-Alejandre, I; Bollen, P; Burger, D; Colbers, A; Freriksen, J; Hidalgo Tenorio, C; Konopnicki, D; Moltó, J; Taylor, G; van Crevel, R; Weizsäcker, K, 2021)	0.86
" This study aimed to develop and evaluate maternal-fetal physiologically based pharmacokinetic models for two antiretroviral drugs, dolutegravir and raltegravir."	( Prediction of Maternal and Fetal Pharmacokinetics of Dolutegravir and Raltegravir Using Physiologically Based Pharmacokinetic Modeling. Best, BM; Burckart, GJ; Cressey, TR; Dallmann, A; Green, DJ; Liu, XI; Mirochnick, M; Momper, JD; Rakhmanina, NY; van den Anker, JN, 2020)	1.01
" Dolutegravir pharmacokinetic sampling (0-24 hours) was undertaken 14 days after treatment initiation and within 1-3 weeks after delivery, with matched maternal and cord samples at delivery."	( Infant Exposure to Dolutegravir Through Placental and Breast Milk Transfer: A Population Pharmacokinetic Analysis of DolPHIN-1. Amara, A; Byamugisha, J; Coombs, JA; Dickinson, L; Else, L; Gini, J; Heiberg, C; Hodel, EM; Kaboggoza, J; Khoo, S; Kintu, K; Lamorde, M; Malaba, TR; Myer, L; Orrell, C; Pertinez, H; Reynolds, H; Sihlangu, M; Singh, Y; Waitt, C; Walimbwa, S, 2021)	1.86
" The median predicted infant dolutegravir half-life and median time to protein-adjusted 90% inhibitory concentration (0."	( Infant Exposure to Dolutegravir Through Placental and Breast Milk Transfer: A Population Pharmacokinetic Analysis of DolPHIN-1. Amara, A; Byamugisha, J; Coombs, JA; Dickinson, L; Else, L; Gini, J; Heiberg, C; Hodel, EM; Kaboggoza, J; Khoo, S; Kintu, K; Lamorde, M; Malaba, TR; Myer, L; Orrell, C; Pertinez, H; Reynolds, H; Sihlangu, M; Singh, Y; Waitt, C; Walimbwa, S, 2021)	1.24
" The ODYSSEY trial includes nested pharmacokinetic (PK) sub-studies which evaluated pragmatic World Health Organization (WHO) weight-band-based DTG dosing and opened recruitment to children < 14 kg while dosing was in development."	( ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg Amuge, P; Archary, M; Atwine, L; Barlow-Mosha, LN; Behuhuma, O; Burger, DM; Compagnucci, A; Cotton, MF; Cressey, TR; Ford, D; Giaquinto, C; Gibb, DM; Hakim, J; Kekitiinwa, A; Kityo, CM; Lugemwa, A; Moore, CL; Mujuru, H; Musiime, V; Puthanakit, T; Rojo, P; Saϊdi, Y; Shakeshaft, C; Turkova, A; Variava, E; Violari, A, 2021)	0.84
" Our objective was to develop and evaluate a novel, physiologically based pharmacokinetic modeling workflow for predicting perinatal and postnatal disposition of commonly used antiretroviral drugs administered prenatally to pregnant women living with human immunodeficiency virus."	( Physiologically Based Pharmacokinetic Modeling Framework to Predict Neonatal Pharmacokinetics of Transplacentally Acquired Emtricitabine, Dolutegravir, and Raltegravir. Best, BM; Burckart, GJ; Cressey, TR; Dallmann, A; Green, DJ; Liu, XI; Mirochnick, M; Momper, JD; Rakhmanina, NY; van den Anker, JN, 2021)	0.82
"Neonatal physiologically based pharmacokinetic models generally captured the initial plasma concentrations after delivery but underestimated concentrations in the terminal phase."	( Physiologically Based Pharmacokinetic Modeling Framework to Predict Neonatal Pharmacokinetics of Transplacentally Acquired Emtricitabine, Dolutegravir, and Raltegravir. Best, BM; Burckart, GJ; Cressey, TR; Dallmann, A; Green, DJ; Liu, XI; Mirochnick, M; Momper, JD; Rakhmanina, NY; van den Anker, JN, 2021)	0.82
"These findings demonstrate the general feasibility of applying physiologically based pharmacokinetic models to predict washout concentrations of transplacentally acquired drugs in newborns."	( Physiologically Based Pharmacokinetic Modeling Framework to Predict Neonatal Pharmacokinetics of Transplacentally Acquired Emtricitabine, Dolutegravir, and Raltegravir. Best, BM; Burckart, GJ; Cressey, TR; Dallmann, A; Green, DJ; Liu, XI; Mirochnick, M; Momper, JD; Rakhmanina, NY; van den Anker, JN, 2021)	0.82
"We developed a population pharmacokinetic model of dolutegravir with data from 26 healthy volunteers in two Phase 2 studies with a total of 403 dolutegravir plasma concentrations at steady state."	( Dolutegravir pharmacokinetics during co-administration with either artemether/lumefantrine or artesunate/amodiaquine. Denti, P; Kawuma, AN; Khoo, S; Lamorde, M; Pillai, GC; Walimbwa, SI; Wasmann, RE, 2021)	2.32
"This study aims to evaluate the association between dolutegravir (DTG) pharmacokinetic parameters and weight changes in treatment-experienced people with HIV (PWHIV) from the Simpl'HIV study newly switched to a dual DTG-based regimen."	( Pharmacokinetic parameters and weight change in HIV patients newly switched to dolutegravir-based regimens in SIMPL'HIV clinical trial. Alves Saldanha, S; Barbieux, C; Bernasconi, E; Braun, D; Calmy, A; Cavassini, M; Courlet, P; Decosterd, LA; Guidi, M; Günthard, HF; Limacher, A; Marinosci, A; Schmid, P; Sculier, D; Smit, M; Stoeckle, M; Vernazza, P; Wandeler, G, 2021)	1.1
" Minimum duration of nonadherence resulting in a negative drug level test was assessed by simulation of treatment cessation using validated population pharmacokinetic models."	( Point-of-Care Detection of Nonadherence to Antiretroviral Treatment for HIV-1 in Resource-Limited Settings Using Drug Level Testing for Efavirenz, Lopinavir, and Dolutegravir: A Validation and Pharmacokinetic Simulation Study. Burger, DM; Heine, RT; Hermans, LE; Houts, T; Nijhuis, M; Schuurman, R; Tempelman, HA; Wensing, AMJ, 2021)	0.82
" Pharmacokinetic evaluation was performed in white albino New Zealand rabbits by subcutaneous injection (30 mg/Kg)."	( Ultra-long acting prodrug of dolutegravir and delivery system - Physicochemical, pharmacokinetic and formulation characterizations. Dharani, S; Immadi, S; Khan, MA; Khuroo, T; Lu, D; Mohamed, EM; Nehete, P; Rahman, Z; Wu, Z, 2021)	0.91
" These include studies on transplacental transfer of dolutegravir, ex vivo placenta perfusion models, physiologically based pharmacokinetic (PBPK) models and animal studies."	( Pharmacokinetics and placental transfer of dolutegravir in pregnancy. Anumba, D; Ikumi, NM; Matjila, M, 2022)	1.23
"Population pharmacokinetic modeling and simulation were used to assess newborn DTG dosing requirements during the first few days of life as a function of maternal DTG dosing history before delivery."	( Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Acosta, E; Best, BM; Capparelli, EV; Clarke, DF; Mirochnick, M; Momper, JD; Nikanjam, M; Piscitelli, J, 2022)	1.11
" Maternal and neonate population pharmacokinetic models were separately developed."	( Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Acosta, E; Best, BM; Capparelli, EV; Clarke, DF; Mirochnick, M; Momper, JD; Nikanjam, M; Piscitelli, J, 2022)	1.11
"34 μg/mL representing 2-fold above the adult Cmax value)."	( Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Acosta, E; Best, BM; Capparelli, EV; Clarke, DF; Mirochnick, M; Momper, JD; Nikanjam, M; Piscitelli, J, 2022)	1.11
" The DTG pharmacokinetic profiles in different groups were assessed."	( Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex. Chen, J; Guo, X; Le, X; Liu, L; Qi, T; Shen, Y; Song, W; Sun, J; Tang, Y; Wang, J; Wang, Z; Yin, L; Zhang, L; Zhang, R, 2022)	1.02
" A non-compartmental analysis was performed to estimate the main pharmacokinetic parameters."	( Pharmacokinetics and tissue distribution of tenofovir, emtricitabine and dolutegravir in mice. Barrail-Tran, A; Benzemrane, MS; Bourgeois, C; Gelé, T; Gouget, H; Labarthe, L; Lambotte, O; Le Calvez, P; Le Grand, R; Legrand, N, 2022)	0.95
"ARV plasma pharmacokinetic parameters in both strains were similar to those estimated in the clinical context."	( Pharmacokinetics and tissue distribution of tenofovir, emtricitabine and dolutegravir in mice. Barrail-Tran, A; Benzemrane, MS; Bourgeois, C; Gelé, T; Gouget, H; Labarthe, L; Lambotte, O; Le Calvez, P; Le Grand, R; Legrand, N, 2022)	0.95
" We aimed to select dosing for a dispersible tablet formulation of dolutegravir that achieved pharmacokinetic exposures similar to those in adults, and was safe and well tolerated in young children."	( Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. Acosta, EP; Anthony, P; Archary, M; Bartlett, M; Brothers, C; Buchanan, AM; Chokephaibulkit, K; Dayton, D; Deville, JG; Dobbels, EFM; George, K; Gray, KP; Hazra, R; Koech, L; Liu, JP; Mmbaga, BT; Montañez, N; Ounchanum, P; Pinto, JA; Popson, S; Ruel, TD; Singh, R; Townley, E; Vavro, C; Vhembo, T; Wiznia, A, 2022)	1.19
" Doses were selected on the basis of intensive pharmacokinetic evaluation on days 5-10, with safety and tolerability assessed up to 48 weeks."	( Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. Acosta, EP; Anthony, P; Archary, M; Bartlett, M; Brothers, C; Buchanan, AM; Chokephaibulkit, K; Dayton, D; Deville, JG; Dobbels, EFM; George, K; Gray, KP; Hazra, R; Koech, L; Liu, JP; Mmbaga, BT; Montañez, N; Ounchanum, P; Pinto, JA; Popson, S; Ruel, TD; Singh, R; Townley, E; Vavro, C; Vhembo, T; Wiznia, A, 2022)	0.96
"Antiretroviral therapy-naive participants randomized to dolutegravir-based therapy in the ADVANCE study were enrolled into a pharmacokinetic sub-study."	( Pharmacokinetic and pharmacogenetic associations with dolutegravir neuropsychiatric adverse events in an African population. Akpomiemie, G; Denti, P; Griesel, R; Haas, DW; Joska, J; Kawuma, A; Maartens, G; Sinxadi, P; Sokhela, S; Venter, F, 2022)	1.22
"Data from 464 participants were available for pharmacokinetic analyses and 301 for genetic analyses."	( Pharmacokinetic and pharmacogenetic associations with dolutegravir neuropsychiatric adverse events in an African population. Akpomiemie, G; Denti, P; Griesel, R; Haas, DW; Joska, J; Kawuma, A; Maartens, G; Sinxadi, P; Sokhela, S; Venter, F, 2022)	0.97
" Within a nested pharmacokinetic (PK) substudy, we performed a population PK analysis to describe total and unbound dolutegravir plasma concentrations in children and adolescents receiving this dual therapy."	( Population pharmacokinetics of unbound and total dolutegravir concentrations in children aged 12 years and older: a PK substudy of the SMILE trial. Abdalla, S; Coelho, A; Compagnucci, A; Cressey, TR; Hirt, D; Ramos, JT; Riault, Y; Saidi, Y; Tréluyer, JM; Zheng, Y, 2023)	1.37
" Dolutegravir concentrations were measured using validated LCMS/MS and pharmacokinetic parameters calculated by noncompartmental analysis."	( Pharmacokinetics and pharmacodynamics of adult dolutegravir tablets in treatment-experienced children with HIV weighing at least 20 kg. Amissah, AK; Antwi, S; Asiedu, P; Bosomtwe, D; Dompreh, A; Dong, SK; Enimil, A; Frimpong Appiah, A; Kusi-Amponsah, I; Kwara, A; Maranchick, N; Martyn-Dickens, C; Ojewale, O; Opoku, T; Peloquin, CA; Sarfo, AD; Sly-Moore, E, 2023)	2.08
" Dolutegravir mean exposure, peak and trough concentrations at both pharmacokinetic visits were higher than the mean reference values in adults and children weighing 20 kg to less than 40 kg treated with 50 mg once daily, but were closer to the mean values in adults given 50 mg twice a day."	( Pharmacokinetics and pharmacodynamics of adult dolutegravir tablets in treatment-experienced children with HIV weighing at least 20 kg. Amissah, AK; Antwi, S; Asiedu, P; Bosomtwe, D; Dompreh, A; Dong, SK; Enimil, A; Frimpong Appiah, A; Kusi-Amponsah, I; Kwara, A; Maranchick, N; Martyn-Dickens, C; Ojewale, O; Opoku, T; Peloquin, CA; Sarfo, AD; Sly-Moore, E, 2023)	2.08
" We did a nested pharmacokinetic (PK) substudy within CHAPAS4 to evaluate the DTG exposure in children with HIV taking DTG with food as part of their second-line treatment."	( Pharmacokinetic Data of Dolutegravir in Second-line Treatment of Children With Human Immunodeficiency Virus: Results From the CHAPAS4 Trial. Bevers, LAH; Burger, DM; Bwakura-Dangarembizi, M; Chabala, C; Colbers, A; Gibb, DM; Makumbi, S; Mulenga, V; Mumbiro, V; Musiime, V; Nangiya, J; Szubert, AJ; Waalewijn, H, 2023)	1.22
" At steady state, 8-9 blood samples were taken to construct pharmacokinetic curves."	( First Pharmacokinetic Data of Tenofovir Alafenamide Fumarate and Tenofovir With Dolutegravir or Boosted Protease Inhibitors in African Children: A Substudy of the CHAPAS-4 Trial. Bamford, A; Burger, DM; Bwakura-Dangarembizi, M; Chabala, C; Colbers, A; Denti, P; Doerholt, K; Gibb, DM; Griffiths, AL; Makumbi, S; McIlleron, HM; Monkiewicz, LN; Mulenga, V; Mumbiro, V; Musiime, V; Nangiya, J; Szubert, AJ; Waalewijn, H; Wasmann, RE; Wiesner, L, 2023)	1.14
" For each combination, tenofovir GM (CV%) AUCtau and Cmax remained below reference values in adults taking 25 mg TAF with a boosted protease inhibitors."	( First Pharmacokinetic Data of Tenofovir Alafenamide Fumarate and Tenofovir With Dolutegravir or Boosted Protease Inhibitors in African Children: A Substudy of the CHAPAS-4 Trial. Bamford, A; Burger, DM; Bwakura-Dangarembizi, M; Chabala, C; Colbers, A; Denti, P; Doerholt, K; Gibb, DM; Griffiths, AL; Makumbi, S; McIlleron, HM; Monkiewicz, LN; Mulenga, V; Mumbiro, V; Musiime, V; Nangiya, J; Szubert, AJ; Waalewijn, H; Wasmann, RE; Wiesner, L, 2023)	1.14
" To support pediatric dosing of dolutegravir in children, we used a population pharmacokinetic model with dolutegravir data from the P1093 and ODYSSEY clinical trials."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.46
"A population pharmacokinetic model was developed with data from P1093 and ODYSSEY to characterize the pharmacokinetics and associated variability and to evaluate the impact of pharmacokinetic covariates."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.18
" The final population pharmacokinetic model was a one-compartment model with first-order absorption and elimination, enabling predictions of dolutegravir concentrations in the pediatric population across weight bands and doses/formulations."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.38
" Observed pharmacokinetic variability was higher in this pediatric population and no additional safety concerns were observed."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.18

Excerpt	Reference	Relevance
" This work investigated the in vitro drug transport and metabolism of DTG and assessed the potential for clinical drug-drug interactions."	( In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor. Clarke, JD; Generaux, GT; Harmon, KA; Humphreys, JE; Kanaoka, E; Polli, JW; Reese, MJ; Savina, PM; Tracey, H; Webster, LO, 2013)	0.59
" These data indicate that the 3-direct-acting-antiviral regimen can be administered with dolutegravir or abacavir plus lamivudine without dose adjustment."	( Drug-Drug Interaction between the Direct-Acting Antiviral Regimen of Ombitasvir-Paritaprevir-Ritonavir plus Dasabuvir and the HIV Antiretroviral Agent Dolutegravir or Abacavir plus Lamivudine. Khatri, A; Menon, R; Podsadecki, T; Trinh, R; Zhao, W, 2016)	0.85
"In general, DTG 50 mg given once daily combined with an active background drug is a better choice in terms of both efficacy and safety."	( Dolutegravir(DTG, S/GSK1349572) combined with other ARTs is superior to RAL- or EFV-based regimens for treatment of HIV-1 infection: a meta-analysis of randomized controlled trials. Chen, H; Guo, W; Huang, J; Jiang, J; Liang, B; Liang, H; Liao, Y; Su, J; Xu, X; Ye, L; Zang, N, 2016)	1.88
"To evaluate the plasma trough concentrations ( C trough ) of dolutegravir and rilpivirine used in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus (HCV)-coinfected patients with liver cirrhosis."	( Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis. Ariaudo, A; Bonora, S; Castagna, A; D'Avolio, A; Galli, L; Hasson, H; Lazzarin, A; Marinaro, L; Merli, M; Messina, E; Uberti-Foppa, C, 2017)	1.02
"Dolutegravir plasma trough concentrations were measured in 78 HIV-infected patients given the drug in combination with a protease inhibitor, a non-nucleoside reverse transcriptase inhibitor or abacavir/lamivudine."	( Dolutegravir plasma concentrations according to companion antiretroviral drug: unwanted drug interaction or desirable boosting effect? Cattaneo, D; Clementi, E; Cozzi, V; Galli, M; Gervasoni, C; Meraviglia, P; Minisci, D; Riva, A, 2017)	3.34
"Antiretroviral agents pose a high risk for drug-drug interactions (DDIs), mainly but not limited to being a substrate, inducer or inhibitor of P450 cytochrome enzymes."	( Prevalence of drug-drug interactions in the era of HIV integrase inhibitors: a retrospective clinical study. Baecke, C; Decoutere, L; Gyssens, IC; Messiaen, P; van der Hilst, JCH, 2017)	0.46
"ART regimens pose a dissimilar risk for drug-drug interactions in clinical practice."	( Prevalence of drug-drug interactions in the era of HIV integrase inhibitors: a retrospective clinical study. Baecke, C; Decoutere, L; Gyssens, IC; Messiaen, P; van der Hilst, JCH, 2017)	0.46
" DTG in combination with one to two NRTIs was as efficient as PI/r in individuals with pre-existing NRTI mutations in this setting."	( Effect of dolutegravir in combination with Nucleoside Reverse Transcriptase Inhibitors (NRTIs) on people living with HIV who have pre-existing NRTI mutations. Carlander, C; Flamholc, L; Gisslén, M; Hejdeman, B; Sönnerborg, A; Sörstedt, E; Svedhem, V; Yilmaz, A, 2018)	0.88
" This study aimed to examine pharmacokinetic drug-drug interactions between this regimen and dolutegravir, a first-line antiretroviral medication."	( Cytokine-Mediated Systemic Adverse Drug Reactions in a Drug-Drug Interaction Study of Dolutegravir With Once-Weekly Isoniazid and Rifapentine. Alfaro, RM; Brooks, KM; De, P; Dobos, KM; George, JM; Hadigan, C; Kellogg, A; Kovacs, JA; Kumar, P; McLaughlin, M; McManus, M; Mehaffy, C; Pau, AK; Rupert, A, 2018)	0.92
"This was a single-center, open-label, fixed-sequence, drug-drug interaction study in healthy volunteers."	( Cytokine-Mediated Systemic Adverse Drug Reactions in a Drug-Drug Interaction Study of Dolutegravir With Once-Weekly Isoniazid and Rifapentine. Alfaro, RM; Brooks, KM; De, P; Dobos, KM; George, JM; Hadigan, C; Kellogg, A; Kovacs, JA; Kumar, P; McLaughlin, M; McManus, M; Mehaffy, C; Pau, AK; Rupert, A, 2018)	0.7
"We report the cases of two treatment-experienced HIV-infected patients with complex antiretroviral regimens that showed significant drug-drug interactions with etravirine."	( Optimizing concentrations of concomitant antiretrovirals by reducing etravirine doses: two case reports of complex drug-drug interactions. Cabot, JF; Denault, JS; Langlois, H; Marcotte, S; Sheehan, NL, 2019)	0.51
" We undertook two pharmacokinetic studies in healthy volunteers, using standard adult doses of artemether-lumefantrine or artesunate-amodiaquine given with 50 mg once daily dolutegravir (DTG) to investigate the drug-drug interaction between artemether-lumefantrine or artesunate-amodiaquine and dolutegravir."	( Drug Interactions between Dolutegravir and Artemether-Lumefantrine or Artesunate-Amodiaquine. Amara, A; Byakika-Kibwika, P; Chiong, J; Else, L; Gini, J; Kaboggoza, J; Khoo, SH; Lamorde, M; Tarning, J; Waitt, C; Walimbwa, SI; Winterberg, M, 2019)	1.01
"Elbasvir or grazoprevir co-administered with raltegravir or dolutegravir resulted in no clinically meaningful drug-drug interactions and was generally well tolerated."	( Assessment of drug interaction potential between the HCV direct-acting antiviral agents elbasvir/grazoprevir and the HIV integrase inhibitors raltegravir and dolutegravir. Butterton, JR; Caro, L; Fandozzi, C; Feng, HP; Fraser, I; Guo, Z; Huang, X; Iwamoto, M; Jumes, P; Ma, J; Mangin, E; Marshall, WL; Panebianco, D; Ross, LL; Talaty, J; Yeh, WW, 2019)	0.95
" Accordingly, it is important that physicians be aware and confident about the drug-drug interactions (DDIs) involving dolutegravir, lamivudine, and other medications."	( Drug-drug interactions of a two-drug regimen of dolutegravir and lamivudine for HIV treatment. Capetti, A; Cattaneo, D; Rizzardini, G, 2019)	0.98
" Simulations based on the final model served to compare expected dolutegravir concentrations under standard and alternative dosage regimens in the case of drug-drug interactions."	( Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. Aouri, M; Barcelo, C; Braun, DL; Buclin, T; Cavassini, M; Courlet, P; Csajka, C; Decosterd, LA; Guidi, M; Günthard, HF; Piso, RJ, 2019)	1.04
" Hence, potential drug-drug interactions (DDIs) may occur between these 2 drugs and antiretrovirals."	( Drug-Drug Interactions Between Antiretrovirals and Carbamazepine/Oxcarbazepine: A Real-Life Investigation. Atzori, C; Baldelli, S; Cattaneo, D; Cozzi, V; Filice, C; Fusi, M; Gervasoni, C; Micheli, V, 2020)	0.56
": The risk of drug-drug interactions (DDIs) is elevated in aging people living with HIV (PLWH) because of highly prevalent age-related comorbidities leading to more comedications."	( Aging does not impact drug--drug interaction magnitudes with antiretrovirals. Battegay, M; Cavassini, M; Courlet, P; Decosterd, L; Marzolini, C; Saldanha, SA; Stader, F; Stoeckle, M, 2020)	0.56
"The dolutegravir/valproic acid drug-drug interaction (DDI) is suggested to be caused by protein displacement."	( The dolutegravir/valproic acid drug-drug interaction is primarily based on protein displacement. Bax, H; Bollen, PDJ; Burger, DM; Colbers, A; de Mendonca Melo, M; de Vries-Sluijs, TEMS; Nouwen, J; Prins, HAB; Rijnders, BJA; Rokx, C; van Nood, E; Velthoven-Graafland, K; Verbon, A, 2021)	1.74
"Dolutegravir in combination with NRTIs was effective in treating patients with HIV-1 infection, including those with extensive NRTI resistance in whom no NRTIs were predicted to have activity."	( Dolutegravir or Darunavir in Combination with Zidovudine or Tenofovir to Treat HIV. Asienzo, J; Ategeka, G; Balyegisawa, A; Castelnuovo, B; Hakim, J; Hoppe, A; Kaimal, A; Kambugu, A; Kiragga, A; Kityo, C; Mirembe, G; Mugerwa, H; Musaazi, J; Paton, NI; Siika, A; Tukamushabe, P; Walimbwa, S, 2021)	3.51
"We assessed virological failure (VF) and resistance-associated mutations (RAMs) on dolutegravir maintenance regimens in combination with rilpivirine or with lamivudine or emtricitabine (xTC) and analysed the factors associated with VF."	( Dolutegravir-based dual maintenance regimens combined with lamivudine/emtricitabine or rilpivirine: risk of virological failure in a real-life setting. Allavena, C; Bani-Sadr, F; Cabie, A; Cuzin, L; Deschanvres, C; Duvivier, C; Hocqueloux, L; Joly, V; Lamaury, I; Palich, R; Raffi, F; Rey, D; Reynes, J; Robineau, O, 2021)	2.29
" Because islatravir may be coadministered with other antiretroviral agents, assessment of potential drug-drug interactions are warranted."	( Lack of a Clinically Meaningful Drug Interaction Between the HIV-1 Antiretroviral Agents Islatravir, Dolutegravir, and Tenofovir Disoproxil Fumarate. Armas, D; Fillgrove, KL; Fox-Bosetti, S; Friedman, E; Iwamoto, M; Matthews, RP; Rudd, DJ; Stoch, SA; Zhang, S, 2021)	0.84
" While previous international studies have shown low healthcare worker knowledge of drug-drug interactions, there is a paucity of information on antiretroviral interaction knowledge in the South African setting, where much ART is nurse-led."	( South African healthcare workers' knowledge of dolutegravir's drug-drug interactions in the first year of its rollout: a cross-sectional online survey. Blockman, M; Chisholm, BS; Swart, AM, 2022)	0.98
" Following a 2 × 2 factorial design and stratified by site and screening HIV-1 RNA concentration, participants were randomly assigned (1:1:1:1) to receive a 96-week regimen containing either dolutegravir (50 mg once daily) or ritonavir-boosted darunavir (800 mg of darunavir plus 100 mg of ritonavir once daily) in combination with either tenofovir (300 mg once daily) plus lamivudine (300 mg once daily) or zidovudine (300 mg twice daily) plus lamivudine (150 mg twice daily)."	( Efficacy and safety of dolutegravir or darunavir in combination with lamivudine plus either zidovudine or tenofovir for second-line treatment of HIV infection (NADIA): week 96 results from a prospective, multicentre, open-label, factorial, randomised, non Asienzo, J; Ategeka, G; Balyegisawa, A; Borok, M; Castelnuovo, B; Hoppe, A; Kaimal, A; Kambugu, A; Kiragga, A; Kityo, C; Lugemwa, A; Mirembe, G; Mugerwa, H; Musaazi, J; Odongpiny, ELA; Paton, NI; Siika, A; Walimbwa, S, 2022)	1.22
" To this end, the drug-drug interaction between efavirenz and the uridine 5'-diphospho-glucuronosyltransferase 1A1 substrates dolutegravir and raltegravir was first simulated in nonpregnant subjects."	( Mechanistic Modeling of the Drug-Drug Interaction Between Efavirenz and Dolutegravir: Is This Interaction Clinically Relevant When Switching From Efavirenz to Dolutegravir During Pregnancy? Ahmadzia, HK; Dallmann, A; Rakhmanina, N; van den Anker, J, 2023)	1.35
" Albuvirtide (ABT), a new peptide drug, is a long-acting HIV fusion inhibitor with limited drug-drug interactions and fast onset time."	( Tolerability and effectiveness of albuvirtide combined with dolutegravir for hospitalized people living with HIV/AIDS. Cheng, J; He, S; He, Y; Liu, H; Lu, C; Yang, T; Yao, Y; Yin, K; Zhou, R, 2023)	1.15

Excerpt	Reference	Relevance
" A pediatric formulation of raltegravir with less variable pharmacokinetics and greater bioavailability was US Food and Drug Administration (US FDA)-approved in December 2011."	( Pharmacology of HIV integrase inhibitors. Adams, JL; Greener, BN; Kashuba, AD, 2012)	0.38
" Dolutegravir was rapidly absorbed from oral solution with a high bioavailability in rat and monkey (75."	( The comparative disposition and metabolism of dolutegravir, a potent HIV-1 integrase inhibitor, in mice, rats, and monkeys. Bowers, GD; Kanaoka, E; Moss, L; Olson, K; Wagner, D; Yueh, YL, 2015)	1.59
" Primary endpoints were bioavailability of immediately consumed dispersible tablet in LMC water relative to granule formulation reconstituted in purified water and PK of the dispersible tablet."	( Relative Bioavailability of a Dolutegravir Dispersible Tablet and the Effects of Low- and High-Mineral-Content Water on the Tablet in Healthy Adults. Buchanan, AM; Choukour, M; Conn, I; Davies, M; Holton, M; Wynne, BR, 2017)	0.74
"A phase 1, open-label, randomized study was conducted in healthy adults to evaluate the relative bioavailability of a novel dispersible FDC tablet of abacavir 150 mg/dolutegravir 10 mg/lamivudine 75 mg administered under 4 different dosing conditions compared with dolutegravir plus abacavir/lamivudine nondispersible, film-coated tablets."	( Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Buchanan, AM; Casillas, L; Joshi, S; Shaik, JSB; Shreeves, T; Singh, RP; Skoura, N, 2018)	0.89
"Following administration of dispersible abacavir/dolutegravir/lamivudine, the relative bioavailability of dolutegravir was approximately 50% higher."	( Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Buchanan, AM; Casillas, L; Joshi, S; Shaik, JSB; Shreeves, T; Singh, RP; Skoura, N, 2018)	0.95
"Physiological changes during pregnancy can affect pharmacokinetics and reduce a mother's bioavailability of antiretroviral drugs, potentially altering their pharmacological activity."	( Low plasmatic concentration of intensified antiretroviral therapy in a pregnant woman: a case report. Be, G; Chiesi, S; Lanzafame, M; Lattuada, E; Piacentini, D; Rizzardo, S; Tacconelli, E, 2019)	0.51
"The ATP-binding cassette transporter P-glycoprotein (P-gp) is known to limit both brain penetration and oral bioavailability of many chemotherapy drugs."	( A High-Throughput Screen of a Library of Therapeutics Identifies Cytotoxic Substrates of P-glycoprotein. Ambudkar, SV; Brimacombe, KR; Chen, L; Gottesman, MM; Guha, R; Hall, MD; Klumpp-Thomas, C; Lee, OW; Lee, TD; Lusvarghi, S; Robey, RW; Shen, M; Tebase, BG, 2019)	0.51
" Further, in vivo oral bioavailability was investigated for the dispersion prepared by quench cooling by using crystalline Dolutegravir as a control."	( Investigation of drug-polymer miscibility, biorelevant dissolution, and bioavailability improvement of Dolutegravir-polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer solid dispersions. Chegireddy, M; Dengale, SJ; Hanegave, GK; Kumar, N; Lakshman, D; Lewis, SA; Sree, KN, 2020)	0.98
" The antiviral drugs Raltegravir, Indinavir, Tipranavir, Dolutegravir, and Etravirine also exhibited good bioavailability and drug-likeness properties."	( Raltegravir, Indinavir, Tipranavir, Dolutegravir, and Etravirine against main protease and RNA-dependent RNA polymerase of SARS-CoV-2: A molecular docking and drug repurposing approach. Al-Dhabi, NA; Arunagirinathan, N; Ignacimuthu, S; Indu, P; Rameshkumar, MR; Valan Arasu, M, 2020)	1.08
" This article outlines the chronology of dolutegravir pediatric formulation development as granules and conventional and dispersible tablets in a total of 5 pharmacokinetic studies evaluating the relative bioavailability of dolutegravir SE and FDC formulations in healthy adults."	( Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. Adkison, KK; Baker, M; Brothers, C; Buchanan, AM; Davies, M; Parasrampuria, R; Sewell, N; Singh, RP; Wolstenholme, A, 2022)	1.34
"The relative bioavailability studies were 2-part, Phase I, open-label, randomized studies in healthy adults."	( Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. Adkison, KK; Baker, M; Brothers, C; Buchanan, AM; Davies, M; Parasrampuria, R; Sewell, N; Singh, RP; Wolstenholme, A, 2022)	1.07
"As observed in previous studies, dolutegravir administered as dispersion (granules/dispersible tablets) showed relatively higher bioavailability compared with conventional tablets."	( Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. Adkison, KK; Baker, M; Brothers, C; Buchanan, AM; Davies, M; Parasrampuria, R; Sewell, N; Singh, RP; Wolstenholme, A, 2022)	1.36

Excerpt	Relevance	Reference
" PK was linear over the dosage range studied."	( Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers. Borland, J; Chen, S; Fujiwara, T; Lou, Y; Min, S; Piscitelli, SC; Song, I, 2010)	0.36
" Co-administration with ATV/RTV resulted in increased plasma S/GSK1349572 area under the concentration-time curve during a dosing interval (AUC(0,τ)), observed maximal concentration (C(max) ), and concentration at the end of dosing interval at steady state (C(τ) ) by 62%, 34% and 121%, respectively."	( Effect of atazanavir and atazanavir/ritonavir on the pharmacokinetics of the next-generation HIV integrase inhibitor, S/GSK1349572. Borland, J; Chen, S; Lou, Y; Min, S; Peppercorn, A; Piscitelli, SC; Song, I; Wajima, T, 2011)	0.37
" Concurrent antacid co-administration reduced S/GSK1349572 AUC by 74% and staggered antacid dosing significantly diminished this interaction, with a reduction in S/GSK1349572 AUC of 26%."	( Pharmacokinetics of the HIV integrase inhibitor S/GSK1349572 co-administered with acid-reducing agents and multivitamins in healthy volunteers. Borland, J; Chen, S; Lou, Y; Min, SS; Patel, A; Patel, P; Peppercorn, A; Piscitelli, SC; Song, I; Wajima, T, 2011)	0.37
" In addition, a well characterized dose-response relationship was observed for viral load decrease."	( Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. Chen, S; DeJesus, E; Fujiwara, T; Hawkins, T; Lalezari, J; McCurdy, L; Min, S; Piscitelli, S; Sloan, L; Song, I; Stroder, R; Underwood, M, 2011)	0.6
"Dolutegravir demonstrated potent antiviral activity, good short-term tolerability, low pharmacokinetic variability, and a predictable pharmacokinetics/pharmacodynamics relationship, which support once-daily dosing without a pharmacokinetic booster in integrase-naive patients in future studies."	( Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. Chen, S; DeJesus, E; Fujiwara, T; Hawkins, T; Lalezari, J; McCurdy, L; Min, S; Piscitelli, S; Sloan, L; Song, I; Stroder, R; Underwood, M, 2011)	2.05
" The use of SF and PK-PD disease models can be a valuable tool to predict dose-response of NMEs and support rational dose selection for monotherapy trials."	( From in vitro EC₅₀ to in vivo dose-response for antiretrovirals using an HIV disease model. Part I: a framework. Fang, J; Jadhav, PR, 2012)	0.38
" The development of resistance and the need for a once-daily dosing option has led to the development of new INSTIs, including elvitegravir and dolutegravir."	( Update on raltegravir and the development of new integrase strand transfer inhibitors. Bookstaver, PB; Rokas, KE; Shamroe, CL; Weissman, SB, 2012)	0.58
" Once daily dosing of raltegravir is virologically inferior to raltegravir taken twice daily."	( The use of HIV-1 integrase inhibitors in antiretroviral naive patients. Lennox, JL, 2012)	0.38
" These data better characterized integrase inhibitor pharmacokinetics, assessed dosing regimens, and investigated previously undescribed drug-drug interactions."	( Pharmacology of HIV integrase inhibitors. Adams, JL; Greener, BN; Kashuba, AD, 2012)	0.38
" Pharmacokinetic data in special populations (pregnancy, pediatrics) to optimize dosing are still required."	( Pharmacology of HIV integrase inhibitors. Adams, JL; Greener, BN; Kashuba, AD, 2012)	0.38
" Dolutegravir had a good, similar safety profile with each dosing regimen."	( Safety and efficacy of dolutegravir in treatment-experienced subjects with raltegravir-resistant HIV type 1 infection: 24-week results of the VIKING Study. Ait-Khaled, M; Clotet, B; Durant, J; Eron, JJ; Fujiwara, T; Huang, J; Katlama, C; Kumar, P; Lazzarin, A; Min, S; Poizot-Martin, I; Richmond, G; Soriano, V; Vavro, C; Yeo, J, 2013)	1.61
" However, it has the limitations of twice-daily dosing and a relatively modest genetic barrier to the development of resistance."	( Next-generation integrase inhibitors : where to after raltegravir? Karmon, SL; Markowitz, M, 2013)	0.39
" The changes in plasma exposures of DTG in healthy individuals as a result of prednisone dosing were not clinically significant."	( Effect of prednisone on the pharmacokinetics of the integrase inhibitor dolutegravir. Borland, J; Chen, S; Peppercorn, AF; Piscitelli, S; Savina, P; Song, IH, 2013)	0.62
" Structure-activity studies evolved a tricyclic series of carbamoyl pyridines that demonstrated properties indicative of once-daily dosing and superior potency against resistant viral strains."	( Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744). Akiyama, T; Foster, SA; Fuji, M; Fujiwara, T; Garvey, EP; Jeffrey, J; Johns, BA; Johnson, MN; Kawasuji, T; Kiyama, R; Kobayashi, M; Murai, H; Sato, A; Seki, T; Taishi, T; Tanimoto, N; Taoda, Y; Temelkoff, DP; Weatherhead, JG; Yoshida, H; Yoshinaga, T, 2013)	0.59
"A total of 8 healthy females given DTG 50 mg daily for 5-7 days had 11 paired BP and CVF samples collected over 24 h following the first dose (PK1) and multiple dosing (PK2)."	( Single and multiple dose pharmacokinetics of dolutegravir in the genital tract of HIV-negative women. Adams, JL; Dumond, JB; Greener, BN; Kashuba, AD; Patterson, KB; Prince, HM; Sykes, C, 2013)	0.65
" Accumulation of DTG with multiple dosing was observed in BP, SF, and RT."	( Dolutegravir pharmacokinetics in the genital tract and colorectum of HIV-negative men after single and multiple dosing. Adams, JL; Cohen, MS; Dellon, ES; Dumond, JB; Greener, BN; Kashuba, AD; Madanick, RD; Patterson, KB; Prince, HM; Shaheen, NJ; Sykes, CS, 2013)	1.83
" Once-daily dosing without requirement for a pharmacokinetic booster makes dolutegravir-based therapy an attractive treatment option for HIV-1-infected treatment-naive patients."	( Once-daily dolutegravir versus twice-daily raltegravir in antiretroviral-naive adults with HIV-1 infection (SPRING-2 study): 96 week results from a randomised, double-blind, non-inferiority trial. Albrecht, H; Almond, S; Baril, JG; Belonosova, E; Brennan, C; Domingo, P; Gatell, JM; Jaeger, H; Min, S; Quiros-Roldan, E; Raffi, F, 2013)	1.01
" However, raltegravir is dosed twice/day."	( Dolutegravir: a new integrase strand transfer inhibitor for the treatment of HIV. Desimone, JA; Schafer, JJ; Shah, BM, 2014)	1.85
" Once-a-day dolutegravir dosing also does not require a pharmacokinetic booster like elvitegravir which minimizes the drug-drug interaction potential of dolutegravir."	( Dolutegravir for the treatment of adult patients with HIV-1 infection. Abraham, T; Saad, N; Wu, G, 2014)	2.22
" This drug also exhibited efficacy in antiretroviral therapy-experienced participants and has proven to retain activity when dosed twice daily in some participants harboring resistance to the other INSTIs, raltegravir and elvitegravir."	( Dolutegravir: a next-generation integrase inhibitor for treatment of HIV infection. Goldman, M; Osterholzer, DA, 2014)	1.85
" Coadministration of dolutegravir with boceprevir had no effect on dolutegravir area under the plasma concentration-time curve (AUC) and maximal plasma concentration (Cmax ) and caused a small increase in concentration at the end of the dosing interval (Cτ ; 8%)."	( Effects of boceprevir and telaprevir on the pharmacokinetics of dolutegravir. Borland, J; Chen, S; Johnson, M; Piscitelli, S; Savina, P; Wynne, B, 2014)	0.96
" Fosamprenavir-ritonavir decreased the DTG area under the concentration-time curve, maximum concentration in plasma, and concentration in plasma at the end of the dosing interval by 35%, 24%, and 49%, respectively."	( Effect of fosamprenavir-ritonavir on the pharmacokinetics of dolutegravir in healthy subjects. Borland, J; Chen, S; Peppercorn, A; Piscitelli, SC; Song, I; Wajima, T, 2014)	0.64
" New treatment options show high efficacy and safety and include single-tablet coformulations for once-daily dosing to improve convenience."	( HIV: new drugs, new guidelines. Geretti, AM; Tsakiroglou, M, 2014)	0.4
" The pharmacokinetic properties of dolutegravir allow once-daily dosing (50 mg), with or without food, maintaining concentrations far above those effective against wild-type viruses."	( [Mechanisms of action, pharmacology and interactions of dolutegravir]. Podzamczer, D; Ribera, E, 2015)	0.94
" Dolutegravir geometric mean of the area under the plasma concentration-time curve from time of administration to 24 hours after dosing (AUC0-24) and 24 hour postdose concentration (C24) were 46."	( Safety, Pharmacokinetics and Efficacy of Dolutegravir in Treatment-experienced HIV-1 Infected Adolescents: Forty-eight-week Results from IMPAACT P1093. Acosta, EP; Alvero, C; Fenton, T; Hazra, R; Min, S; Steimers, D; Townley, E; Viani, RM; Wiznia, A, 2015)	1.59
"05) in the area under the plasma concentration-time curve for dolutegravir from the time the dose was administered until the end of the dosing interval (-19%, P = 0."	( Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. Allavena, C; Billaud, E; Bouchez, S; Bouquié, R; Dailly, E; Deslandes, G; Grégoire, M; Hall, N; Hernando, H; Jolliet, P; Raffi, F; Reliquet, V, 2015)	0.89
" According to therapeutic drug monitoring for dolutegravir, some patients may need a higher dose than 50 mg of dolutegravir once daily to maintain the therapeutic plasma concentration throughout the dosing interval."	( Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. Allavena, C; Billaud, E; Bouchez, S; Bouquié, R; Dailly, E; Deslandes, G; Grégoire, M; Hall, N; Hernando, H; Jolliet, P; Raffi, F; Reliquet, V, 2015)	0.91
" Integrase strand transfer inhibitors cause a rapid drop in viral load, exhibit very low drug interactions (except elvitegravir/cobicistat), and have low pill burden and convenient dosing frequency."	( Efficacy and Tolerability of Integrase Inhibitors in Antiretroviral-Naive Patients. Abrescia, N; Busto, A; D'Abbraccio, M; De Marco, M; Figoni, M; Maddaloni, A, )	0.13
" And while the drug elvitegravir has been inserted into a four-drug combination pill providing a once-daily dosing alternative, dolutegravir has demonstrated superiority in terms of its efficacy and resistance."	( The preclinical discovery and development of dolutegravir for the treatment of HIV. Bailly, F; Cotelle, P, 2015)	0.88
" For dolutegravir, plasma terminal elimination t1/2 to the last measurable concentration (within 216 h) was longer than its t1/2 within the dosing interval (0-24 h): 14."	( Dolutegravir and elvitegravir plasma concentrations following cessation of drug intake. Amara, A; Back, D; Boffito, M; Elliot, E; Else, L; Jackson, A; Khoo, S; Moyle, G; Owen, A, 2016)	2.39
" Our results show minimal dolutegravir removal by hemodialysis, with no specific dolutegravir dosage adjustments required in this setting."	( Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease. Amara, A; Bancu, I; Bonjoch, A; Clotet, B; Graterol, F; Khoo, S; Miranda, C; Moltó, J, 2016)	1.12
"31) for area under the curve from time zero to the end of the dosing interval (AUC(0-τ)), maximum observed plasma concentration (Cmax), and plasma concentration at the end of the dosing interval (Cτ), respectively."	( Effect of carbamazepine on dolutegravir pharmacokinetics and dosing recommendation. Borland, J; Choukour, M; Jerva, F; Patel, J; Piscitelli, S; Song, I; Weller, S; Wynne, B, 2016)	0.73
" Dolutegravir is the first member of the class of second generation integrase strand transfer inhibitors aimed primarily to address the current unmet need for novel unboosted integrase inhibitors with convenient once-daily dosing and a superior resistance profile."	( The Promise of Dolutegravir: A Novel Second Generation Integrase Strand Transfer Inhibitor. Kakkar, AK; Kaur, M; Kumar, H; Singh, H, 2016)	1.7
"The first-generation integrase inhibitors (INIs) raltegravir (RAL) and elvitegravir (EVG) have shown efficacy against HIV infection, but they have the limitations of once-more daily dosing and extensive cross-resistance."	( Dolutegravir(DTG, S/GSK1349572) combined with other ARTs is superior to RAL- or EFV-based regimens for treatment of HIV-1 infection: a meta-analysis of randomized controlled trials. Chen, H; Guo, W; Huang, J; Jiang, J; Liang, B; Liang, H; Liao, Y; Su, J; Xu, X; Ye, L; Zang, N, 2016)	1.88
"Oral formulations of doravirine and dolutegravir were dosed both individually and concomitantly once daily in healthy adults."	( A Two-Way Steady-State Pharmacokinetic Interaction Study of Doravirine (MK-1439) and Dolutegravir. Anderson, MS; Butterton, JR; Fan, L; Hussaini, A; Khalilieh, S; Liu, R; Rizk, ML; Ross, LL; Shah, V; Song, I; Yee, KL, 2017)	0.95
" We show that the dose-response curve slope, which indicates cooperativity and is a major determinant of antiviral activity, is higher for DTG than for first-generation InSTIs."	( Quantitative evaluation of the antiretroviral efficacy of dolutegravir. Laskey, SB; Siliciano, RF, 2016)	0.68
" This boosting effect of atazanavir could be used to optimize dolutegravir dosing in particular clinical settings."	( Dolutegravir plasma concentrations according to companion antiretroviral drug: unwanted drug interaction or desirable boosting effect? Cattaneo, D; Clementi, E; Cozzi, V; Galli, M; Gervasoni, C; Meraviglia, P; Minisci, D; Riva, A, 2017)	2.14
"Simplified dosing regimens are important for patients who face challenges in adhering to HIV-1 therapy."	( Dolutegravir/abacavir/lamivudine versus current ART in virally suppressed patients (STRIIVING): a 48-week, randomized, non-inferiority, open-label, Phase IIIb study. Aboud, M; Brennan, C; Brinson, C; Granier, C; Hopking, J; Koteff, JA; Lake, JE; Logue, K; Santiago, L; Trottier, B; Wynne, B, 2017)	1.9
" However, adequacy of drug exposures after these administration routes are largely unknown, making dosing recommendations and the attainment of viral suppression challenging in this patient population."	( Decreased Absorption of Dolutegravir and Tenofovir Disoproxil Fumarate, But Not Emtricitabine, in an HIV-Infected Patient Following Oral and Jejunostomy-Tube Administration. Anderson, M; Bailey, B; Balba, G; Brooks, KM; Garrett, KL; George, JM; Kuriakose, SS; Lane, HC; Maldarelli, F; Pau, AK, 2017)	0.76
" Twenty-four hour intensive PK sampling was performed on day 7 of each sequence following observed dosing and a standardized meal."	( Small increase in dolutegravir trough, but equivalent total dolutegravir exposure with simeprevir in HIV/HCV seronegative volunteers. Burton, JR; Bushman, LR; Castillo-Mancilla, J; Fey, J; Huntley, RT; Kiser, JJ; Larson, B; MacBrayne, CE; MaWhinney, S; Micke, K; Wagner, CB, 2018)	0.81
" Here we describe an oral dosage form composed of distinct drug-polymer matrices which achieved week-long systemic drug levels of the antiretrovirals dolutegravir, rilpivirine and cabotegravir in a pig."	( Development of an oral once-weekly drug delivery system for HIV antiretroviral therapy. Abouzid, O; Bellinger, AM; Bensel, T; Bershteyn, A; Booth, L; Cleveland, C; Craig, M; Eckhoff, PA; Grant, T; Hayward, A; Hill, AL; Javid, F; Kirtane, AR; Langer, R; Lee, YL; Mazdiyasni, H; Minahan, D; Mo, SS; Nikolic, B; Nowak, MA; Rogner, J; Selinger, C; Traverso, G; Wood, L; Wu, SJ, 2018)	0.68
" Serum DTG concentrations were supratherapeutic which has required a dosing interval adjustment."	( Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring. Brunel, F; Gagnieu, MC; Miailhes, P; Parant, F, 2018)	1.92
"Co-administration of dolutegravir and oxcarbazepine has been reported to reduce levels of dolutegravir and therefore is contraindicated due to insufficient data to make dosing recommendations."	( Sustained viral suppression with co-administration of oxcarbazepine and dolutegravir. Badowski, ME; Kandil, MM; Schriever, CA, 2018)	1.03
"In this report, we describe a human immunodeficiency virus (HIV)-infected patient in whom changes in phenobarbital (PB) dosage resulted in associated changes in plasma concentrations of dolutegravir (DTG)."	( A potential drug interaction between phenobarbital and dolutegravir: A case report. Hideta, K; Higasa, S; Hikasa, S; Kimura, T; Sawada, A; Seino, H; Shimabukuro, S; Tokugawa, T; Uwa, N, 2018)	0.92
"Regimen switching in virally suppressed HIV-1-infected patients may be considered to reduce pill burden or dosing frequency, decrease short- or long-term toxicity, prevent or manage drug-drug interactions, and/or decrease cost."	( Dolutegravir Dual Therapy as Maintenance Treatment in HIV-Infected Patients: A Review. Boswell, R; Foisy, MM; Hughes, CA, 2018)	1.92
" Once daily PrEP with 50mg oral DTG prevented 99-100% infections, and 85% of infections when 50% of dosing events were missed."	( Hybrid stochastic framework predicts efficacy of prophylaxis against HIV: An example with different dolutegravir prophylaxis schemes. Dickinson, L; Duwal, S; Khoo, S; von Kleist, M, 2018)	0.7
" Alternative formulations with acceptable palatability and convenient dosing are needed for children who require smaller doses and have difficulty swallowing tablets."	( Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Buchanan, AM; Casillas, L; Joshi, S; Shaik, JSB; Shreeves, T; Singh, RP; Skoura, N, 2018)	0.69
"A phase 1, open-label, randomized study was conducted in healthy adults to evaluate the relative bioavailability of a novel dispersible FDC tablet of abacavir 150 mg/dolutegravir 10 mg/lamivudine 75 mg administered under 4 different dosing conditions compared with dolutegravir plus abacavir/lamivudine nondispersible, film-coated tablets."	( Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Buchanan, AM; Casillas, L; Joshi, S; Shaik, JSB; Shreeves, T; Singh, RP; Skoura, N, 2018)	0.89
" Neither the mineral content of the water nor dosing times affected the pharmacokinetics of individual components."	( Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Buchanan, AM; Casillas, L; Joshi, S; Shaik, JSB; Shreeves, T; Singh, RP; Skoura, N, 2018)	0.69
" Simulations based on the final model served to compare expected dolutegravir concentrations under standard and alternative dosage regimens in the case of drug-drug interactions."	( Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. Aouri, M; Barcelo, C; Braun, DL; Buclin, T; Cavassini, M; Courlet, P; Csajka, C; Decosterd, LA; Guidi, M; Günthard, HF; Piso, RJ, 2019)	1.04
" Simulations suggest that average dolutegravir trough concentrations are 63% lower after 50 mg/12h with rifampicin compared with a standard dosage of 50 mg/24h without rifampicin."	( Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. Aouri, M; Barcelo, C; Braun, DL; Buclin, T; Cavassini, M; Courlet, P; Csajka, C; Decosterd, LA; Guidi, M; Günthard, HF; Piso, RJ, 2019)	1.08
"Patients co-treated with dolutegravir and rifampicin might benefit from therapeutic drug monitoring and individualized dosage increase, up to 100 mg/12 h in some cases."	( Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. Aouri, M; Barcelo, C; Braun, DL; Buclin, T; Cavassini, M; Courlet, P; Csajka, C; Decosterd, LA; Guidi, M; Günthard, HF; Piso, RJ, 2019)	1.1
" Of those who received DTG-based regimen; 44% received once-daily dosing and 53% twice-daily dosing."	( Clinical and Virological Outcomes of TB/HIV Coinfected Patients Treated With Dolutegravir-Based HIV Antiretroviral Regimens: Programmatic Experience From Botswana. Dima, M; Kgwaadira, B; Matsiri, O; Modongo, C; Rankgoane-Pono, G; Shin, SS; Wang, Q; Zetola, NM, 2019)	0.74
" With the assistance of therapeutic drug monitoring, dolutegravir dosing was increased to 150 mg daily."	( Successful use of once-daily high-dose darunavir and dolutegravir in multidrug-resistant HIV. Fulco, PP; Gomes, D; Leibrand Kaczmar, CR; Smith, T, 2020)	1.06
"To model the pharmacokinetics of dolutegravir in neonates and to simulate a theoretical optimal dosing regimen."	( Prediction of dolutegravir pharmacokinetics and dose optimization in neonates via physiologically based pharmacokinetic (PBPK) modelling. Bunglawala, F; Mirochnick, M; Owen, A; Rajoli, RKR; Siccardi, M, 2020)	1.2
" However, drug dosing is challenging as pharmacokinetics (PK) may be altered during pregnancy."	( Assessment of Maternal and Fetal Dolutegravir Exposure by Integrating Ex Vivo Placental Perfusion Data and Physiologically-Based Pharmacokinetic Modeling. Abduljalil, K; Burger, DM; Colbers, AP; Freriksen, JJM; Greupink, R; Russel, FGM; Schalkwijk, S, 2020)	0.84
" Treatment of resistant tuberculosis (TB) was streamlined with the World Health Organization (WHO) recommendations, and new tables on immune reconstitution inflammatory syndrome, on when to start ART in the presence of opportunistic infections and on TB drug dosing were included."	( 2019 update of the European AIDS Clinical Society Guidelines for treatment of people living with HIV version 10.0. Arribas, JR; Battegay, M; Béguelin, C; Bhagani, S; Cinque, P; Collins, S; Cotter, A; De Miguel, R; Guaraldi, G; Kirk, O; Kowalska, JD; Mallon, P; Marzolini, C; Molina, JM; Podlekareva, D; Rauch, A; Ryom, L; Winston, A, 2020)	0.56
" The non-monotonic dose-response relationship between DTG and fetal anomalies could explain the previous lack of fetal toxicity findings from pre-clinical DTG studies."	( Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels. Cahill, LS; Copp, AJ; Delgado-Olguín, P; Greene, NDE; Laurette, EY; Lenis, MG; Leung, KY; Mohan, H; Sanghvi, T; Serghides, L; Sled, JG; Tejada, O, 2021)	2.06
" The ODYSSEY trial includes nested pharmacokinetic (PK) sub-studies which evaluated pragmatic World Health Organization (WHO) weight-band-based DTG dosing and opened recruitment to children < 14 kg while dosing was in development."	( ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg Amuge, P; Archary, M; Atwine, L; Barlow-Mosha, LN; Behuhuma, O; Burger, DM; Compagnucci, A; Cotton, MF; Cressey, TR; Ford, D; Giaquinto, C; Gibb, DM; Hakim, J; Kekitiinwa, A; Kityo, CM; Lugemwa, A; Moore, CL; Mujuru, H; Musiime, V; Puthanakit, T; Rojo, P; Saϊdi, Y; Shakeshaft, C; Turkova, A; Variava, E; Violari, A, 2021)	0.84
" Challenges encountered include: (i) running the trial across high- to low-income countries with differing frequencies of standard-of-care viral load monitoring; (ii) evaluating pragmatic DTG dosing in PK sub-studies alongside FDA- and EMA-approved dosing and subsequently transitioning participants to new recommended doses; (iii) delays in dosing information for children weighing 3 to < 14 kg and rapid recruitment of ART-naïve older/heavier children, which led to capping recruitment of participants weighing ≥35 kg in ODYSSEY A and extending recruitment (above 700) to allow for ≥60 additional children weighing between 3 to < 14 kg with associated PK; (iv) a safety alert associated with DTG use during pregnancy, which required a review of the safety plan for adolescent girls."	( ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg Amuge, P; Archary, M; Atwine, L; Barlow-Mosha, LN; Behuhuma, O; Burger, DM; Compagnucci, A; Cotton, MF; Cressey, TR; Ford, D; Giaquinto, C; Gibb, DM; Hakim, J; Kekitiinwa, A; Kityo, CM; Lugemwa, A; Moore, CL; Mujuru, H; Musiime, V; Puthanakit, T; Rojo, P; Saϊdi, Y; Shakeshaft, C; Turkova, A; Variava, E; Violari, A, 2021)	0.84
"By employing a basket design, to include ART-naïve and -experienced children, and nested PK sub-studies, the ODYSSEY trial efficiently evaluates multiple scientific questions regarding dosing and effectiveness of DTG-based ART in children."	( ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg Amuge, P; Archary, M; Atwine, L; Barlow-Mosha, LN; Behuhuma, O; Burger, DM; Compagnucci, A; Cotton, MF; Cressey, TR; Ford, D; Giaquinto, C; Gibb, DM; Hakim, J; Kekitiinwa, A; Kityo, CM; Lugemwa, A; Moore, CL; Mujuru, H; Musiime, V; Puthanakit, T; Rojo, P; Saϊdi, Y; Shakeshaft, C; Turkova, A; Variava, E; Violari, A, 2021)	0.84
" Tuberculosis is a common coinfection in Mexico that requires rifampin-based anti-tuberculosis therapy, which requires increasing DTG to double dosing (50 mg BID)."	( Dolutegravir in Mexico for special populations: A cost analysis perspective. Cristhian, R; Cristina, H; Del Angel, J; Isidoro, P; Marco, B; Reyes, A; Sigfrido, R, 2021)	2.06
" partial least square (PLS) and genetic algorithm (GA) were utilized for the simultaneous determination of the vital ternary antiretroviral therapy dolutegravir (DTG), lamivudine (LMV), and abacavir (ACV) in their combined dosage form."	( Analysis of the ternary antiretroviral therapy dolutegravir, lamivudine and abacavir using UV spectrophotometry and chemometric tools. Abdelzaher, AM; Elmaaty, AA; Hasan, MA; Serag, A; Tolba, EH, 2022)	1.18
"Population pharmacokinetic modeling and simulation were used to assess newborn DTG dosing requirements during the first few days of life as a function of maternal DTG dosing history before delivery."	( Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Acosta, E; Best, BM; Capparelli, EV; Clarke, DF; Mirochnick, M; Momper, JD; Nikanjam, M; Piscitelli, J, 2022)	1.11
"Newborn DTG dosing requirements during the first few days of life depend on maternal DTG dosing history before delivery."	( Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Acosta, E; Best, BM; Capparelli, EV; Clarke, DF; Mirochnick, M; Momper, JD; Nikanjam, M; Piscitelli, J, 2022)	1.11
" There is an urgent need for optimal pediatric formulations of dolutegravir as single-entity (SE) and fixed-dose combination (FDC) to ensure correct dosing and adherence for swallowing and palatability."	( Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. Adkison, KK; Baker, M; Brothers, C; Buchanan, AM; Davies, M; Parasrampuria, R; Sewell, N; Singh, RP; Wolstenholme, A, 2022)	1.31
"These studies demonstrate the successful development of pediatric dolutegravir-containing formulations as SE and FDC that permit pediatric dosing in line with WHO recommendations."	( Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. Adkison, KK; Baker, M; Brothers, C; Buchanan, AM; Davies, M; Parasrampuria, R; Sewell, N; Singh, RP; Wolstenholme, A, 2022)	1.31
"A simple, selective and rapid ultra performance liquid chromatography-tandem mass spectrometry method was developed and validated for the simultaneous estimation of dolutegravir, lamivudine and tenofovir in bulk and tablet dosage form."	( Development and validation of ultra performance liquid chromatography-tandem mass spectrometry method for the simultaneous estimation of dolutegravir, lamivudine and tenofovir in bulk and tablet dosage form. Dodda, S; Gangarapu, K; Veerareddy, V, 2021)	1.02
"This study is concerned with assessing the bulk and tablet dosage forms of Dolutegravir (DTG) by means of a novel yet simple environmentally friendly spectrofluorimetric method that features fast response and high sensitivity compared to the time consuming HPLC methods and the lower sensitivity spectrophotometric ones."	( An eco- friendly, selective, and sensitive spectrofluorimetric method for the quantification of Dolutegravir in its bulk and tablet dosage form. Abbas, M; Alossaimi, MA; Altharawi, A; El Gamal, RM, 2022)	1.17
" Knowledge of specific interactions and the dosing changes needed was low with a wide range between different drugs: 79."	( South African healthcare workers' knowledge of dolutegravir's drug-drug interactions in the first year of its rollout: a cross-sectional online survey. Blockman, M; Chisholm, BS; Swart, AM, 2022)	0.98
"There are gaps in the awareness and knowledge of dolutegravir interactions and how to adjust dosing among South African healthcare workers."	( South African healthcare workers' knowledge of dolutegravir's drug-drug interactions in the first year of its rollout: a cross-sectional online survey. Blockman, M; Chisholm, BS; Swart, AM, 2022)	1.23
" We aimed to select dosing for a dispersible tablet formulation of dolutegravir that achieved pharmacokinetic exposures similar to those in adults, and was safe and well tolerated in young children."	( Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. Acosta, EP; Anthony, P; Archary, M; Bartlett, M; Brothers, C; Buchanan, AM; Chokephaibulkit, K; Dayton, D; Deville, JG; Dobbels, EFM; George, K; Gray, KP; Hazra, R; Koech, L; Liu, JP; Mmbaga, BT; Montañez, N; Ounchanum, P; Pinto, JA; Popson, S; Ruel, TD; Singh, R; Townley, E; Vavro, C; Vhembo, T; Wiznia, A, 2022)	1.19
"In this study, the proposed once daily dosing of dolutegravir dispersible tablets provided drug exposures similar to those for adults, and was safe and well tolerated."	( Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. Acosta, EP; Anthony, P; Archary, M; Bartlett, M; Brothers, C; Buchanan, AM; Chokephaibulkit, K; Dayton, D; Deville, JG; Dobbels, EFM; George, K; Gray, KP; Hazra, R; Koech, L; Liu, JP; Mmbaga, BT; Montañez, N; Ounchanum, P; Pinto, JA; Popson, S; Ruel, TD; Singh, R; Townley, E; Vavro, C; Vhembo, T; Wiznia, A, 2022)	1.21
"In the survey, 86 of 90 (96%) HIV clinics in 18 countries reported prescribing dolutegravir to patients who were receiving rifampicin as part of tuberculosis treatment, with 77 (90%) reporting that they use twice-daily dosing of dolutegravir, of which 74 (96%) reported having 50 mg tablets available to accommodate twice-daily dosing."	( Real-world use and outcomes of dolutegravir-containing antiretroviral therapy in HIV and tuberculosis co-infection: a site survey and cohort study in sub-Saharan Africa. Brazier, E; Chimbetete, C; De Waal, R; Diero, L; Dzudie, A; Ezechi, OC; Fenner, L; Kunzekwenyika, C; Lelo, P; Mahambou-Nsondé, D; Muhairwe, JA; Murenzi, G; Muyindike, WR; Nash, D; Rafael, I; Romo, ML; Sekaggya-Wiltshire, C; Shah, NS; Tiendrebeogo, T; Twizere, C; Wools-Kaloustian, KK; Yotebieng, M, 2022)	1.23
" Dispersible 5 mg dolutegravir was dosed according to WHO weight bands."	( Once-daily dolutegravir-based antiretroviral therapy in infants and children living with HIV from age 4 weeks: results from the below 14 kg cohort in the randomised ODYSSEY trial. Ali, S; Amuge, P; Ankunda, R; Archary, M; Atwine, L; Bbuye, D; Ford, D; Giaquinto, C; Gibb, DM; Kaudha, E; Kekitiinwa, AR; Kityo, CM; Liberty, A; Lugemwa, A; Maseko, L; Mngqibisa, R; Mosala, M; Mujuru, HA; Mumbiro, V; Nanduudu, A; Nathoo, KJ; Rojo, P; Shakeshaft, C; Turkova, A; Turner, RM; Variava, E; Violari, A; White, E; Wynne, B, 2022)	1.45
"Dolutegravir concentrations are reduced by efavirenz induction effect necessitating twice-daily dolutegravir dosing when coadministered."	( Initial Supplementary Dose of Dolutegravir in Second-Line Antiretroviral Therapy: A Noncomparative, Double-Blind, Randomized Placebo-Controlled Trial. Griesel, R; Hill, A; Keene, C; Maartens, G; Meintjes, G; Omar, Z; Simmons, B; van Zyl, G; Zhao, Y, 2023)	2.64
" The geometric mean (GM) area under the concentration-time curve over the dosing interval (AUC0-24h) was 57."	( Pharmacokinetic Data of Dolutegravir in Second-line Treatment of Children With Human Immunodeficiency Virus: Results From the CHAPAS4 Trial. Bevers, LAH; Burger, DM; Bwakura-Dangarembizi, M; Chabala, C; Colbers, A; Gibb, DM; Makumbi, S; Mulenga, V; Mumbiro, V; Musiime, V; Nangiya, J; Szubert, AJ; Waalewijn, H, 2023)	1.22
" Daily emtricitabine/TAF was dosed according to World Health Organization (WHO)-recommended weight bands: 120/15 mg in children weighing 14 to <25 kg and 200/25 mg in those weighing ≥25 kg."	( First Pharmacokinetic Data of Tenofovir Alafenamide Fumarate and Tenofovir With Dolutegravir or Boosted Protease Inhibitors in African Children: A Substudy of the CHAPAS-4 Trial. Bamford, A; Burger, DM; Bwakura-Dangarembizi, M; Chabala, C; Colbers, A; Denti, P; Doerholt, K; Gibb, DM; Griffiths, AL; Makumbi, S; McIlleron, HM; Monkiewicz, LN; Mulenga, V; Mumbiro, V; Musiime, V; Nangiya, J; Szubert, AJ; Waalewijn, H; Wasmann, RE; Wiesner, L, 2023)	1.14
"In children, TAF combined with boosted PIs or dolutegravir and dosed according to WHO-recommended weight bands provides TAF and tenofovir concentrations previously demonstrated to be well tolerated and effective in adults."	( First Pharmacokinetic Data of Tenofovir Alafenamide Fumarate and Tenofovir With Dolutegravir or Boosted Protease Inhibitors in African Children: A Substudy of the CHAPAS-4 Trial. Bamford, A; Burger, DM; Bwakura-Dangarembizi, M; Chabala, C; Colbers, A; Denti, P; Doerholt, K; Gibb, DM; Griffiths, AL; Makumbi, S; McIlleron, HM; Monkiewicz, LN; Mulenga, V; Mumbiro, V; Musiime, V; Nangiya, J; Szubert, AJ; Waalewijn, H; Wasmann, RE; Wiesner, L, 2023)	1.4
" To support pediatric dosing of dolutegravir in children, we used a population pharmacokinetic model with dolutegravir data from the P1093 and ODYSSEY clinical trials."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.46
"The dolutegravir dosing in children ≥ 4 weeks of age on an age/weight-band basis provides comparable exposures to those historically observed in adults."	( Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Acosta, EP; Alvero, C; Baker, M; Bollen, P; Buchanan, A; Burger, D; Bwakura-Dangarembizi, M; Chandasana, H; Colbers, A; Fairlie, L; Farhad, M; Ford, D; Gibb, DM; Hayes, S; Hazra, R; Mujuru, H; Ruel, T; Singh, R; Thapar, M; Townley, E; Turkova, A; Waalewijn, H; Wiznia, A, 2023)	1.74
"To develop an injectable dosage form of the daily oral HIV drugs, tenofovir (T), lamivudine (L), and dolutegravir (D), creating a single, complete, all-in-one TLD 3-drug-combination that demonstrates long-acting pharmacokinetics."	( A novel formulation enabled transformation of 3-HIV drugs tenofovir-lamivudine-dolutegravir from short-acting to long-acting all-in-one injectable. Collier, AC; Delle Fratte, R; Eguchi, M; Ho, RJY; Melvin, AJ; Perazzolo, S; Stephen, ZR; Xu, X, 2023)	1.35
" We provide suggested dolutegravir dosing considerations with concomitant rifapentine use, not currently addressed in recommended guidelines."	( Alternative dolutegravir dosing strategies with concurrent rifapentine utilized for latent tuberculosis treatment. Pecora Fulco, P; Taylor, A; Winthrop, E, 2023)	1.6

Role	Description
HIV-1 integrase inhibitor	An inhibitor of HIV-1 integrase, an enzyme required for the integration of the genetic material of the retrovirus into the DNA of the infected cells.
[role information is derived from Chemical Entities of Biological Interest (ChEBI), Hastings J, Owen G, Dekker A, Ennis M, Kale N, Muthukrishnan V, Turner S, Swainston N, Mendes P, Steinbeck C. (2016). ChEBI in 2016: Improved services and an expanding collection of metabolites. Nucleic Acids Res]

Class	Description
monocarboxylic acid amide	A carboxamide derived from a monocarboxylic acid.
organic heterotricyclic compound	An organic tricyclic compound in which at least one of the rings of the tricyclic skeleton contains one or more heteroatoms.
secondary carboxamide	A carboxamide resulting from the formal condensation of a carboxylic acid with a primary amine; formula RC(=O)NHR(1).
difluorobenzene	Any member of the class of fluorobenzenes containing a mono- or poly-substituted benzene ring carrying two fluorine atoms.
[compound class information is derived from Chemical Entities of Biological Interest (ChEBI), Hastings J, Owen G, Dekker A, Ennis M, Kale N, Muthukrishnan V, Turner S, Swainston N, Mendes P, Steinbeck C. (2016). ChEBI in 2016: Improved services and an expanding collection of metabolites. Nucleic Acids Res]

Protein	Taxonomy	Measurement	Average (µ)	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Fumarate hydratase	Homo sapiens (human)	Potency	37.2212	0.0030	8.7949	48.0869	AID1347053
EWS/FLI fusion protein	Homo sapiens (human)	Potency	19.0694	0.0013	10.1577	42.8575	AID1259252; AID1259253; AID1259255; AID1259256
polyprotein	Zika virus	Potency	37.2212	0.0030	8.7949	48.0869	AID1347053
Spike glycoprotein	Severe acute respiratory syndrome-related coronavirus	Potency	0.0096	0.0096	10.5250	35.4813	AID1479148
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Chain A, PFV integrase	Human spumaretrovirus	IC50 (µMol)	0.0517	0.0270	0.0517	0.0880	AID977608
Chain A, PFV integrase	Human spumaretrovirus	IC50 (µMol)	0.0517	0.0270	0.0517	0.0880	AID977608
Chain A, PFV integrase	Human spumaretrovirus	IC50 (µMol)	0.0517	0.0270	0.0517	0.0880	AID977608
Solute carrier family 22 member 2	Homo sapiens (human)	IC50 (µMol)	1.9000	0.4000	3.1000	9.7000	AID1211974
Cytochrome P450 1A2	Homo sapiens (human)	IC50 (µMol)	90.0000	0.0001	1.7740	10.0000	AID1212007
ATP-dependent translocase ABCB1	Homo sapiens (human)	IC50 (µMol)	95.0000	0.0002	2.3185	10.0000	AID1211968; AID1212007
Cytochrome P450 3A4	Homo sapiens (human)	IC50 (µMol)	67.0000	0.0001	1.7536	10.0000	AID1212009
Cytochrome P450 2C8	Homo sapiens (human)	IC50 (µMol)	90.0000	0.0008	1.8848	7.9000	AID1212007
Cytochrome P450 2D6	Homo sapiens (human)	IC50 (µMol)	90.0000	0.0000	2.0151	10.0000	AID1212007; AID1212008
Cytochrome P450 2A6	Homo sapiens (human)	IC50 (µMol)	100.0000	0.0044	3.8895	10.0000	AID1211999
Cytochrome P450 2C9	Homo sapiens (human)	IC50 (µMol)	90.0000	0.0000	2.8005	10.0000	AID1212008
UDP-glucuronosyltransferase 1A1	Homo sapiens (human)	IC50 (µMol)	100.0000	0.3000	3.2580	7.3000	AID1211999
Cytochrome P450 2C19	Homo sapiens (human)	IC50 (µMol)	67.0000	0.0000	2.3983	10.0000	AID1212009
Sigma intracellular receptor 2	Homo sapiens (human)	Ki	0.0180	0.0001	0.8360	4.6005	AID1655661
Sigma intracellular receptor 2	Rattus norvegicus (Norway rat)	Ki	0.0237	0.0024	1.1050	9.3000	AID1824523; AID1877931
Sigma non-opioid intracellular receptor 1	Cavia porcellus (domestic guinea pig)	Ki	0.0975	0.0000	0.3385	10.0000	AID1191388; AID1877932
Vesicular acetylcholine transporter	Rattus norvegicus (Norway rat)	Ki	4.5230	0.0013	0.5622	4.5230	AID1506088
Reverse transcriptase/RNaseH	Human immunodeficiency virus 1	IC50 (µMol)	10.0000	0.0001	1.0768	10.0000	AID1406290; AID1602241; AID1635810
Integrase	Human immunodeficiency virus 1	IC50 (µMol)	0.0414	0.0005	1.5443	10.0000	AID1406292; AID1588917; AID1602243; AID1635801; AID759973
Canalicular multispecific organic anion transporter 1	Homo sapiens (human)	IC50 (µMol)	95.0000	2.4100	6.3433	10.0000	AID1211970; AID1212008
Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)	IC50 (µMol)	100.0000	0.1047	2.7195	7.0795	AID1211972
Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)	IC50 (µMol)	48.5000	0.0040	1.9666	10.0000	AID1211969; AID1212009
Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)	IC50 (µMol)	100.0000	0.0500	2.3797	9.7000	AID1211971
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Integrase	Human immunodeficiency virus 2	EC50 (µMol)	0.0023	0.0023	0.0023	0.0023	AID1603996
Integrase	Human immunodeficiency virus 1	EC50 (µMol)	0.0034	0.0002	0.0024	0.0068	AID1604009; AID1604010; AID1604011; AID1604012
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
UDP-glucuronosyltransferase 1A1	Homo sapiens (human)	Km	21.0000	4.4900	6.5133	9.0000	AID1211925
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Process	via Protein(s)	Taxonomy
activation of cysteine-type endopeptidase activity involved in apoptotic process	Solute carrier family 22 member 2	Homo sapiens (human)
positive regulation of gene expression	Solute carrier family 22 member 2	Homo sapiens (human)
organic cation transport	Solute carrier family 22 member 2	Homo sapiens (human)
monoatomic cation transport	Solute carrier family 22 member 2	Homo sapiens (human)
neurotransmitter transport	Solute carrier family 22 member 2	Homo sapiens (human)
serotonin transport	Solute carrier family 22 member 2	Homo sapiens (human)
body fluid secretion	Solute carrier family 22 member 2	Homo sapiens (human)
organic cation transport	Solute carrier family 22 member 2	Homo sapiens (human)
quaternary ammonium group transport	Solute carrier family 22 member 2	Homo sapiens (human)
prostaglandin transport	Solute carrier family 22 member 2	Homo sapiens (human)
amine transport	Solute carrier family 22 member 2	Homo sapiens (human)
putrescine transport	Solute carrier family 22 member 2	Homo sapiens (human)
spermidine transport	Solute carrier family 22 member 2	Homo sapiens (human)
acetylcholine transport	Solute carrier family 22 member 2	Homo sapiens (human)
choline transport	Solute carrier family 22 member 2	Homo sapiens (human)
dopamine transport	Solute carrier family 22 member 2	Homo sapiens (human)
norepinephrine transport	Solute carrier family 22 member 2	Homo sapiens (human)
xenobiotic transport	Solute carrier family 22 member 2	Homo sapiens (human)
epinephrine transport	Solute carrier family 22 member 2	Homo sapiens (human)
histamine transport	Solute carrier family 22 member 2	Homo sapiens (human)
serotonin uptake	Solute carrier family 22 member 2	Homo sapiens (human)
histamine uptake	Solute carrier family 22 member 2	Homo sapiens (human)
norepinephrine uptake	Solute carrier family 22 member 2	Homo sapiens (human)
thiamine transmembrane transport	Solute carrier family 22 member 2	Homo sapiens (human)
purine-containing compound transmembrane transport	Solute carrier family 22 member 2	Homo sapiens (human)
amino acid import across plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
dopamine uptake	Solute carrier family 22 member 2	Homo sapiens (human)
L-arginine import across plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
export across plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
transport across blood-brain barrier	Solute carrier family 22 member 2	Homo sapiens (human)
L-alpha-amino acid transmembrane transport	Solute carrier family 22 member 2	Homo sapiens (human)
spermidine transmembrane transport	Solute carrier family 22 member 2	Homo sapiens (human)
L-arginine transmembrane transport	Solute carrier family 22 member 2	Homo sapiens (human)
cellular detoxification	Solute carrier family 22 member 2	Homo sapiens (human)
xenobiotic transport across blood-brain barrier	Solute carrier family 22 member 2	Homo sapiens (human)
steroid catabolic process	Cytochrome P450 1A2	Homo sapiens (human)
porphyrin-containing compound metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
cholesterol metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
estrogen metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
toxin biosynthetic process	Cytochrome P450 1A2	Homo sapiens (human)
post-embryonic development	Cytochrome P450 1A2	Homo sapiens (human)
alkaloid metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
regulation of gene expression	Cytochrome P450 1A2	Homo sapiens (human)
monoterpenoid metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
dibenzo-p-dioxin metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
epoxygenase P450 pathway	Cytochrome P450 1A2	Homo sapiens (human)
lung development	Cytochrome P450 1A2	Homo sapiens (human)
methylation	Cytochrome P450 1A2	Homo sapiens (human)
monocarboxylic acid metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 1A2	Homo sapiens (human)
retinol metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
long-chain fatty acid biosynthetic process	Cytochrome P450 1A2	Homo sapiens (human)
cellular respiration	Cytochrome P450 1A2	Homo sapiens (human)
aflatoxin metabolic process	Cytochrome P450 1A2	Homo sapiens (human)
hydrogen peroxide biosynthetic process	Cytochrome P450 1A2	Homo sapiens (human)
oxidative demethylation	Cytochrome P450 1A2	Homo sapiens (human)
cellular response to cadmium ion	Cytochrome P450 1A2	Homo sapiens (human)
omega-hydroxylase P450 pathway	Cytochrome P450 1A2	Homo sapiens (human)
G2/M transition of mitotic cell cycle	ATP-dependent translocase ABCB1	Homo sapiens (human)
xenobiotic metabolic process	ATP-dependent translocase ABCB1	Homo sapiens (human)
response to xenobiotic stimulus	ATP-dependent translocase ABCB1	Homo sapiens (human)
phospholipid translocation	ATP-dependent translocase ABCB1	Homo sapiens (human)
terpenoid transport	ATP-dependent translocase ABCB1	Homo sapiens (human)
regulation of response to osmotic stress	ATP-dependent translocase ABCB1	Homo sapiens (human)
transmembrane transport	ATP-dependent translocase ABCB1	Homo sapiens (human)
transepithelial transport	ATP-dependent translocase ABCB1	Homo sapiens (human)
stem cell proliferation	ATP-dependent translocase ABCB1	Homo sapiens (human)
ceramide translocation	ATP-dependent translocase ABCB1	Homo sapiens (human)
export across plasma membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
transport across blood-brain barrier	ATP-dependent translocase ABCB1	Homo sapiens (human)
positive regulation of anion channel activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
carboxylic acid transmembrane transport	ATP-dependent translocase ABCB1	Homo sapiens (human)
xenobiotic detoxification by transmembrane export across the plasma membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
xenobiotic transport across blood-brain barrier	ATP-dependent translocase ABCB1	Homo sapiens (human)
regulation of chloride transport	ATP-dependent translocase ABCB1	Homo sapiens (human)
lipid hydroxylation	Cytochrome P450 3A4	Homo sapiens (human)
lipid metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
steroid catabolic process	Cytochrome P450 3A4	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
steroid metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
cholesterol metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
androgen metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
estrogen metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
alkaloid catabolic process	Cytochrome P450 3A4	Homo sapiens (human)
monoterpenoid metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
calcitriol biosynthetic process from calciol	Cytochrome P450 3A4	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 3A4	Homo sapiens (human)
vitamin D metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
vitamin D catabolic process	Cytochrome P450 3A4	Homo sapiens (human)
retinol metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
retinoic acid metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
long-chain fatty acid biosynthetic process	Cytochrome P450 3A4	Homo sapiens (human)
aflatoxin metabolic process	Cytochrome P450 3A4	Homo sapiens (human)
oxidative demethylation	Cytochrome P450 3A4	Homo sapiens (human)
lipid hydroxylation	Cytochrome P450 2C8	Homo sapiens (human)
organic acid metabolic process	Cytochrome P450 2C8	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 2C8	Homo sapiens (human)
steroid metabolic process	Cytochrome P450 2C8	Homo sapiens (human)
estrogen metabolic process	Cytochrome P450 2C8	Homo sapiens (human)
epoxygenase P450 pathway	Cytochrome P450 2C8	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 2C8	Homo sapiens (human)
retinol metabolic process	Cytochrome P450 2C8	Homo sapiens (human)
retinoic acid metabolic process	Cytochrome P450 2C8	Homo sapiens (human)
long-chain fatty acid biosynthetic process	Cytochrome P450 2C8	Homo sapiens (human)
icosanoid biosynthetic process	Cytochrome P450 2C8	Homo sapiens (human)
oxidative demethylation	Cytochrome P450 2C8	Homo sapiens (human)
omega-hydroxylase P450 pathway	Cytochrome P450 2C8	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
steroid metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
cholesterol metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
estrogen metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
coumarin metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
alkaloid metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
alkaloid catabolic process	Cytochrome P450 2D6	Homo sapiens (human)
monoterpenoid metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
isoquinoline alkaloid metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 2D6	Homo sapiens (human)
retinol metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
long-chain fatty acid biosynthetic process	Cytochrome P450 2D6	Homo sapiens (human)
negative regulation of binding	Cytochrome P450 2D6	Homo sapiens (human)
oxidative demethylation	Cytochrome P450 2D6	Homo sapiens (human)
negative regulation of cellular organofluorine metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
arachidonic acid metabolic process	Cytochrome P450 2D6	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 2A6	Homo sapiens (human)
steroid metabolic process	Cytochrome P450 2A6	Homo sapiens (human)
coumarin metabolic process	Cytochrome P450 2A6	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 2A6	Homo sapiens (human)
coumarin catabolic process	Cytochrome P450 2A6	Homo sapiens (human)
epoxygenase P450 pathway	Cytochrome P450 2A6	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
steroid metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
cholesterol metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
estrogen metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
monoterpenoid metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
epoxygenase P450 pathway	Cytochrome P450 2C9	Homo sapiens (human)
urea metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
monocarboxylic acid metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 2C9	Homo sapiens (human)
long-chain fatty acid biosynthetic process	Cytochrome P450 2C9	Homo sapiens (human)
amide metabolic process	Cytochrome P450 2C9	Homo sapiens (human)
icosanoid biosynthetic process	Cytochrome P450 2C9	Homo sapiens (human)
oxidative demethylation	Cytochrome P450 2C9	Homo sapiens (human)
omega-hydroxylase P450 pathway	Cytochrome P450 2C9	Homo sapiens (human)
liver development	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
bilirubin conjugation	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
xenobiotic metabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
acute-phase response	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
response to nutrient	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
steroid metabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
estrogen metabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
animal organ regeneration	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
response to lipopolysaccharide	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
retinoic acid metabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
response to starvation	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
negative regulation of steroid metabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
flavone metabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
cellular glucuronidation	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
flavonoid glucuronidation	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
xenobiotic glucuronidation	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
biphenyl catabolic process	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
cellular response to ethanol	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
cellular response to glucocorticoid stimulus	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
cellular response to estradiol stimulus	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
long-chain fatty acid metabolic process	Cytochrome P450 2C19	Homo sapiens (human)
xenobiotic metabolic process	Cytochrome P450 2C19	Homo sapiens (human)
steroid metabolic process	Cytochrome P450 2C19	Homo sapiens (human)
monoterpenoid metabolic process	Cytochrome P450 2C19	Homo sapiens (human)
epoxygenase P450 pathway	Cytochrome P450 2C19	Homo sapiens (human)
xenobiotic catabolic process	Cytochrome P450 2C19	Homo sapiens (human)
omega-hydroxylase P450 pathway	Cytochrome P450 2C19	Homo sapiens (human)
regulation of cell growth	Sigma intracellular receptor 2	Homo sapiens (human)
regulation of intracellular lipid transport	Sigma intracellular receptor 2	Homo sapiens (human)
regulation of intracellular cholesterol transport	Sigma intracellular receptor 2	Homo sapiens (human)
cholesterol homeostasis	Sigma intracellular receptor 2	Homo sapiens (human)
positive regulation of wound healing	Sigma intracellular receptor 2	Homo sapiens (human)
positive regulation of lipoprotein transport	Sigma intracellular receptor 2	Homo sapiens (human)
xenobiotic metabolic process	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
xenobiotic transmembrane transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
negative regulation of gene expression	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
bile acid and bile salt transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
bilirubin transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
heme catabolic process	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
xenobiotic export from cell	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
transmembrane transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
transepithelial transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
leukotriene transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
monoatomic anion transmembrane transport	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
transport across blood-brain barrier	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
xenobiotic transport across blood-brain barrier	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
xenobiotic metabolic process	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
monoatomic ion transport	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
organic anion transport	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
bile acid and bile salt transport	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
heme catabolic process	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
sodium-independent organic anion transport	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
transmembrane transport	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
lipid transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
organic anion transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
urate transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
biotin transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
sphingolipid biosynthetic process	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
riboflavin transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
urate metabolic process	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
transmembrane transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
transepithelial transport	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
renal urate salt excretion	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
export across plasma membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
transport across blood-brain barrier	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
cellular detoxification	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
xenobiotic transport across blood-brain barrier	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
xenobiotic metabolic process	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
monoatomic ion transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
organic anion transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
bile acid and bile salt transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
prostaglandin transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
heme catabolic process	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
sodium-independent organic anion transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
transmembrane transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
thyroid hormone transport	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Process	via Protein(s)	Taxonomy
amine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
acetylcholine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
neurotransmitter transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
monoamine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
organic anion transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
organic cation transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
prostaglandin transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
L-amino acid transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
pyrimidine nucleoside transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
choline transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
thiamine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
putrescine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
efflux transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
spermidine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
quaternary ammonium group transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
toxin transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
xenobiotic transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
L-arginine transmembrane transporter activity	Solute carrier family 22 member 2	Homo sapiens (human)
monooxygenase activity	Cytochrome P450 1A2	Homo sapiens (human)
iron ion binding	Cytochrome P450 1A2	Homo sapiens (human)
protein binding	Cytochrome P450 1A2	Homo sapiens (human)
electron transfer activity	Cytochrome P450 1A2	Homo sapiens (human)
oxidoreductase activity	Cytochrome P450 1A2	Homo sapiens (human)
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	Cytochrome P450 1A2	Homo sapiens (human)
enzyme binding	Cytochrome P450 1A2	Homo sapiens (human)
heme binding	Cytochrome P450 1A2	Homo sapiens (human)
demethylase activity	Cytochrome P450 1A2	Homo sapiens (human)
caffeine oxidase activity	Cytochrome P450 1A2	Homo sapiens (human)
aromatase activity	Cytochrome P450 1A2	Homo sapiens (human)
estrogen 16-alpha-hydroxylase activity	Cytochrome P450 1A2	Homo sapiens (human)
estrogen 2-hydroxylase activity	Cytochrome P450 1A2	Homo sapiens (human)
hydroperoxy icosatetraenoate dehydratase activity	Cytochrome P450 1A2	Homo sapiens (human)
protein binding	ATP-dependent translocase ABCB1	Homo sapiens (human)
ATP binding	ATP-dependent translocase ABCB1	Homo sapiens (human)
ABC-type xenobiotic transporter activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
efflux transmembrane transporter activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
ATP hydrolysis activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
transmembrane transporter activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
ubiquitin protein ligase binding	ATP-dependent translocase ABCB1	Homo sapiens (human)
ATPase-coupled transmembrane transporter activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
xenobiotic transmembrane transporter activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
carboxylic acid transmembrane transporter activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
phosphatidylcholine floppase activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
phosphatidylethanolamine flippase activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
ceramide floppase activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
floppase activity	ATP-dependent translocase ABCB1	Homo sapiens (human)
monooxygenase activity	Cytochrome P450 3A4	Homo sapiens (human)
steroid binding	Cytochrome P450 3A4	Homo sapiens (human)
iron ion binding	Cytochrome P450 3A4	Homo sapiens (human)
protein binding	Cytochrome P450 3A4	Homo sapiens (human)
steroid hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
retinoic acid 4-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
oxidoreductase activity	Cytochrome P450 3A4	Homo sapiens (human)
oxygen binding	Cytochrome P450 3A4	Homo sapiens (human)
enzyme binding	Cytochrome P450 3A4	Homo sapiens (human)
heme binding	Cytochrome P450 3A4	Homo sapiens (human)
vitamin D3 25-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
caffeine oxidase activity	Cytochrome P450 3A4	Homo sapiens (human)
quinine 3-monooxygenase activity	Cytochrome P450 3A4	Homo sapiens (human)
testosterone 6-beta-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
1-alpha,25-dihydroxyvitamin D3 23-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
anandamide 8,9 epoxidase activity	Cytochrome P450 3A4	Homo sapiens (human)
anandamide 11,12 epoxidase activity	Cytochrome P450 3A4	Homo sapiens (human)
anandamide 14,15 epoxidase activity	Cytochrome P450 3A4	Homo sapiens (human)
aromatase activity	Cytochrome P450 3A4	Homo sapiens (human)
vitamin D 24-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
estrogen 16-alpha-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
estrogen 2-hydroxylase activity	Cytochrome P450 3A4	Homo sapiens (human)
1,8-cineole 2-exo-monooxygenase activity	Cytochrome P450 3A4	Homo sapiens (human)
monooxygenase activity	Cytochrome P450 2C8	Homo sapiens (human)
iron ion binding	Cytochrome P450 2C8	Homo sapiens (human)
protein binding	Cytochrome P450 2C8	Homo sapiens (human)
arachidonic acid epoxygenase activity	Cytochrome P450 2C8	Homo sapiens (human)
retinoic acid 4-hydroxylase activity	Cytochrome P450 2C8	Homo sapiens (human)
caffeine oxidase activity	Cytochrome P450 2C8	Homo sapiens (human)
aromatase activity	Cytochrome P450 2C8	Homo sapiens (human)
estrogen 16-alpha-hydroxylase activity	Cytochrome P450 2C8	Homo sapiens (human)
heme binding	Cytochrome P450 2C8	Homo sapiens (human)
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	Cytochrome P450 2C8	Homo sapiens (human)
monooxygenase activity	Cytochrome P450 2D6	Homo sapiens (human)
iron ion binding	Cytochrome P450 2D6	Homo sapiens (human)
oxidoreductase activity	Cytochrome P450 2D6	Homo sapiens (human)
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	Cytochrome P450 2D6	Homo sapiens (human)
heme binding	Cytochrome P450 2D6	Homo sapiens (human)
anandamide 8,9 epoxidase activity	Cytochrome P450 2D6	Homo sapiens (human)
anandamide 11,12 epoxidase activity	Cytochrome P450 2D6	Homo sapiens (human)
anandamide 14,15 epoxidase activity	Cytochrome P450 2D6	Homo sapiens (human)
iron ion binding	Cytochrome P450 2A6	Homo sapiens (human)
coumarin 7-hydroxylase activity	Cytochrome P450 2A6	Homo sapiens (human)
enzyme binding	Cytochrome P450 2A6	Homo sapiens (human)
heme binding	Cytochrome P450 2A6	Homo sapiens (human)
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	Cytochrome P450 2A6	Homo sapiens (human)
arachidonic acid epoxygenase activity	Cytochrome P450 2A6	Homo sapiens (human)
monooxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
iron ion binding	Cytochrome P450 2C9	Homo sapiens (human)
arachidonic acid epoxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
steroid hydroxylase activity	Cytochrome P450 2C9	Homo sapiens (human)
arachidonic acid 14,15-epoxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
arachidonic acid 11,12-epoxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
oxidoreductase activity	Cytochrome P450 2C9	Homo sapiens (human)
(S)-limonene 6-monooxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
(S)-limonene 7-monooxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
caffeine oxidase activity	Cytochrome P450 2C9	Homo sapiens (human)
(R)-limonene 6-monooxygenase activity	Cytochrome P450 2C9	Homo sapiens (human)
aromatase activity	Cytochrome P450 2C9	Homo sapiens (human)
heme binding	Cytochrome P450 2C9	Homo sapiens (human)
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	Cytochrome P450 2C9	Homo sapiens (human)
retinoic acid binding	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
enzyme inhibitor activity	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
steroid binding	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
glucuronosyltransferase activity	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
enzyme binding	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
protein homodimerization activity	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
protein heterodimerization activity	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
monooxygenase activity	Cytochrome P450 2C19	Homo sapiens (human)
iron ion binding	Cytochrome P450 2C19	Homo sapiens (human)
steroid hydroxylase activity	Cytochrome P450 2C19	Homo sapiens (human)
oxidoreductase activity	Cytochrome P450 2C19	Homo sapiens (human)
(S)-limonene 6-monooxygenase activity	Cytochrome P450 2C19	Homo sapiens (human)
(S)-limonene 7-monooxygenase activity	Cytochrome P450 2C19	Homo sapiens (human)
oxygen binding	Cytochrome P450 2C19	Homo sapiens (human)
enzyme binding	Cytochrome P450 2C19	Homo sapiens (human)
heme binding	Cytochrome P450 2C19	Homo sapiens (human)
(R)-limonene 6-monooxygenase activity	Cytochrome P450 2C19	Homo sapiens (human)
aromatase activity	Cytochrome P450 2C19	Homo sapiens (human)
long-chain fatty acid omega-1 hydroxylase activity	Cytochrome P450 2C19	Homo sapiens (human)
arachidonic acid epoxygenase activity	Cytochrome P450 2C19	Homo sapiens (human)
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen	Cytochrome P450 2C19	Homo sapiens (human)
protein binding	Sigma intracellular receptor 2	Homo sapiens (human)
oxysterol binding	Sigma intracellular receptor 2	Homo sapiens (human)
cholesterol binding	Sigma intracellular receptor 2	Homo sapiens (human)
protein binding	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ATP binding	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
organic anion transmembrane transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ABC-type xenobiotic transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
bilirubin transmembrane transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ABC-type glutathione S-conjugate transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ATP hydrolysis activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ATPase-coupled transmembrane transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
xenobiotic transmembrane transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ATPase-coupled inorganic anion transmembrane transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
ABC-type transporter activity	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
serine-type endopeptidase inhibitor activity	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
organic anion transmembrane transporter activity	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
bile acid transmembrane transporter activity	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
sodium-independent organic anion transmembrane transporter activity	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
protein binding	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
ATP binding	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
organic anion transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
ABC-type xenobiotic transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
urate transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
biotin transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
efflux transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
ATP hydrolysis activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
riboflavin transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
ATPase-coupled transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
identical protein binding	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
protein homodimerization activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
xenobiotic transmembrane transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
sphingolipid transporter activity	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
organic anion transmembrane transporter activity	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
bile acid transmembrane transporter activity	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
prostaglandin transmembrane transporter activity	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
sodium-independent organic anion transmembrane transporter activity	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
thyroid hormone transmembrane transporter activity	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Process	via Protein(s)	Taxonomy
plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
basal plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
membrane	Solute carrier family 22 member 2	Homo sapiens (human)
basolateral plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
apical plasma membrane	Solute carrier family 22 member 2	Homo sapiens (human)
extracellular exosome	Solute carrier family 22 member 2	Homo sapiens (human)
presynapse	Solute carrier family 22 member 2	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 1A2	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 1A2	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 1A2	Homo sapiens (human)
cytoplasm	ATP-dependent translocase ABCB1	Homo sapiens (human)
plasma membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
cell surface	ATP-dependent translocase ABCB1	Homo sapiens (human)
membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
apical plasma membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
extracellular exosome	ATP-dependent translocase ABCB1	Homo sapiens (human)
external side of apical plasma membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
plasma membrane	ATP-dependent translocase ABCB1	Homo sapiens (human)
cytoplasm	Cytochrome P450 3A4	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 3A4	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 3A4	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 2C8	Homo sapiens (human)
plasma membrane	Cytochrome P450 2C8	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2C8	Homo sapiens (human)
cytoplasm	Cytochrome P450 2C8	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2C8	Homo sapiens (human)
mitochondrion	Cytochrome P450 2D6	Homo sapiens (human)
endoplasmic reticulum	Cytochrome P450 2D6	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 2D6	Homo sapiens (human)
cytoplasm	Cytochrome P450 2D6	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2D6	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 2A6	Homo sapiens (human)
cytoplasmic microtubule	Cytochrome P450 2A6	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2A6	Homo sapiens (human)
cytoplasm	Cytochrome P450 2A6	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 2C9	Homo sapiens (human)
plasma membrane	Cytochrome P450 2C9	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2C9	Homo sapiens (human)
cytoplasm	Cytochrome P450 2C9	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2C9	Homo sapiens (human)
endoplasmic reticulum	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
endoplasmic reticulum membrane	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
plasma membrane	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
perinuclear region of cytoplasm	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
endoplasmic reticulum chaperone complex	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
cytochrome complex	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
endoplasmic reticulum	UDP-glucuronosyltransferase 1A1	Homo sapiens (human)
endoplasmic reticulum membrane	Cytochrome P450 2C19	Homo sapiens (human)
plasma membrane	Cytochrome P450 2C19	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2C19	Homo sapiens (human)
intracellular membrane-bounded organelle	Cytochrome P450 2C19	Homo sapiens (human)
cytoplasm	Cytochrome P450 2C19	Homo sapiens (human)
virion membrane	Spike glycoprotein	Severe acute respiratory syndrome-related coronavirus
endoplasmic reticulum	Sigma intracellular receptor 2	Homo sapiens (human)
lysosome	Sigma intracellular receptor 2	Homo sapiens (human)
endoplasmic reticulum	Sigma intracellular receptor 2	Homo sapiens (human)
rough endoplasmic reticulum	Sigma intracellular receptor 2	Homo sapiens (human)
plasma membrane	Sigma intracellular receptor 2	Homo sapiens (human)
rough endoplasmic reticulum membrane	Sigma intracellular receptor 2	Homo sapiens (human)
nuclear membrane	Sigma intracellular receptor 2	Homo sapiens (human)
plasma membrane	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
cell surface	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
apical plasma membrane	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
intercellular canaliculus	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
apical plasma membrane	Canalicular multispecific organic anion transporter 1	Homo sapiens (human)
plasma membrane	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
basal plasma membrane	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
basolateral plasma membrane	Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)
nucleoplasm	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
plasma membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
apical plasma membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
brush border membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
mitochondrial membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
membrane raft	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
external side of apical plasma membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
plasma membrane	Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)
plasma membrane	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
basal plasma membrane	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
membrane	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
basolateral plasma membrane	Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Assay ID	Title	Year	Journal	Article
AID1211972	Inhibition of human OATP1B3 expressed in BacMam baculovirus virus infected HEK MSR2 cells using [3H]estradiol 17beta-D-glucuronide as substrate by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604000	Inhibition of HIV-2 ROD9 integrase Y143C mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1073335	Antiviral activity against HIV-1 harboring integrase T97A mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1073332	Antiviral activity against HIV-1 harboring integrase G140S mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1073324	Antiviral activity against HIV-1 harboring integrase T66I/R263K double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211953	Activity at human BCRP expressed in MDCK2 cells assessed as apical efflux ratio by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604008	Inhibition of HIV-2 ROD9 integrase T97A/N155H double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1300996	Selectivity ratio of EC50 for raltegravir resistant HIV1 harboring integrase Q148H mutant infected in human MT4 cells to EC50 for wild type HIV1 3B infected in human MT4 cells	2016	European journal of medicinal chemistry, Jul-19, Volume: 117	2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs) as human immunodeficiency virus type 1 integrase inhibitors: Influence of the alkylcarboxamide substitution of position 4.
AID1635806	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 1556-1 expressing integrase Y143C mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1211951	Activity at human MDR1 expressed in MDCK2 cells assessed as apical efflux ratio at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212014	Inhibition of CYP3A4 in human liver microsomes using atorvastatin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211950	Activity at human MDR1 expressed in MDCK2 cells assessed as apical efflux ratio at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073318	Antiviral activity against HIV-1 harboring integrase T97A/Y143C double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1191388	Displacement of (+)-[3H]pentazocine from guinea pig brain cortex sigma1 receptor by scintillation analyzer	2015	European journal of medicinal chemistry, Jan-27, Volume: 90	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1073337	Antiviral activity against HIV-1 harboring integrase T66R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211964	In vitro passive membrane permeability across dog MDCK2 cells at 3 uM using fasted state-simulated intestinal fluid buffer at pH 7.4 on donor side and 1% human serum albumin at pH 7.4 on receiver side by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635807	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 4736-2 expressing integrase N155H mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1211946	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A4-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211936	Drug metabolism in supersomes expressing human recombinant CYP2B6 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211981	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human OCT2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212006	Drug excretion in human feces at 20 mg, po	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211949	Drug metabolism assessed as UDPGA-fortified human recombinant UGT2B7-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073334	Antiviral activity against HIV-1 harboring integrase G118R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211916	Drug metabolism assessed as UDPGA-fortified human recombinant UGT2B15-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211956	Activity at human BCRP expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211944	Inhibition of CYP2C8 in human liver microsomes using rosiglitazone as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212010	Protein binding in plasma (unknown origin)	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483418	Cytotoxicity against human P4R5 cells by MTS assay	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1211983	Ratio of drug level in human 250 ml gastrointestinal volume at 50 mg administered as daily dose to IC50 for human BCRP	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073331	Antiviral activity against HIV-1 harboring integrase Y143C mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1406292	Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by HTS assay	2018	European journal of medicinal chemistry, Aug-05, Volume: 156	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1212025	Metabolism-dependent inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073317	Antiviral activity against HIV-1 harboring integrase T97A/Y143R double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211978	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human OATP1B1	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155173	Antiviral activity against HIV-1 harboring wild type integrase infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID759973	Inhibition of HIV-1 integrase strand transfer activity using [3H]-DNA as substrate preincubated for 60 mins prior to substrate addition measured after 25 to 45 mins	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1212021	Metabolism-dependent inhibition of CYP1A2 in human liver microsomes using phenacetin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211992	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211922	Drug metabolism in UDPGA-fortified human liver microsomes assessed as UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1191391	Displacement of [3H]MK801 from pig brain cortex NMDA receptor PCP binding site at 1 uM by scintillation analyzer	2015	European journal of medicinal chemistry, Jan-27, Volume: 90	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1212013	Inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211995	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1270893	Inhibition of HIV integrase-mediated strand transfer activity using precleaved 19T duplex oligonucleotide after 2 hrs	2015	European journal of medicinal chemistry, Dec-01, Volume: 106	Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
AID1211966	Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine at 30 uM after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212000	Inhibition of human recombinant UGT2B7 expressed in supersomes assessed as 7-HFC glucuronidation up to 100 uM by fluoresence analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211937	Drug metabolism in supersomes expressing human recombinant CYP2C8 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211938	Drug metabolism in supersomes expressing human recombinant CYP2C9 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211968	Inhibition of MDR1 (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [3H]digoxin after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1603997	Inhibition of HIV-2 ROD9 integrase E92Q mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211987	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A3-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211930	Drug metabolism in NADPH-fortified human liver microsomes assessed as metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide) formati	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1603998	Inhibition of HIV-2 ROD9 integrase T97A mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID759977	Antiviral activity against Human immunodeficiency virus harboring integrase Q148K mutant infected in human HeLa cells expressing CD4 after 2 days by beta galactosidase assay relative to wild type HIV	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID759971	Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells after 4 to 5 days by bioluminescence assay	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1212027	Metabolism-dependent inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1603996	Inhibition of wild type HIV-2 ROD9 integrase	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211982	Ratio of drug level in human 250 ml gastrointestinal volume at 50 mg administered as daily dose to IC50 for human P-gp	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073328	Antiviral activity against HIV-1 harboring integrase Q148K mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1406291	Inhibition of HIV1 reverse transcriptase polymerase activity using 18 nucleotide DNA primer and 100 nucleotide DNA template after 30 mins	2018	European journal of medicinal chemistry, Aug-05, Volume: 156	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1212017	Inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212022	Metabolism-dependent inhibition of CYP2A6 in human liver microsomes using coumarin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483415	Inhibition of HIV integrase strand transfer activity expressed in Escherichia coli BL21 (DE3) using 5' biotin ATGTGGAAAATCTCTAGCA primer annealed with ACTGCTAGAGATTTTCCACAT 3' Cy5 template preincubated for 10 mins followed by primer/template addition meas	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1212019	Inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211997	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID759972	Antiviral activity against Human immunodeficiency virus 1 Ba-L infected human PBMC after 7 days by [methyl-3H]dTTP incorporation assay	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1211923	Drug metabolism in UDPGA-fortified human liver microsomes assessed as UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1655661	Displacement of [3H]-di-o-tolylguanidine from sigma2 receptor (unknown origin) incubated for 1 hr in presence of (+)SKF10047 by liquid scintillation counting method
AID1689343	Antiviral activity against HIV1 3B	2020	European journal of medicinal chemistry, Mar-01, Volume: 189	Synthesis, biological evaluation and in silico modeling of novel integrase strand transfer inhibitors (INSTIs).
AID1602241	Inhibition of HIV1 reverse transcriptase RNase H expressed in Escherichia coli JM109 using RNA/DNA duplex substrate HTS-1	2019	European journal of medicinal chemistry, Mar-15, Volume: 166	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID1602243	Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins	2019	European journal of medicinal chemistry, Mar-15, Volume: 166	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID1604004	Inhibition of HIV-2 ROD9 integrase E92Q/Y143C double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1155176	Antiviral activity against raltegravir-resistant HIV-1 harboring integrase G140S/Q148H double mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1604005	Inhibition of HIV-2 ROD9 integrase T97A/Y143C double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211925	Drug metabolism assessed as human recombinant UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)-3,4,5-trihydrox	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073325	Antiviral activity against HIV-1 harboring integrase R263K mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1506086	Displacement of (+)-[3H]pentazocine from sigma1 receptor in rat brain membranes after 60 mins by liquid scintillation counting method	2018	Journal of medicinal chemistry, Aug-09, Volume: 61, Issue:15	Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
AID1073323	Antiviral activity against HIV-1 harboring integrase E92Q/N155H double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211991	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211958	Activity at human MDR1 expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211961	Activity at human BCRP expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211954	Activity at human MDR1 expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID759978	Antiviral activity against pseudo Human immunodeficiency virus infected in HEK293T cells after 2 days in presence of human serum albumin	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1211943	Inhibition of CYP2B6 in human liver microsomes using bupropion as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211998	Inhibition of human recombinant UGT1A1 expressed in supersomes assessed as scopoletin glucuronidation at 100 uM by fluorescence analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211963	In vitro passive membrane permeability across dog MDCK2 cells at 3 uM using fasted state-simulated intestinal fluid buffer at pH 5.5 on donor side and 1% human serum albumin at pH 7.4 on receiver side by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212020	Inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212018	Inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073336	Antiviral activity against HIV-1 harboring integrase E92Q mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1406290	Inhibition of HIV1 reverse transcriptase RNaseH activity using 3'-fluorescein/5'-Dabcyl labeled HTS-1 substrate	2018	European journal of medicinal chemistry, Aug-05, Volume: 156	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1211984	Ratio of drug level in human 250 ml gastrointestinal volume at 50 mg administered as daily dose to IC50 for human MRP2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073322	Antiviral activity against HIV-1 harboring integrase E138K/Q148H double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1212008	Inhibition of human MRP2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483417	Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 cells assessed as inhibition of viral replication preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene ass	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1635805	Antiviral activity against HIV1 infected in human P4R5 cells assessed as reduction of virus replication preincubated with cells for 24 hrs followed by viral infection for 48 hrs by 4-methylumbelliferylgalactoside-based MAGI assay	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1483413	Inhibition of recombinant full length HIV1 reverse transcriptase RNase H domain using RNA/DNA duplex substrate HTS1 assessed as reduction in internal cleavage of RNA strand by fluoresence assay	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1824523	Displacement of [3H]DTG from sigma 2 receptor in Wistar Han rat liver membranes measured after 120 mins by scintillation counting method	2022	European journal of medicinal chemistry, Jan-15, Volume: 228	Development of novel phenoxyalkylpiperidines as high-affinity Sigma-1 (σ
AID1602244	Antiviral activity against HIV-1 infected in human P4R5 cells assessed as reduction in viral replication preincubated for 24 hrs followed by viral infection and measured after 48 hrs by MAGI assay	2019	European journal of medicinal chemistry, Mar-15, Volume: 166	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID1603999	Inhibition of HIV-2 ROD9 integrase G140S mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1073321	Antiviral activity against HIV-1 harboring integrase E138K/Q148K double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1212026	Metabolism-dependent inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604010	Inhibition of HIV-1 NL4-3 integrase T97A/Y143C double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1212009	Inhibition of human BCRP	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211917	Drug metabolism in human hepatocytes assessed as DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)-3,4,5-trihydroxytetr	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211980	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human MRP2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1300997	Selectivity ratio of EC50 for raltegravir resistant HIV1 harboring integrase N155H mutant infected in human MT4 cells to EC50 for wild type HIV1 3B infected in human MT4 cells	2016	European journal of medicinal chemistry, Jul-19, Volume: 117	2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs) as human immunodeficiency virus type 1 integrase inhibitors: Influence of the alkylcarboxamide substitution of position 4.
AID1155175	Antiviral activity against raltegravir-resistant HIV-1 harboring integrase N155H mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1211999	Inhibition of human recombinant UGT1A1 expressed in supersomes assessed as scopoletin glucuronidation by fluorescence analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211967	Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine at 100 uM after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212024	Metabolism-dependent inhibition of CYP2C8 in human liver microsomes using rosiglitazone as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211952	Activity at human BCRP expressed in MDCK2 cells assessed as apical efflux ratio at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1380353	Lipophilicity, log D of the compound at pH 7.4 by chromatographic method	2018	Journal of medicinal chemistry, 08-09, Volume: 61, Issue:15	Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
AID1211965	Inhibition of MDR1 (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [3H]digoxin at 100 uM after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073333	Antiviral activity against HIV-1 harboring integrase E138K mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1604003	Inhibition of HIV-2 ROD9 integrase N155H mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211969	Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212016	Inhibition of CYP2B6 in human liver microsomes using bupropion as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635808	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 8070-1 expressing integrase G140S/Y143H/Q148H mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1212002	Induction of CYP2B6 mRNA expression in human hepatocytes at 1 to 40 uM after 48 hrs by real time PCR analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635810	Inhibition of RNase H activity of full length HIV1 reverse transcriptase using RNA-DNA duplex HTS-1 substrate	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1191390	Selectivity ratio of Ki for rat liver sigma2 receptor to Ki for guinea pig brain cortex sigma1 receptor	2015	European journal of medicinal chemistry, Jan-27, Volume: 90	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1211929	Drug metabolism in supersomes expressing human recombinant CYP3A4 assessed as NADPH-fortified enzyme-mediated metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyri	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1877931	Displacement of [3H]-DTG from Sprague-Dawley rat liver Sigma 2 receptor incubated for 120 mins in presence of [3H]-(+)-pentazocine by liquid scintillation counting analysis	2022	European journal of medicinal chemistry, Feb-15, Volume: 230	Dual Sigma-1 receptor antagonists and hydrogen sulfide-releasing compounds for pain treatment: Design, synthesis, and pharmacological evaluation.
AID1211933	Drug metabolism in supersomes expressing human recombinant CYP3A4 assessed as for NADPH-fortified enzyme-mediated metabolite M1 ((4R,12aS)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide) for	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155174	Antiviral activity against raltegravir-resistant HIV-1 harboring integrase Y143R mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1212029	Metabolism-dependent inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211927	Drug metabolism assessed as intrinsic clearance for human recombinant UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604011	Inhibition of HIV-1 NL4-3 integrase G140S/Q148R double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211957	Activity at human BCRP expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211962	In vitro passive membrane permeability from basolateral to apical side of dog MDCK2 cells at 3 uM using Dulbecco's modified Eagle's medium as transport buffer at pH 7.4 on both donor and receiver side by liquid scintillation counting analysis in presence	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155179	Ratio of EC50 for raltegravir-resistant HIV-1 harboring integrase G140S/Q148H double mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1212004	Drug excretion in human urine at 20 mg, po	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635809	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 8070-2 expressing integrase G140S/Q148H mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1211971	Inhibition of human OATP1B1 expressed in CHO cells using [3H]estradiol 17beta-D-glucuronide as substrate by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID759979	Antiviral activity against pseudo Human immunodeficiency virus infected in HEK293T cells after 2 days	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1211942	Inhibition of CYP2A6 in human liver microsomes using coumarin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211975	Inhibition of human OCT2 expressed in MDCK2 cells using [14C]metformin as substrate at 25 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211970	Inhibition of human MRP2 expressed in baculovirus-infected Sf9 cell membrane vesicle using [3H]estradiol 17beta-D-glucuronide as substrate preincubated with vesicles for 5 mins prior to substrate addition by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211928	Drug metabolism in supersomes expressing human recombinant CYP3A4 assessed as intrinsic clearance for NADPH-fortified enzyme-mediated metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483414	Inhibition of recombinant full length HIV1 reverse transcriptase polymerase domain assessed as decrease in extension of 18 nucleotide DNA primer annealed to 100 nucleotide DNA template after 30 mins	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1211921	Drug metabolism in UDPGA-fortified human liver microsomes assessed as DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211974	Inhibition of human OCT2 expressed in MDCK2 cells using [14C]metformin as substrate by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211994	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073319	Antiviral activity against HIV-1 harboring integrase G140S/Q148K double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211948	Drug metabolism assessed as UDPGA-fortified human recombinant UGT2B4-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211939	Drug metabolism in supersomes expressing human recombinant CYP2C19 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211926	Drug metabolism assessed as human recombinant UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)-3,4,5-trihydrox	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211979	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human OTAP1B3	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211976	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human P-gp	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604007	Inhibition of HIV-2 ROD9 integrase E92Q/N155H double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1155180	Antiviral activity against INSTI-resistant HIV-1 harboring integrase R263K mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1212023	Metabolism-dependent inhibition of CYP2B6 in human liver microsomes using bupropion as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212011	Inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1270894	Inhibition of HIV integrase-mediated strand transfer activity using 5'-[gamma-32P]-labeled full length 21T DNA at 50 nM after 2 hrs	2015	European journal of medicinal chemistry, Dec-01, Volume: 106	Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
AID1073327	Antiviral activity against HIV-1 harboring integrase Q148R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211941	Inhibition of CYP1A2 in human liver microsomes using phenacetin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155183	Ratio of EC50 for INSTI-resistant HIV-1 harboring integrase G118R mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1211947	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A6-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211955	Activity at human MDR1 expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155177	Ratio of EC50 for raltegravir-resistant HIV-1 harboring integrase Y143R mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1211919	Drug metabolism in UDPGA-fortified human liver microsomes assessed as DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211959	Activity at human MDR1 expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211935	Drug metabolism in supersomes expressing human recombinant CYP1A2 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212015	Inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1655660	Displacement of [3H]-(+)-pentazocine from sigma1 receptor in guinea pig brain membranes incubated for 1 hr by liquid scintillation counting method
AID1211924	Drug metabolism in UDPGA-fortified human liver microsomes assessed as intrinsic clearance for UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1506087	Displacement of [3H]DTG from sigma2 receptor in rat liver membranes after 60 mins by liquid scintillation counting method	2018	Journal of medicinal chemistry, Aug-09, Volume: 61, Issue:15	Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
AID1604002	Inhibition of HIV-2 ROD9 integrase Q148R mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1212003	Induction of CYP3A4 mRNA expression in human hepatocytes at 1 to 40 uM after 48 hrs by real time PCR analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155181	Antiviral activity against INSTI-resistant HIV-1 harboring integrase G118R mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1270892	Inhibition of HIV integrase-mediated 3'-processing activity using 5'-[gamma-32P]-labeled full length 21T DNA after 2 hrs	2015	European journal of medicinal chemistry, Dec-01, Volume: 106	Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
AID1211940	Drug metabolism in supersomes expressing human recombinant CYP2D6 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211932	Drug metabolism in NADPH-fortified human liver microsomes assessed as metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide) formati	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073330	Antiviral activity against HIV-1 harboring integrase Y143R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1212007	Inhibition of human MDR1	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1406293	Selectivity index, ratio of IC50 for HIV integrase strand transfer activity to IC50 for HIV1 reverse transcriptase RNaseH activity	2018	European journal of medicinal chemistry, Aug-05, Volume: 156	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1073329	Antiviral activity against HIV-1 harboring integrase Q148H mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1212028	Metabolism-dependent inhibition of CYP3A4 in human liver microsomes using atorvastatin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211989	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A9-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212012	Inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073326	Antiviral activity against HIV-1 harboring integrase N155H mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211977	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human BCRP	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211973	Inhibition of human OCT1 expressed in HEK293 cells using [14C]metformin as substrate at 10 uM after 10 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604006	Inhibition of HIV-2 ROD9 integrase G140S/Q148R double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1191389	Displacement of [3H]DTG from rat liver sigma2 receptor by scintillation analyzer	2015	European journal of medicinal chemistry, Jan-27, Volume: 90	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1073320	Antiviral activity against HIV-1 harboring integrase G140S/Q148H double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3	Inhibiting the HIV integration process: past, present, and the future.
AID1211985	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A1-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155182	Ratio of EC50 for INSTI-resistant HIV-1 harboring integrase R263K mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1155178	Ratio of EC50 for raltegravir-resistant HIV-1 harboring integrase N155H mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1604009	Inhibition of wild type HIV-1 NL4-3 integrase	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1588917	Inhibition of HIV integrase strand transfer activity	2019	Bioorganic & medicinal chemistry, 09-01, Volume: 27, Issue:17	Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
AID1211990	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604001	Inhibition of HIV-2 ROD9 integrase Q148H mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1877932	Displacement of [3H]-(+)-pentazocine from Dunkin-Hartley guinea pig brain cortex Sigma 1 receptor incubated for 150 mins by liquid scintillation counting analysis	2022	European journal of medicinal chemistry, Feb-15, Volume: 230	Dual Sigma-1 receptor antagonists and hydrogen sulfide-releasing compounds for pain treatment: Design, synthesis, and pharmacological evaluation.
AID1604012	Inhibition of HIV-1 NL4-3 integrase E92Q/N155H double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1212001	Induction of CYP1A2 mRNA expression in human hepatocytes at 1 to 40 uM after 48 hrs by real time PCR analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635801	Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1506088	Displacement of (-)-[3H]vesamicol from rat VAChT expressed in rat PC12 cell membranes after 60 mins by liquid scintillation counting method	2018	Journal of medicinal chemistry, Aug-09, Volume: 61, Issue:15	Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
AID1300998	Selectivity ratio of EC50 for raltegravir resistant HIV1 harboring integrase G140S/Q148H double mutant infected in human MT4 cells to EC50 for wild type HIV1 3B infected in human MT4 cells	2016	European journal of medicinal chemistry, Jul-19, Volume: 117	2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs) as human immunodeficiency virus type 1 integrase inhibitors: Influence of the alkylcarboxamide substitution of position 4.
AID1211996	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211960	Activity at human BCRP expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211993	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483416	Selectivity index, ratio of IC50 for HIV integrase strand transfer activity to IC50 for recombinant full length HIV1 reverse transcriptase RNase H domain	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1602242	Inhibition of HIV1 reverse transcriptase polymerase using deoxynucleotide triphosphates and 18 nucleotide DNA primer annealed to 100 nucleotide DNA template after 30 mins	2019	European journal of medicinal chemistry, Mar-15, Volume: 166	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID759970	Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells after 4 to 5 days by bioluminescence assay in presence of human serum relative to control	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1406294	Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 MAGI cells preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene assay	2018	European journal of medicinal chemistry, Aug-05, Volume: 156	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1347097	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Saos-2 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347104	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for RD cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347103	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for OHS-50 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347093	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for SK-N-MC cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347091	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for SJ-GBM2 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1296008	Cytotoxic Profiling of Annotated Libraries Using Quantitative High-Throughput Screening	2020	SLAS discovery : advancing life sciences R & D, 01, Volume: 25, Issue:1	Cytotoxic Profiling of Annotated and Diverse Chemical Libraries Using Quantitative High-Throughput Screening.
AID1347154	Primary screen GU AMC qHTS for Zika virus inhibitors	2020	Proceedings of the National Academy of Sciences of the United States of America, 12-08, Volume: 117, Issue:49	Therapeutic candidates for the Zika virus identified by a high-throughput screen for Zika protease inhibitors.
AID1347089	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for TC32 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347099	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for NB1643 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347090	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for DAOY cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1346987	P-glycoprotein substrates identified in KB-8-5-11 adenocarcinoma cell line, qHTS therapeutic library screen	2019	Molecular pharmacology, 11, Volume: 96, Issue:5	A High-Throughput Screen of a Library of Therapeutics Identifies Cytotoxic Substrates of P-glycoprotein.
AID1347106	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for control Hh wild type fibroblast cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347108	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Rh41 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347082	qHTS for Inhibitors of the Functional Ribonucleoprotein Complex (vRNP) of Lassa (LASV) Arenavirus: LASV Primary Screen - GLuc reporter signal	2020	Antiviral research, 01, Volume: 173	A cell-based, infectious-free, platform to identify inhibitors of lassa virus ribonucleoprotein (vRNP) activity.
AID1347086	qHTS for Inhibitors of the Functional Ribonucleoprotein Complex (vRNP) of Lymphocytic Choriomeningitis Arenaviruses (LCMV): LCMV Primary Screen - GLuc reporter signal	2020	Antiviral research, 01, Volume: 173	A cell-based, infectious-free, platform to identify inhibitors of lassa virus ribonucleoprotein (vRNP) activity.
AID1347101	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for BT-12 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347107	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Rh30 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347102	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Rh18 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347096	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for U-2 OS cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347094	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for BT-37 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347095	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for NB-EBc1 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1508630	Primary qHTS for small molecule stabilizers of the endoplasmic reticulum resident proteome: Secreted ER Calcium Modulated Protein (SERCaMP) assay	2021	Cell reports, 04-27, Volume: 35, Issue:4	A target-agnostic screen identifies approved drugs to stabilize the endoplasmic reticulum-resident proteome.
AID1347092	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for A673 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1745845	Primary qHTS for Inhibitors of ATXN expression
AID1347083	qHTS for Inhibitors of the Functional Ribonucleoprotein Complex (vRNP) of Lassa (LASV) Arenavirus: Viability assay - alamar blue signal for LASV Primary Screen	2020	Antiviral research, 01, Volume: 173	A cell-based, infectious-free, platform to identify inhibitors of lassa virus ribonucleoprotein (vRNP) activity.
AID1347098	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for SK-N-SH cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347105	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for MG 63 (6-TG R) cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347100	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for LAN-5 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1346986	P-glycoprotein substrates identified in KB-3-1 adenocarcinoma cell line, qHTS therapeutic library screen	2019	Molecular pharmacology, 11, Volume: 96, Issue:5	A High-Throughput Screen of a Library of Therapeutics Identifies Cytotoxic Substrates of P-glycoprotein.
AID977608	Experimentally measured binding affinity data (IC50) for protein-ligand complexes derived from PDB	2011	Molecular pharmacology, Oct, Volume: 80, Issue:4	Structural and functional analyses of the second-generation integrase strand transfer inhibitor dolutegravir (S/GSK1349572).
[information is prepared from bioassay data collected from National Library of Medicine (NLM), extracted Dec-2023]

Timeframe	Studies, This Drug (%)	All Drugs %
pre-1990	0 (0.00)	18.7374
1990's	0 (0.00)	18.2507
2000's	0 (0.00)	29.6817
2010's	614 (55.42)	24.3611
2020's	494 (44.58)	2.80
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Publication Type	This drug (%)	All Drugs (%)
Trials	179 (15.87%)	5.53%
Reviews	119 (10.55%)	6.00%
Case Studies	95 (8.42%)	4.05%
Observational	58 (5.14%)	0.25%
Other	677 (60.02%)	84.16%
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Clinical Trials (206)

Trial Overview

Trial	Phase	Enrollment	Study Type	Start Date	Status
Phase III Multicenter Randomized Trial Evaluating in Patients at the Time of the Primary HIV-1 Infection, the Impact on the Viral Reservoir of a Combination Including Tenofovir/Emtricitabine and Dolutegravir or Tenofovir/Emtricitabine and Darunavir/Cobici [NCT02987530]	Phase 3	101 participants (Actual)	Interventional	2017-04-11	Completed
A Phase 3, Randomized, Double-Blind Study to Evaluate the Safety and Efficacy of Switching From a Regimen of Dolutegravir and Either Emtricitabine/Tenofovir Alafenamide or Emtricitabine/Tenofovir Disoproxil Fumarate to a Fixed Dose Combination of Bictegra [NCT03110380]	Phase 3	567 participants (Actual)	Interventional	2017-06-12	Completed
Relative Bioavailability Study to Investigate a Potential Interaction Between Dolutegravir (DTG) and Tenofovir Alafenamide Fumarate/Emtricitabine (F/TAF) Administered as Paediatric Tablet Formulations [NCT05489406]	Phase 1	16 participants (Actual)	Interventional	2022-10-06	Completed
An Open Label, Non-Randomized, Single Dose, Mass Balance Study to Investigate the Recovery, Excretion, and Pharmacokinetics of 14C-GSK1349572 20 mg, Administered as a Single Oral Suspension Dose to Healthy Adult Subjects (ING111853) [NCT00828763]	Phase 1	6 participants (Actual)	Interventional	2009-02-28	Completed
A Phase 1, Single Dose, Crossover, Relative Bioavailability Study of a Dolutegravir Dispersible Tablet as Compared to a Dolutegravir Pediatric Granule Formulation and Effect of Different Types of Water on the Dispersible Tablet in Healthy Volunteers(20040 [NCT02185300]	Phase 1	15 participants (Actual)	Interventional	2014-07-31	Completed
Phase 1, Open Label, Two Arm, Fixed Sequence Study to Evaluate the Effect of Rifampin and Rifabutin on GSK1349572 Pharmacokinetics in Healthy Male and Female Volunteers [NCT01231542]	Phase 1	27 participants (Actual)	Interventional	2011-05-31	Completed
A Phase 1, Open Label, Single Sequence, Two-Way Drug Interaction Study Evaluating Plasma GSK2248761 and GSK1379572 Pharmacokinetics in Healthy Adult Subjects [NCT01283100]	Phase 1	0 participants (Actual)	Interventional	2011-03-31	Withdrawn(stopped due to In a Phase II study in HIV-infected patients there were a number of seizures, although exact causality could not be assessed phase 1 activity was terminated.)
Immediate Initiation of Antiretroviral Therapy During Acute HIV Infection [NCT02656511]	Phase 4	74 participants (Anticipated)	Interventional	2015-12-31	Active, not recruiting
An Open-label, Randomized, Single Dose, Crossover, Pivotal Bioequivalence Study of Fixed-dose Combination Tablets of Dolutegravir and Lamivudine Versus Dolutegravir and Lamivudine Single Entities and Food Effect Assessment in Healthy Volunteers [NCT03078556]	Phase 1	154 participants (Actual)	Interventional	2017-03-27	Completed
Switching Treatment-Experienced, Integrase Inhibitor-Naïve, Virally Suppressed HIV-1 Infected Adults From Ritonavir Boosted Protease Inhibitors to Dolutegravir: An Open-Label Randomized Controlled Trial [NCT04229290]	Phase 4	795 participants (Actual)	Interventional	2020-02-12	Completed
Relative Bioavailability Study of Three Different Tablet Formulations of GSK1349572 50 mg and the Dose Proportionality of and Effect of Food on the Selected Formulation in Healthy Male and Female Volunteers (ING113674) [NCT01098513]	Phase 1	24 participants (Actual)	Interventional	2010-04-30	Completed
A Phase II, Multicenter, Single-Arm, Open-Label Clinical Trial to Evaluate the Safety and Efficacy of Triple Therapy With Dolutegravir Plus 2 NRTIs, in Treatment-Naïve HIV-2 Infected Subjects [NCT03224338]	Phase 2	30 participants (Actual)	Interventional	2017-04-05	Completed
Phase One, Open Lab Study to Investigate the Impact of Rifampicin Administration on the PK of Dolutegravir When Dosed Once Daily at 50 or 100 mg in Healthy Volunteers [NCT03199690]	Phase 1	16 participants (Anticipated)	Interventional	2017-10-31	Not yet recruiting
A Phase 1, Randomized, Double-Blind, Single-Ascending-Dose, and Food Effect Study to Assess the Safety, Tolerability, Ventricular Repolarization, and Pharmacokinetics of S-648414 in Healthy Adult Study Participants (Part 1); A Phase 1, Randomized, Double- [NCT04147715]	Phase 1	98 participants (Actual)	Interventional	2019-10-09	Completed
The Dolutegravir Antiretroviral Mono-Therapy for HIV Trial [NCT02401828]	Phase 4	134 participants (Actual)	Interventional	2015-03-31	Completed
A Phase IIb, Randomized, Double-blind, Parallel-group Study to Assess the Efficacy, Safety, Tolerability, and Resistance Profile of GSK3640254 in Combination With Dolutegravir Compared to Dolutegravir Plus Lamivudine in HIV-1 Infected, Treatment-naïve Adu [NCT04900038]	Phase 2	85 participants (Actual)	Interventional	2021-08-18	Terminated(stopped due to Company decision to stop compound development. The decision was not based on any safety or efficacy concerns. It reflected the company strategy for portfolio progression.)
Impact of a Dolutegravir-based Regimen on Early Mortality of Severely Immunocompromised AIDS Patients [NCT01837277]	Phase 2/Phase 3	186 participants (Actual)	Interventional	2017-12-15	Completed
Relative Bioavailability Study of a Tablet Formulation vs. Pediatric Granule Formulation of Dolutegravir 50 mg and Effect of Different Types of Water Plus Infant Formula on the Pediatric Granule Formulation in Healthy Male and Female Volunteers [NCT01382238]	Phase 1	20 participants (Actual)	Interventional	2011-06-30	Completed
A Phase IV, Open-label Three-arm Study Investigating the Impact of a Combination of Tenofovir Disoproxil Fumarate/Emtricitabine With Raltegravir or Dolutegravir or Elvitegravir/Cobicistat on Renal Tubular Function and Renal Transporters in HIV-1 Antiretro [NCT02351908]	Phase 4	60 participants (Actual)	Interventional	2015-03-31	Completed
Immune Reconstitution in Severely Immunosuppressed Antiretroviral-naive HIV-1-Infected Patients (<100 CD4+ T Cells/μL) Taking Antiretroviral Regimens Based on Dolutegravir or Ritonavir-boosted Darunavir (the Advanz-4 Trial). [NCT02337322]	Phase 4	104 participants (Actual)	Interventional	2015-03-31	Active, not recruiting
A Trial of the Safety, Tolerability, and Pharmacokinetics of Bedaquiline and Delamanid, Alone and in Combination, Among Participants Taking Multidrug Treatment for Drug-Resistant Pulmonary Tuberculosis [NCT02583048]	Phase 2	84 participants (Actual)	Interventional	2016-08-15	Completed
Defining Antiretroviral Pharmacology Within HIV-1 Reservoirs of Males and Females [NCT02924389]	Phase 4	22 participants (Actual)	Interventional	2016-09-30	Terminated(stopped due to This study terminated early due to the ongoing covid-19 pandemic making it unsafe to recruit participants for in-person visits. Participants are living with HIV who are antiretroviral therapy-naive and are at high risk of COVID-19 complications.)
An Open-Label, Single Dose Study to Investigate the Pharmacokinetics, Safety and Tolerability of GSK1349572 (Dolutegravir, DTG) in Healthy Japanese Subjects [NCT01332565]	Phase 1	10 participants (Actual)	Interventional	2011-04-30	Completed
Dolutegravir, Darunavir/Ritonavir and Optimized NRTI Recycling as a Third-line Antiretroviral Regimen in Cambodia [NCT03602690]	Phase 2	54 participants (Anticipated)	Interventional	2018-10-04	Recruiting
A Phase I, Open Label, Parallel Group, Three Period, Fixed Sequence Crossover Study to Evaluate the Effect of Dolutegravir on Metformin Pharmacokinetics in Healthy Adult Subjects [NCT02064374]	Phase 1	30 participants (Actual)	Interventional	2014-02-28	Completed
A Prospective, Non-interventional Study of the Use of Dolutegravir as Part of Combination Antiretroviral Therapy in Routine Daily Practice in Germany (DOL-ART) [NCT02076386]		411 participants (Actual)	Observational	2014-03-04	Completed
A Randomized, Open-Label, Single-Dose, 3-Period, Crossover Evaluation of the Relative Bioavailability of Two Experimental Fixed-Dose Combination Tablet Formulations of Dolutegravir 50 mg/Abacavir 600 mg/Lamivudine 300 mg Compared to Co-Administered Dolute [NCT01366547]	Phase 1	18 participants (Actual)	Interventional	2011-06-30	Completed
Body Composition Sub-study of the D2EFT Trial [NCT03675815]	Phase 4	155 participants (Actual)	Interventional	2019-12-05	Active, not recruiting
A Pilot Trial Evaluating Maintenance Therapy With Lamivudine(Epivir®) and Dolutegravir(Tivicay®) in Human Immunodeficiency Virus 1 (HIV-1) Infected Patients Virologically Suppressed With Triple HAART - ANRS 167 Lamidol [NCT02527096]	Phase 2	110 participants (Actual)	Interventional	2015-09-17	Completed
A Pilot Phase II Study of a Nucleoside Sparing Regimen of Dolutegravir + Atazanavir/r in HIV-1 Infected Patients With Detectable Viremia (DOLATAV Study) [NCT02542852]	Phase 2	10 participants (Actual)	Interventional	2015-09-30	Completed
A Randomised Non-inferiority Trial With Nested PK to Assess DTG/3TC Fixed Dose Formulations for the Maintenance of Virological Suppression in Children With HIV Infection Aged 2 to <15 Years Old [NCT04337450]	Phase 2/Phase 3	370 participants (Anticipated)	Interventional	2022-04-22	Recruiting
Standard Versus Double Dose Dolutegravir in Patients With HIV-associated Tuberculosis: a Phase 2 Non-comparative Randomised Controlled Trial [NCT03851588]	Phase 2	108 participants (Actual)	Interventional	2019-12-19	Completed
Efficacy of Dolutegravir Plus Lamivudine Compared to Dolutegravir Plus Tenofovir/Emtricitabine in HIV-1-infected Treatment-naïve Adults Without Baseline Genotyping Test (D2ARLING Study) [NCT04549467]	Phase 4	244 participants (Actual)	Interventional	2020-11-17	Active, not recruiting
Evaluating Inflammatory and Immunological Changes of HIV-positive Patients Switching to DTG Dual Regimen Compared to Those Switching to a Triple Drugs Regimen (B/F/TAF) [NCT04054089]	Phase 4	66 participants (Anticipated)	Interventional	2019-09-30	Not yet recruiting
Open Label, Randomized (1:1) Clinical Trial to Evaluate Switching From Dual Regimens Based on Dolutegravir Plus a Reverse Transcriptase Inhibitor to Elvitegravir/Cobicistat/Emtricitabine/Tenofovir Alafenamide in Virologically Suppressed, HIV-1 Infected Pa [NCT03493568]	Phase 3	100 participants (Actual)	Interventional	2017-02-06	Terminated(stopped due to The futility analysis on 24-week results estimated that there was only 2% probability of verifying the study hypothesis of a higher proportion pat. with no residual viremia through 48w in arm E/C/F/TAF)
A Phase III, Randomised, Double-blind, Multicentre, Parallel-group, Non-inferiority Study Evaluating the Efficacy, Safety, and Tolerability of Dolutegravir Plus Lamivudine Compared to Dolutegravir Plus Tenofovir/Emtricitabine in HIV-1-infected Treatment-n [NCT02831764]	Phase 3	722 participants (Actual)	Interventional	2016-07-18	Completed
A Phase III, Randomised, Double Blind, Multicentre, Parallel Group, Non Inferiority Study Evaluating the Efficacy, Safety, and Tolerability of Dolutegravir Plus Lamivudine Compared to Dolutegravir Plus Tenofovir/Emtricitabine in Human Immunodeficiency Vir [NCT02831673]	Phase 3	719 participants (Actual)	Interventional	2016-07-21	Completed
A Prosp., Multic., Randomized, Open-label Trial to Assess the Safety, Tolerability and Efficacy of Dual Therapy With Boosted Darunavir + Dolutegravir When Switching From SOC ART in HIV-patients With Sustained Virological Suppr. [NCT02486133]	Phase 3	269 participants (Actual)	Interventional	2015-07-31	Completed
HIV Drug Resistance Profiles Among Individuals Failing Tenofovir/Lamivudine and Dolutegravir First Line Regimen in Brazil [NCT04453436]		2,500 participants (Anticipated)	Observational [Patient Registry]	2020-09-01	Not yet recruiting
A Phase I, Open Label, Single Sequence,Drug Interaction Study Evaluating Plasma GSK1349572 and Tenofovir Pharmacokinetics in Healthy Adult Subjects (ING111604) [NCT00726336]	Phase 1	16 participants (Anticipated)	Interventional	2008-08-31	Completed
A Phase I Study of the Safety, Tolerability, and Pharmacokinetics of Dolutegravir in Neonates Exposed to HIV-1 [NCT05406583]	Phase 1	36 participants (Anticipated)	Interventional	2022-10-05	Recruiting
A Phase IIIB/IV Randomised Open-label Trial Comparing Dolutegravir With Pharmaco-enhanced Darunavir Versus Dolutegravir With Predetermined Nucleosides Versus Recommended Standard of Care ART Regimens in Patients With HIV-1 Infection Failing First Line The [NCT03017872]	Phase 4	831 participants (Actual)	Interventional	2017-11-23	Active, not recruiting
Phase I/II Study of the Pharmacokinetics, Safety, and Tolerability of Abacavir/Dolutegravir/Lamivudine Dispersible and Immediate Release Tablets in HIV-1-Infected Children Less Than 12 Years of Age [NCT03760458]	Phase 1/Phase 2	57 participants (Actual)	Interventional	2020-09-09	Completed
Pharmacokinetic Properties of Antiretroviral and Related Drugs During Pregnancy and Postpartum [NCT00042289]		1,578 participants (Actual)	Observational	2003-06-09	Completed
A Phase 3b Randomised, Multicentre, Open-label Study Evaluating the Effectiveness of Switching to Two-monthly Long-acting Injectable Cabotegravir and Rilpivirine From First-line Oral Antiretroviral Therapy in HIV-1 Positive Virologically Suppressed Adults [NCT05546242]	Phase 3	540 participants (Anticipated)	Interventional	2022-12-08	Recruiting
A Phase IV Open-label, Multi-centre, Randomised, Dual-arm, Pilot Study to Assess the Feasibility of Switching Individuals Receiving Efavirenz With Continuing Central Nervous System (CNS) Toxicity, to Dolutegravir [NCT02285374]	Phase 4	40 participants (Anticipated)	Interventional	2014-11-30	Not yet recruiting
Drug Interactions Between Dolutegravir and Escalating Doses of Rifampicin [NCT04166474]	Phase 4	36 participants (Actual)	Interventional	2021-11-18	Active, not recruiting
'COMBINE-2': Real-world Evidence for Effectiveness of Two Drug Regimen, Antiretroviral Therapy With Integrase Inhibitors Plus a Reverse Transcriptase Inhibitor [NCT04019873]		1 participants (Actual)	Observational	2019-11-18	Completed
Dolutegravir in Pregnant HIV Mothers and Their Neonates [NCT03249181]	Phase 3	268 participants (Actual)	Interventional	2018-01-22	Completed
Open-label Access to Dolutegravir for HIV-1 Infected Children and Adolescents Completing IMPAACT Studies P1093 and P2019 [NCT03016533]	Phase 3	300 participants (Anticipated)	Interventional	2017-06-07	Recruiting
Dolutegravir-Lamivudine for naïve HIV-Infected Patients With ≤200 CD4/mm3 [NCT04880395]	Phase 4	230 participants (Anticipated)	Interventional	2021-05-20	Recruiting
A Phase I, Open-Label, Parallel-Group Study to Evaluate the Pharmacokinetics and Safety of Dolutegravir in Subjects With Renal Impairment and Healthy Matched Control Subjects (ING113125) [NCT01353716]	Phase 1	16 participants (Actual)	Interventional	2011-06-30	Completed
Open Label Study to Evaluate the Safety and Pharmacokinetics of Elpida® in Healthy Subjects and Patients With Hepatic Impairment, as Well as to Assess the Impact of Food Intake and Drug-Drug Interactions in Case of Co-administration With Other Antiviral D [NCT03706898]	Phase 1	36 participants (Actual)	Interventional	2018-10-01	Completed
Defining the Potency of DTG/3TC for Suppressed HIV Patients in Real-life: the DUALING Study. [NCT04707326]		480 participants (Anticipated)	Observational [Patient Registry]	2019-11-01	Recruiting
Phase I, Open Label, Two Period Study to Evaluate the Effects of Fosamprenavir/Ritonavir on GSK1349572 Pharmacokinetics and a Phase I, Randomized, Three-Way Crossover Study to Evaluate the Relative Bioavailability of Three Tablet Variants Made Using Micro [NCT01209065]	Phase 1	27 participants (Actual)	Interventional	2010-09-30	Completed
A Phase 1, Open Label, Placebo-Controlled Study to Evaluate the Effect of GSK1349572 on Iohexol and Para-Aminohippurate Clearance in Healthy Subjects [NCT01214993]	Phase 1	38 participants (Actual)	Interventional	2010-10-31	Completed
Pharmacokinetics of Single-dose Dolutegravir in HIV-seronegative Subjects With Severe Hepatic Impairment Compared to Matched Controls. [NCT03813979]	Phase 4	0 participants (Actual)	Interventional	2020-11-15	Withdrawn(stopped due to difficult recruitment and delay due to COVID19)
A Phase I, Open-Label, Parallel-Group, Two-Part, Adaptive Study to Evaluate the Pharmacokinetics and Safety of GSK1349572 in Subjects With Hepatic Impairment and Healthy Matched Control Subjects (ING113097) [NCT01231529]	Phase 1	16 participants (Actual)	Interventional	2010-11-19	Completed
AntiRetroviral Therapy In Second-line: Investigating Tenofovir-lamivudine-dolutegravir (ARTIST): a Randomised Controlled Trial [NCT03991013]	Phase 2	192 participants (Actual)	Interventional	2019-08-08	Completed
Bioequivalence of Dotilavir Sodium Tablets in Healthy Subjects: A Single-center, Open, Randomized, Single-dose, Crossover Study [NCT05168176]	Phase 1	64 participants (Anticipated)	Interventional	2021-12-01	Recruiting
A Phase 1, Open Label, Study in Healthy Female Subjects to Describe GSK1349572 Exposure in Blood, Cervicovaginal Fluid, and Cervical and Vaginal Tissue Following Single and Multiple Dosing of GSK1349572 [NCT01404806]	Phase 1	10 participants (Actual)	Interventional	2011-08-31	Completed
Pilot Single-Arm Clinical Trial to Evaluate the Efficacy, PK Interactions and Safety of Dolutegravir Plus 2 NRTIs in HIV-1-Infected Solid Organ Transplant Patients [NCT03360682]	Phase 4	20 participants (Anticipated)	Interventional	2018-04-12	Active, not recruiting
The Effect of Dolutegravir-based ART on Plasma Etonogestrel Levels in HIV-infected Women Using Contraceptive Implants in Botswana [NCT03336346]		148 participants (Actual)	Observational	2017-11-15	Completed
Removal of Dolutegravir by Hemodialysis in HIV-infected Patients With End-stage Renal Disease [NCT02487706]	Phase 4	5 participants (Actual)	Interventional	2015-06-30	Completed
Phase III Study of the Virologic Efficacy and Safety of Dolutegravir-Containing Versus Efavirenz-Containing Antiretroviral Therapy Regimens in HIV-1-Infected Pregnant Women and Their Infants [NCT03048422]	Phase 3	643 participants (Actual)	Interventional	2018-01-19	Completed
A Randomized, Double-Blind Study of the Safety and Efficacy of GSK1349572 Plus Abacavir/Lamivudine Fixed-Dose Combination Therapy Administered Once Daily Compared to Atripla Over 96 Weeks in HIV-1 Infected Antiretroviral Therapy Naive Adult Subjects [NCT01263015]	Phase 3	844 participants (Actual)	Interventional	2011-02-01	Completed
GSK1349572 Repeat Dose Escalation Study [NCT00631592]	Phase 1	44 participants (Actual)	Interventional	2008-02-29	Completed
Observational Assessment of the Nation-wide Roll-out of Dolutegravir in Lesotho [NCT04238767]		1,433 participants (Actual)	Observational [Patient Registry]	2020-02-10	Completed
Doravirine Dose Optimisation in Pregnancy [NCT05630638]	Phase 4	76 participants (Anticipated)	Interventional	2023-10-10	Recruiting
Efficacy and Safety of Dolutegravir + Lamivudine in Antiretroviral Treatment-naive Adults With HIV-1 Infection in a Multicenter Real-life Cohort Study [NCT04638686]		185 participants (Actual)	Observational	2020-06-15	Completed
An Open Label Study Examining the Efficacy and Cardiovascular Risk of Immediate Versus Deferred Switch From a Boosted PI to Dolutegravir (DTG) in HIV Infected Patients With Stable Virological Suppression [NCT02098837]	Phase 4	415 participants (Actual)	Interventional	2014-04-30	Completed
Evaluation of Dolutegravir Interactions With Artemether-Lumefantrine and Amodiaquine-Artesunate [NCT02242799]	Phase 1	46 participants (Actual)	Interventional	2015-06-30	Completed
A Phase 2, Randomized, Double-Blinded Study of the Safety and Efficacy of GS-9883 + Emtricitabine/Tenofovir Alafenamide Versus Dolutegravir + Emtricitabine/Tenofovir Alafenamide in HIV-1 Infected, Antiretroviral Treatment-Naive Adults [NCT02397694]	Phase 2	98 participants (Actual)	Interventional	2015-03-23	Completed
Efficacy and Safety of Early Switching to Dolutegravir/Lamivudine (DTG/3TC) From INSTI-based Three-drug Regimens in HIV-1-infected Adults Previously naïve Who Achieve Virological Suppression [NCT04979468]	Phase 3	440 participants (Anticipated)	Interventional	2021-03-23	Recruiting
Phase 2 Multicentric Open-label Study of Switch From Abacavir/Lamivudine Fixed Dose Combination Plus Nevirapine to Abacavir/Lamivudine/Dolutegravir in Virologically Suppressed HIV-1 Infected Adults [NCT02067767]	Phase 2	53 participants (Actual)	Interventional	2014-02-28	Completed
Efficacy of Doravirine + Dolutegravir Dual Therapy in the Context of Antiretroviral Therapy Switch (DORDOL) [NCT04892654]	Phase 3	150 participants (Anticipated)	Interventional	2022-08-17	Recruiting
Effect of Reducing Nucleotide Exposure on Bone Health (ReNew) [NCT03549689]	Phase 2	0 participants (Actual)	Interventional	2019-08-01	Withdrawn(stopped due to Withdrawn by drug manufacturer)
A Study to Evaluate Dolutegravir Plus Lamivudine Dual Therapy for the Treatment of Naïve HIV-1-infected Participants [NCT02582684]	Phase 2	122 participants (Actual)	Interventional	2015-12-08	Completed
A Phase IIb, Randomized, Partially Blind, Active Controlled, Dose-range Finding Study of GSK3640254 Compared to a Reference Arm of Dolutegravir, Each in Combination With Nucleoside Reverse Transcriptase Inhibitors, in HIV-1 Infected Antiretroviral Treatme [NCT04493216]	Phase 2	169 participants (Actual)	Interventional	2020-11-18	Terminated(stopped due to Company decision to stop compound development. The decision is not based on any safety or efficacy concerns. It reflects the company strategy for portfolio progression.)
Virologic Outcomes of Lamivudine/Dolutegravir in Virologically Suppressed Subjects With Expected or Confirmed Resistance to Lamivudine. [NCT04880785]	Phase 2	121 participants (Actual)	Interventional	2021-07-28	Active, not recruiting
A Prospective, Randomised, Controlled, Open-label, Non-inferiority Trial to Compare the Efficacy of Standard of Care Combination Antiretroviral Therapy With a Simplified Dolutegravir Monotherapy in Patients With a Primary HIV-1 Infection Under Suppressive [NCT02551523]	Phase 2	101 participants (Actual)	Interventional	2016-11-30	Active, not recruiting
A Phase 1, Open Label, Single Sequence, Three Period Study to Evaluate the Single Dose Pharmacokinetics of GSK1349572 100mg Versus 50mg and the Effect of Efavirenz 600mg Once Daily on the Pharmacokinetics, Safety and Tolerability of GSK1349572 50mg Once D [NCT01098526]	Phase 1	12 participants (Actual)	Interventional	2010-03-16	Completed
An Open Label, Comparative, Randomized , Phase IV Pilot Study to Evaluate the Efficacy and Safety of a Rilpivarine-based Antiretroviral Tratment Regimen in HIV- Infected Patients With Liver Metabolic Disease Who Maintain Udetectable HIV Viral Load [NCT05898841]	Phase 4	75 participants (Anticipated)	Interventional	2023-05-26	Recruiting
A Prospective, Single Arm, Open-label 96 Week Observational Trial of the Tolerability, Adherence and Efficacy of a Dolutegravir/Abacavir/Lamivudine Single Tablet Regimen in HIV-1 Antibody Positive People Living With HIV With a History of Injection Drug Us [NCT02659761]	Phase 4	50 participants (Anticipated)	Interventional	2016-11-30	Recruiting
APT-POCT-01: An Open Label, Pharmacokinetic Study of Plasma/Urine/Salivary Drug Concentrations Over Fourteen Days Following Drug Intake Cessation, In HIV-Uninfected Healthy Volunteers Dosing to Steady-state to Further Development of Point of Care Diagnost [NCT04302896]	Early Phase 1	30 participants (Actual)	Interventional	2020-08-31	Completed
Implication for Strategies of Long Term Control of Viral Replication in Patient With Primary HIV Infection (PHI) Treated With Multitarget Antiviral Therapy (MT-ART) [NCT04225325]	Phase 4	112 participants (Anticipated)	Interventional	2018-05-07	Recruiting
A Phase I, Open Label, Randomized, Four-Period Crossover Study to Evaluate the Effects of Maalox® Advanced Maximum Strength and One A Day® Maximum on Pharmacokinetics of GSK1349572 in Healthy Adult Subjects [NCT00858455]	Phase 1	16 participants (Actual)	Interventional	2009-01-31	Completed
Impact of DOlutegravir+Lamivudine Simplification on TIssue and Blood Latent Replication-competent HIV-1 Reservoirs (IDOLTIB Study) [NCT04034862]	Phase 3	36 participants (Actual)	Interventional	2019-10-01	Active, not recruiting
A Randomized, Double Blind Study of the Safety and Efficacy of GSK1349572 50mg Once Daily to Raltegravir 400mg Twice Daily Both Administered With Fixed-dose Dual Nucleoside Reverse Transcriptase Inhibitor Therapy Over 96 Weeks in HIV-1 Infected Antiretrov [NCT01227824]	Phase 3	828 participants (Actual)	Interventional	2010-10-19	Completed
Real Life Study of Dolutegravir Plus Lamivudine in HIV-1-Infected Treatment-Naive Patients [NCT04002323]		139 participants (Anticipated)	Observational [Patient Registry]	2019-05-07	Recruiting
Antiretroviral Treatment Guided by Proviral Genotype: Pilot Trial of Proof of Concept. [NCT03539224]	Phase 2	41 participants (Actual)	Interventional	2017-11-02	Active, not recruiting
Randomized Clinical Trial to Evaluate the Efficacy of a Dolutegravir Monotherapy (Tivicay®) Versus the Maintenance of a Successful Triple Therapy Using Abacavir + Lamivudine + Dolutegravir (Triumeq®) in HIV-1- Infected Patients [NCT02596334]	Phase 3	158 participants (Actual)	Interventional	2015-12-23	Terminated(stopped due to 5 patients on tivicay had virological failure)
An Interventional, One-arm, Open Label Pilot Study to Assess the Feasibility of Dolutegravir Monotherapy in Virologically Suppressed Patients on Conventional Triple Antiretroviral Therapy of Dolutegravir Plus Two Nucleoside Reverse Transcriptase Inhibitor [NCT02572947]	Phase 2	8 participants (Actual)	Interventional	2016-06-30	Completed
Pharmacokinetics, Safety and Efficacy of Atazanavir /Dolutegravir/Lamivudine Regimen as Maintenance Regimen in Patients With Intolerance and/or Resistance to NRTIs, NNRTIs and RTV: A Pilot Study [NCT02566707]	Phase 2	9 participants (Actual)	Interventional	2015-08-31	Terminated(stopped due to due to introduction of another integrase inhibitor, recruitement was not feasible anymore.)
A Phase I, Open Label, Two Period, Single Fixed-Sequence Crossover Study to Evaluate the Effect of Etravirine on GSK1349572 Pharmacokinetics in Healthy Adult Subjects (ING111603) [NCT00774111]	Phase 1	16 participants (Actual)	Interventional	2008-10-31	Completed
A Phase I, Open Label, Randomized, Two Period, One-way Two Sequence Crossover Study to Evaluate the Effect of Darunavir/Ritonavir and Lopinavir/Ritonavir on GSK1349572 Pharmacokinetics in Healthy Adult Subjects (ING111405). [NCT00774735]	Phase 1	30 participants (Actual)	Interventional	2008-10-31	Completed
Bioequivalence Study of CRushed TriUMeq With or Without Drip Feed Compared to the Whole Tablet (SCRUM) [NCT02569346]	Phase 1	22 participants (Actual)	Interventional	2016-03-31	Completed
Pharmacokinetics and Safety of Antiretroviral Drugs in Lactating Women and Breastmilk Fed Infants [NCT04862975]		200 participants (Anticipated)	Observational	2024-01-08	Not yet recruiting
A Phase IIb Study to Select a Once Daily Dose of GSK1349572 Administered With Either Abacavir/Lamivudine or Tenofovir/Emtricitabine in HIV-1 Infected Antiretroviral Therapy Naive Adult Subjects [NCT00951015]	Phase 2	208 participants (Actual)	Interventional	2009-07-30	Completed
A Pilot Study to Assess the Antiviral Activity of GSK1349572 Containing Regimen in Antiretroviral Therapy (ART)-Experienced, HIV-1-infected Adult Subjects With Raltegravir Resistance [NCT00950859]	Phase 2	51 participants (Actual)	Interventional	2009-08-31	Completed
Dolutegravir-Lamivudine as Dual Therapy in naïve HIV-Infected Patients With Documented M184V Mutation:A Pilot Study [NCT05295394]	Phase 4	0 participants (Actual)	Interventional	2019-05-22	Withdrawn(stopped due to Low recruitment, We did not find participants with the M184V mutation , inclusion criteria , throughout 230 resistance tests carried out)
The Official Study Title Exceeds the 300 Character Limit for This Field. See Detailed Study Description Section for Official Study Title. [NCT00942136]	Phase 1	24 participants (Actual)	Interventional	2009-07-31	Completed
Phase I, Open Label, Randomized, Drug-Drug Interaction Study in Healthy Subjects to Investigate the Effects of Co-Administered Atazanavir/Ritonavir (300mg/100mg) or Atazanavir 400mg Administered Once Daily on the Steady-State Plasma Pharmacokinetics of GS [NCT00883935]	Phase 1	24 participants (Actual)	Interventional	2009-04-30	Completed
A Phase 3, Randomized, Double-Blind Study to Evaluate the Safety and Efficacy of GS-9883/Emtricitabine/Tenofovir Alafenamide Versus Dolutegravir + Emtricitabine/Tenofovir Alafenamide in HIV-1 Infected, Antiretroviral Treatment-Naive Adults [NCT02607956]	Phase 3	657 participants (Actual)	Interventional	2015-11-11	Completed
A Phase I, Open Label, Randomized, Two Cohort, Two Period, Oneway Study to Evaluate the Effect of Boceprevir and Telaprevir onDolutegravir Pharmacokinetics in Healthy Adult Subjects (ING115697) [NCT01563328]	Phase 1	32 participants (Actual)	Interventional	2012-03-01	Completed
A Phase I, Open Label, Randomized, Three Period, One-way, Two Cohort, Adaptive Crossover Study to Evaluate the Effect of Darunavir/Ritonavir Plus Etravirine and Lopinavir/Ritonavir Plus Etravirine on GSK1349572 Pharmacokinetics in Healthy Adult Subjects ( [NCT00867152]	Phase 1	17 participants (Actual)	Interventional	2009-04-30	Completed
A Study to Evaluate the Effect of a Single 250 mg Oral Dose of GSK1349572 on Cardiac Conduction as Assessed by 12-lead Electrocardiogram Compared to Placebo and a Single Oral Dose of Moxifloxacin (ING111856). [NCT00996021]	Phase 1	42 participants (Actual)	Interventional	2009-09-30	Completed
Characterization of Acute and Recent HIV-1 Infections in Zurich: a Long-term Observational Study [NCT00537966]		2,017 participants (Anticipated)	Interventional	2002-01-31	Recruiting
A Phase I, Relative Oral Bioavailability Study of Different Fixed Dose Combinations of Dolutegravir and Lamivudine in Healthy Subjects [NCT02738931]	Phase 1	30 participants (Actual)	Interventional	2016-05-31	Completed
A Phase III Randomized, Open Label Trial to Evaluate Dolutegravir Versus Efavirenz 400 mg, Both Combined With Tenofovir Disoproxil Fumarate + Lamivudine for the Initial Management of HIV Infected Adults in Resource-limited Settings [NCT02777229]	Phase 3	616 participants (Actual)	Interventional	2016-07-31	Completed
An Open-Label, Single Sequence, Three-Period Drug Interaction Study of GSK1349572 and Tipranavir/Ritonavir in Healthy Adult Subjects (ING113096) [NCT01068925]	Phase 1	18 participants (Actual)	Interventional	2010-02-15	Completed
An Open-Label, Multi-Centre, Randomised, Switch Study to Evaluate the Virological Efficacy Over 96 Weeks Of 2-Drug Therapy With DTG/RPV FDC in Antiretroviral Treatment-Experienced HIV-1 Infected Subjects Virologically Suppressed With NNRTIs Resistance Mut [NCT05349838]	Phase 3	140 participants (Actual)	Interventional	2018-11-05	Completed
A Phase 3b Multi-center, Open Label, Single Arm, 52-week Study, Evaluating the Feasibility, Efficacy and Safety of Rapid Test and Treat Intervention in Newly Diagnosed HIV-1 Infected Adults Using a Fixed Dose Combination of Dolutegravir Plus Lamivudine (D [NCT03945981]	Phase 3	131 participants (Actual)	Interventional	2019-07-02	Completed
Non-randomized, Sequential, Fixed-sequence Evaluation of Prototype Dolutegravir Liquid Formulations Versus 5mg Dolutegravir Dispersible Tablets Following Single-dose Fasted-state Administrations to Normal Healthy Adult Participants [NCT03921723]	Phase 1	22 participants (Actual)	Interventional	2019-05-07	Completed
Optimizing Malaria Treatment for HIV-Malaria Co-Infected Individuals by Addressing Drug Interactions Between Artemether-Lumefantrine and Efavirenz; a Randomized Controlled Trial [NCT04708496]	Phase 4	888 participants (Anticipated)	Interventional	2021-01-18	Recruiting
Nucleosides And Darunavir/Dolutegravir In Africa (NADIA): a Randomised Controlled Trial of Darunavir Versus Dolutegravir and Tenofovir Versus Zidovudine in Second-line Antiretroviral Therapy Regimens for the Public Health Approach in Sub-Saharan Africa [NCT03988452]	Phase 3	465 participants (Actual)	Interventional	2019-07-30	Active, not recruiting
MULTICENTRE STUDY TO ASSESS CHANGES IN BONE MINERAL DENSITY OF THE SWITCH FROM PROTEASE INHIBITORS TO DOLUTEGRAVIR IN HIV-1-INFECTED SUBJECTS WITH LOW BONE MINERAL DENSITY [NCT01966822]	Phase 3	75 participants (Actual)	Interventional	2014-01-31	Completed
Compassionate Use of Ibalizumab for the Treatment of HIV Infection [NCT02028819]		0 participants	Expanded Access	2012-01-31	No longer available
A Phase 2 Randomized Cross-Over Design Study of the Early Metabolic Effects of Dolutegravir or Tenofovir Alafenamide in Healthy Volunteers [NCT05652478]	Phase 2	120 participants (Anticipated)	Interventional	2024-01-03	Recruiting
Prospective Evaluation of Neurologic and Psychiatric Adverse Events of Rilpivirine, Elvitegravir, or Dolutegravir in a Real Life Setting [NCT02882230]		1 participants (Actual)	Observational	2018-11-19	Terminated(stopped due to Unfavourable opinion of ethical comittee for Amendment Nr 3)
Pharmacokinetics of DOLUTEGRAVIR Once Daily and ELVITEGRAVIR/COBICISTAT Once Daily Over 10 Days Following Drug Intake Cessation in Healthy Volunteers [NCT02219217]	Phase 1	17 participants (Actual)	Interventional	2014-10-31	Completed
The Tolerability of, and Adherence to, Dolutegravir With Co-formulated Tenofovir-emtricitabine for HIV Non-occupational Post-exposure Prophylaxis [NCT02211690]	Phase 4	100 participants (Actual)	Interventional	2014-08-31	Completed
A Phase I, Single Dose, Five-period Crossover Relative Bioavailability Study of a Fixed-dose Combination Dolutegravir/Abacavir/Lamivudine Dispersible Tablet as Compared to a Co-dose of TIVICAY and EPZICOM in Healthy Subjects [NCT02893488]	Phase 1	20 participants (Actual)	Interventional	2016-09-01	Completed
A Two-way Drug Interaction Study to Evaluate the Effect of BMS-955176 on the Pharmacokinetics of Dolutegravir and the Effect of Dolutegravir on the Pharmacokinetics of BMS-955176 [NCT02715479]	Phase 1	14 participants (Actual)	Interventional	2016-04-30	Completed
The Effects of Switching From Dolutegravir/Lamivudine/Abacavir (d/l/a) to Bictegravir/Emtricitabine/Tenofovir Alafenamide (b/f/Taf) in Patients With Suppressed Viral Load on Neuropsychiatric Side Effects and Neurocognitive Function [NCT04155554]	Phase 3	100 participants (Anticipated)	Interventional	2020-01-29	Recruiting
Pharmacokinetics and Safety of Double-dose Dolutegravir When Used With Rifapentine for HIV-associated Tuberculosis [NCT05630872]	Phase 2	30 participants (Anticipated)	Interventional	2024-01-02	Not yet recruiting
Phase 2a Open Label Study, Safety and Tolerability of Combination Antiretroviral Therapy (Triumeq) in Participants With Amyotrophic Lateral Sclerosis (ALS) - The Lighthouse Project. [NCT02868580]	Phase 2	43 participants (Actual)	Interventional	2016-10-31	Completed
The Impact of Co-infections on Inflammation in Patients Commencing Second-line Antiretroviral Therapy. A Sub-study of D²EFT (Dolutegravir and Darunavir Evaluation in Adults Failing Therapy) [NCT04183738]	Phase 4	0 participants (Actual)	Interventional	2021-02-01	Withdrawn(stopped due to In the context of COVID-19 pandemic.)
An Adaptive, Two Part, Two Period, Single Sequence, Drug Interaction Study Between Dolutegravir 50 mg and Prednisone in Adult Healthy Volunteers [NCT01425099]	Phase 1	12 participants (Actual)	Interventional	2011-09-30	Completed
Efficacy, Safety and Tolerability of Switching to Dolutegravir/Lamivudine in Virologically-suppressed Adults Living With HIV on Bictegravir/Tenofovir Alafenamide/emtricitabine-the DYAD Study [NCT04585737]	Phase 4	222 participants (Actual)	Interventional	2020-09-22	Completed
Phase 1/2 Study of Switching to Fixed Dose Combination Dolutegravir/Rilpivirine Among Virologically Suppressed Children, 6 to Less Than 12 Years of Age, Living With HIV-1 [NCT05674656]	Phase 1/Phase 2	20 participants (Anticipated)	Interventional	2023-06-01	Not yet recruiting
Switch to DOVATO in Patients Suppressed on Biktarvy (SOUND) [NCT04826562]	Phase 4	40 participants (Actual)	Interventional	2021-09-26	Active, not recruiting
ENLIGHTEN: Establishing Novel Antiretroviral (ARV) Imaging for Hair to Elucidate Non-Adherence [NCT03218592]	Phase 4	36 participants (Actual)	Interventional	2017-06-28	Completed
Randomized, Non-inferiority Trial Comparing a Dual Maintenance Therapy Strategy With Dolutegravir + Lamivudine (DTG/3TC) or Atazanavir/Ritonavir + Lamivudine (ATV/r+3TC) Versus the Standard WHO First Line Triple Therapy Tenofovir + Lamivudine + Efavirenz [NCT04022967]	Phase 3	480 participants (Actual)	Interventional	2020-09-21	Active, not recruiting
A Randomized, Double-blind Study of the Safety and Efficacy of GSK1349572 50 mg Once Daily Versus Raltegravir 400 mg Twice Daily, Both Administered With an Investigator-selected Background Regimen Over 48 Weeks in HIV-1 Infected, Integrase Inhibitor-Naïve [NCT01231516]	Phase 3	724 participants (Actual)	Interventional	2010-10-26	Completed
Multi Interventional Study Exploring HIV-1 Residual Replication: a Step Towards HIV-1 Eradication and Sterilizing Cure [NCT02961829]		30 participants (Actual)	Interventional	2015-07-31	Completed
A Phase 3b, Multi-center, Randomized, Parallel-group, Open-label, Non-inferiority Study Evaluating the Efficacy, Safety, and Tolerability of Oral Dolutegravir/Lamivudine Once-daily as a First-line Regimen Compared to Oral Bictegravir/Emtricitabine/Tenofov [NCT05979311]	Phase 3	412 participants (Anticipated)	Interventional	2023-12-29	Not yet recruiting
Contribution of the Integrase Inhibitor Dolutegravir to Obesity and Cardiovascular Disease in Persons Living With HIV [NCT04340388]	Phase 4	10 participants (Actual)	Interventional	2020-09-17	Completed
An Open-label, Sequential Non-randomised Pharmacokinetics Study of DTG Plasma Exposure When Given as Twice or Once Daily DTG in the Presence of Rifampicin in Children With HIV and TB Between 20-35kgs in SA [NCT04746547]	Phase 4	20 participants (Anticipated)	Interventional	2021-08-19	Recruiting
A Dolutegravir Open Label Protocol for HIV Infected, Adult and Adolescent Patients With Integrase Resistance [NCT01536873]		200 participants (Anticipated)	Interventional	2012-06-14	Completed
Switch to Maraviroc and Integrase Strand Transfer Inhibitor Combination Therapy (a Triple Class-Sparing Regimen) for the Treatment of HIV-1-Infected Patients on Suppressive Antiretroviral Regimens [NCT01896921]	Phase 3	7 participants (Actual)	Interventional	2013-09-30	Completed
Pharmacokinetic Properties of Antiretroviral and Anti-Tuberculosis Drugs During Pregnancy and Postpartum [NCT04518228]		325 participants (Anticipated)	Observational	2021-06-08	Recruiting
A Phase IV, Open-Label Study to Compare Virologic and Immunologic Responses to Raltegravir and Dolutegravir in the Gastrointestinal Tract of HIV-Positive Men and Women [NCT02218320]		20 participants (Actual)	Observational	2014-10-31	Completed
WRHI 060 (ADVANCE): A Randomised, Phase 3 Non-inferiority Study of DTG + TAF + FTC Compared With DTG + TDF + FTC and EFV + TDF + FTC in Patients Infected With HIV-1 Starting First-line Antiretroviral Therapy - Extension to 192 Weeks [NCT03122262]	Phase 3	1,110 participants (Actual)	Interventional	2017-01-16	Completed
Contraceptives and Dolutegravir-based ART [NCT04910711]	Phase 4	140 participants (Anticipated)	Interventional	2021-10-21	Active, not recruiting
A Phase IIIb, Randomized, Open-label Study of the Safety and Efficacy of Dolutegravir/Abacavir/Lamivudine Once Daily Compared to Atazanavir and Ritonavir Plus Tenofovir/Emtricitabine Once Daily in HIV-1 Infected Antiretroviral Therapy Naïve Women [NCT01910402]	Phase 3	499 participants (Actual)	Interventional	2013-08-22	Completed
A Double-Blind Study to Evaluate the Pharmacokinetics of an Oral Contraceptive Containing Norgestimate and Ethinyl Estradiol When Co-administered With Dolutegravir in Healthy Adult Female Subjects [NCT01498861]	Phase 1	16 participants (Actual)	Interventional	2011-12-31	Completed
An Evaluation of the Bioequivalence of a Combined Formulated Tablet (50mg/600mg/300mg Dolutegravir/Abacavir/Lamivudine) Compared to One Dolutegravir 50mg Tablet and One EPZICOM† (600mg/300mg Abacavir/Lamivudine) Tablet Administered Concurrently and the Ef [NCT01622790]	Phase 1	66 participants (Actual)	Interventional	2012-06-30	Completed
Pilot Study of Dolutegravir Plus Tenofovir/Lamivudine or Emtricitabine in HIV-1 Infected Transgender Women [NCT03033836]	Phase 4	60 participants (Actual)	Interventional	2015-12-31	Completed
A Phase I, Open-label, Fixed-sequence, Two-period, Crossover, Drug-drug Interaction Study to Evaluate the Effect of Multiple Doses of Ganaplacide and Lumefantrine Combination on the Pharmacokinetics of Midazolam, Repaglinide, Dextromethorphan, Metformin, [NCT05236530]	Phase 1	48 participants (Actual)	Interventional	2022-03-09	Completed
A Pilot Study of Rapid HIV Treatment Initiation, Access and Engagement in Care (RHAE) [NCT03512964]		32 participants (Actual)	Interventional	2016-11-29	Completed
Single-Dose Fasting and Fed Pilot BE Study in Healthy Males and Females Not of Childbearing Potential [NCT05030025]	Early Phase 1	43 participants (Actual)	Interventional	2021-08-01	Completed
A Phase 2a, Multicenter, Randomized, Parallel, Double-Blind, Dose Ranging, Placebo-Controlled Study to Compare Antiviral Effect, Safety, Tolerability and Pharmacokinetics of GSK1349572 Monotherapy Versus Placebo Over 10 Days in HIV-1 Infected Adults (ING1 [NCT00708110]	Phase 2	35 participants (Actual)	Interventional	2008-06-30	Completed
What is the Impact of Current HIV Medication Regimens on Endothelial Dysfunction? [NCT03782142]		22 participants (Actual)	Observational	2018-11-01	Completed
A Phase I, Open Label, Randomized, Four-Period Crossover Study to Evaluate the Effects of Calcium Carbonate 1200 mg and Ferrous Fumarate 324 mg on Pharmacokinetics of Dolutegravir 50 mg in Healthy Adult Subjects [NCT01762995]	Phase 1	24 participants (Actual)	Interventional	2012-12-31	Completed
A Phase I, Multiple-Dose, Open-Label, Crossover Study in Healthy Subjects to Assess the Effect of Dolutegravir (DTG) on the Pharmacokinetics (PK) of Cenicriviroc (CVC) and the Effect of CVC on the PK of DTG and on a Single Dose of Midazolam [NCT01827540]	Phase 1	20 participants (Actual)	Interventional	2013-03-31	Completed
A Single-arm Study of the Safety, Efficacy and Central Nervous System and Plasma PK of GSK1349572 (Dolutegravir, DTG) 50 mg Once Daily in Combination With the Abacavir/Lamivudine Fixed Dose Combination Tablet Over 96 Weeks in HIV-1 Infected Antiretroviral [NCT01499199]	Phase 3	13 participants (Actual)	Interventional	2012-01-31	Completed
A Double-Blind, Randomized, Placebo-Controlled, Single Dose Escalation Study to Investigate the Safety, Tolerability and Pharmacokinetics of GSK1349572 in Healthy Subjects [NCT00555035]	Phase 1	20 participants (Actual)	Interventional	2007-11-30	Completed
A Phase III Randomized, Double-blind Study to Demonstrate the Antiviral Activity of Dolutegravir (DTG) 50 mg Twice Daily Versus Placebo Both Co-Administered With a Failing Antiretroviral Regimen Over Seven Days, Followed by an Open Label Phase With All Su [NCT01568892]	Phase 3	30 participants (Actual)	Interventional	2012-04-18	Completed
A Phase 1, Open-Label, 2-Period Drug Interaction Study to Assess Steady State Plasma Methadone Enantiomer Pharmacokinetics Following Co-Administration of Methadone QD With Dolutegravir (GSK1349572) 50 mg Twice Daily in Opiate-Dependent, HIV Seronegative A [NCT01467518]	Phase 1	11 participants (Actual)	Interventional	2011-12-31	Completed
A Phase 1, Open-Label, Crossover Study to Evaluate the Pharmacokinetics and Safety of GSK1265744 and Rilpivirine and Dolutegravir and Rilpivirine in Healthy Adult Subjects [NCT01467531]	Phase 1	28 participants (Actual)	Interventional	2011-11-30	Completed
A 2-Part, Phase I, Single Dose, Crossover Relative Bioavailability Study of Both TIVICAY 10 mg Conventional Tablets and 5 mg Dispersible Tablets Compared to Conventional TIVICAY Tablets in Fasted Healthy Adult Subjects [NCT03095638]	Phase 1	38 participants (Actual)	Interventional	2017-05-03	Completed
A Phase I, Open-label, Single-dose Study to Investigate the Pharmacokinetics, Safety and Tolerability of Dolutegravir + Rilpivirine (JULUCA™) 50 mg/25 mg Tablets in Healthy Participants of Japanese Descent [NCT03984838]	Phase 1	16 participants (Actual)	Interventional	2019-06-17	Completed
Gut Microbiota, Pharmacogenetics and Integrase Strand Transfer Inhibitors Response [NCT04805944]		200 participants (Anticipated)	Observational	2021-03-05	Recruiting
The Effect of Dolutegravir on Whole-body Insulin Sensitivity, Lipid and Endocrine Profile in Healthy Volunteers [NCT04771754]	Phase 1	16 participants (Anticipated)	Interventional	2022-03-20	Recruiting
Dolutegravir Impact on Residual Replication: Dolutegravir Intensification Study [NCT02500446]	Phase 4	40 participants (Actual)	Interventional	2015-09-28	Completed
Phase I, Open-Label Study in Healthy Male Subjects Describing GSK1349572 Exposure in Blood Plasma, Seminal Fluid and Rectal Mucosal Tissue Following Single and Multiple Dosing [NCT01459315]	Phase 1	14 participants (Actual)	Interventional	2011-11-30	Completed
Changes in Weight and Body Composition After Switch to Dolutegravir/Lamivudine Compared to Continued Dolutegravir/Abacavir/Lamivudine for Virologically Suppressed HIV Infection: A Randomized Open-label Superiority Trial: AVERTAS-1 [NCT04904406]	Phase 4	95 participants (Anticipated)	Interventional	2020-10-22	Recruiting
A Phase 2b Study to Evaluate the Efficacy, Safety and PK of a Combination of Bictegravir, Emtricitabine, and Tenofovir Alafenamide Fumarate for Treatment of HIV-1 Infection in Patients With Drug-susceptible Tuberculosis on a Rifampicin-based Regimen [NCT04734652]	Phase 2	120 participants (Anticipated)	Interventional	2022-02-18	Recruiting
A Phase 1, Drug-Drug Interaction Study to Evaluate the Safety, Tolerability, and the Induction Potential of TBAJ-876 on CYP3A4 and P-glycoprotein and the Inhibition Potential of TBAJ-876 on P-glycoprotein in Healthy Adult Subjects [NCT05526911]	Phase 1	28 participants (Actual)	Interventional	2022-07-20	Completed
Efficacy and Safety of a Simplification Strategy Based on Dolutegravir and Darunavir / Cobicistat vs Optimized Treatment in Suppressed HIV-1-infected Patients Carrying Archived Multidrug Resistance Mutations. [NCT03683524]	Phase 4	96 participants (Actual)	Interventional	2018-11-19	Completed
Effect of Dolutegravir Intensification on Blood and Tissue Latent HIV-1 Reservoirs and on Residual Viremia Despite ART [NCT05351684]	Phase 2	20 participants (Actual)	Interventional	2019-01-01	Completed
Dolutegravir-Lamivudine as Dual Therapy in Naive HIV-Infected Patients: A Pilot Study [NCT02211482]	Phase 4	20 participants (Actual)	Interventional	2014-10-31	Completed
A Randomized, Double-Blinded, Placebo-Controlled Trial Comparing Antiretroviral Intensification With Maraviroc and Dolutegravir With No Intensification or Intensification With Dolutegravir Alone for the Treatment of Cognitive Impairment in HIV [NCT02519777]	Phase 4	191 participants (Actual)	Interventional	2016-04-21	Completed
Drug Interaction Potential Between Dolutegravir and Simeprevir in HIV/Hepatitis C Virus (HCV) Seronegative Volunteers [NCT02404805]		25 participants (Actual)	Interventional	2016-02-29	Completed
Pharmacokinetic Study of an Optimized Dose Ratio of Dolutegravir/Emtricitabine/Tenofovir Alafenamide Fumarate: Expediting a UNIVERSAL First Line Regimen for All Children Living With HIV in Africa [NCT05993767]	Phase 2	50 participants (Anticipated)	Interventional	2024-01-31	Not yet recruiting
Dolutegravir Antiretroviral Strategy to Promote Improvement and Reduce Drug Exposure (ASPIRE) Study [NCT02263326]	Phase 3	89 participants (Actual)	Interventional	2014-12-31	Completed
Kinetics of HIV-RNA Decay in Seminal Plasma of Men Receiving a Dolutegravir-based Regimen at the Time of Primary HIV Infection (IMEA 051-DOLUPRIM Study) [NCT02976259]	Phase 3	20 participants (Actual)	Interventional	2017-01-31	Completed
A Retrospective Study to Evaluate the Safety and Efficacy of a Nucleoside-Sparing Regimen of Darunavir, Ritonavir, and Dolutegravir [NCT03198884]		20 participants (Actual)	Observational	2017-01-01	Completed
HERV-K Suppression Using Antiretroviral Therapy in Volunteers With Amyotrophic Lateral Sclerosis (ALS) [NCT02437110]	Phase 1	122 participants (Actual)	Interventional	2019-04-01	Active, not recruiting
A Phase IIIb, Randomized, Open-label Study of the Safety and Efficacy of GSK1349572 (Dolutegravir, DTG) 50 mg Once Daily Compared to Darunavir/Ritonavir (DRV/r) 800 mg/100 mg Once Daily Each Administered With Fixed-dose Dual Nucleoside Reverse Transcripta [NCT01449929]	Phase 3	488 participants (Actual)	Interventional	2011-10-31	Completed
A Study Evaluating the Efficacy and Tolerability of Dolutegravir Plus Lamivudine in HIV Infected Adults Who Are Virologically Suppressed and With Evidence of TDF Toxicity [NCT05493969]	Phase 4	100 participants (Anticipated)	Interventional	2022-08-31	Not yet recruiting
Population Pharmacokinetics of Antiretroviral in Children [NCT03194165]		65 participants (Actual)	Observational	2017-06-16	Completed
Randomised Double-Blind Placebo-Controlled Phase 3 Trial of Triumeq in Amyotrophic Lateral Sclerosis [NCT05193994]	Phase 3	390 participants (Anticipated)	Interventional	2022-02-24	Recruiting
Antiretroviral Therapy for Acute and Chronic HIV Infection [NCT00796263]	Phase 3	722 participants (Anticipated)	Interventional	2009-04-30	Recruiting
A Prospective Phase Ib/IIa, Active-controlled, Randomized, Open-label Study to Evaluate the Safety, Tolerability, Extended Early Bactericidal Activity and Pharmacokinetics of Multiple Oral Doses of BTZ-043 Tablets in Subjects With Newly Diagnosed, Uncompl [NCT04044001]	Phase 1/Phase 2	77 participants (Actual)	Interventional	2019-11-15	Completed
Safety and Pharmacokinetics of Dolutegravir in Pregnant HIV Mothers and Their Neonates: A Pilot Study [NCT02245022]	Phase 2/Phase 3	60 participants (Actual)	Interventional	2017-03-14	Completed
A Phase 2b Randomized, Active-Controlled, Staged, Open-Label Trial to Investigate Safety and Efficacy of BMS-955176/GSK3532795 in Combination With Dolutegravir and Atazanavir (With or Without Ritonavir) in Treatment-Experienced HIV-1 Infected Adults [NCT02386098]	Phase 2	86 participants (Actual)	Interventional	2015-07-08	Terminated(stopped due to GI Intolerability)
Obesogenic Origins of Maternal and Child Metabolic Health Involving Dolutegravir [NCT04991402]		1,900 participants (Anticipated)	Observational	2021-09-21	Recruiting
Changes in Weight After Switch to Dolutegravir/Lamivudine or Doravirine/Tenofovir/Lamivudine Compared to Continued Treatment With Dolutegravir/Tenofovir/Lamivudine for Virologically Suppressed HIV Infection. AVERTAS-2 [NCT04903847]	Phase 4	126 participants (Anticipated)	Interventional	2021-02-02	Recruiting
DTG/3TC vs. BIC/FTC/TAF Maintenance Therapy in People Living With HIV: an Open-label Randomized Clinical Trial [NCT04884139]	Phase 4	555 participants (Anticipated)	Interventional	2021-07-14	Active, not recruiting
The Pharmacokinetics of Dolutegravir, Darunavir/Cobocistat When Co-administered in Healthy Volunteers [NCT03094507]	Phase 1	21 participants (Actual)	Interventional	2017-04-19	Completed
Darunavir/Cobicistat and Dolutegravir to Maintain Virologic Suppression and Reduce NRTI-associated Toxicity (The 'deNUC' Study; TMC114HIV2030) [NCT02499978]	Phase 2/Phase 3	0 participants (Actual)	Interventional	2016-05-31	Withdrawn
The Efficacy and Safety of Dolutegravir-based Dual Therapies in HIV-infected Patients With Intolerance or Toxicity to Nucleoside Analogues [NCT02491242]		155 participants (Actual)	Observational [Patient Registry]	2015-11-30	Completed
Long-term Safety of Subjects Continuing Dolutegravir After Participation in Clinical Studies of Dolutegravir in Russian Federation [NCT03314064]	Phase 4	43 participants (Actual)	Interventional	2016-12-08	Completed
Open Label, Single Arm, Two-stage Trial to Evaluate the Single and Multi-dose Pharmacokinetics and Safety of the Paediatric Dolutegravir (10 mg, Scored) Dispersible Tablet in HIV-exposed Neonates [NCT05590325]	Phase 1/Phase 2	56 participants (Anticipated)	Interventional	2022-09-12	Recruiting
Prospective Non-Interventional Observational Study of Use of Triumeq® and Corresponding Monitoring Measures in Clinical Practice in Germany [NCT02342769]		403 participants (Actual)	Observational	2015-02-19	Completed
Drug-Drug Interactions Between Rifapentine and Dolutegravir in HIV/LTBI Co-Infected Individuals [NCT04272242]	Phase 2	72 participants (Anticipated)	Interventional	2020-08-01	Suspended(stopped due to Following completion of Arm 1, A5372 is currently Temporarily Closed. Timeline for opening of Arm 2 is not available.)
Randomized Clinical Trial to Evaluate the Interest of a Down-scaled Treatment Strategy Using Dual Therapy (Nucleoside Analogs) in HIV Infected Patients Already Being Treated Using Triple Therapy, Who Present With a Successful Virological Control and for W [NCT02302547]	Phase 3	224 participants (Actual)	Interventional	2014-12-31	Completed
A Phase III Study to Demonstrate the Antiviral Activity and Safety of Dolutegravir in HIV-1 Infected Adult Subjects With Treatment Failure on an Integrase Inhibitor Containing Regimen. [NCT01328041]	Phase 3	183 participants (Actual)	Interventional	2011-05-31	Completed
Safety, Tolerability and Drug-drug Interactions of Short-course Treatment of Latent Tuberculosis Infection With High-dose Once-weekly Rifapentine and Isoniazid (3HP) Among Infants, Children and Adolescents Living With HIV Taking Dolutegravir-based Antiret [NCT05122767]	Phase 1/Phase 2	92 participants (Anticipated)	Interventional	2023-05-24	Recruiting
Booster-free Antiretroviral Therapy for Persons Living With HIV and Multidrug Resistance: A Multicentre Multi-stage Randomized Trial [NCT06037564]	Phase 4	210 participants (Anticipated)	Interventional	2023-11-13	Enrolling by invitation
An Open Label Study to Investigate the Safety and Efficacy of Abacavir/Lamivudine/Dolutegravir and the Pharmacokinetic Profile of Dolutegravir in HIV-infected Patients of 60 Years of Age and Older [NCT02509195]	Phase 4	40 participants (Anticipated)	Interventional	2015-08-04	Completed
HIV Reservoir Dynamics After Switching to Dolutegravir in Patients With Two NRTI and a Protease Inhibitor Based Regimen. A Phase IV Open Randomized Trial [NCT02513147]	Phase 4	44 participants (Actual)	Interventional	2015-06-30	Completed
A Pilot Study on the Efficacy of DTG Plus 3TC for Prophylaxis of Mother-to-child Transmission of HIV Infection in Pregnant Women Who Have Detectable Viral Load After 14 Weeks of Gestation [NCT04808973]	Phase 3	20 participants (Actual)	Interventional	2021-07-01	Completed
IGHID 11417 - The Safety and Efficacy of Fixed Dose Combination Dolutegravir/Abacavir/Lamivudine FDC Initiated During Acute HIV Infection: Impact on the Latent HIV Reservoir and Long-Term Immunologic Effect [NCT02384395]		40 participants (Actual)	Interventional	2015-09-30	Completed
[information is prepared from clinicaltrials.gov, extracted Sep-2024]

Trial Outcomes

Trial	Outcome
NCT00042289 (26) [back to overview]	PK Parameter: Cord/Maternal Blood Concentration Ratio With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	Number of Women Who Met PK Target of Area Under the Curve (AUC) for ARVs
NCT00042289 (26) [back to overview]	Number of Women Who Met PK Target of Area Under the Curve (AUC) for ARVs
NCT00042289 (26) [back to overview]	Area Under the Curve From 0 to 24 Hours (AUC24) of ARVs for Contraceptive Arms
NCT00042289 (26) [back to overview]	Area Under the Curve From 0 to 12 Hours (AUC12) of ARVs for Contraceptive Arms
NCT00042289 (26) [back to overview]	Plasma Concentration for Contraceptives
NCT00042289 (26) [back to overview]	PK Parameter: Cord/Maternal Blood Concentration Ratio With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	Pharmacokinetic (PK) Parameter: Infant Plasma Washout Half-life (T1/2) of ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Geometric Mean (95% CI) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	Pharmacokinetic (PK) Parameter: Infant Plasma Washout Concentration of ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Maximum Concentration (Cmax) in ng/mL With Median (95% CI) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Maximum Concentration (Cmax) in ng/mL With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Trough Concentration (C12) With Geometric Mean (95% CI) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Trough Concentration (C12) With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Trough Concentration (C12) With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Trough Concentration (C24) With Median (IQR) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Trough Concentration (C24) With Median (Range) for ARVs and TB Drugs
NCT00042289 (26) [back to overview]	PK Parameter: Trough Concentration (C24) With Median (Range) for ARVs and TB Drugs
NCT00708110 (25) [back to overview]	Area Under the Plasma Concentration-time Curve From Time Zero (Pre-dose) Extrapolated to Infinite Time (AUC[0-inf]) and Over 24 Hours (AUC[0-24]) of GSK1349572 Following Dose Administration on Day 1
NCT00708110 (25) [back to overview]	Change From Baseline in Mean Blood Pressure at Days 1, 4, 7, and 10
NCT00708110 (25) [back to overview]	Change From Baseline in Mean Heart Rate at Days 1, 4, 7, and 10
NCT00708110 (25) [back to overview]	Maximum Observed Plasma Concentration (Cmax) and Concentration at 24 Hours Post Dose (C24) of GSK1349572 Following Dose Administration on Day 1
NCT00708110 (25) [back to overview]	Number of Participants Who Received the Indicated Concomitant Medications During the Study Period
NCT00708110 (25) [back to overview]	Number of Participants With Abnormal Electrocardiogram (ECG) Findings
NCT00708110 (25) [back to overview]	Number of Participants With Any Non-serious Adverse Event (AE) or Serious Adverse Event (SAE)
NCT00708110 (25) [back to overview]	Number of Participants With HIV-1 RNA <400 Copies/mL and <50 Copies/mL
NCT00708110 (25) [back to overview]	Number of Participants With the Indicated Grade 3 and Grade 4 Laboratory Abnormalities
NCT00708110 (25) [back to overview]	Pre-dose Concentration (C0), Concentration at the End of the Dosing Interval (Ctau), Minimum Observed Concentration During One Dosing Interval (Cmin), and Maximum Obsevered Plasma Concentration (Cmax) of GSK1349572 Following the Last Repeat Administration
NCT00708110 (25) [back to overview]	Time to Maximum Observed Concentration (Tmax) and Absorption Lag Time (Tlag) of GSK1349572 Following Dose Administration on Day 1
NCT00708110 (25) [back to overview]	Median Change From Baseline in Plasma HIV-1 RNA to Nadir (Maximum Change) at Day 11
NCT00708110 (25) [back to overview]	Number of Participants With the Emergence of Drug Resistance Mutations
NCT00708110 (25) [back to overview]	Median Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Count at Day 11
NCT00708110 (25) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA to Nadir (Maximum Change) at Day 11
NCT00708110 (25) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA Levels During the Follow-up Period (Days 11 to 21)
NCT00708110 (25) [back to overview]	Change From Baseline in Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) at Day 11
NCT00708110 (25) [back to overview]	Area Under the Concentration-time Curve Over the Dosing Interval (AUC[0-tau]) of GSK1349572 Following the Last Repeat Administration on Day 10
NCT00708110 (25) [back to overview]	Apparent Clearance (CL/F) of GSK1349572 Following Dose Administration on Day 10
NCT00708110 (25) [back to overview]	Apparent Clearance (CL/F) of GSK1349572 Following Dose Administration on Day 1
NCT00708110 (25) [back to overview]	Plasma HIV-1 RNA Rate of Decline Over 10 Days
NCT00708110 (25) [back to overview]	Median Change From Baseline in Plasma HIV-1 RNA Levels During the Follow-up Period (Days 11 to 21)
NCT00708110 (25) [back to overview]	Terminal Half-life (t1/2) of GSK1349572 Following Dose Administration on Day 1
NCT00708110 (25) [back to overview]	Terminal Half-life (t1/2) of GSK1349572 Following the Last Repeat Administration on Day 10
NCT00708110 (25) [back to overview]	Time to the Maximum Observed Concentration (Tmax) of GSK1349572 Following the Last Repeat Administration on Day 10
NCT00950859 (18) [back to overview]	Number of Participants (Cumulative) With Protocol-defined Virological Failure (PDVF) at Day 11 and Weeks 8, 12, 16, 20, 24, 32, 40, 48, 60, 72, 84, 96, Week 108 Every 12 Weeks up to Study Completion
NCT00950859 (18) [back to overview]	Median Fold Change in Sensitivity to DTG by the Baseline (Day 1) IN Mutational Group
NCT00950859 (18) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA at Day 6 to 8, Day 11, Weeks 4, 12, 24, 48, 72, 96, From Week 108 Every 12 Weeks up to Study Completion
NCT00950859 (18) [back to overview]	Cmax, Cmin, and Ctau of DTG
NCT00950859 (18) [back to overview]	Proportion of Participants Who Achieved Plasma HIV-1 RNA <400 c/mL and <50 c/mL From Week 48 Every 12 Weeks up to Study Completion
NCT00950859 (18) [back to overview]	AUC0-24 Assessment of DTG
NCT00950859 (18) [back to overview]	Number of Participants Who Achieved HIV-1 RNA <400 Copies (c)/Milliliter (mL) or at Least 0.7 log10 c/mL Below Their Baseline Value at Day 11
NCT00950859 (18) [back to overview]	Tmax of DTG
NCT00950859 (18) [back to overview]	C0 Assessment of DTG
NCT00950859 (18) [back to overview]	Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Protocol-defined Virologic Failure (PDVF) as a Measure of Genotypic Resistance
NCT00950859 (18) [back to overview]	Number of Participants With the Indicated HIV-1 Associated Conditions, Excluding Recurrences
NCT00950859 (18) [back to overview]	Change From Baseline in CD4+ Cell Count at Day 11 and Weeks 4, 12, 24, 48, 72, 96, Week 108 Every 12 Weeks up to Study Completion
NCT00950859 (18) [back to overview]	Number of Participants With the Indicated Grade 3 and Grade 4 Hematological Toxicities
NCT00950859 (18) [back to overview]	Number of Participants With the Indicated Grade 3 and Grade 4 Clinical Chemistry Toxicities
NCT00950859 (18) [back to overview]	Number of Participants With the Indicated Genotypic Resistance at Baseline
NCT00950859 (18) [back to overview]	Number of Participants With the Indicated Fold Increase in DTG FC (Fold Change in IC50 Relative to Wild-type Virus) Between Baseline and the Time of PDVF, as a Measure of Post-Baseline Phenotypic Resistance
NCT00950859 (18) [back to overview]	Number of Participants With HIV-1 Associated Disease Progression With the Indicated Shifts to CDC Class C or Death
NCT00950859 (18) [back to overview]	Number of Participants Who Achieved Plasma HIV-1 RNA <400 c/mL and <50 c/mL at Baseline and Weeks 4, 12, 24, 48, 72, and 96: TLOVR Analysis.
NCT00951015 (22) [back to overview]	Number of Participants With the Indicated Treatment-emergent Major Mutations of Other Classes Detected at the Time of Protocol-defined Virologic Failure (PDVF), as a Measure of Genotypic Resistance
NCT00951015 (22) [back to overview]	Number of Participants With Any Adverse Event (AE) and Any Serious Adverse Events (SAE)
NCT00951015 (22) [back to overview]	Relationship Between the Indicated Safety Parameters at Week 96 and the Indicated Plasma DTG PK Parameters
NCT00951015 (22) [back to overview]	Relationship Between the Change From Baseline in CD4+ Cell Counts at Week 96 and the Indicated Plasma DTG PK Parameters
NCT00951015 (22) [back to overview]	Relationship Between Gastrointestinal System Organ Class AEs of Special Interest at Week 96 and the Indicated Plasma DTG PK Parameters
NCT00951015 (22) [back to overview]	Pre-dose Concentration (C0) and C0 Avg of DTG
NCT00951015 (22) [back to overview]	Plasma DTG Concentration
NCT00951015 (22) [back to overview]	Number of Participants With the Indicated Type of HIV-1 Disease Progression (AIDS or Death)
NCT00951015 (22) [back to overview]	Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Protocol-defined Virologic Failure (PDVF), as a Measure of Genotypic Resistance
NCT00951015 (22) [back to overview]	Number of Participants With the Indicated Grade 1 to Grade 4 Treatment-emergent Clinical Chemistry and Hematology Toxicities
NCT00951015 (22) [back to overview]	Number of Participants With the Indicated Fold Increase in DTG FC (Fold Change in IC50 Relative to Wild-type Virus) at the Time of PDVF, as a Measure of Post-Baseline Phenotypic Resistance
NCT00951015 (22) [back to overview]	Number of Participants With Plasma HIV-1 RNA <50 c/mL
NCT00951015 (22) [back to overview]	Number of Participants With Plasma HIV-1 RNA <400 c/mL
NCT00951015 (22) [back to overview]	Number of Participants With Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 16
NCT00951015 (22) [back to overview]	AUC(0-tau) of DTG
NCT00951015 (22) [back to overview]	Time to Maximal Drug Concentration (Tmax) of DTG
NCT00951015 (22) [back to overview]	Viral Change Over the Initial 2 Weeks of Treatment
NCT00951015 (22) [back to overview]	Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Counts at the Indicated Time Points
NCT00951015 (22) [back to overview]	Change From Baseline in HIV-1 RNA at the Indicated Time Points
NCT00951015 (22) [back to overview]	Maximal Concentration (Cmax), Minimal Concentration (Cmin), and Concentration at the End of Dosing Interval (Ctau) of DTG
NCT00951015 (22) [back to overview]	Relationship Between the Change From Baseline in Plasma HIV-1 RNA at Week 2 and the Indicated Plasma DTG PK Parameters
NCT00951015 (22) [back to overview]	Number of Participants With New HIV-associated Conditions of the Indicated Class
NCT01227824 (12) [back to overview]	Number of Participants With the Indicated Post-Baseline HIV-associated Conditions and Progression, Excluding Recurrences
NCT01227824 (12) [back to overview]	Number of Participants With Detectable HIV-1 Virus That Has Genotypic or Phenotypic Evidence of INI Resistance.
NCT01227824 (12) [back to overview]	Maximum Plasma Concentration (Cmax) and Concentration at the End of a Dosing Interval (Ctau) of DTG
NCT01227824 (12) [back to overview]	Percentage of Participants With Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) [HIV-1RNA] <50 Copies (c)/Milliliter (mL) Through Week 48
NCT01227824 (12) [back to overview]	Number of Participants With Plasma HIV-1 RNA <50 c/mL
NCT01227824 (12) [back to overview]	Area Under the Plasma Concentration-time Curve From Time Zero to Time Tau [AUC(0-tau)] of DTG
NCT01227824 (12) [back to overview]	Change From Baseline in Plasma HIV-1 RNA Over Time
NCT01227824 (12) [back to overview]	Change From Baseline in Cluster of Differentiation (CD)4+ Cell Counts Over Time
NCT01227824 (12) [back to overview]	Absolute Values in Plasma HIV-1 RNA Over Time
NCT01227824 (12) [back to overview]	Absolute Values in CD4+ Cell Counts Over Time
NCT01227824 (12) [back to overview]	Number of Participants With Plasma HIV-1 RNA <400 c/mL
NCT01227824 (12) [back to overview]	Number of Participants With the Indicated Grade 1 to 4 Clinical Chemistry and Hematology Toxicities/Laboratory Adverse Events (AEs)
NCT01231516 (14) [back to overview]	DTG PK Parameters Including Maximum Plasma Drug Concentration (Cmax), Minimal Plasma Drug Concentration (Cmin), and Average Plasma Pre-dose Concentration (C0_avg)
NCT01231516 (14) [back to overview]	DTG PK Parameter Including Pre-dose Concentration (C0)
NCT01231516 (14) [back to overview]	Change From Baseline in European Quality of Life-5 Dimensions-3 Levels (EQ-5D-3L) Utility Score
NCT01231516 (14) [back to overview]	Change From Baseline in European Quality of Life-5 Dimensions-3 Levels (EQ-5D-3L) Thermometer Scores
NCT01231516 (14) [back to overview]	Change From Baseline in CD4+ Cell Counts at Weeks 4, 8, 12,16, 24, 32, 40, 48, 96 and 144
NCT01231516 (14) [back to overview]	Absolute Values of Cluster of Differentiation 4+ (CD4+) Cell Counts at Baseline (Day 1) and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 96 and 144
NCT01231516 (14) [back to overview]	Number of Participants With Plasma HIV-1 RNA <400 c/mL at Week 24 and Week 48
NCT01231516 (14) [back to overview]	Number of Participants With Plasma HIV-1 RNA <50 c/mL at Week 24
NCT01231516 (14) [back to overview]	Number of Participants (Par.) With Detectable Virus That Has Genotypic or Phenotypic Evidence of Treatment-emergent Integrase Inhibitor (INI) Resistance at Time of Protocol Defined Virology Failure (PDVF)
NCT01231516 (14) [back to overview]	DTG PK Parameters Including Area Under the Plasma Concentration-time Curve From Time Zero to Time Tau Over a Dosing Interval at Steady State (AUC[0-tau])
NCT01231516 (14) [back to overview]	Number of Participants With Post-Baseline HIV-associated Conditions, Excluding Recurrences, and Disease Progressions
NCT01231516 (14) [back to overview]	Percentage of Participants With HIV-1 Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 48
NCT01231516 (14) [back to overview]	Number of Participants With Post-Baseline Emergent Grade 1 to 4 Clinical Chemistry and Hematology Toxicities
NCT01231516 (14) [back to overview]	Number of Participants With Post-Baseline Emergent Grade 1 to 4 Clinical Chemistry and Hematology Toxicities
NCT01263015 (11) [back to overview]	Number of Participants With a Confirmed Plasma HIV-1 RNA Level >=1000 c/mL at or After Week 16 and Before Week 24, or a Confirmed Plasma HIV-1 RNA Level >=200 c/mL at or After Week 24
NCT01263015 (11) [back to overview]	Number of Participants With the Indicated Genotypic Resistance With Virological Failure (VF) Through 144
NCT01263015 (11) [back to overview]	Number of Participants With the Indicated Grade 1 to 4 Clinical and Hematology Toxicities at Week144
NCT01263015 (11) [back to overview]	Number of Participants With the Indicated Post-baseline HIV-associated Conditions and Progression, Excluding Recurrences at Week 144
NCT01263015 (11) [back to overview]	Percentage of Participants With Plasma Human Immunodeficiency Virus -1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 96 and Week 144
NCT01263015 (11) [back to overview]	Change From Baseline in the Symptom Bother Score (SBS) at Week 4 Through Week 48
NCT01263015 (11) [back to overview]	Change From Baseline in CD4+ Cell Counts at Week 144
NCT01263015 (11) [back to overview]	Time to Viral Suppression (<50 c/mL)
NCT01263015 (11) [back to overview]	Change From Baseline in CD4+ Cell Counts at Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96, 108, 120, 132 and 144
NCT01263015 (11) [back to overview]	Change From Baseline in Plasma HIV-1 RNA at Weeks 2, 4, 8, 12, 16, 24, 32, 40,48, 60, 72, 84, 96, 108, 120, 132 and 144
NCT01263015 (11) [back to overview]	Proportion of Subjects Responding Based on Plasma HIV-1 RNA <50 c/mL at Week 48
NCT01328041 (19) [back to overview]	Number of Participants With HIV-1 RNA Less Than 50 Copies/mL at Week 24
NCT01328041 (19) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA at Day 8
NCT01328041 (19) [back to overview]	Ratio of CD4+/CD8+ Cell Count at Baseline and Weeks 4, 12, 24, and 48
NCT01328041 (19) [back to overview]	Number of Participants With the Maximum Post-Baseline-emergent Hematology Toxicities of the Indicated Grade
NCT01328041 (19) [back to overview]	Number of Participants With the Maximum Post-Baseline-emergent Clinical Chemistry Toxicities of the Indicated Grade
NCT01328041 (19) [back to overview]	Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Protocol-defined Virologic Failure (PDVF) as a Measure of Genotypic Resistance
NCT01328041 (19) [back to overview]	Number of Participants With the Indicated Fold Increase in DTG FC (Fold Change in IC50 Relative to Wild-type Virus) Between Baseline and the Time of PDVF, as a Measure of Post-Baseline Phenotypic Resistance
NCT01328041 (19) [back to overview]	Number of Participants With Adverse Events of the Indicated Severity, Per the Division of Acquired Immune Deficiency Syndrome (DAIDS) Grading Scale
NCT01328041 (19) [back to overview]	Number of Participants With Plasma HIV-1 RNA Less Than 400 and 50 Copies/mL From Week 48 Every 12 Weeks up to Study Completion
NCT01328041 (19) [back to overview]	Number of Participants With Plasma HIV-1 RNA Less Than 400 and 50 Copies/mL at Baseline; Day 8; and Weeks 4, 8, 12, 16, 24, 32, 40, and 48
NCT01328041 (19) [back to overview]	Number of Participants With HIV-1 Disease Progression (Acquired Immune Deficiency Syndrome [AIDS] or Death)
NCT01328041 (19) [back to overview]	Number of Participants With Any Adverse Event (AE) or Any Serious Adverse Event (SAE)
NCT01328041 (19) [back to overview]	Median Change From Baseline in CD4+ Cell Counts at Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and From Week 48 Every 12 Weeks Until Study Completion
NCT01328041 (19) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA at Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and From Week 48 Every 12 Weeks up to Study Completion
NCT01328041 (19) [back to overview]	Cmax and Ctau of DTG
NCT01328041 (19) [back to overview]	C0 Assessment of DTG
NCT01328041 (19) [back to overview]	AUC(0-tau) and AUC(0-24) of DTG
NCT01328041 (19) [back to overview]	Absolute Values for CD4+ Cell Counts at Baseline, Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and 48 and for CD8+ Cell Counts at Baseline and Weeks 4, 12, 24, and 48
NCT01328041 (19) [back to overview]	Number of Participants With HIV-1 RNA Less Than 50 Copies/mL at Week 48
NCT01449929 (16) [back to overview]	Number of Participants With HIV-1 Associated Disease Progression With the Indicated Shift to CDC Class C, or New CDC Class C or Death at Week 48
NCT01449929 (16) [back to overview]	Percentage of Participants With Grade 2 or Higher Abnormalities in Fasting LDL Cholesterol Through Week 48
NCT01449929 (16) [back to overview]	Percentage of Participants With Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 48
NCT01449929 (16) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <400 c/mL at Week 48
NCT01449929 (16) [back to overview]	Human Immunodeficiency Virus Treatment Satisfaction Questionnaire (HIVTSQ) Convenience Score at Week 4, Week 24, and Week 48
NCT01449929 (16) [back to overview]	Human Immunodeficiency Virus Treatment Satisfaction Questionnaire (HIVTSQ) Lifestyle/Ease Sub Score at Week 4, Week 24, and Week 48
NCT01449929 (16) [back to overview]	Change From Baseline in Plasma HIV-1 RNA (log10 c/mL) at Weeks 4, 8, 12, 16, 24, 36 and 48
NCT01449929 (16) [back to overview]	Number of Participants (Par.) With Detectable Virus That Has Genotypic or Phenotypic Evidence of Treatment-emergent Resistance to DTG, DRV+RTV and Other On-study ART at Time of Protocol Defined Virology Failure (PDVF)
NCT01449929 (16) [back to overview]	Change From Baseline in European Quality of Life -5 Dimensions (EQ-5D) Utility Scores at Week 24 and Week 48
NCT01449929 (16) [back to overview]	Change From Baseline in EQ-5D Thermometer Scores at Week 24 and Week 48
NCT01449929 (16) [back to overview]	Change From Baseline in CD4+ and CD8+ Cell Counts
NCT01449929 (16) [back to overview]	Change From Baseline in Acquired Immune Deficiency Syndrome (AIDS) Clinical Trials Group (ACTG) Symptom Distress Module (SDM) Bother Score at Week 4, Week 24, and Week 48
NCT01449929 (16) [back to overview]	Time to Virologic Suppression (<50 Copies/mL) Through Week 48
NCT01449929 (16) [back to overview]	Change From Baseline in Fasting Low-density Lipoprotein (LDL) Cholesterol Through Week 48
NCT01449929 (16) [back to overview]	Number of Participants With the Indicated Grade 3 and Grade 4 Maximum Post-Baseline Chemistry and Hematology Laboratory Toxicities
NCT01449929 (16) [back to overview]	Human Immunodeficiency Virus Treatment Satisfaction Questionnaire (HIVTSQ) Total Score at Week 4, Week 24, and Week 48
NCT01499199 (16) [back to overview]	The Ratio of Total and Unbound DTG Concentrations Between Cerebrospinal Fluid (CSF) and Plasma at Week 2 and Week 16
NCT01499199 (16) [back to overview]	The Numbers of Participants (Par.) With Clinical Adverse Events or Laboratory Abnormalities
NCT01499199 (16) [back to overview]	Plasma DTG Unbound Fraction at Week 2 and Week 16
NCT01499199 (16) [back to overview]	Pearson Correlation Between CSF DTG Concentration and Absolute Values and Change From Baseline (CFB) in CSF HIV-1 RNA at Week 2, Week 16, and Overall
NCT01499199 (16) [back to overview]	Number of Participants With Treatment-emergent Genotypic and Phenotypic Resistance to DTG and Other Antiretroviral Therapy (ART)
NCT01499199 (16) [back to overview]	Number of Participants With the Indicated Number of Copies of HIV-1 RNA in Both the CSF and Plasma at Baseline, Week 2, and Week 16
NCT01499199 (16) [back to overview]	Number of Participants With Post-Baseline HIV-1-associated Conditions, Including Recurrences
NCT01499199 (16) [back to overview]	Number of Participants With CSF HIV-1 RNA <50 Copies/Milliliter (c/mL) at Baseline, Week 2, and Week 16
NCT01499199 (16) [back to overview]	DTG Concentrations in CSF at Weeks 2 and Week 16
NCT01499199 (16) [back to overview]	Absolute Values and Change From Baseline in Plasma Human Immunodeficiency Virus (HIV-1) Ribonucleic Acid (RNA) Levels at Weeks 2, 4, 8, 12, 16, 24, 36, 48, 60, 72, 84, and 96
NCT01499199 (16) [back to overview]	Absolute Values and Change From Baseline in CSF HIV-1 RNA Levels at Week 2 and Week 16
NCT01499199 (16) [back to overview]	Absolute Values and Change From Baseline in Cluster of Differentiation 8+ (CD8+) Cell Counts at Weeks 4, 12, 16, 24, 48, and 96
NCT01499199 (16) [back to overview]	Absolute Values and Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Counts at Weeks 4, 8, 12, 16, 24, 36, 48, 60, 72, 84, and 96
NCT01499199 (16) [back to overview]	Unbound DTG Plasma Concentrations at Week 2 and Week 16
NCT01499199 (16) [back to overview]	Total DTG Plasma Concentrations at Week 2 and Week 16
NCT01499199 (16) [back to overview]	Number of Participants With Plasma HIV-1 RNA <50 Copies Per Milliliter (c/mL) at Baseline and Weeks 2, 4, 8, 12, and 16
NCT01568892 (48) [back to overview]	Change From Baseline in Cholesterol, Chloride, Carbon Dioxide (CO2)/Bicarbonate (HCO3), Glucose, High Density Lipoprotein Cholesterol, Potassium, Low Density Lipoprotein (LDL) Cholesterol, Sodium, Phosphorus, Triglycerides and Urea/Blood Urea Nitrogen
NCT01568892 (48) [back to overview]	Change From Baseline in Basophils, Eosinophils, Lymphocytes, Monocytes, Total Neutrophils, Platelet and White Blood Cell (WBC) Count
NCT01568892 (48) [back to overview]	Change From Baseline in Basophils, Eosinophils, Lymphocytes, Monocytes, Total Neutrophils, Platelet and White Blood Cell (WBC) Count
NCT01568892 (48) [back to overview]	Change From Baseline in Alkaline Phosphatase (ALP), Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST) and Creatine Kinase
NCT01568892 (48) [back to overview]	Change From Baseline in Alkaline Phosphatase (ALP), Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST) and Creatine Kinase
NCT01568892 (48) [back to overview]	Change From Baseline in Albumin Level
NCT01568892 (48) [back to overview]	Absolute Values in Plasma HIV-1 RNA Over Time
NCT01568892 (48) [back to overview]	Absolute Values in Plasma HIV-1 RNA Over Time
NCT01568892 (48) [back to overview]	Absolute Values in Cluster of Differentiation 8+ (CD8+) Cell Counts Over Time
NCT01568892 (48) [back to overview]	Absolute Values in Cluster of Differentiation 4+ (CD4+) Cell Counts Over Time
NCT01568892 (48) [back to overview]	Absolute Values in Cluster of Differentiation 4+ (CD4+) Cell Counts Over Time
NCT01568892 (48) [back to overview]	Number of Participants With Clinically Significant Electrocardiogram (ECG) Findings
NCT01568892 (48) [back to overview]	Mean Change From Baseline in Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) at Day 8
NCT01568892 (48) [back to overview]	Cmax of DTG
NCT01568892 (48) [back to overview]	AUC(0-tau) of DTG
NCT01568892 (48) [back to overview]	Plasma DTG Pre-dose Concentration (C0) at Day 8, Day 28, and Week 24; and Average DTG C0 (C0 Avg) at Week 24
NCT01568892 (48) [back to overview]	Plasma DTG Pre-dose Concentration (C0) at Day 8, Day 28, and Week 24; and Average DTG C0 (C0 Avg) at Week 24
NCT01568892 (48) [back to overview]	Number of Participants With the Maximum Post-Baseline-emergent Hematology Toxicities of the Indicated Grade
NCT01568892 (48) [back to overview]	Number of Participants With the Maximum Post-Baseline-emergent Clinical Chemistry Toxicities of the Indicated Grade
NCT01568892 (48) [back to overview]	Number of Participants With the Indicated Type of HIV-1 Disease Progression (Acquired Immunodeficiency Syndrome [AIDS] or Death [DT])
NCT01568892 (48) [back to overview]	Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Defined Virologic Failure (PDVF), as a Measure of Genotypic Resistance
NCT01568892 (48) [back to overview]	Number of Participants With the Indicated Fold Increase in Fold Change (FC) in the 50% Inhibitory Concentration Relative to Wild-type Virus for DTG (i.e. PDVF FC/Baseline FC Ratio) at the Time of PDVF, as a Measure of Phenotypic Resistance
NCT01568892 (48) [back to overview]	Number of Participants With Plasma HIV-1 RNA <50 c/mL Over Time
NCT01568892 (48) [back to overview]	Number of Participants With Plasma HIV-1 RNA <400 c/mL Over Time
NCT01568892 (48) [back to overview]	Number of Participants With Any Adverse Event (Serious and Non-serious) of the Indicated Grade
NCT01568892 (48) [back to overview]	Median Change From Baseline in CD8+ Cell Counts Over Time
NCT01568892 (48) [back to overview]	Median Change From Baseline in CD4+ Cell Counts Over Time
NCT01568892 (48) [back to overview]	Median Change From Baseline in CD4+ Cell Counts Over Time
NCT01568892 (48) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA Over Time
NCT01568892 (48) [back to overview]	Mean Change From Baseline in Plasma HIV-1 RNA Over Time
NCT01568892 (48) [back to overview]	Change From Baseline in Total Bilirubin (T. Bil) and Creatinine Levels
NCT01568892 (48) [back to overview]	Change From Baseline in Total Bilirubin (T. Bil) and Creatinine Levels
NCT01568892 (48) [back to overview]	Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP)
NCT01568892 (48) [back to overview]	Change From Baseline in Red Blood Cell Count
NCT01568892 (48) [back to overview]	Change From Baseline in Red Blood Cell Count
NCT01568892 (48) [back to overview]	Change From Baseline in Mean Corpuscle Volume
NCT01568892 (48) [back to overview]	Change From Baseline in Mean Corpuscle Volume
NCT01568892 (48) [back to overview]	Change From Baseline in Lipase Levels
NCT01568892 (48) [back to overview]	Change From Baseline in Lipase Levels
NCT01568892 (48) [back to overview]	Change From Baseline in Hemoglobin Level
NCT01568892 (48) [back to overview]	Change From Baseline in Hemoglobin Level
NCT01568892 (48) [back to overview]	Change From Baseline in Hematocrit Level
NCT01568892 (48) [back to overview]	Change From Baseline in Hematocrit Level
NCT01568892 (48) [back to overview]	Change From Baseline in Heart Rate
NCT01568892 (48) [back to overview]	Change From Baseline in Creatinine Clearance
NCT01568892 (48) [back to overview]	Change From Baseline in Creatinine Clearance
NCT01568892 (48) [back to overview]	Change From Baseline in Cholesterol, Chloride, Carbon Dioxide (CO2)/Bicarbonate (HCO3), Glucose, High Density Lipoprotein Cholesterol, Potassium, Low Density Lipoprotein (LDL) Cholesterol, Sodium, Phosphorus, Triglycerides and Urea/Blood Urea Nitrogen
NCT01568892 (48) [back to overview]	Number of Participants Who Discontinued Study Treatment Due to AEs
NCT01837277 (1) [back to overview]	Early Mortality
NCT01896921 (3) [back to overview]	Number of Participants With Adverse Events
NCT01896921 (3) [back to overview]	Number of Patients Virologically Suppressed (HIV RNA <50 Copies/ml) at 48 Weeks.
NCT01896921 (3) [back to overview]	Number of Patients Who Are Virologically Suppressed (HIV RNA < 50 Copies/ml)
NCT01910402 (48) [back to overview]	Change From Baseline in Carbon Dioxide, Electrolytes, Lipids, Glucose, Urea at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Carbon Dioxide, Electrolytes, Lipids, Glucose, Urea at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in CD4+ Cell Count at Indicated Timepoints-Continuation Phase
NCT01910402 (48) [back to overview]	Change From Baseline in Creatinine Clearance at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Erythrocyte Mean Corpuscular Volume at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Erythrocytes at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Hematocrit Count at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Lipase at Indicated Timepoints
NCT01910402 (48) [back to overview]	Change From Baseline in Plasma HIV-1 RNA at Indicated Time Points-Continuation Phase
NCT01910402 (48) [back to overview]	Change From Baseline in Plasma HIV-1 RNA at Indicated Time Points-Randomized Phase
NCT01910402 (48) [back to overview]	Change From Baseline in Total CHLS/HDL CHLS Ratio at Indicated Timepoints
NCT01910402 (48) [back to overview]	Change From Baseline in Type I Collagen C-telopeptides at Indicated Timepoints
NCT01910402 (48) [back to overview]	Change From Baseline in Urine Albumin Creatinine Ratio at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Vitamin D, Vitamin D2 and Vitamin D3 at Week 24 and Week 48
NCT01910402 (48) [back to overview]	HIVTSQs Total Score at Indicated Timepoints
NCT01910402 (48) [back to overview]	Number of Participants With AEs by Maximum Toxicity-Continuation Phase
NCT01910402 (48) [back to overview]	Number of Participants With AEs by Maximum Toxicity-Randomized Phase
NCT01910402 (48) [back to overview]	Number of Participants With Any Adverse Events (AEs), and Serious Adverse Events (SAEs)-Randomized Phase
NCT01910402 (48) [back to overview]	Number of Participants With Any AEs, and SAEs in Continuation Phase
NCT01910402 (48) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities-Continuation Phase
NCT01910402 (48) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities-Randomized Phase
NCT01910402 (48) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities-Continuation Phase
NCT01910402 (48) [back to overview]	Change From Baseline in CD4+ Cell Count at Indicated Timepoints-Randomized Phase
NCT01910402 (48) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities-Randomized Phase
NCT01910402 (48) [back to overview]	Number of Participants With Post-Baseline HIV-1 Disease Progression for DTG 50 mg/ABC 600 mg/3TC 300 mg QD (Randomized + Continuation Phase)
NCT01910402 (48) [back to overview]	Number of Participants With Post-Baseline HIV-1 Disease Progression-Randomized Phase
NCT01910402 (48) [back to overview]	Number of Participants With Treatment Emergent Resistances for ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200mg QD (Randomized Phase)
NCT01910402 (48) [back to overview]	Number of Participants With Treatment Emergent Resistances for DTG 50 mg/ABC 600 mg/3TC 300 mg QD (Randomized + Continuation Phase)
NCT01910402 (48) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 and <400 c/mL Over Time-Randomized Phase
NCT01910402 (48) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL in Continuation Phase
NCT01910402 (48) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 Copies/mL at Week 48 by Subgroups
NCT01910402 (48) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 Copies/mL at Week 48 by Subgroups
NCT01910402 (48) [back to overview]	Change From Baseline in Albumin at Indicated Timepoints
NCT01910402 (48) [back to overview]	Change From Baseline in Basophils, Eosinophils, Lymphocytes, Monocytes at Indicated Time Points
NCT01910402 (48) [back to overview]	Change From Baseline in Bilirubin and Creatinine at Indicated Timepoints
NCT01910402 (48) [back to overview]	Change From Baseline in Bone Specific Alkaline Phosphatase, Osteocalcin and Procollagen 1 N-terminal Propeptide at Indicated Timepoints
NCT01910402 (48) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 Copies/mL at Week 48
NCT01910402 (48) [back to overview]	Change From Baseline in TC/HDL Ratio at Week 48
NCT01910402 (48) [back to overview]	Change From Baseline in Triglycerides at Week 48
NCT01910402 (48) [back to overview]	Number of Participants Who Withdrew From Treatment Due to AEs-Continuation Phase
NCT01910402 (48) [back to overview]	Number of Participants Who Withdrew From Treatment Due to AEs-Randomized Phase
NCT01910402 (48) [back to overview]	Change From Baseline in Alanine Aminotransferase, Alkaline Phosphatase, Aspartate Aminotransferase, Creatine Kinase at Indicated Time Points
NCT01910402 (48) [back to overview]	Absolute Values in CD4+ Cell Count at Indicated Timepoints-Continuation Phase
NCT01910402 (48) [back to overview]	Absolute Values in CD4+ Cell Count at Indicated Timepoints-Randomized Phase
NCT01910402 (48) [back to overview]	Absolute Values in Plasma HIV-1 RNA at Indicated Time Points-Continuation Phase
NCT01910402 (48) [back to overview]	Absolute Values in Plasma HIV-1 RNA at Indicated Time Points-Randomized Phase
NCT01910402 (48) [back to overview]	Bone Specific Alkaline Phosphatase, Osteocalcin, Procollagen 1 N-terminal Propeptide, Type 1 Collagen C-Telopeptide, Vitamin D Ratio of Week 48 Results Over Baseline
NCT01910402 (48) [back to overview]	Change From Baseline at Week 48 in SF-12 Total Score, MCS and PCS
NCT02218320 (3) [back to overview]	Rectal Tissue Concentrations of Ralegravir and Dolutegravir
NCT02218320 (3) [back to overview]	RNA Concentrations From Gastrointestinal Tissues
NCT02218320 (3) [back to overview]	Percentage of Total CD8+ T-cells With CCR5 Expression
NCT02263326 (8) [back to overview]	Change in LDL Cholesterol From Baseline to Week 48
NCT02263326 (8) [back to overview]	Change in Creatinine Clearance From Baseline to Week 48
NCT02263326 (8) [back to overview]	Change in CD4 Count From Baseline to Week 48
NCT02263326 (8) [back to overview]	Residual Viremia by HIV-1 Single-copy Assay
NCT02263326 (8) [back to overview]	Proportion of Participants With Virologic Success
NCT02263326 (8) [back to overview]	Proportion of Participants With Treatment Failure
NCT02263326 (8) [back to overview]	Drug Resistance Associated Mutations
NCT02263326 (8) [back to overview]	Change in Total Cholesterol From Baseline to Week 48
NCT02384395 (4) [back to overview]	Proportion of Treated Participants With HIV-1 RNA to <50 Copies/mL at Week 48
NCT02384395 (4) [back to overview]	Median Change HIV-1 RNA Level Among Participants Completing Week 24 Visit
NCT02384395 (4) [back to overview]	Number of Participants With Grade 3 or Higher Adverse Event (AE)
NCT02384395 (4) [back to overview]	Number of Participants With Viral Load Measurement <200 Copies/mL at Week 24
NCT02386098 (8) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <40 c/mL at Weeks 48 and 96-Stage 1
NCT02386098 (8) [back to overview]	Percentage of Participants With HIV-1 RNA <200 c/mL at Weeks 24, 48 and 96-Stage 1
NCT02386098 (8) [back to overview]	Change From Baseline in Logarithm to the Base 10 (log10) HIV-1 RNA Over Time-Stage 1
NCT02386098 (8) [back to overview]	Number of Participants With Occurrence of New Acquired Immunodeficiency Syndrome (AIDS) Defining Events-Stage 1
NCT02386098 (8) [back to overview]	Percentage of Participants With Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <40 Copies Per Milliliter (c/mL) at Week 24-Stage 1
NCT02386098 (8) [back to overview]	Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Count Over Time-Stage 1
NCT02386098 (8) [back to overview]	Change From Baseline in Percentage of CD4+ Cells Over Time-Stage 1
NCT02386098 (8) [back to overview]	Number of Participants With Serious Adverse Events (SAEs) and Adverse Events (AEs) Leading to Discontinuation (AELD)-Stage 1
NCT02397694 (16) [back to overview]	Percentage of Participants With HIV-1 RNA < 50 Copies/mL as Determined by the FDA-defined Snapshot Algorithm.
NCT02397694 (16) [back to overview]	Percentage of Participants With Treatment Emergent Adverse Events (TEAEs) During Double-Blinded Randomized Phase
NCT02397694 (16) [back to overview]	The Change From Baseline in CD4+ Cell Count at Week 24
NCT02397694 (16) [back to overview]	The Change From Baseline in CD4+ Cell Count at Week 48
NCT02397694 (16) [back to overview]	The Change From Baseline in Cluster of Differentiation 4 Positive (CD4+) Cell Count at Week 12
NCT02397694 (16) [back to overview]	The Change From Baseline in log10 HIV-1 RNA at Week 12
NCT02397694 (16) [back to overview]	The Change From Baseline in log10 HIV-1 RNA at Week 24
NCT02397694 (16) [back to overview]	Percentage of Participants With Treatment Emergent Laboratory Abnormalities During Double-Blind Randomized Phase
NCT02397694 (16) [back to overview]	PK Parameter:Ctau for BIC, FTC and TFV
NCT02397694 (16) [back to overview]	Percentage of Participants With HIV-1 RNA < 50 Copies/mL as Determined by the FDA-defined Snapshot Algorithm at Week 12
NCT02397694 (16) [back to overview]	The Change From Baseline in log10 HIV-1 RNA at Week 48
NCT02397694 (16) [back to overview]	PK Parameter: AUCtau for BIC, FTC, TAF, and TFV
NCT02397694 (16) [back to overview]	PK Parameter: Cmax for Bictegravir (BIC), Emtricitabine (FTC), Tenofovir Alafenamide (TAF) and Tenofavir (TFV) at Steady-State
NCT02397694 (16) [back to overview]	PK Parameter: t1/2 of BIC, FTC, TAF, and TFV
NCT02397694 (16) [back to overview]	PK Parameter: Tmax for BIC, FTC, TAF, and TFV at Steady-State
NCT02397694 (16) [back to overview]	Percentage of Participants With HIV-1 RNA < 50 Copies/mL as Determined by the FDA-defined Snapshot Algorithm at Week 48
NCT02404805 (2) [back to overview]	Dolutegravir AUC Pharmacokinetics
NCT02404805 (2) [back to overview]	Simeprevir AUC Pharmacokinetics
NCT02519777 (17) [back to overview]	Change in CD4+ T-cell Count
NCT02519777 (17) [back to overview]	Number of Participants With Plasma HIV-1 RNA Greater Than or Equal to 50 Copies/mL
NCT02519777 (17) [back to overview]	Change in Log10 MIP-1 Beta in Cerebrospinal Fluid (CSF) at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 sTNFr-II in Plasma at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 sCD14 in Plasma at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 Neopterin in CSF at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Normalized Composite Neurocognitive Test Score at Weeks 24, 72, and 96 From Baseline
NCT02519777 (17) [back to overview]	Change in Functional Status Scores
NCT02519777 (17) [back to overview]	Change in CD8+ T-cell Count
NCT02519777 (17) [back to overview]	CD8+ T-cell Counts
NCT02519777 (17) [back to overview]	CD4+ T-cell Counts
NCT02519777 (17) [back to overview]	Number of Participants With Treatment Related Adverse Events (AEs)
NCT02519777 (17) [back to overview]	Change in Normalized Composite Neurocognitive Test Score at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 VCAM in Plasma at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 MIP-1 Beta in Plasma at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 NFL in CSF at Week 48 From Baseline
NCT02519777 (17) [back to overview]	Change in Log10 IP-10 in CSF at Week 48 From Baseline
NCT02582684 (12) [back to overview]	Proportion of Participants With Plasma HIV-1 RNA <200 Copies/mL- ITT Missing = Ignored
NCT02582684 (12) [back to overview]	Proportion of Participants With Plasma HIV-1 RNA <50 Copies/mL - Missing = Ignored
NCT02582684 (12) [back to overview]	Proportion of Participants With Plasma HIV-1 RNA <50 Copies/mL- As Treated
NCT02582684 (12) [back to overview]	CD4+ Cell Count
NCT02582684 (12) [back to overview]	Number of HIV-1 Drug Resistance Mutation Occurrences in Participants
NCT02582684 (12) [back to overview]	Fasting Lipids and Glucose
NCT02582684 (12) [back to overview]	Proportion of Participants With Plasma HIV-1 RNA <200 Copies/mL- As Treated
NCT02582684 (12) [back to overview]	Creatinine Clearance
NCT02582684 (12) [back to overview]	Change in CD4+ Cell Count
NCT02582684 (12) [back to overview]	Number of Participants With Grade 3 of Higher Adverse Events
NCT02582684 (12) [back to overview]	Proportion of Participants With Plasma HIV-1 RNA < 200 Copies/mL - Missing = Failure
NCT02582684 (12) [back to overview]	Proportion of Participants With Plasma HIV-1 RNA < 50 Copies/mL - Missing = Failure
NCT02583048 (22) [back to overview]	Percentage of Participants With an Occurrence of QTcF Greater Than 500 Milliseconds (ms)
NCT02583048 (22) [back to overview]	Mean Change From Baseline in QTcF
NCT02583048 (22) [back to overview]	N-monodesmethyl Metabolite of BDQ PK Parameter Cmax Determined Based on BDQ Metabolite Levels From Individual Participants Enrolled in Arms 1 and 3
NCT02583048 (22) [back to overview]	Percentage of Participants Who Discontinued Study TB Drug(s) For Any Reason
NCT02583048 (22) [back to overview]	Percentage of Participants With an Increase in QTcF From Baseline of Greater Than 60 Milliseconds (ms)
NCT02583048 (22) [back to overview]	Percentage of Participants Who Died
NCT02583048 (22) [back to overview]	Percentage of Participants With an Occurrence of QTcF >480 and ≤500 Milliseconds (ms)
NCT02583048 (22) [back to overview]	Percentage of Participants With an Occurrence of QTcF Increase From Baseline of >30 and ≤60 Milliseconds (ms)
NCT02583048 (22) [back to overview]	BDQ PK Parameter Area Under the Concentration Time Curve (AUC 0-22h) Calculated Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 1 and 3
NCT02583048 (22) [back to overview]	BDQ PK Parameter Maxmum Plasma Concentration (Cmax) Determined Based on BDQ Levels From Individual Participants Enrolled in Arms 1 and 3
NCT02583048 (22) [back to overview]	BDQ PK Parameter Minimum Plasma Concentration (Cmin) Determined Based on BDQ Levels From Individual Participants Enrolled in Arms 1 and 3
NCT02583048 (22) [back to overview]	Changes in QTcF From Baseline
NCT02583048 (22) [back to overview]	DLM Metabolite DM6705 PK AUC 0-11h Determined Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 2 and 3
NCT02583048 (22) [back to overview]	DLM Metabolite DM6705 PK Parameter Cmax Determined Based on DLM Metabolite Levels From Individual Participants Enrolled in Arms 2 and 3
NCT02583048 (22) [back to overview]	DLM Metabolite DM6705 PK Parameter Cmin Determined Based on DLM Metabolite Levels From Individual Participants Enrolled in Arms 2 and 3
NCT02583048 (22) [back to overview]	DLM PK Area Under the Concentration Time Curve (AUC 0-11h) Determined Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 2 and 3
NCT02583048 (22) [back to overview]	DLM PK Parameter Cmax Determined Based on DLM Levels From Individual Participants Enrolled in Arms 2 and 3
NCT02583048 (22) [back to overview]	N-monodesmethyl Metabolite of BDQ PK Parameter AUC 0-22h Calculated Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 1 and 3
NCT02583048 (22) [back to overview]	N-monodesmethyl Metabolite of BDQ PK Parameter Cmin Determined Based on BDQ Metabolite Levels From Individual Participants Enrolled in Arms 1 and 3
NCT02583048 (22) [back to overview]	Percentage of Participants With an Occurrence of Grade 3 or Higher Adverse Event
NCT02583048 (22) [back to overview]	Post-Baseline QTcF
NCT02583048 (22) [back to overview]	DLM PK Parameter Cmin Determined Based on DLM Levels From Individual Participants Enrolled in Arms 2 and 3
NCT02607956 (18) [back to overview]	Change From Baseline in CD4+ Cell Count at Week 96
NCT02607956 (18) [back to overview]	Change From Baseline in CD4+ Cell Count at Week 48 Open-Label
NCT02607956 (18) [back to overview]	Change From Baseline in CD4+ Cell Count at Week 96 Open-Label
NCT02607956 (18) [back to overview]	Change From Baseline in CD4+ Cell Count at Week 48
NCT02607956 (18) [back to overview]	Change From Baseline in CD4+ Cell Count at Week 144
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 96 Open-Label as Defined by Missing = Excluded Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 96 Open-Label as Defined by Missing = Failure Algorithm
NCT02607956 (18) [back to overview]	Change From Baseline in log10 HIV-1 RNA at Week 48
NCT02607956 (18) [back to overview]	Change From Baseline in log10 HIV-1 RNA at Week 96
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 20 Copies/mL at Week 144 as Defined by the US FDA-Defined Snapshot Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 20 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm
NCT02607956 (18) [back to overview]	Change From Baseline in log10 HIV-1 RNA at Week 144
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 144 as Defined by the US FDA-Defined Snapshot Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 48 Open-Label as Defined by Missing = Excluded Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 48 Open-Label as Defined by Missing = Failure Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 96 as Defined by the US FDA-Defined Snapshot Algorithm
NCT02607956 (18) [back to overview]	Percentage of Participants Who Achieved HIV-1 RNA < 20 Copies/mL at Week 96 as Defined by the US FDA-Defined Snapshot Algorithm
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in EQ-5D-5L Utility Score at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in EQ-5D-5L Utility Score at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in EQ-5D-5L Thermometer Scores at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in EQ-5D-5L Thermometer Scores at Week 144
NCT02831673 (64) [back to overview]	CD4+ Cell Counts at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 144
NCT02831673 (64) [back to overview]	CD4+ Cell Counts at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 96
NCT02831673 (64) [back to overview]	Percentage of Participants With Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/mL (c/mL) at Week 48
NCT02831673 (64) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 96
NCT02831673 (64) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 24
NCT02831673 (64) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Bone Biomarkers-Serum Bone Specific Alkaline Phosphatase (Bone-ALP), Serum Osteocalcin, Serum Procollagen 1 N-Terminal Propeptide (PINP) and Serum Type I Collagen C-Telopeptides (CTX-1) at Weeks 24, 48
NCT02831673 (64) [back to overview]	Time to Viral Suppression (HIV-1 RNA <50 c/mL) up to Week 144
NCT02831673 (64) [back to overview]	CD4+ Cell Counts at Weeks 24 and 48
NCT02831673 (64) [back to overview]	Change From Baseline in Bone Biomarker-Serum Vitamin D at Weeks 24, 48
NCT02831673 (64) [back to overview]	Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in EuroQol - 5 Dimensions - 5 Levels (EQ-5D-5L) Thermometer Scores at Weeks 4, 24 48
NCT02831673 (64) [back to overview]	Change From Baseline in EuroQol - 5 Dimensions - 5 Levels (EQ-5D-5L) Utility Score at Weeks 4, 24, 48
NCT02831673 (64) [back to overview]	Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 96
NCT02831673 (64) [back to overview]	Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum Cystatin C and Serum Retinol Binding Protein (RBP) at Weeks 24, 48
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) and Serum or Plasma GFR From Creatinine Adjusted Using CKD-EPI at Weeks 24, 48
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 96
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 144 by Subgroups
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 24 and 48
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 24 by Subgroups
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 48 by Subgroups
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 96 by Subgroups
NCT02831673 (64) [back to overview]	Number of Participants Who Discontinue Treatment Due to AEs Over Weeks 24, 48, 96
NCT02831673 (64) [back to overview]	Number of Participants With AEs by Maximum Severity Grades up to Week 144
NCT02831673 (64) [back to overview]	Number of Participants With Any AE and SAE up to Week 148
NCT02831673 (64) [back to overview]	Number of Participants With Any Drug Related AEs and Drug Related AEs by Maximum Grade up to Week 144
NCT02831673 (64) [back to overview]	Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 144
NCT02831673 (64) [back to overview]	Number of Participants Who Discontinue Treatment Due to AEs Over Week 144
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 96
NCT02831673 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum RBP at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Weeks 24, 48
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum RBP at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 96
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 144
NCT02831673 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 96
NCT02831673 (64) [back to overview]	Number of Participants With HIV-1 Disease Progression up to Week 144
NCT02831673 (64) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities up to Week 144
NCT02831673 (64) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities up to Week 144
NCT02831673 (64) [back to overview]	Number of Participants With Treatment-emergent Genotypic Resistance up to Week 144
NCT02831673 (64) [back to overview]	Number of Participants With Treatment-emergent Phenotypic Resistance up to Week 144
NCT02831673 (64) [back to overview]	Percentage Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Weeks 24, 48
NCT02831673 (64) [back to overview]	Percentage Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Weeks 24, 48
NCT02831673 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 144
NCT02831673 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 48
NCT02831673 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 96
NCT02831673 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count, Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 24
NCT02831673 (64) [back to overview]	Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Weeks 24, 48
NCT02831673 (64) [back to overview]	Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 144
NCT02831673 (64) [back to overview]	Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 96
NCT02831673 (64) [back to overview]	Ratio to Baseline in Renal Biomarkers-Urine and Serum Beta-2 Microglobulin (B2M), Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 144
NCT02831764 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 144
NCT02831764 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 48
NCT02831764 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 96
NCT02831764 (64) [back to overview]	Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count, Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 24
NCT02831764 (64) [back to overview]	Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Weeks 24, 48
NCT02831764 (64) [back to overview]	Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 144
NCT02831764 (64) [back to overview]	Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 96
NCT02831764 (64) [back to overview]	Ratio to Baseline in Renal Biomarkers-Urine and Serum Beta-2 Microglobulin (B2M), Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum RBP at Week 96
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 144
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 96
NCT02831764 (64) [back to overview]	Number of Participants Who Discontinue Treatment Due to AEs Over Week 144
NCT02831764 (64) [back to overview]	Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 144
NCT02831764 (64) [back to overview]	Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 96
NCT02831764 (64) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 144
NCT02831764 (64) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 24
NCT02831764 (64) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 96
NCT02831764 (64) [back to overview]	Percentage of Participants With Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/mL (c/mL) at Week 48
NCT02831764 (64) [back to overview]	Time to Viral Suppression (HIV-1 RNA <50 c/mL) up to Week 144
NCT02831764 (64) [back to overview]	CD4+ Cell Counts at Weeks 24 and 48
NCT02831764 (64) [back to overview]	Change From Baseline in Bone Biomarker-Serum Vitamin D at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Bone Biomarkers-Serum Bone Specific Alkaline Phosphatase (Bone-ALP), Serum Osteocalcin, Serum Procollagen 1 N-Terminal Propeptide (PINP) and Serum Type I Collagen C-Telopeptides (CTX-1) at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in European Quality of Life [EuroQoL] - 5 Dimensions - 5 Levels (EQ-5D-5L) Utility Score at Weeks 4, 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in EuroQol - 5 Dimensions - 5 Levels (EQ-5D-5L) Thermometer Scores at Weeks 4, 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum Cystatin C and Serum Retinol Binding Protein (RBP) at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) and Serum or Plasma GFR From Creatinine Adjusted Using CKD-EPI at Weeks 24, 48
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 96
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 144 by Subgroups
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 24 and 48
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 24 by Subgroups
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 48 by Subgroups
NCT02831764 (64) [back to overview]	Changes From Baseline in CD4+ Cell Counts at Week 96 by Subgroups
NCT02831764 (64) [back to overview]	Number of Participants Who Discontinue Treatment Due to AEs Over Weeks 24, 48, 96
NCT02831764 (64) [back to overview]	Number of Participants With AEs by Maximum Severity Grades up to Week 148
NCT02831764 (64) [back to overview]	Number of Participants With Any Adverse Event (AE) and Serious AE (SAE) up to Week 148
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 96
NCT02831764 (64) [back to overview]	Number of Participants With Any Drug Related AEs and Drug Related AEs by Maximum Grade up to Week 148
NCT02831764 (64) [back to overview]	Number of Participants With HIV-1 Disease Progression up to Week 144
NCT02831764 (64) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities up to Week 144
NCT02831764 (64) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities up to Week 144
NCT02831764 (64) [back to overview]	Number of Participants With Treatment-emergent Genotypic Resistance up to Week 144
NCT02831764 (64) [back to overview]	Number of Participants With Treatment-emergent Phenotypic Resistance up to Week 144
NCT02831764 (64) [back to overview]	Percentage Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Weeks 24, 48
NCT02831764 (64) [back to overview]	Percentage Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma High Density Lipoprotein (HDL) Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Weeks 24, 48
NCT02831764 (64) [back to overview]	CD4+ Cell Counts at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 144
NCT02831764 (64) [back to overview]	CD4+ Cell Counts at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in EQ-5D-5L Thermometer Scores at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in EQ-5D-5L Thermometer Scores at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in EQ-5D-5L Utility Score at Week 144
NCT02831764 (64) [back to overview]	Change From Baseline in EQ-5D-5L Utility Score at Week 96
NCT02831764 (64) [back to overview]	Change From Baseline in Renal Biomarker-Serum RBP at Week 144
NCT02924389 (4) [back to overview]	Time of Maximum Dolutegravir Concentration
NCT02924389 (4) [back to overview]	Dolutegravir Concentration in Rectal Tissue
NCT02924389 (4) [back to overview]	Area Under the Dolutegravir Plasma Concentration vs Time Curve
NCT02924389 (4) [back to overview]	Dolutegravir Concentration
NCT03048422 (23) [back to overview]	Percentage of Mothers With HIV-1 ARV Drug Resistance Mutations at the Time of Maternal Virologic Failure
NCT03048422 (23) [back to overview]	Infant Creatinine Clearance
NCT03048422 (23) [back to overview]	Percentage of Mothers With HIV-1 RNA Viral Load Less Than 200 Copies/mL at Delivery
NCT03048422 (23) [back to overview]	Time to First HIV-1 RNA Less Than 200 Copies/mL Through Delivery
NCT03048422 (23) [back to overview]	Percentage of Mothers With Virologic Success of HIV-1 RNA Less Than 200 Copies/mL at Delivery Based on FDA Snapshot Algorithm
NCT03048422 (23) [back to overview]	Percentage of Mothers With Virologic Success of HIV-1 RNA Less Than 200 Copies/mL at 50 Weeks Postpartum Based on FDA Snapshot Algorithm
NCT03048422 (23) [back to overview]	Percentage of Mothers With HIV-1 RNA Less Than 50 Copies/mL at Delivery Measured at Central Laboratory
NCT03048422 (23) [back to overview]	Percentage of Mothers With HIV-1 RNA Less Than 200 Copies/mL at 50 Weeks Postpartum
NCT03048422 (23) [back to overview]	Percentage of Mother-Infant Pairs With Preterm Deliveries
NCT03048422 (23) [back to overview]	Percentage of Mother-infant Pairs With an Adverse Pregnancy Outcome or Major Congenital Anomaly
NCT03048422 (23) [back to overview]	Percentage of Mother-Infant Pairs With an Adverse Pregnancy Outcome
NCT03048422 (23) [back to overview]	Percentage of Mother-infant Pairs With an Adverse Pregnancy Outcome
NCT03048422 (23) [back to overview]	Percentage of Infants Born Small for Gestational Age
NCT03048422 (23) [back to overview]	Maternal Change in Creatinine Clearance
NCT03048422 (23) [back to overview]	Cumulative Probability of Women Experiencing Grade 3 or Higher Adverse Event
NCT03048422 (23) [back to overview]	Cumulative Probability of Infants Experiencing Grade 3 or Higher Adverse Event
NCT03048422 (23) [back to overview]	Cumulative Probability of Infants Experiencing Grade 3 or Higher Adverse Event
NCT03048422 (23) [back to overview]	Cumulative Probability of Infant HIV-infection
NCT03048422 (23) [back to overview]	Cumulative Probability of Infant Deaths
NCT03048422 (23) [back to overview]	Count of Infants With HIV-1 Antiretroviral Drug Resistance Mutations at the Time of Infant HIV Diagnosis
NCT03048422 (23) [back to overview]	Change in Maternal Weight Postpartum
NCT03048422 (23) [back to overview]	Change in Maternal Weight Overall
NCT03048422 (23) [back to overview]	Change in Maternal Weight Antepartum
NCT03078556 (59) [back to overview]	Tlast of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Tlag of DTG and 3TC in Fed State: Part 2
NCT03078556 (59) [back to overview]	Tlag of DTG and 3TC in Fed State: Part 1
NCT03078556 (59) [back to overview]	Tlag of DTG and 3TC in Fasted State: Part 2
NCT03078556 (59) [back to overview]	Time to Reach Maximum Plasma Concentration (Tmax) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Time to Reach Half the Maximum Plasma Concentration (t1/2) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Time of the Last Quantifiable Concentration (Tlast) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	T1/2 of DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	t1/2 of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Percentage of Extrapolated AUC(0 to Inf) of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Percentage of Extrapolated AUC (0-inf) in the Fed State: Part 2
NCT03078556 (59) [back to overview]	Percentage of Extrapolated AUC (0-inf) in the Fed State: Part 1
NCT03078556 (59) [back to overview]	Percentage of Extrapolated AUC (0 to Inf) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Number of Participants With Adverse Events (AEs) and Serious Adverse Events (SAEs): Part 1 and 2
NCT03078556 (59) [back to overview]	Last Quantifiable Concentration (Clast) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Lambda z of DTG and 3TC in in the Fed State: Part 2
NCT03078556 (59) [back to overview]	Apparent Oral Clearance (CL/F) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Lambda z of DTG and 3TC in in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Concentration at 24 Hours Post-dose (C24) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	AUC(0-24) of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Cmax of Plasma DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	AUC of 0 to 24 Hours (AUC[0-24]) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	AUC (0-t) of Plasma DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	AUC (0-t) of Plasma DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	AUC (0-Inf) of Plasma DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	AUC (0-Inf) of Plasma DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	Lambda z of DTG and 3TC in in the Fed State: Part 1
NCT03078556 (59) [back to overview]	AUC (0-Inf) of Plasma DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Area Under the Concentration-time Curve From Time 0 to the Last Quantifiable Time Point (AUC[0-t]) of Plasma DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Area Under the Concentration-time Curve From Time 0 Extrapolated to Infinity [AUC (0-Inf)] of Plasma DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Apparent Oral Volume of Distribution (Vz/F) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Apparent Elimination Rate Constant (Lambda z) of DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Absorption Lag Time (Tlag) of DTG and 3TC in Fasted State: Part 1
NCT03078556 (59) [back to overview]	Maximum Observed Concentration (Cmax) of Plasma DTG and 3TC in the Fasted State: Part 1
NCT03078556 (59) [back to overview]	Vz/F of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	Vz/F of DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	Vz/F of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Tmax of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	Tmax of DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	Tmax of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Tlast of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	Tlast of DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	Cmax of Plasma DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	Cmax of Plasma DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Clast of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Clast of DTG and 3TC in in the Fed State: Part 2
NCT03078556 (59) [back to overview]	Clast of DTG and 3TC in in the Fed State: Part 1
NCT03078556 (59) [back to overview]	CL/F of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	T1/2 of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	CL/F of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP): Part 1 and 2
NCT03078556 (59) [back to overview]	Change From Baseline in Heart Rate (HR): Part 1 and 2
NCT03078556 (59) [back to overview]	C24 of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	C24 of DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	C24 of DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	AUC(0-t) of Plasma DTG and 3TC in the Fasted State: Part 2
NCT03078556 (59) [back to overview]	AUC(0-24) of DTG and 3TC in the Fed State: Part 2
NCT03078556 (59) [back to overview]	AUC(0-24) of DTG and 3TC in the Fed State: Part 1
NCT03078556 (59) [back to overview]	CL/F of DTG and 3TC in the Fed State: Part 1
NCT03095638 (56) [back to overview]	Apparent Oral Clearance (CL/F) of DTG for Part 1
NCT03095638 (56) [back to overview]	Apparent Volume of Distribution During the Terminal Phase (Vz/F) of DTG for Part 1
NCT03095638 (56) [back to overview]	Area Under the Concentration-time Curve Over Time Zero (Pre-dose) to 24 Hours After Dose Administration (AUC[0-24]) of DTG for Part 1
NCT03095638 (56) [back to overview]	Area Under the Plasma Concentration-time Curve From Time of Dose Extrapolated to Infinite Time (AUC[0-infinity]) of DTG for Part 1
NCT03095638 (56) [back to overview]	Area Under the Plasma Concentration-time Curve From Time of Dose to Last Measurable Concentration AUC [0-t] of DTG for Part 1
NCT03095638 (56) [back to overview]	AUC (0-24) of DTG for Part 2
NCT03095638 (56) [back to overview]	AUC (0-infinity) of DTG for Part 2
NCT03095638 (56) [back to overview]	AUC (0-t) of DTG for Part 2
NCT03095638 (56) [back to overview]	C24 of DTG for Part 2
NCT03095638 (56) [back to overview]	Cmax of DTG for Part 2
NCT03095638 (56) [back to overview]	Ct of DTG for Part 2
NCT03095638 (56) [back to overview]	DTG CL/F for Part 2
NCT03095638 (56) [back to overview]	Lambda Z of DTG for Part 2
NCT03095638 (56) [back to overview]	Last Observed Quantifiable Concentration (Ct) of DTG for Part 1
NCT03095638 (56) [back to overview]	Maximum Observed Concentration (Cmax) of DTG for Part 1
NCT03095638 (56) [back to overview]	Number of Participants With Chemistry Toxicities of Grade 2 as Defined by Division of Acquired Immunodeficiency Syndrome (DAIDS) for Part 1
NCT03095638 (56) [back to overview]	Number of Participants With Urinalysis Toxicities of Grade 2 as Defined by DAIDS for Part 1
NCT03095638 (56) [back to overview]	Observed Concentration at 24 Hours After Dose Administration (C24) of DTG for Part 1
NCT03095638 (56) [back to overview]	Percentage of AUC (0-infinity) Obtained by Extrapolation (%AUCex) of DTG for Part 1
NCT03095638 (56) [back to overview]	Plasma DTG Lag Time Before Observation of Drug Concentrations (Tlag) for Part 1
NCT03095638 (56) [back to overview]	Plasma DTG Tlag for Part 2
NCT03095638 (56) [back to overview]	t1/2 of DTG for Part 2
NCT03095638 (56) [back to overview]	Terminal Phase Half-life (t1/2) of DTG for Part 1
NCT03095638 (56) [back to overview]	Terminal-phase Rate Constant (Lambda z) of DTG for Part 1
NCT03095638 (56) [back to overview]	Time to First Occurrence of Cmax (Tmax) of DTG for Part 1
NCT03095638 (56) [back to overview]	Tmax of DTG for Part 2
NCT03095638 (56) [back to overview]	Vz/F of DTG for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum Alanine Amino Transferase (ALT), Serum Alkaline Phosphatase, Serum Aspartate Amino Transferase (AST), Serum Creatine Kinase for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum Albumin and Serum Protein for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum Albumin and Serum Protein for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum ALT, Serum Alkaline Phosphate, Serum AST, Serum Creatine Kinase for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum Bilirubin, Serum Creatine and Serum Direct Bilirubin for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum Bilirubin, Serum Creatinine and Serum Direct Bilirubin for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Chemistry Parameters Serum Glucose, Serum Calcium, Serum Potassium, Serum Sodium, Serum Urea for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Clinical Laboratory Parameters Serum Glucose, Serum Calcium, Serum Potassium, Serum Sodium, Serum Urea for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Erythrocyte MCH for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Erythrocyte MCV for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Erythrocyte Mean Corpuscular Hemoglobin (MCH) for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Erythrocyte Mean Corpuscular Volume (MCV) for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Erythrocytes for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Hematocrit for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Hematocrit for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Hemoglobin for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Hemoglobin for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameters Blood Basophils, Blood Eosinophils, Blood Leukocytes, Blood Lymphocytes, Blood Monocytes, Blood Neutrophils, Blood Platelets for Part 1
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameters Blood Basophils, Blood Eosinophils,, Blood Leukocytes, Blood Lymphocytes, Blood Monocytes, Blood Neutrophils, Blood Platelets for Part 2
NCT03095638 (56) [back to overview]	Number of Participants With Abnormal Values on Urinalysis by Dipstick Method for Part 1
NCT03095638 (56) [back to overview]	Number of Participants With Abnormal Values on Urinalysis by Dipstick Method for Part 2
NCT03095638 (56) [back to overview]	Number of Participants With Adverse Events (AEs) and Serious Adverse Events (SAEs) for Part 1
NCT03095638 (56) [back to overview]	Number of Participants With Adverse Events AEs and Serious Adverse Events SAEs for Part 2
NCT03095638 (56) [back to overview]	Urine pH Analysis by Dipstick Method for Part 2
NCT03095638 (56) [back to overview]	Urine Potential of Hydrogen (pH) Analysis by Dipstick Method for Part 1
NCT03095638 (56) [back to overview]	Urine Specific Gravity Analysis by Dipstick Method for Part 1
NCT03095638 (56) [back to overview]	Urine Specific Gravity Analysis by Dipstick Method for Part 2
NCT03095638 (56) [back to overview]	Change From Baseline in Hematology Parameter Blood Erythrocytes for Part 2
NCT03095638 (56) [back to overview]	%AUCex of DTG for Part 2
NCT03110380 (3) [back to overview]	Change From Baseline in CD4+ Cell Count at Week 48
NCT03110380 (3) [back to overview]	Percentage of Participants With HIV-1 RNA < 50 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm
NCT03110380 (3) [back to overview]	Percentage of Participants With HIV-1 RNA ≥ 50 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm
NCT03198884 (7) [back to overview]	Analysis of Creatinine Clearance at Time Points 24, 36 and 48 Weeks.
NCT03198884 (7) [back to overview]	Number of Grade 1 Adverse Events Reported
NCT03198884 (7) [back to overview]	Incidence of Adverse Events.
NCT03198884 (7) [back to overview]	The Change in Serum Creatinine From Baseline to 48 Weeks.
NCT03198884 (7) [back to overview]	Number of Participants With RNA <50 Copies/mL at 48 Weeks
NCT03198884 (7) [back to overview]	Number of Participants With RNA <50 Copies/mL at 24, 36, and 48 Weeks
NCT03198884 (7) [back to overview]	Change in Mean CD4+ Cell Count From Baseline.
NCT03218592 (4) [back to overview]	Peripheral Blood Mononuclear Cells (PBMC) Antiretroviral Concentrations
NCT03218592 (4) [back to overview]	Hair Antiretroviral Imaging
NCT03218592 (4) [back to overview]	Whole Blood Antiretroviral Concentrations
NCT03218592 (4) [back to overview]	Plasma Antiretroviral Concentrations
NCT03512964 (4) [back to overview]	Number of Patients Who Receive Rapid HIV Treatment Initiation
NCT03512964 (4) [back to overview]	Number of Patients Who Accepted Rapid HIV Treatment Initiation
NCT03512964 (4) [back to overview]	Number of Patients Offered Rapid HIV Treatment Initiation
NCT03512964 (4) [back to overview]	Rapid HIV Treatment Initiation Acceptability as Assessed by the Number of Patients Who Respond Yes to Starting ART Same Day
NCT03760458 (52) [back to overview]	Geometric Mean Area Under the Plasma Concentration-time Curve Over 24 Hours (AUC0-24h) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Antiretroviral (ARV) Resistance Mutations
NCT03760458 (52) [back to overview]	Percentage of Participants With at Least One Adverse Event Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Serious Adverse Event Assessed as Related to Study Drug Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Serious Adverse Event Assessed as Related to Study Drug Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Serious Adverse Event Assessed as Related to Study Drug Through Week 24
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Life-threatening Adverse Event Assessed as Related to Study Drug Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Life-threatening Adverse Event Assessed as Related to Study Drug Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Grade 3 or Grade 4 Adverse Event Assessed as Related to Study Drug Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Grade 3 or Grade 4 Adverse Event Assessed as Related to Study Drug Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Grade 3 or Grade 4 Adverse Event Assessed as Related to Study Drug Through Week 24
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Adverse Event Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants With HIV-1 RNA Less Than 200 Copies/mL
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Adverse Event Through Week 24
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Adverse Event Assessed as Related to Study Drug That Led to Permanent Discontinuation of Study Drug Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Adverse Event Assessed as Related to Study Drug That Led to Permanent Discontinuation of Study Drug Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Adverse Event Assessed as Related to Study Drug That Led to Permanent Discontinuation of Study Drug Through Week 24
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had a Grade 5 Adverse Event Assessed as Related to Study Drug Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had a Grade 5 Adverse Event Assessed as Related to Study Drug Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had a Grade 5 Adverse Event Assessed as Related to Study Drug Through Week 24
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean Apparent Oral Clearance (CL/F) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean Concentration at 24 Hours Post-dose (C24h) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean Concentration at Time 0 (Pre-dose) (C0h) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean Half-life (t1/2) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean Maximum Plasma Concentration (Cmax) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean Time to Maximum Concentration (Tmax) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Ease of Giving Study Drug
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Reason for Missed Doses of Study Drug
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Response of Child's Face When Taking Favorite Food
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Number of Missed Doses of Study Drug
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Response of Child's Face When Taking Study Drug
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Response of How Often the Child Received the Study Drug in the Way They Were Supposed to
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Response of How Well the Person Usually Responsible Administered the Study Drug in the Way They Were Supposed to
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Satisfaction With the Number of Study Drug Tablets to Dissolve
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Time for Study Drug Tablets to Dissolve
NCT03760458 (52) [back to overview]	Population PK: Geometric Mean AUC0-24h for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Percentage of Participants With Virologic Success of HIV-1 RNA Less Than 50 Copies/mL Using FDA Snapshot Algorithm
NCT03760458 (52) [back to overview]	Percentage of Participants With Virologic Success of HIV-1 RNA Less Than 200 Copies/mL Using FDA Snapshot Algorithm
NCT03760458 (52) [back to overview]	Percentage of Participants Who Had at Least One Life-threatening Adverse Event Assessed as Related to Study Drug Through Week 24
NCT03760458 (52) [back to overview]	Percentage of Participants Who Experienced Virologic Failure Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Experienced Virologic Failure Through Week 60
NCT03760458 (52) [back to overview]	Percentage of Participants Who Experienced Virologic Failure Through Week 48
NCT03760458 (52) [back to overview]	Percentage of Participants Who Experienced Virologic Failure Through Week 48
NCT03760458 (52) [back to overview]	Parent/Guardian-reported Percent Adherence to Study Drug
NCT03760458 (52) [back to overview]	Median (Q1,Q3) Change From Baseline in Triglycerides
NCT03760458 (52) [back to overview]	Median (Q1,Q3) Change From Baseline in Total Cholesterol
NCT03760458 (52) [back to overview]	Median (Q1,Q3) Change From Baseline in LDL
NCT03760458 (52) [back to overview]	Median (Q1,Q3) Change From Baseline in HDL
NCT03760458 (52) [back to overview]	Median (Q1, Q3) CD4+ Percentage
NCT03760458 (52) [back to overview]	Median (Q1, Q3) CD4+ Cell Count
NCT03760458 (52) [back to overview]	Geometric Mean Maximum Plasma Concentration (Cmax) for ABC, DTG, and 3TC
NCT03760458 (52) [back to overview]	Geometric Mean Concentration at 24 Hours Post-dose (C24h) for ABC, DTG, and 3TC
NCT03851588 (3) [back to overview]	Virological Suppression at 24 Weeks (Per Protocol)
NCT03851588 (3) [back to overview]	Virological Suppression at 24 Weeks
NCT03851588 (3) [back to overview]	Virological Suppression at 12 Weeks (Modified ITT)
NCT03921723 (21) [back to overview]	Number of Participants With Non-serious Adverse Events (AEs) and Serious Adverse Events (SAEs)
NCT03921723 (21) [back to overview]	Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP)
NCT03921723 (21) [back to overview]	Time of Maximum Observed Concentration (Tmax) Following Administration of DTG
NCT03921723 (21) [back to overview]	Time of Last Quantifiable Concentration (Tlast) Following Administration of DTG
NCT03921723 (21) [back to overview]	Percentage of AUC(0-inf) Extrapolated (%AUCex) Following Administration of DTG
NCT03921723 (21) [back to overview]	Number of Participants With Clinically Significant Urine Parameters
NCT03921723 (21) [back to overview]	Number of Participants With Clinically Significant Hematology Parameters
NCT03921723 (21) [back to overview]	Number of Participants With Clinically Significant Chemistry Parameters
NCT03921723 (21) [back to overview]	Maximum Observed Concentration (Cmax) for DTG
NCT03921723 (21) [back to overview]	Last Quantifiable Concentration (Ct) Following Administration of DTG
NCT03921723 (21) [back to overview]	Elimination Half-life (t½) Following Administration of DTG
NCT03921723 (21) [back to overview]	Concentration at 24hours Post-dose (C24) Following Administration of DTG
NCT03921723 (21) [back to overview]	AUC From Time Zero to Infinity (AUC[0-inf]) for DTG
NCT03921723 (21) [back to overview]	AUC From Time Zero to 72 Hours (AUC[0-72]) Following Administration of DTG
NCT03921723 (21) [back to overview]	AUC From Time Zero to 24 Hours (AUC[0-24]) Following Administration of DTG
NCT03921723 (21) [back to overview]	Absorption Lag Time (Tlag) Following Administration of DTG
NCT03921723 (21) [back to overview]	Area Under the Plasma Concentration Time Curve From Time Zero to the Last Quantifiable Time Point (AUC[0-t]) for DTG
NCT03921723 (21) [back to overview]	Apparent Oral Volume of Distribution (Vz/F) Following Administration of DTG
NCT03921723 (21) [back to overview]	Apparent Oral Clearance (CL/F) Following Administration of DTG
NCT03921723 (21) [back to overview]	Apparent Elimination Rate Constant (Lambda z) Following Administration of DTG
NCT03921723 (21) [back to overview]	Change From Baseline in Pulse Rate
NCT03945981 (18) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities Under Treatment With DTG + 3TC FDC
NCT03945981 (18) [back to overview]	Number of Participants With Any Serious Adverse Events (SAEs) and Any Common (>=2%) Non-serious Adverse Events (Non-SAEs) Under Treatment With DTG + 3TC FDC
NCT03945981 (18) [back to overview]	Number of Participants Who Completed 24 and 48 Weeks on Study
NCT03945981 (18) [back to overview]	Number of Participants Who Changed First Line Regimen of DTG + 3TC FDC Due to Baseline Laboratory Results or HIV-1 Resistance Mutation Results
NCT03945981 (18) [back to overview]	Change From Baseline in Cluster of Differentiation (CD4+) Cell Counts for Participants Under Treatment With DTG + 3TC FDC
NCT03945981 (18) [back to overview]	Change From Baseline in CD4+/CD8+ Cell Count Ratio for Participants Under Treatment With DTG + 3TC FDC
NCT03945981 (18) [back to overview]	Time to Viral Suppression (HIV-1 RNA<50 c/mL) for Participants Who Had HIV-1 RNA >= 50 c/mL at Baseline
NCT03945981 (18) [back to overview]	Percentage of Participants With Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) Regardless of Antiretroviral Therapy (ART) Regimen at Week 24 by ITT-E Missing = Failure Analysis
NCT03945981 (18) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL Regardless of ART Regimen at Week 48 by ITT-E Missing = Failure Analysis
NCT03945981 (18) [back to overview]	Number of Participants With Treatment-emergent Phenotypic Resistance
NCT03945981 (18) [back to overview]	Number of Participants With HIV-1 Disease Progression to Stage 3 HIV-associated Conditions, Acquired Immunodeficiency Syndrome (AIDS) or Death (for Participants Under Treatment With DTG + 3TC FDC)
NCT03945981 (18) [back to overview]	Number of Participants With Treatment-emergent Genotypic Resistance
NCT03945981 (18) [back to overview]	Number of Participants Retained in Care for 24 and 48 Weeks on Study and Have HIV-1 RNA <200 c/mL
NCT03945981 (18) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL Using Food and Drug Administration (FDA) Snapshot Algorithm
NCT03945981 (18) [back to overview]	Percentage of Participants With HIV-1 RNA < 50 c/mL at Weeks 24 and 48 Among Participants With Available HIV-1 RNA Assessment Regardless of ART
NCT03945981 (18) [back to overview]	Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities Under Treatment With DTG + 3TC FDC
NCT03945981 (18) [back to overview]	Number of Participants Who Discontinued the Study Treatment (DTG+3TC FDC) Due to AEs
NCT03945981 (18) [back to overview]	Number of Participants Who Discontinued the Study Treatment (DTG+3TC FDC) Due to Drug-related AEs
NCT03984838 (57) [back to overview]	Apparent Elimination Rate Constant (Lambda z) of DTG
NCT03984838 (57) [back to overview]	Apparent Oral Clearance (CL/F) of DTG
NCT03984838 (57) [back to overview]	Apparent Oral Volume of Distribution (Vz/F) of DTG
NCT03984838 (57) [back to overview]	Area Under the Concentration (AUC) Time Curve From Time Zero Extrapolated to Infinite Time (AUC [0-infinity]) of DTG
NCT03984838 (57) [back to overview]	Area Under the Concentration Time Curve From Time Zero to Last Time of Quantifiable Concentration (AUC [0-t]) of DTG
NCT03984838 (57) [back to overview]	Area Under the Plasma Concentration Time Curve From Time Zero to 24 Hours (AUC[0-24]) of DTG
NCT03984838 (57) [back to overview]	Area Under the Plasma Concentration Time Curve From Time Zero to 72 Hours (AUC[0-72]) of DTG
NCT03984838 (57) [back to overview]	AUC (0-24) of RPV
NCT03984838 (57) [back to overview]	AUC (0-72) of RPV
NCT03984838 (57) [back to overview]	AUC (0-infinity) of RPV
NCT03984838 (57) [back to overview]	AUC (0-t) of RPV
NCT03984838 (57) [back to overview]	C24 of RPV
NCT03984838 (57) [back to overview]	Change From Baseline in Body Temperature
NCT03984838 (57) [back to overview]	Change From Baseline in Erythrocytes
NCT03984838 (57) [back to overview]	Change From Baseline in Hematocrit Level
NCT03984838 (57) [back to overview]	Change From Baseline in Hemoglobin Level
NCT03984838 (57) [back to overview]	Change From Baseline in Mean Corpuscular Hemoglobin (MCH)
NCT03984838 (57) [back to overview]	Change From Baseline in Mean Corpuscular Volume (MCV)
NCT03984838 (57) [back to overview]	Change From Baseline in Pulse Rate
NCT03984838 (57) [back to overview]	Change From Baseline in Reticulocytes
NCT03984838 (57) [back to overview]	CL/F of RPV
NCT03984838 (57) [back to overview]	Cmax of RPV
NCT03984838 (57) [back to overview]	Concentration at 24-hour Post-dose (C24) of DTG
NCT03984838 (57) [back to overview]	Elimination Half-life (t1/2) of DTG
NCT03984838 (57) [back to overview]	Lambda z of RPV
NCT03984838 (57) [back to overview]	Last Quantifiable Concentration (Ct) of DTG
NCT03984838 (57) [back to overview]	Maximum Observed Plasma Concentration (Cmax) of DTG
NCT03984838 (57) [back to overview]	Percentage AUCex of RPV
NCT03984838 (57) [back to overview]	Percentage of AUC(0-infinity) That Was Extrapolated (%AUCex) of DTG
NCT03984838 (57) [back to overview]	T1/2 of RPV
NCT03984838 (57) [back to overview]	Time of Last Quantifiable Concentration (Tlast) of DTG
NCT03984838 (57) [back to overview]	Time to Reach Maximum Observed Concentration (Tmax) of DTG
NCT03984838 (57) [back to overview]	Tlag of RPV
NCT03984838 (57) [back to overview]	Tlast of RPV
NCT03984838 (57) [back to overview]	Tmax of RPV
NCT03984838 (57) [back to overview]	Vz/F of RPV
NCT03984838 (57) [back to overview]	Absolute Values of AST, ALT and ALP Levels
NCT03984838 (57) [back to overview]	Absolute Values of Body Temperature
NCT03984838 (57) [back to overview]	Absolute Values of BUN, Glucose, Calcium, Sodium, and Potassium Levels
NCT03984838 (57) [back to overview]	Absolute Values of Erythrocytes
NCT03984838 (57) [back to overview]	Absolute Values of Hematocrit Level
NCT03984838 (57) [back to overview]	Absolute Values of Hemoglobin Level
NCT03984838 (57) [back to overview]	Absolute Values of MCH
NCT03984838 (57) [back to overview]	Absolute Values of MCV
NCT03984838 (57) [back to overview]	Absolute Values of Neutrophil, Lymphocyte, Leukocyte, Monocyte, Eosinophil, Basophil and Platelet Count
NCT03984838 (57) [back to overview]	Absolute Values of Pulse Rate
NCT03984838 (57) [back to overview]	Absolute Values of Reticulocytes
NCT03984838 (57) [back to overview]	Absolute Values of SBP and DBP
NCT03984838 (57) [back to overview]	Absolute Values of Total and Direct Bilirubin, Creatinine and Protein Levels
NCT03984838 (57) [back to overview]	Change From Baseline in Aspartate Aminotransferase (AST), Alanine Aminotransferase (ALT) and Alkaline Phosphatase (ALP) Levels
NCT03984838 (57) [back to overview]	Change From Baseline in Blood Urea Nitrogen (BUN), Glucose, Calcium, Sodium, and Potassium Levels
NCT03984838 (57) [back to overview]	Change From Baseline in Neutrophil, Lymphocyte, Leukocyte, Monocyte, Eosinophil, Basophil and Platelet Count
NCT03984838 (57) [back to overview]	Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP)
NCT03984838 (57) [back to overview]	Change From Baseline in Total and Direct Bilirubin, Creatinine and Protein Levels
NCT03984838 (57) [back to overview]	Number of Participants With Adverse Events (AE) and Serious Adverse Events (SAE)
NCT03984838 (57) [back to overview]	Ct of RPV
NCT03984838 (57) [back to overview]	Absorption Lag Time (Tlag) of DTG
NCT04147715 (50) [back to overview]	Part 2: Maximum Plasma Concentration (Cmax) of S-648414 Following Single and Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Area Under the Concentration-time Curve From Time Zero to the Last Quantifiable Concentration After Dosing (AUC0-last) for Midazolam
NCT04147715 (50) [back to overview]	Part 2: Terminal Elimination Rate Constant (λz) of S-648414 Following Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Terminal Elimination Half-life for Midazolam
NCT04147715 (50) [back to overview]	Part 2: Terminal Elimination Half-life (t1/2,z) of S-648414 Following Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Renal Clearance (CLR) of S-648414 Following Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Mean Residence Time for Midazolam
NCT04147715 (50) [back to overview]	Part 2: Maximum Plasma Concentration (Cmax) of Midazolam
NCT04147715 (50) [back to overview]	Part 2: Fraction of S-648414 Dose Excreted in Urine Over the Dosing Interval (Feu0- τ) Following Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Area Under the Concentration-time Curve From Time Zero to Infinity (AUC0-inf) of Midazolam
NCT04147715 (50) [back to overview]	Part 2: Terminal Elimination Rate Constant for Midazolam
NCT04147715 (50) [back to overview]	Part 2: Apparent Volume of Distribution in the Terminal Elimination Phase (Vz/F) of S-648414 Following Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Apparent Total Clearance (CL/F) of S-648414 Following Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 1: Time to Maximum Plasma Concentration (Tmax) of S-648414
NCT04147715 (50) [back to overview]	Part 1: Terminal Elimination Rate Constant (λz) of S-648414
NCT04147715 (50) [back to overview]	Part 1: Terminal Elimination Half-life (t1/2,z) of S-648414
NCT04147715 (50) [back to overview]	Parts 1: Change From Baseline in Heart Rate (HR)
NCT04147715 (50) [back to overview]	Part 1: Renal Clearance (CLR) of S-648414
NCT04147715 (50) [back to overview]	Part 2: Time to Maximum Plasma Concentration (Tmax) of S-648414 Following Single and Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 2: Number of Participants With Treatment-emergent Adverse Events
NCT04147715 (50) [back to overview]	Part 1: Mean Residence Time (MRT) of S-648414
NCT04147715 (50) [back to overview]	Part 2: Area Under the Concentration-time Curve Over the Dosing Interval τ (AUC0-τ) of S-648414 Following Single and Multiple-dose Administration
NCT04147715 (50) [back to overview]	Part 1: Placebo-corrected Change From Baseline in QRS Duration
NCT04147715 (50) [back to overview]	Part 1: Placebo-corrected Change From Baseline in PR Interval
NCT04147715 (50) [back to overview]	Part 1: Placebo-corrected Change From Baseline in Heart Rate
NCT04147715 (50) [back to overview]	Part 1: Placebo-corrected Change From Baseline in Fridericia's Corrected QT Interval
NCT04147715 (50) [back to overview]	Part 1: Maximum Plasma Concentration (Cmax) of S-648414
NCT04147715 (50) [back to overview]	Part 1: Fraction of S-648414 Dose Excreted in Urine From 0 to 96 Hours Postdose (Feu0-96)
NCT04147715 (50) [back to overview]	Part 1: Area Under the Concentration-time Curve From Time Zero to the Last Quantifiable Concentration After Dosing (AUC0-last) of S-648414
NCT04147715 (50) [back to overview]	Part 1: Apparent Volume of Distribution in the Terminal Elimination Phase (Vz/F) of S-648414
NCT04147715 (50) [back to overview]	Part 3: Time to Maximum Plasma Concentration (Tmax) of Dolutegravir
NCT04147715 (50) [back to overview]	Part 1: Apparent Total Clearance (CL/F) of S-648414
NCT04147715 (50) [back to overview]	Part 3: Apparent Total Clearance (CL/F) of Dolutegravir
NCT04147715 (50) [back to overview]	Part 1: Number of Participants With Treatment-emergent Changes for T-wave Morphology and U-wave Presence
NCT04147715 (50) [back to overview]	Part 1: Number of Participants With Treatment-emergent Adverse Events (TEAEs)
NCT04147715 (50) [back to overview]	Part 1: Number of Participants With Recorded Outlier Values for QTcF, HR, PR, and QRS
NCT04147715 (50) [back to overview]	Part 1: Change From Baseline in QRS Interval
NCT04147715 (50) [back to overview]	Part 1: Change From Baseline in PR Interval
NCT04147715 (50) [back to overview]	Part 1: Change From Baseline in Fridericia's Corrected QT Interval (QTcF)
NCT04147715 (50) [back to overview]	Part 3: Time to Maximum Plasma Concentration (Tmax) of S-648414
NCT04147715 (50) [back to overview]	Part 1: Area Under the Concentration-time Curve From Time Zero to Infinity (AUC0-inf) of S-648414
NCT04147715 (50) [back to overview]	Part 3: Plasma Concentration of S-648414 at the End of the Dosing Interval τ (Cτ)
NCT04147715 (50) [back to overview]	Part 3: Plasma Concentration of Dolutegravir at the End of the Dosing Interval τ (Cτ)
NCT04147715 (50) [back to overview]	Part 3: Maximum Plasma Concentration (Cmax) of S-648414
NCT04147715 (50) [back to overview]	Part 3: Maximum Plasma Concentration (Cmax) of Dolutegravir
NCT04147715 (50) [back to overview]	Part 3: Area Under the Concentration-time Curve Over the Dosing Interval τ (AUC0-τ) for S-648414
NCT04147715 (50) [back to overview]	Part 3: Area Under the Concentration-time Curve Over the Dosing Interval τ (AUC0-τ) for Dolutegravir
NCT04147715 (50) [back to overview]	Part 3: Apparent Total Clearance (CL/F) of S-648414
NCT04147715 (50) [back to overview]	Part 3: Number of Participants With Treatment-emergent Adverse Events
NCT04147715 (50) [back to overview]	Part 2: Time to Maximum Plasma Concentration of Midazolam
NCT04493216 (19) [back to overview]	Number of Participants With Adverse Events (AEs) Leading to Treatment Discontinuation Through Weeks 24 and 48
NCT04493216 (19) [back to overview]	Change From Baseline in Plasma HIV-1 RNA at Weeks 24 and 48
NCT04493216 (19) [back to overview]	Change From Baseline in CD4+ Cell Counts at Weeks 24 and 48
NCT04493216 (19) [back to overview]	Absolute Values of HIV-1 RNA at Weeks 24 and 48
NCT04493216 (19) [back to overview]	Number of Participants With AEs Based on Maximum Severity Grades at Weeks 24 and 48
NCT04493216 (19) [back to overview]	Absolute Values of Cluster of Differentiation 4 Plus (CD4+) Cell Counts at Weeks 24 and 48
NCT04493216 (19) [back to overview]	Time to Cmax (Tmax) of GSK3640254 at Steady State
NCT04493216 (19) [back to overview]	Steady State Oral Clearance (CLt/F) of GSK3640254
NCT04493216 (19) [back to overview]	Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 48
NCT04493216 (19) [back to overview]	Observed Pre-dose Plasma Concentration (C0) of GSK3640254 at Steady State
NCT04493216 (19) [back to overview]	Observed Plasma Concentration at the End of the Dosing Interval (Ctau) of GSK3640254 at Steady State - Week 2
NCT04493216 (19) [back to overview]	Number of Participants With Genotypic Resistance
NCT04493216 (19) [back to overview]	Maximum Observed Concentration (Cmax) of GSK3640254 at Steady State
NCT04493216 (19) [back to overview]	Area Under the Plasma Drug Concentration-time Curve From Pre-dose to the End of the Dosing Interval (AUC [0-tau]) of GSK3640254 at Steady State
NCT04493216 (19) [back to overview]	Number of Participants With AEs of Special Interest (AESI) (Gastrointestinal (GI), Nervous System, and Psychiatric AEs) Through Weeks 24 and 48
NCT04493216 (19) [back to overview]	Observed Plasma Concentration at the End of the Dosing Interval (Ctau) of GSK3640254 at Steady State - Weeks 24 and 48
NCT04493216 (19) [back to overview]	Number of Participants With Serious Adverse Events (SAEs) and Deaths Through Weeks 24 and 48
NCT04493216 (19) [back to overview]	Number of Participants With Phenotypic Resistance
NCT04493216 (19) [back to overview]	Percentage of Participants With Plasma HIV-1 Ribonucleic Acid (RNA) Less Than (<)50 Copies Per Milliliter (c/mL) at Week 24
NCT04900038 (11) [back to overview]	Trough Concentration (Ctrough) of GSK3640254 at Weeks 2, 4, 8, 12 and 24
NCT04900038 (11) [back to overview]	Number of Participants With Serious Adverse Events (SAEs) and Deaths, up to End of Continued Access to Treatment Post-study Termination (Day 478)
NCT04900038 (11) [back to overview]	Number of Participants With Adverse Events of Special Interest (AESIs), up to End of Continued Access to Treatment Post-study Termination (Day 478)
NCT04900038 (11) [back to overview]	Absolute Values of HIV-1 RNA Through Week 24
NCT04900038 (11) [back to overview]	Percentage of Participants With Plasma HIV-1 Ribonucleic Acid (RNA) Less Than (<)50 Copies Per Milliliter (c/mL) at Week 24
NCT04900038 (11) [back to overview]	Number of Participants With Adverse Events (AEs) Leading to Discontinuation, up to End of Continued Access to Treatment Post-study Termination (Day 478)
NCT04900038 (11) [back to overview]	Number of Participants Who Develop Phenotypic Resistance up to Week 24
NCT04900038 (11) [back to overview]	Number of Participants Who Develop Genotypic Resistance up to Week 24
NCT04900038 (11) [back to overview]	Change From Baseline in CD4+ T-cell Counts Through Week 24
NCT04900038 (11) [back to overview]	Absolute Values of Cluster of Differentiation 4+ (CD4+) T-cell Counts Through Week 24
NCT04900038 (11) [back to overview]	Change From Baseline in HIV-1 RNA Through Week 24

PK Parameter: Cord/Maternal Blood Concentration Ratio With Median (IQR) for ARVs and TB Drugs

Cord blood and maternal plasma concentrations were collected and measured at delivery, and compared as a ratio. (NCT00042289)
Timeframe: Measured at time of delivery with single cord blood and single maternal plasma sample.

Intervention	unitless (Median)
DRV/RTV 600 or 800 or 900/100mg b.i.d. Then 800 or 900/100mg b.i.d. Then 600/100mg b.i.d.	0.15
DTG 50mg q.d.	1.25
EVG/COBI 150/150mg q.d.	0.91
DRV/COBI 800/150 mg q.d.	0.07
ATV/COBI 300/150 mg q.d.	0.07
TFV 300mg q.d.	0.88

[back to top]

Number of Women Who Met PK Target of Area Under the Curve (AUC) for ARVs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC (area under the curve) were determined using the linear trapezoidal rule. See PK target in the Protocol Appendix V. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, 12 (and 24) hours post dosing.

,,,,,,,,,,,,,,,,,,,,,,

Intervention	Participants (Count of Participants)
	2nd Trimester	3rd Trimester	Postpartum
ATV/RTV Arm 1: 300/100mg q.d.	1	12	12
DRV/COBI 800/150 mg q.d.	3	4	14
DRV/RTV 600 or 800 or 900/100mg b.i.d. Then 800 or 900/100mg b.i.d. Then 600/100mg b.i.d.	7	16	22
DRV/RTV 600/100mg b.i.d.	7	19	22
DRV/RTV 800/100mg q.d.	9	19	22
DTG 50mg q.d.	9	20	23
EFV 600 mg q.d. (Outside THA)	12	33	34
ATV/RTV Arm 2: 300/100mg q.d. Then 400/100mg q.d. Then 300/100mg q.d.	8	29	27
ETR 200mg b.i.d.	5	13	7
EVG/COBI 150/150mg q.d.	8	10	18
FPV/RTV 700/100mg b.i.d.	8	26	22
IDV/RTV Arm 2: 400/100mg q.d. (Only THA)	10	19	26
LPV/RTV Arm 3: 400/100mg b.i.d. Then 600/150mg b.i.d. Then 400/100mg b.i.d.	9	30	27
ATV/COBI 300/150 mg q.d.	1	2	5
NFV Arm 2: 1250mg b.i.d. Then 1875mg b.i.d. Then 1250mg b.i.d.	NA	15	14
RAL 400mg b.i.d.	11	33	30
RPV 25mg q.d.	14	26	25
TAF 10mg q.d. w/COBI	15	23	22
TAF 25mg q.d.	13	23	24
TAF 25mg q.d. w/COBI or RTV Boosting	10	24	18
TFV 300mg q.d.	2	27	27
TFV/ATV/RTV Arm 1: 300/300/100mg q.d.	1	11	12
TFV/ATV/RTV Arm 2: 300/300/100mg q.d. Then 300/400/100mg q.d Then 300/300/100mg q.d.	7	23	32

[back to top]

Number of Women Who Met PK Target of Area Under the Curve (AUC) for ARVs

Intervention	Participants (Count of Participants)
	3rd Trimester	Postpartum
EFV 600mg q.d.	20	21
MVC 150 or 300mg b.i.d.	8	7

[back to top]

Area Under the Curve From 0 to 24 Hours (AUC24) of ARVs for Contraceptive Arms

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC24h (area-under-the-curve from 0 to 24 hours) were determined using the linear trapezoidal rule. (NCT00042289)
Timeframe: Measured at 2-12 wks postpartum before contraceptive initiation and 6-7 wks after contraceptive initiation. Blood samples were drawn pre-dose and at 0, 1, 2, 6, 8, 12, and 24 hours post dosing.

Intervention	mcg*hr/mL (Median)
	Before contraceptive initiation	After contraceptive initiation
ATV/RTV/TFV 300/100/300mg q.d. With ENG	53.96	55.25
EFV 600mg q.d. With ENG	53.64	56.65

[back to top]

Area Under the Curve From 0 to 12 Hours (AUC12) of ARVs for Contraceptive Arms

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC12h (area-under-the-curve from 0 to 12 hours) were determined using the linear trapezoidal rule. (NCT00042289)
Timeframe: Measured at 2-12 wks postpartum before contraceptive initiation and 6-7 wks after contraceptive initiation. Blood samples were drawn pre-dose and at 0, 1, 2, 6, 8 and 12 hours post dosing.

Intervention	mcg*hr/mL (Median)
	Before contraceptive initiation	After contraceptive initiation
LPV/RTV 400/100 b.i.d. With ENG	115.97	100.20

[back to top]

Plasma Concentration for Contraceptives

Serum concentrations of the contraceptives. Note that no historical controls were provided by team pharmacologists and thus no comparisons were done for contraceptive concentrations in women using hormonal contraceptives and selected ARV drugs as compared to historical controls not using those ARV drugs. (NCT00042289)
Timeframe: Measured at 6-7 weeks after contraceptive initiation postpartum

Intervention	pg/mL (Median)
ATV/RTV/TFV 300/100/300mg q.d. With ENG	604
LPV/RTV 400/100 b.i.d. With ENG	428
EFV 600mg q.d. With ENG	125

[back to top]

PK Parameter: Cord/Maternal Blood Concentration Ratio With Median (Range) for ARVs and TB Drugs

Cord blood and maternal plasma concentrations were collected and measured at delivery, and compared as a ratio. For arms with zero overall participants analyzed, samples were below the limit of quantification and ratios could not be calculated. (NCT00042289)
Timeframe: Measured at time of delivery with single cord blood and single maternal plasma sample.

Intervention	unitless (Median)
TAF 10mg q.d. w/COBI	0.97
EFV 600 mg q.d. (Outside THA)	0.67
EFV 600mg q.d.	0.49
LPV/RTV Arm 3: 400/100mg b.i.d. Then 600/150mg b.i.d. Then 400/100mg b.i.d.	0.2
RAL 400mg b.i.d.	1.5
ETR 200mg b.i.d.	0.52
MVC 150 or 300mg b.i.d.	0.33
ATV/RTV Arm 2: 300/100mg q.d. Then 400/100mg q.d. Then 300/100mg q.d.	0.14
TFV/ATV/RTV Arm 2: 300/300/100mg q.d. Then 300/400/100mg q.d Then 300/300/100mg q.d.	0.16
NFV Arm 2: 1250mg b.i.d. Then 1875mg b.i.d. Then 1250mg b.i.d.	0.19
IDV/RTV Arm 2: 400/100mg q.d. (Only THA)	0.12
RPV 25mg q.d.	0.55
ATV/RTV 300/100mg q.d. or TFV/ATV/RTV 300/300/100mg q.d.	0.18
DRV/RTV 800/100mg q.d. or DRV/RTV 600/100mg b.i.d.	0.18

[back to top]

Pharmacokinetic (PK) Parameter: Infant Plasma Washout Half-life (T1/2) of ARVs and TB Drugs

Infant plasma concentrations were collected and measured during the first 9 days of life. Half-life is defined as 0.693/k, where k, the elimination rate constant, is the slope of the decline in concentrations. (NCT00042289)
Timeframe: Infant plasma samples at 2-10, 18-28, 36-72 hours and 5-9 days after birth.

Intervention	hour (Median)
DTG 50mg q.d.	32.8
EVG/COBI 150/150mg q.d.	7.6
DRV/COBI 800/150 mg q.d.	NA
EFV 600 mg q.d. (Outside THA)	65.6

[back to top]

PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Cmax was the maximum observed concentration after a dose. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm; Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8,12 (and 24) hours post dosing.

,,,

Intervention	mg/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
ETR 200mg b.i.d.	0.70	1.01	0.63
LPV/RTV Arm 3: 400/100mg b.i.d. Then 600/150mg b.i.d. Then 400/100mg b.i.d.	8.4	10.7	14.6
RAL 400mg b.i.d.	2.250	1.770	3.035
RPV 25mg q.d.	0.145	0.134	0.134

[back to top]

PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (IQR) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC24 (area under the curve from 0 to 24 hours) were determined using the linear trapezoidal rule. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, 12 and 24 hours post dosing.

,,,,,,,,,,,,,

Intervention	mg*hour/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
ATV/COBI 300/150 mg q.d.	25.33	18.85	36.20
ATV/RTV Arm 1: 300/100mg q.d.	88.2	41.9	57.9
ATV/RTV Arm 2: 300/100mg q.d. Then 400/100mg q.d. Then 300/100mg q.d.	30.6	45.7	48.8
DRV/COBI 800/150 mg q.d.	50.00	42.05	95.55
DRV/RTV 800/100mg q.d.	64.6	63.5	103.9
DTG 50mg q.d.	47.6	49.2	65.0
EFV 600 mg q.d. (Outside THA)	47.30	60.02	62.70
EVG/COBI 150/150mg q.d.	15.3	14.0	21.0
TAF 10mg q.d. w/COBI	0.197	0.206	0.216
TAF 25mg q.d.	0.171	0.212	0.271
TAF 25mg q.d. w/COBI or RTV Boosting	0.181	0.257	0.283
TFV 300mg q.d.	1.9	2.4	3.0
TFV/ATV/RTV Arm 1: 300/300/100mg q.d.	14.5	28.8	39.6
TFV/ATV/RTV Arm 2: 300/300/100mg q.d. Then 300/400/100mg q.d Then 300/300/100mg q.d.	26.2	37.7	58.7

[back to top]

PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC12 (area under the curve from 0 to 12 hours) were determined using the linear trapezoidal rule. (NCT00042289)
Timeframe: Measured in 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks, or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, and 12 hrs post dosing.

,,,

Intervention	mg*hour/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
ETR 200mg b.i.d.	4.5	8.3	5.3
IDV/RTV Arm 2: 400/100mg q.d. (Only THA)	14.9	16.1	27.1
LPV/RTV Arm 3: 400/100mg b.i.d. Then 600/150mg b.i.d. Then 400/100mg b.i.d.	72	96	133
RAL 400mg b.i.d.	6.6	5.4	11.6

[back to top]

PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Median (IQR) for ARVs and TB Drugs

,,,

Intervention	mg*hour/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
DRV/RTV 600 or 800 or 900/100mg b.i.d. Then 800 or 900/100mg b.i.d. Then 600/100mg b.i.d.	55.1	51.8	79.6
DRV/RTV 600/100mg b.i.d.	45.8	45.9	61.7
FPV/RTV 700/100mg b.i.d.	43.50	32.15	51.60
NFV Arm 2: 1250mg b.i.d. Then 1875mg b.i.d. Then 1250mg b.i.d.	NA	34.2	33.5

[back to top]

PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Geometric Mean (95% CI) for ARVs and TB Drugs

Measured in 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks, or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, and 12 hrs post dosing. (NCT00042289)
Timeframe: Measured in 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks, or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, and 12 hrs post dosing.

Intervention	ng*hour/mL (Geometric Mean)
	2nd Trimester	3rd Trimester	Postpartum
MVC 150 or 300mg b.i.d.	NA	2717	3645

[back to top]

Pharmacokinetic (PK) Parameter: Infant Plasma Washout Concentration of ARVs and TB Drugs

Infant plasma concentrations were collected and measured during the first 9 days of life. (NCT00042289)
Timeframe: Blood samples were collected at 2-10, 18-28, 36-72 hours and 5-9 days after birth.

,,,

Intervention	mcg/mL (Median)
	2-10 hours after birth	18-28 hours after birth	36-72 hours after birth	5-9 days after birth
DRV/COBI 800/150 mg q.d.	0.35	1.43	1.87	1.72
DTG 50mg q.d.	1.73	1.53	1.00	0.06
EFV 600 mg q.d. (Outside THA)	1.1	1.0	0.9	0.4
EVG/COBI 150/150mg q.d.	0.132	0.032	0.005	0.005

[back to top]

PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC24h (area-under-the-curve from 0 to 24 hours) were determined using the trapezoidal rule. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, 12 and 24 hours post dosing.

Intervention	mg*hour/L (Median)
	3rd Trimester	Postpartum
EFV 600mg q.d.	55.4	58.3

[back to top]

PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. AUC24h (area-under-the-curve from 0 to 24 hours) were determined using the trapezoidal rule. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Blood samples were drawn pre-dose and at 1, 2, 4, 6, 8, 12 and 24 hours post dosing.

Intervention	mg*hour/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
RPV 25mg q.d.	1.969	1.669	2.387

[back to top]

PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (IQR) for ARVs and TB Drugs

Intervention	mg/L (Median)
	3rd Trimester	Postpartum
EFV 600mg q.d.	5.44	5.10

[back to top]

PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (IQR) for ARVs and TB Drugs

,,,,,,,,,,,,,,

Intervention	mg/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
ATV/COBI 300/150 mg q.d.	2.82	2.20	3.90
ATV/RTV Arm 1: 300/100mg q.d.	NA	3.6	4.1
ATV/RTV Arm 2: 300/100mg q.d. Then 400/100mg q.d. Then 300/100mg q.d.	3.11	4.51	4.52
DRV/COBI 800/150 mg q.d.	4.59	3.67	7.04
DRV/RTV 600 or 800 or 900/100mg b.i.d. Then 800 or 900/100mg b.i.d. Then 600/100mg b.i.d.	6.22	6.55	8.96
DRV/RTV 600/100mg b.i.d.	5.64	5.53	7.78
DRV/RTV 800/100mg q.d.	6.77	5.78	8.11
DTG 50mg q.d.	3.62	3.54	4.85
EFV 600 mg q.d. (Outside THA)	3.87	5.13	4.41
FPV/RTV 700/100mg b.i.d.	5.61	5.12	6.75
IDV/RTV Arm 2: 400/100mg q.d. (Only THA)	3.89	3.62	5.37
NFV Arm 2: 1250mg b.i.d. Then 1875mg b.i.d. Then 1250mg b.i.d.	NA	5.1	5.0
TFV 300mg q.d.	0.250	0.245	0.298
TFV/ATV/RTV Arm 1: 300/300/100mg q.d.	1.2	2.5	4.1
TFV/ATV/RTV Arm 2: 300/300/100mg q.d. Then 300/400/100mg q.d Then 300/300/100mg q.d.	2.73	3.56	5.43

[back to top]

PK Parameter: Maximum Concentration (Cmax) in ng/mL With Median (95% CI) for ARVs and TB Drugs

Intervention	ng/mL (Median)
	3rd Trimester	Postpartum
MVC 150 or 300mg b.i.d.	448	647

[back to top]

PK Parameter: Maximum Concentration (Cmax) in ng/mL With Median (IQR) for ARVs and TB Drugs

,,,

Intervention	ng/mL (Median)
	2nd Trimester	3rd Trimester	Postpartum
EVG/COBI 150/150mg q.d.	1447.1	1432.8	1713.1
TAF 10mg q.d. w/COBI	80.4	91.2	98.2
TAF 25mg q.d.	69.7	96	133
TAF 25mg q.d. w/COBI or RTV Boosting	87.8	107	141

[back to top]

PK Parameter: Trough Concentration (C12) With Geometric Mean (95% CI) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Trough concentration was the measured concentration from the 12h post-dose sample after an observed dose. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Trough concentration was measured 12 hrs after an observed dose.

Intervention	ng/mL (Geometric Mean)
	3rd Trimester	Postpartum
MVC 150 or 300mg b.i.d.	108	128

[back to top]

PK Parameter: Trough Concentration (C12) With Median (IQR) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Trough concentration was the measured concentration from the 12h post-dose sample after an observed dose. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation); 3rd trimester (30-38 gestation); and either 2-3 wks, 2-8 wks, or 6-12 wks postpartum, depending on study arm. Trough concentration was measured 12 hrs after an observed dose.

,,,

Intervention	mg/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
DRV/RTV 600 or 800 or 900/100mg b.i.d. Then 800 or 900/100mg b.i.d. Then 600/100mg b.i.d.	2.84	2.52	4.51
DRV/RTV 600/100mg b.i.d.	2.12	2.22	2.51
FPV/RTV 700/100mg b.i.d.	2.12	1.64	2.87
NFV Arm 2: 1250mg b.i.d. Then 1875mg b.i.d. Then 1250mg b.i.d.	NA	0.47	0.52

[back to top]

PK Parameter: Trough Concentration (C12) With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Trough concentration was the measured concentration from the 12h post-dose sample after an observed dose. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation); 3rd trimester (30-38 gestation); and either 2-3 wks, 2-8 wks, or 6-12 wks postpartum, depending on study arm. Trough concentration was measured 12 hrs after an observed dose.

,,,

Intervention	mg/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
ETR 200mg b.i.d.	0.36	0.48	0.38
IDV/RTV Arm 2: 400/100mg q.d. (Only THA)	0.13	0.13	0.28
LPV/RTV Arm 3: 400/100mg b.i.d. Then 600/150mg b.i.d. Then 400/100mg b.i.d.	3.7	5.1	7.2
RAL 400mg b.i.d.	0.0621	0.064	0.0797

[back to top]

PK Parameter: Trough Concentration (C24) With Median (IQR) for ARVs and TB Drugs

"Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Trough concentration was the measured concentration from the 24h post-dose sample after an observed dose.~For the TAF 25 mg q.d., 10 mg q.d. w/COBI, and 25 mg q.d. w/COBI or RTV boosting arms, samples were all below the limit of quantification and statistical analyses were not conducted." (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Trough concentration was measured 24 hrs after an observed dose.

,,,,,,,,,,,,,

Intervention	mg/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
ATV/COBI 300/150 mg q.d.	0.21	0.21	0.61
ATV/RTV Arm 1: 300/100mg q.d.	2.0	0.7	1.2
ATV/RTV Arm 2: 300/100mg q.d. Then 400/100mg q.d. Then 300/100mg q.d.	0.49	0.71	0.90
DRV/COBI 800/150 mg q.d.	0.33	0.27	1.43
DRV/RTV 800/100mg q.d.	0.99	1.17	2.78
DTG 50mg q.d.	0.73	0.93	1.28
EFV 600 mg q.d. (Outside THA)	1.49	1.48	1.94
EVG/COBI 150/150mg q.d.	0.0258	0.0487	0.3771
TAF 10mg q.d. w/COBI	0.00195	0.00195	0.00195
TAF 25mg q.d.	0.00195	0.00195	0.00195
TAF 25mg q.d. w/COBI or RTV Boosting	0.00195	0.00195	0.00195
TFV 300mg q.d.	0.039	0.054	0.061
TFV/ATV/RTV Arm 1: 300/300/100mg q.d.	0.3	0.5	0.8
TFV/ATV/RTV Arm 2: 300/300/100mg q.d. Then 300/400/100mg q.d Then 300/300/100mg q.d.	0.44	0.57	1.26

[back to top]

PK Parameter: Trough Concentration (C24) With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Trough concentration was the measured concentration from the 24h post-dose sample after an observed dose. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Trough concentration was measured 24 hrs after an observed dose.

Intervention	mg/L (Median)
	3rd Trimester	Postpartum
EFV 600mg q.d.	1.60	2.05

[back to top]

PK Parameter: Trough Concentration (C24) With Median (Range) for ARVs and TB Drugs

Pharmacokinetic parameters were determined from plasma concentration-time profiles using noncompartmental methods. Trough concentration was the measured concentration from the 24h post-dose sample after an observed dose. (NCT00042289)
Timeframe: Measured at 2nd trimester (20-26 wks gestation), 3rd trimester (30-38 wks gestation), and either 2-3 wks, 2-8 wks or 6-12 wks postpartum depending on study arm. Trough concentration was measured 24 hrs after an observed dose.

Intervention	mg/L (Median)
	2nd Trimester	3rd Trimester	Postpartum
RPV 25mg q.d.	0.063	0.056	0.081

[back to top]

Area Under the Plasma Concentration-time Curve From Time Zero (Pre-dose) Extrapolated to Infinite Time (AUC[0-inf]) and Over 24 Hours (AUC[0-24]) of GSK1349572 Following Dose Administration on Day 1

AUC is defined as the area under the GSK1349572 concentration-time curve as a measure of drug exposure. AUC(0-inf) is defined as the area under the concentration-time curve from time zero (pre-dose) extrapolated to infinite time. AUC(0-24) is defined as the area under the concentration-time curve from time zero (pre-dose) to24 hours. Blood samples for pharmacokinetic (PK) analysis of GSK1349572 were obtained on Day 1at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 1

Intervention	Microgramshour per milliliter (µghr/mL (Geometric Mean)
	AUC(0-inf)	AUC(0-24)
GSK1349572 10 mg QD	10.1	7.41
GSK1349572 2 mg QD	2.63	2.05
GSK1349572 50 mg QD	40.5	30.34

[back to top]

Change From Baseline in Mean Blood Pressure at Days 1, 4, 7, and 10

Blood pressure measurement included systolic blood pressure (SBP) and diastolic BP (DBP). Change in the mean blood pressure from Baseline was calculated as the post-Baseline value minus the Baseline value. Data are presented for change from Baseline at Day 1 (2 hours post dose [hrs]), Day 4 (1 hr pre-dose), Day 7 (1 hr pre-dose), and Day 10 (1 hr pre-dose and 2 hrs post dose). (NCT00708110)
Timeframe: Baseline and Days 1, 4, 7, and 10

,,,

Intervention	millimeters of mercury (mmHg) (Mean)
	SBP, Day 1, 2 hrs post dose	SBP, Day 4, 1 hr pre-dose	SBP, Day 7, 1 hr pre-dose	SBP, Day 10, 1 hr pre-dose	SBP, Day 10, 2 hrs post dose	DBP, Day 1, 2 hrs post dose	DBP, Day 4, 1 hr pre-dose	DBP, Day 7, 1 hr pre-dose	DBP, Day 10, 1 hr pre-dose	DBP, Day 10, 2 hrs post dose
GSK1349572 10 mg QD	-2.17	1.72	2.28	4.94	3.50	2.33	-0.67	1.33	4.11	6.00
GSK1349572 2 mg QD	-1.11	1.78	-0.56	2.89	2.67	1.39	1.72	1.61	0.17	0.83
GSK1349572 50 mg QD	3.10	-7.60	-2.90	-6.40	-6.40	-2.70	-3.20	-2.40	-7.00	-4.90
Placebo	-5.93	-1.64	0.08	-3.21	-2.07	0.64	0.50	-0.58	0.07	-0.79

[back to top]

Change From Baseline in Mean Heart Rate at Days 1, 4, 7, and 10

Heart rate is the measure of heart beats per minute (bpm). Change in the mean heart rate from Baseline was calculated as the post-Baseline value minus the Baseline value. Data are presented for change from Baseline at Day 1 (2 hours post dose [hrs]), Day 4 (1 hr pre-dose), Day 7 (1 hr pre-dose), and Day 10 (1 hr pre-dose and 2 hrs post dose). (NCT00708110)
Timeframe: Baseline and Days 1, 4, 7, and 10

,,,

Intervention	beats per minute (Mean)
	Day 1, 2 hrs post dose	Day 4, 1 hr pre-dose	Day 7, 1 hr pre-dose	Day 10, 1 hr pre-dose	Day 10, 2 hrs post dose
GSK1349572 10 mg QD	-2.83	6.50	3.72	3.83	-3.72
GSK1349572 2 mg QD	-7.67	-3.22	0.67	0.56	0.44
GSK1349572 50 mg QD	-6.85	2.95	-2.85	-0.95	-7.05
Placebo	-3.71	3.43	2.86	3.29	-1.57

[back to top]

Maximum Observed Plasma Concentration (Cmax) and Concentration at 24 Hours Post Dose (C24) of GSK1349572 Following Dose Administration on Day 1

Cmax is defined as the maximum observed plasma concentration, and C24 is defined as the concentration at 24 hours post dose. Blood samples for PK analysis of GSK1349572 were obtained on Day 1at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. From the plasma concentration-time curve, Cmax was determined by standard non-compartmental analysis using WinNonlin Pro 4.1 or higher. (NCT00708110)
Timeframe: Day 1

Intervention	Micrograms per milliliter (µg/mL) (Geometric Mean)
	Cmax	C24
GSK1349572 10 mg QD	0.57	0.15
GSK1349572 2 mg QD	0.18	0.03
GSK1349572 50 mg QD	2.46	0.59

[back to top]

Number of Participants Who Received the Indicated Concomitant Medications During the Study Period

"Concomitant medications received during the study period are presented by generic term. Only those concomitant medications that were received by at least two participants are presented. Multiple ingredient is the term used in the statistical package for items that contain more than one active ingredient." (NCT00708110)
Timeframe: From Baseline (Day 1) until Follow-up (average of 3 study weeks)

,,,

Intervention	participants (Number)
	Multiple ingredients (combination product)	Ibuprofen	Bupropion hydrochloride	Escitalopram oxalate	Acetylsalicylic acid	Ascorbic acid	Cyanocobalamin	Fish oil	Loratadine	Ranitidine hydrochloride	Trazodone	Valacyclovir hydrochloride	Vitamin B substances (not otherwise specified)	Zolpidem tartrate
GSK1349572 10 mg QD	4	3	1	1	0	0	1	1	2	1	1	0	0	1
GSK1349572 2 mg QD	2	0	1	0	1	1	1	0	0	0	0	0	0	0
GSK1349572 50 mg QD	5	2	1	0	1	0	0	1	0	1	1	1	1	1
Placebo	3	0	0	2	0	1	0	0	0	0	0	1	1	0

[back to top]

Number of Participants With Abnormal Electrocardiogram (ECG) Findings

A 12-lead electrocardiogram (ECG) was performed by qualified personnel at the site after the participant had rested for at least 5 minutes in a semi-recumbent or supine position. If a QTc measurement of >=500 milliseconds (msec) was noted on a scheduled or unscheduled ECG, two additional ECGs were to be obtained within 5 minutes to confirm the abnormality. The number of participants with abnormal clinically significant (CS) and not clinically significant (NCS) ECG findings are presented here. The site determined if an ECG finding is significant or not. ECGs were obtained at Screening, Day 1 (pre-dose [twice] and then 1.0, 1.5, and 2.0 hours [hrs] post dose), Day 4 (pre-dose), Day 7 (pre-dose), Day 10 (pre-dose and then 1.0, 1.5, and 2.0 hrs post dose), Day 11 (prior to the 24 hr PK sample [pre lab]), and Follow-up. (NCT00708110)
Timeframe: Screening; Days 1, 7, 10, 11; and Follow-up (up to Study Day 21)

,,,

Intervention	participants (Number)
	Screening, Normal, n=7, 9, 9, 10	Screening, NCS, n=7, 9, 9, 10	Screening, CS, n=7, 9, 9, 10	Day 1, pre-dose 1, Normal, n=7, 9, 9, 10	Day 1, pre-dose 1, NCS, n=7, 9, 9, 10	Day 1, pre-dose 1, CS, n=7, 9, 9, 10	Day 1, pre-dose 2, Normal, n=7, 9, 9, 10	Day 1, pre-dose 2, NCS, n=7, 9, 9, 10	Day 1, pre-dose 2, CS, n=7, 9, 9, 10	Day 1, 1 hr post dose, Normal, n=7, 9, 9, 10	Day 1, 1 hr post dose, NCS, n=7, 9, 9, 10	Day 1, 1 hr post dose, CS, n=7, 9, 9, 10	Day 1, 1.5 hrs post dose, Normal, n=7, 9, 9, 10	Day 1, 1.5 hrs post dose, NCS, n=7, 9, 9, 10	Day 1, 1.5 hrs post dose, CS, n=7, 9, 9, 10	Day 1, 2 hrs post dose, Normal, n=7, 9, 9, 10	Day 1, 2 hrs post dose, NCS, n=7, 9, 9, 10	Day 1, 2 hrs post dose, CS, n=7, 9, 9, 10	Day 4, pre-dose, Normal, n=7, 9, 9, 10	Day 4, pre-dose, CS, n=7, 9, 9, 10	Day 4, pre-dose, NCS, n=7, 9, 9, 10	Day 7, pre-dose, Normal	Day 7, pre-dose, CS, n=7, 9, 9, 10	Day 7, pre-dose, NCS, n=7, 9, 9, 10	Day 10, pre-dose 1, Normal, n=7, 9, 9, 10	Day 10, pre-dose 1, NCS, n=7, 9, 9, 10	Day 10, pre-dose 1, CS, n=7, 9, 9, 10	Day 10, 1 hr post dose, Normal, n=7, 9, 9, 10	Day 10, 1 hr post dose, NCS, n=7, 9, 9, 10	Day 10, 1 hr post dose, CS, n=7, 9, 9, 10	Day 10, 1.5 hrs post dose, Normal, n=7, 9, 9, 9	Day 10, 1.5 hrs post dose, NCS, n=7, 9, 9, 9	Day 10, 1.5 hrs post dose, CS, n=7, 9, 9, 9	Day 10, 2 hrs post dose, Normal, n=7, 9, 9, 10	Day 10, 2 hrs post dose, NCS, n=7, 9, 9, 10	Day 10, 2 hrs post dose, CS, n=7, 9, 9, 10	Day 11, pre lab, Normal, n=7, 9, 9, 10	Day 11, pre lab, CS, n=7, 9, 9, 10	Day 11, pre lab, NCS, n=7, 9, 9, 10	Follow-up, Normal, n=7, 9, 9, 10	Follow-up, CS, n=7, 9, 9, 10	Follow-up, NCS, n=7, 9, 9, 10
GSK1349572 10 mg QD	8	1	0	9	0	0	9	0	0	9	0	0	8	1	0	7	2	0	8	2	0	9	0	0	8	1	0	8	1	0	8	1	0	8	1	0	9	0	0	9	0	0
GSK1349572 2 mg QD	7	2	0	7	2	0	7	2	0	7	2	0	6	3	0	6	3	0	7	2	0	9	0	0	8	1	0	7	2	0	7	2	0	7	2	0	6	3	0	8	1	0
GSK1349572 50 mg QD	9	1	0	8	2	0	8	2	0	8	2	0	7	3	0	8	2	0	9	1	0	9	1	0	8	2	0	8	2	0	8	1	0	7	3	0	10	0	0	9	1	0
Placebo	5	2	0	5	2	0	5	2	0	6	1	0	5	2	0	5	2	0	3	4	0	4	3	0	4	3	0	4	3	0	2	5	0	3	4	0	3	4	0	2	5	0

[back to top]

Number of Participants With Any Non-serious Adverse Event (AE) or Serious Adverse Event (SAE)

An AE is defined as any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product. An SAE is defined as any untoward medical occurrence that, at any dose, results in death, is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, is a congenital anomaly/birth defect, or is an event of possible drug-induced liver injury. Refer to the general Adverse AE/SAE module for a complete list of AEs and SAEs. (NCT00708110)
Timeframe: From Baseline (Day 1) until Follow-up (average of 3 study weeks)

,,,

Intervention	participants (Number)
	Any Non-serious AE	Any SAE
GSK1349572 10 mg QD	7	0
GSK1349572 2 mg QD	4	0
GSK1349572 50 mg QD	7	0
Placebo	5	0

[back to top]

Number of Participants With HIV-1 RNA <400 Copies/mL and <50 Copies/mL

The number of participants who achieved plasma HIV-1 RNA levels <400 copies/mL and <50 copies/mL through Day 11 was measured. (NCT00708110)
Timeframe: Day 11

,,,

Intervention	participants (Number)
	<400 copies/mL	<50 copies/mL
GSK1349572 10 mg QD	4	0
GSK1349572 2 mg QD	1	1
GSK1349572 50 mg QD	9	4
Placebo	0	0

[back to top]

Number of Participants With the Indicated Grade 3 and Grade 4 Laboratory Abnormalities

Clinical laboratory toxicities were graded according to the National Institutes of Allergy and Infectious Diseases (NIAID), Division of Acquired Immunodeficiency Syndrome (DAIDS). Grade 1, Mild; Grade 2, Moderate; Grade 3 (G3), Severe; Grade 4 (G4), Life-threatening or disabling; Grade 5, Death. Data are presented only for Grade 3 and Grade 4 laboratory abnormalities. Clinical laboratory abnormalities included: increased glucose, lipase, decreased platelets, and triglycerides. (NCT00708110)
Timeframe: Screening; Days 1, 3, 7, and 10; and Follow-up (up to Study Day 21)

,,,

Intervention	participants (Number)
	Increased glucose, Screening, n=7, 9, 9, 10	Increased Glucose, Day 7, n=7, 9, 9, 9	Lipase, Day 10, n=7, 9, 9, 9	Decreased platelets, Day 1, n=6, 9, 9, 9	Decreased platelets, Day 3, n=6, 9, 9, 10	Decreased platelets, follow-up, n=7, 9, 9, 10	Triglycerides, Day 7, n=7, 9, 9, 9
GSK1349572 10 mg QD	0	0	1	1	1	1	1
GSK1349572 2 mg QD	1	1	0	0	0	0	0
GSK1349572 50 mg QD	0	0	0	0	0	0	0
Placebo	0	0	0	0	0	0	0

[back to top]

Pre-dose Concentration (C0), Concentration at the End of the Dosing Interval (Ctau), Minimum Observed Concentration During One Dosing Interval (Cmin), and Maximum Obsevered Plasma Concentration (Cmax) of GSK1349572 Following the Last Repeat Administration

C0 is defined as the pre-dose concentration. Ctau is defined as the concentration at the end of the dosing interval. Cmin is defined as the minimum observed concentration during one dosing interval. Cmax is defined as the maximum obsevered plasma concentration. Blood samples for PK analysis of GSK1349572 were obtained on Day 10 at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 10

Intervention	µg/mL (Geometric Mean)
	C0	Ctau	Cmin	Cmax
GSK1349572 10 mg QD	0.20	0.19	0.19	0.80
GSK1349572 2 mg QD	0.04	0.04	0.04	0.22
GSK1349572 50 mg QD	0.82	0.83	0.81	3.34

[back to top]

Time to Maximum Observed Concentration (Tmax) and Absorption Lag Time (Tlag) of GSK1349572 Following Dose Administration on Day 1

tmax is defined as the time to the maximum obsevered plasma concentration. Absorption lag time is defined as the time taken for a drug to appear in the systemic circulation following administration. tlag was estimated based on PK sampling times of 0 (pre-dose), 0.5, 1, 1.5, 2 3, 4, 6, 8, 12, and 24 hours post-dose. Blood samples for PK analysis of GSK1349572 were obtained on Day 1at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. From the plasma concentration-time curve, tmax was determined by standard non-compartmental analysis using WinNonlin Pro 4.1 or higher. (NCT00708110)
Timeframe: Day 1

Intervention	Hours (Median)
	tmax	tlag
GSK1349572 10 mg QD	2.00	0
GSK1349572 2 mg QD	1.50	0
GSK1349572 50 mg QD	2.09	0

[back to top]

Median Change From Baseline in Plasma HIV-1 RNA to Nadir (Maximum Change) at Day 11

Plasma HIV-1 RNA change from Baseline to the on-treatment nadir (maximum change) was calculated as the post-Baseline value minus the Baseline value. (NCT00708110)
Timeframe: Baseline and Day 11

Intervention	Log10 copies/mL (Median)
Placebo	-0.12
GSK1349572 2 mg QD	-1.65
GSK1349572 10 mg QD	-1.99
GSK1349572 50 mg QD	-2.55

[back to top]

Number of Participants With the Emergence of Drug Resistance Mutations

The number of participants with the emergence (from Baseline) of drug resistance mutations at Day 11 was measured. (NCT00708110)
Timeframe: Baseline and Day 11

Intervention	participants (Number)
Placebo	0
GSK1349572 2 mg QD	0
GSK1349572 10 mg QD	0
GSK1349572 50 mg QD	0

[back to top]

Median Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Count at Day 11

Median change from Baseline in CD4+ cell count was calculated as the Day 11 value minus the Baseline value. (NCT00708110)
Timeframe: Baseline and Day 11

Intervention	Cells per cubic millimeter (cells/mm^3) (Median)
Placebo	-28.5
GSK1349572 2 mg QD	15.0
GSK1349572 10 mg QD	106.0
GSK1349572 50 mg QD	64.0

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA to Nadir (Maximum Change) at Day 11

Plasma HIV-1 RNA change from Baseline to the on-treatment nadir (maximum change) was calculated as the post-Baseline value minus the Baseline value. (NCT00708110)
Timeframe: Baseline and Day 11

Intervention	Log10 copies/mL (Mean)
Placebo	-0.31
GSK1349572 2 mg QD	-1.58
GSK1349572 10 mg QD	-2.09
GSK1349572 50 mg QD	-2.61

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA Levels During the Follow-up Period (Days 11 to 21)

Change from Baseline in Plasma HIV-1 RNA levels was calculated as the value during the Follow-up period minus the Basline value. (NCT00708110)
Timeframe: Baseline and Follow-up period (Days 11 to 21)

Intervention	Log10 copies/mL (Mean)
Placebo	-0.188
GSK1349572 2 mg QD	-0.149
GSK1349572 10 mg QD	-0.154
GSK1349572 50 mg QD	-0.899

[back to top]

Change From Baseline in Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) at Day 11

Change from Baseline in Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) was calculated as the Day 11 value minus the Baseline value. Blood samples for the measurement of HIV-1 RNA levels were obtained throughout the treatment period (Day 1 to Day 11). (NCT00708110)
Timeframe: Baseline (Day 1) and Day 11

Intervention	Log10 copies/milliliter (log10 copies/mL (Mean)
Placebo	0.05
GSK1349572 2 mg QD	-1.51
GSK1349572 10 mg QD	-2.03
GSK1349572 50 mg QD	-2.46

[back to top]

Area Under the Concentration-time Curve Over the Dosing Interval (AUC[0-tau]) of GSK1349572 Following the Last Repeat Administration on Day 10

AUC is defined as the area under the GSK1349572 concentration-time curve as a measure of drug exposure. AUC(0-tau) is defined as the area under the concentration-time curve over the dosing interval. Blood samples for PK analysis of GSK1349572 were obtained on Day 10at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 10

Intervention	µg*hr/mL (Geometric Mean)
GSK1349572 2 mg QD	2.56
GSK1349572 10 mg QD	10.13
GSK1349572 50 mg QD	43.39

[back to top]

Apparent Clearance (CL/F) of GSK1349572 Following Dose Administration on Day 10

The CL/F is defined as the apparent total clearance of the drug from plasma after oral administration. Blood samples for PK analysis of GSK1349572 were obtained on Day 10 at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 10

Intervention	L/hr (Geometric Mean)
GSK1349572 2 mg QD	0.78
GSK1349572 10 mg QD	0.99
GSK1349572 50 mg QD	1.15

[back to top]

Apparent Clearance (CL/F) of GSK1349572 Following Dose Administration on Day 1

The CL/F is defined as the apparent total clearance of the drug from plasma after oral administration. Blood samples for PK analysis of GSK1349572 were obtained on Day 1at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 1

Intervention	Liters per hour (L/hr) (Geometric Mean)
GSK1349572 2 mg QD	0.76
GSK1349572 10 mg QD	0.99
GSK1349572 50 mg QD	1.23

[back to top]

Plasma HIV-1 RNA Rate of Decline Over 10 Days

The rate of decline of plasma HIV-1 RNA levels from Day 1 to Day 11 was measured. (NCT00708110)
Timeframe: Day 1 to Day 11

Intervention	Log10 copies/mL/day (Mean)
Placebo	0
GSK1349572 2 mg QD	-0.14
GSK1349572 10 mg QD	-0.20
GSK1349572 50 mg QD	-0.25

[back to top]

Median Change From Baseline in Plasma HIV-1 RNA Levels During the Follow-up Period (Days 11 to 21)

Change from Baseline in Plasma HIV-1 RNA levels was calculated as the value during the Follow-up period minus the Basline value. (NCT00708110)
Timeframe: Baseline and Follow-up period (Days 11 to 21)

Intervention	Log10 copies/mL (Median)
Placebo	-0.069
GSK1349572 2 mg QD	-0.169
GSK1349572 10 mg QD	-0.150
GSK1349572 50 mg QD	-0.887

[back to top]

Terminal Half-life (t1/2) of GSK1349572 Following Dose Administration on Day 1

The terminal half-life (t1/2) of GSK1349572 is defined as the time required for the plasma concentration of GSK1349572 to reach half of its original concentration. Blood samples for PK analysis of GSK1349572 were obtained on Day 1at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 1

Intervention	Hours (Geometric Mean)
GSK1349572 2 mg QD	10.7
GSK1349572 10 mg QD	11.8
GSK1349572 50 mg QD	11.2

[back to top]

Terminal Half-life (t1/2) of GSK1349572 Following the Last Repeat Administration on Day 10

The terminal half-life (t1/2) of GSK1349572 is defined as the time required for the plasma concentration of GSK1349572 to reach half of its original concentration. Blood samples for PK analysis of GSK1349572 were obtained on Day 10 at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. (NCT00708110)
Timeframe: Day 10

Intervention	Hours (Geometric Mean)
GSK1349572 2 mg QD	11.13
GSK1349572 10 mg QD	11.64
GSK1349572 50 mg QD	11.95

[back to top]

Time to the Maximum Observed Concentration (Tmax) of GSK1349572 Following the Last Repeat Administration on Day 10

tmax is defined as the time to the maximum obsevered plasma concentration. Blood samples for PK analysis of GSK1349572 were obtained on Day 10 at pre-dose (within 15 minutes prior to dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours post GSK1349572 dose administration. From the plasma concentration-time curve, tmax was determined by standard non-compartmental analysis using WinNonlin Pro 4.1 or higher. (NCT00708110)
Timeframe: Day 10

Intervention	Hours (Median)
GSK1349572 2 mg QD	1.00
GSK1349572 10 mg QD	1.48
GSK1349572 50 mg QD	2.00

[back to top]

Number of Participants (Cumulative) With Protocol-defined Virological Failure (PDVF) at Day 11 and Weeks 8, 12, 16, 20, 24, 32, 40, 48, 60, 72, 84, 96, Week 108 Every 12 Weeks up to Study Completion

PDVF is defined in relation to Baseline plasma HIV-1 RNA levels: at Day 11, a decrease of <0.7 log10 c/mL unless <400 c/mL; at Weeks 8 to <16, a decrease of <1.0 log10 c/mL unless <400 c/mL or an increase of >= 1.0 log10 c/mL from nadir; and at or after Week 16, ≥400 c/mL. PDVF at Day 11 was based on a single plasma HIV-1 RNA evaluation and did not require confirmation. Confirmation testing was required for visits at or after Week 8. For the combination treatment phase, all HIV-1 RNA samples that meet a criterion for suspected PDVF must be confirmed by a second measurement performed at least 1 week but not more than 4 weeks apart from the date of the original sample. (NCT00950859)
Timeframe: Day 11; Weeks 8, 12, 16, 20, 24, 32, 40, 48, 60, 72, 84, 96, from Week 108 every 12 weeks up to study completion

Intervention	Participants (Number)
	Day 11	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48	Week 60	Week 72	Week 84	Week 96	Week 108	Week 120	Week 132	Week 144	Week 156	Week 168	Week 180	Week 192	Week 204	Week 216	Week 228	Week 240	Week 252	Week 264
Cohort I (DTG 50 mg OD)	6	7	9	10	10	12	12	12	13	13	14	15	16	16	16	16	16	16	16	16	16	16	17	18	18	18	18
Cohort II (DTG 50 mg BID)	1	3	3	5	5	5	5	5	5	5	6	6	6	6	6	6	7	7	7	7	7	7	7	7	NA	NA	NA

[back to top]

Median Fold Change in Sensitivity to DTG by the Baseline (Day 1) IN Mutational Group

Summary of median fold change in sensitivity to DTG by Integrase (IN) mutational group was assessed. The IN mutational group comprises of the following mutations: Q148 +2, Q148 +1, mixture (participants with virus containing more than one Y143, Q148 or N155 mutation at Day 1), Y143, N155, other (participants with virus having no mutations at codons 143, 148, or 155 at Day 1). Fold change (FC) is the fold change in 50% Inhibitory Concentration (IC50) relative to the wild-type control virus. (NCT00950859)
Timeframe: Baseline (Day 1)

Intervention	Percentage (Median)
	Q148 + 2, n=3, 2	Q148 + 1, n=4, 8	Mixture, n=2, 1	Y143, n=12, 6	N155, n=4, 6	Other, n=2, 1
Cohort I (DTG 50 mg OD)	21	5.5	7.8	1.1	1.8	1.2
Cohort II (DTG 50 mg BID)	4	5.5	9.48	1.2	2.3	0.87

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA at Day 6 to 8, Day 11, Weeks 4, 12, 24, 48, 72, 96, From Week 108 Every 12 Weeks up to Study Completion

Mean change from Baseline in Plasma HIV-1 RNA was assessed on Day 6 to 8, Day 11, and Weeks 4, 12, 24, 48, 72, 96, 108, 120, 132, 144, 156, 168, 180, 192, 204, 216, 228, 240, 252, and 264 using data of the observed cases. Study Day 1 was considered as Baseline. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT00950859)
Timeframe: Baseline; Day 6 to 8; Day 11; Weeks 4, 12, 24, 48, 72, 96, from 108 every 12 weeks up to study completion

Intervention	Log10 copies/mL (Mean)
	Day 6 to 8, n=27, 24	Day 11, n=27, 24	Week 4, n=26, 24	Week 12, n=22, 24	Week 24, n=18, 22	Week 48, n=15, 20	Week 72, n=14, 18	Week 96, n=13, 15	Week 108, n= 13, 17	Week 120, n= 11, 17	Week 132, n= 11, 17	Week 144, n= 12, 15	Week 156, n= 12, 15	Week 168, n= 11, 14	Week 180, n= 11, 10	Week 192, n= 9, 7	Week 204, n= 10, 6	Week 216, n= 9, 6	Week 228, n= 6, 4	Week 240, n= 7, 0	Week 252, n= 4, 0	Week 264, n= 1, 0
Cohort I (DTG 50 mg OD)	-1.31	-1.45	-1.82	-1.94	-1.99	-2.02	-2.10	-2.06	-1.95	-2.09	-1.83	-2.08	-2.04	-1.77	-1.76	-1.87	-1.76	-1.61	-1.79	-1.63	-1.72	-2.90
Cohort II (DTG 50 mg BID)	-1.40	-1.76	-2.06	-2.30	-2.50	-2.63	-2.71	-2.58	-2.69	-2.67	-2.66	-2.62	-2.65	-2.72	-2.56	-2.51	-2.35	-2.35	-2.33	NA	NA	NA

[back to top]

Cmax, Cmin, and Ctau of DTG

The maximum plasma concentration (Cmax), minimum plasma concentration (Cmin), and concentration at the end of a dosing interval (Ctau) of DTG were assessed at Day 10. Blood samples for pharmacokinetic (PK) assessments were collected at pre-dose (within 15 minutes prior to dose) and 2, 3, 4, 8, and 24 hours post-dose on Day 10 for DTG 50 mg OD and pre-dose (within 15 minutes prior to dose) and 2, 3, 4 and 8 hours post morning dose and 12 hours post evening dose for DTG 50 mg BID. (NCT00950859)
Timeframe: Day 10

Intervention	Micrograms per milliliter (µg/mL) (Geometric Mean)
	Cmax	Ctau	Cmin
Cohort I (DTG 50 mg OD)	3.04	0.69	0.48
Cohort II (DTG 50 mg BID)	5.41	2.72	2.61

[back to top]

Proportion of Participants Who Achieved Plasma HIV-1 RNA <400 c/mL and <50 c/mL From Week 48 Every 12 Weeks up to Study Completion

The number of participants with plasma HIV-1 RNA <400 c/mL or <50 c/mL was assessed at Weeks 48, 72, 96, 108, 120, 132, 144, 156, 168, 180, 192, 204, 216, 228, 240, 252, and 264 using data of observed cases. Only those participants available at the specified time points were analyzed (represented by n=X in the category titles). (NCT00950859)
Timeframe: From Week 48 every 12 weeks up to study completion

Intervention	Percentage of Participants (Number)
	Week 48, <50 c/mL, n=15, 20	Week 60, <50 c/mL, n=13, 18	Week 72, <50 c/mL, n=14, 18	Week 84, <50 c/mL, n=14, 18	Week 96, <50 c/mL, n=13, 15	Week 108, <50 c/mL, n=13, 17	Week 120, <50 c/mL, n=11, 17	Week 132, <50 c/mL, n=11, 17	Week 144, <50 c/mL, n=12, 15	Week 156, <50 c/mL, n=12, 15	Week 168, <50 c/mL, n=11, 14	Week 180, <50 c/mL, n=11, 10	Week 192, <50 c/mL, n= 9, 7	Week 204, <50 c/mL, n= 10, 6	Week 216, <50 c/mL, n= 9, 6	Week 228, <50 c/mL, n=6, 4	Week 240, <50 c/mL, n=7,0	Week 252, <50 c/mL, n=4, 0	Week 264, <50 c/mL, n=1, 0	Week 48, <400 c/mL, n=15, 20	Week 60,<400 c/mL, n=13, 18	Week 72,<400 c/mL, n=14, 18	Week 84,<400 c/mL, n=14, 18	Week 96,<400 c/mL, n=13, 15	Week 108,<400 c/mL, n=13,17	Week 120,<400 c/mL, n=11, 17	Week 132,<400 c/mL, n=11,17	Week 144,<400 c/mL, n=12, 15	Week 156,<400 c/mL, n=12, 15	Week 168,<400 c/mL, n=11, 14	Week 180,<400 c/mL, n=11, 10	Week 192,<400 c/mL, n=9, 7	Week 204,<400 c/mL, n=10, 6	Week 216,<400 c/mL, n=9, 6	Week 228,<400 c/mL, n=6, 4	Week 240,<400 c/mL, n=7, 0	Week 252,<400 c/mL, n=4, 0	Week 264,<400 c/mL, n=1, 0
Cohort I (DTG 50 mg OD)	60	69	64	57	54	54	55	55	58	67	64	64	67	50	56	67	57	50	100	73	92	79	71	85	85	82	82	83	75	82	73	78	70	56	67	71	50	100
Cohort II (DTG 50 mg BID)	80	94	78	78	87	88	88	82	87	93	86	100	100	100	100	100	NA	NA	NA	95	100	100	94	100	100	94	94	93	100	100	100	100	100	100	100	NA	NA	NA

[back to top]

AUC0-24 Assessment of DTG

AUC is defined as the area under the DTG concentration-time curve as a measure of drug exposure. AUC(0-24) is defined as the area under the concentration-time curve from time zero (pre-dose) to 24 hours. AUC0-24 of DTG was assessed at Day 10. Blood samples for pharmacokinetic assessments were collected at pre-dose (within 15 minutes prior to dose) and 2, 3, 4, 8, and 24 hours post-dose on Day 10 for DTG 50 mg OD and pre-dose (within 15 minutes prior to dose) and 2, 3, 4 and 8 hours post morning dose and 12 hours post evening dose for DTG 50 mg BID. (NCT00950859)
Timeframe: Day 10

Intervention	Microgramshour per milliliter (µghr/mL (Geometric Mean)
Cohort I (DTG 50 mg OD)	36.46
Cohort II (DTG 50 mg BID)	93.36

[back to top]

Number of Participants Who Achieved HIV-1 RNA <400 Copies (c)/Milliliter (mL) or at Least 0.7 log10 c/mL Below Their Baseline Value at Day 11

The number of participants who acheived Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <400 c/mL or at least 0.7 log10 c/mL below their Baseline value at Day 11 was assessed. The last observation was carried forward if a participant had missed the Day 11 visit. The Baseline observation was carried forward if a participant had discontinued the treatment before Day 11. Blood samples for assessment of HIV-1 RNA levels were collected at Baseline and Day 11. (NCT00950859)
Timeframe: Baseline (Day 1) and Day 11

Intervention	Participants (Number)
Cohort I (DTG 50 mg OD)	21
Cohort II (DTG 50 mg BID)	23

[back to top]

Tmax of DTG

The tmax is defined as the time of occurrence of the maximum plasma concentration (Cmax). The tmax was assessed at Day 10. Blood samples for pharmacokinetic assessments were collected at pre-dose (within 15 minutes prior to dose) and 2, 3, 4, 8, and 24 hours post-dose on Day 10 for DTG 50 mg OD and pre-dose (within 15 minutes prior to dose) and 2, 3, 4 and 8 hours post morning dose and 12 hours post evening dose for DTG 50 mg BID. (NCT00950859)
Timeframe: Day 10

Intervention	Hours (Median)
Cohort I (DTG 50 mg OD)	2.97
Cohort II (DTG 50 mg BID)	2.00

[back to top]

C0 Assessment of DTG

The plasma DTG concentration immediately prior to dosing at steady state (C0) was assessed at Day 10, and Weeks 4 and 24. Blood samples for pharmacokinetic assessments were collected at pre-dose (within 15 minutes prior to dose). (NCT00950859)
Timeframe: Day 10; Weeks 4 and 24

Intervention	µg/mL (Geometric Mean)
	C0, Day 10	C0, Week 4	C0, Week 24
Cohort I (DTG 50 mg OD)	0.51	0.57	0.38
Cohort II (DTG 50 mg BID)	3.20	2.55	2.38

[back to top]

Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Protocol-defined Virologic Failure (PDVF) as a Measure of Genotypic Resistance

An analysis of changes at specific amino acids in the IN coding region associated with resistance to raltegravir, elvitegravir, or DTG was performed at Day 1 and at the time of PDVF. PDVF is defined in relation to Baseline plasma HIV-1 RNA levels: at Day 11, a decrease of <0.7 log10 c/mL unless <400 c/mL; at Weeks 8 to <16, a decrease of <1.0 log10 c/mL unless <400 c/mL or an increase of >= 1.0 log10 c/mL from nadir; and at or after Week 16, ≥400 c/mL. PDVF at Day 11 was based on a single plasma HIV-1 RNA evaluation and did not require confirmation. Confirmation testing was required for visits at or after Week 8. For the combination treatment phase, all HIV-1 RNA samples that meet a criterion for suspected PDVF must be confirmed by a second measurement performed at least 1 week but not more than 4 weeks apart from the date of the original sample. (NCT00950859)
Timeframe: From Baseline (Day 1) until study completion (median 605 days for Cohort I, median 1181 days for Cohort II)

Intervention	Participants (Number)
	Any	E138T	N155H	T97A	E92E/Q	G140S	L74I/M	Q148H	E138E/A	E138E/K	L74I/M/I	L74M	L74I	T97T/A	Q148R	S147G	E92E/V	L68L/I
Cohort I (DTG 50 mg OD)	11	0	3	2	0	3	1	2	1	1	1	1	1	0	1	3	0	1
Cohort II (DTG 50 mg BID)	5	1	4	0	1	0	0	0	0	2	0	0	0	2	0	0	1	0

[back to top]

Number of Participants With the Indicated HIV-1 Associated Conditions, Excluding Recurrences

The number of participants with post-Baseline emergent HIV-1 disease progression (Acquired immunodeficiency syndrome (AIDS) or death) was assessed per the Centers for Disease Control and Prevention (CDC) 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. The CDC classifies HIV infection as Category A (participants with asymptomatic HIV infection, acute HIV infection with accompanying illness, or persistent generalized lymphadenopathy), Category B (participants with symptomatic non-AIDS condition, i.e., conditions that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or conditions are considered by physicians to have a clinical course or to require management that is complicated by HIV infection), and Category C (includes AIDS indicator conditions as defined by diagnostic or presumptive measures). (NCT00950859)
Timeframe: From the day of the first dose of study drug until study completion (median 605 days for Cohort I, median 1181 days for Cohort II)

Intervention	Participants (Number)
	Category B, Candidiasis, oropharyngeal	Category B, Hairy leukoplakia, oral	Category B, Herpes Zoster	Category C, Herpes simplex	Category C, Candidiasis, esophageal	Category C, Cytomegalovirus retinitis	Category C, Kaposi's sarcoma	Category C, Lymphoma, Burkitt's	Category C, Lymphoma, immunoblastic	Death, Brain mass	Death, Completed suicide	Death, Febrile bone marrow aplasia	Death, Immunoblastic lymphoma	Death, Acute pulmonary oedema	Death, Anaemia	Death, Haemochromatosis	Death, Hepatic fibrosis	Other: Cryptosporidiosis, acute intestinal	Other: leukoplasia of both side of the tongue
Cohort I (DTG 50 mg OD)	3	2	2	1	0	0	1	0	1	1	0	1	1	1	0	0	0	0	1
Cohort II (DTG 50 mg BID)	2	0	0	0	1	1	0	1	0	0	1	0	0	0	1	1	1	1	0

[back to top]

Change From Baseline in CD4+ Cell Count at Day 11 and Weeks 4, 12, 24, 48, 72, 96, Week 108 Every 12 Weeks up to Study Completion

Change from Baseline in CD4+ cell count was assessed at Day 11 and at Weeks 4, 12, 24, 48, 72, 96, 108, 120, 132, 144, 156, 168, 180, 192, 204, 216, 228, 240, 252, and 264 . Study Day 1 was considered as Baseline. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT00950859)
Timeframe: Baseline; Day 11; Weeks 4, 12, 24, 48, 72, 96, from Week 108 every 12 weeks up to study completion

Intervention	cells per cubic millimeter (mm^3) (Median)
	Baseline, n=27, 24	Day 11, n=27, 24	Week 4, n=27, 24	Week 12, n= 22, 24	Week 24, n=17, 22	Week 48, n=15, 20	Week 72, n=14, 18	Week 96, n=13, 15	Week 108, n=13, 17	Week 120, n=11, 17	Week 132, n=11, 17	Week 144, n=12, 15	Week 156, n=12, 15	Week 168, n=11, 13	Week 180, n=11, 10	Week 192, n=10, 7	Week 204, n=10, 6	Week 216, n=9, 6	Week 228, n=7, 3	Week 240, n=7, 0	Week 252, n=4, 0	Week 264, n=1, 0
Cohort I (DTG 50 mg OD)	114	34	57	84	78	102	163	142	124	221	97	121	212	97	125	94	92	172	148	158	157	560
Cohort II (DTG 50 mg BID)	202	14	35	57	79	106	191.5	189	155	221	158	278	223	271	224	343	264	252	417	NA	NA	NA

[back to top]

Number of Participants With the Indicated Grade 3 and Grade 4 Hematological Toxicities

Intervention	Participants (Number)
	Hemoglobin, Grade 3	Hemoglobin, Grade 4	Platelet count, Grade 3	Platelet count, Grade 4	Total Neutrophils, Grade 3	Total Neutrophils, Grade 4	White Blood Cell count, Grade 3	White Blood Cell, Grade 4
Cohort I (DTG 50 mg OD)	0	0	0	0	0	0	0	0
Cohort II (DTG 50 mg BID)	1	0	0	0	0	2	0	1

[back to top]

Number of Participants With the Indicated Grade 3 and Grade 4 Clinical Chemistry Toxicities

Hematology and clinical chemistry data were summarized according to Division of AIDS (DAIDS) Table for Grading the Severity of Adult and Pediatric Adverse Events, dated December 2004. Grade 1, Mild; Grade 2, Moderate; Grade 3, Severe; Grade 4, Potentially life-threatening. Data are presented for only those parameters for which an increase to Grade 3 or Grade 4 occurred. The Grade 3 and Grade 4 clinical chemistry toxicities included: Albumin, Alkaline Phosphatase, Amylase, Aspartate Amino Transferase, Carbon dioxide content/Bicarbonate, Creatinine, Creatinine Clearance, Hypercalcemia, Hyperglycaemia, Hyperkalemia, Hypernatremia, Hypocalcemia, Hypoglycaemia, Hypokalemia, Hyponatremia, LDL Cholesterol, Magnesium, Phosphorus inorganic, and Total Bilirubin, Alanine Amino Transferase, Calcium, Chloride, Cholesterol, Creatine Kinase, Direct Bilirubin, Glucose, High Density Lipid (HDL), Cholesterol direct, Lipase, Potassium, Sodium, Total Cholesterol, Triglycerides, Urea/Blood Urine Nitrogen. (NCT00950859)
Timeframe: From start of study treatment until the end of treatment visit for each participant, up to Week 264 for Cohort I and up to Week 228 for Cohort II

Intervention	Participants (Number)
	Albumin, Grade 3	Albumin, Grade 4	Alkaline Phosphatase, Grade 3	Alkaline Phosphatase, Grade 4	Amylase, Grade 3	Amylase, Grade 4	Aspartate Amino Transferase, Grade 3	Aspartate Amino Transferase, Grade 4	Carbon dioxide content/Bicarbonate, Grade 3	Carbon dioxide content/Bicarbonate, Grade 4	Creatinine, Grade 3	Creatinine, Grade 4	Creatinine Clearance, estimated, Grade 3	Creatinine Clearance, estimated, Grade 4	Hypercalcemia, Grade 3	Hypercalcemia, Grade 4	Hyperglycaemia, Grade 3	Hyperglycaemia, Grade 4	Hyperkalemia, Grade 3	Hyperkalemia, Grade 4	Hypernatremia, Grade 3	Hypernatremia, Grade 4	Hypocalcemia, Grade 3	Hypocalcemia, Grade 4	Hypoglycaemia, Grade 3	Hypoglycaemia, Grade 4	Hypokalemia, Grade 3	Hypokalemia, Grade 4	Hyponatremia, Grade 3	Hyponatremia, Grade 4	LDL Cholesterol, Grade 3	LDL Cholesterol, Grade 4	Magnesium, Grade 3	Magnesium, Grade 4	Phosphorus inorganic, Grade 3	Phosphorus inorganic, Grade 4	Total Bilirubin, Grade 3	Total Bilirubin, Grade 4	Alanine Amino Transferase ,Grade 3	Alanine Amino Transferase ,Grade 4	Calcium,Grade 3	Calcium,Grade 4	Chloride,Grade 3	Chloride,Grade 4	Cholesterol,Grade 3	Cholesterol,Grade 4	Creatine Kinase,Grade 3	Creatine Kinase,Grade 4	Direct Bilirubin,Grade 3	Direct Bilirubin,Grade 4	Glucose,Grade 3	Glucose,Grade 4	HDL Cholesterol direct,Grade 3	HDL Cholesterol direct,Grade 4	Lipase,Grade 3	Lipase,Grade 4	Potassium,Grade 3	Potassium,Grade 4	Sodium,Grade 3	Sodium,Grade 4	Total Cholesterol/HDLratio, Grade 3	Total Cholesterol/HDLratio, Grade 4	Triglycerides,Grade 3	Triglycerides,Grade 4	Urea/BUN,Grade 3	Urea/BUN,Grade 4
Cohort I (DTG 50 mg OD)	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	2	0	0	0	4	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	2	1	0	0	1	0	0	0	0	0	0	0
Cohort II (DTG 50 mg BID)	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	3	0	2	1	1	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	3	1	0	0	0	0	0	0	2	0	0	0

[back to top]

Number of Participants With the Indicated Genotypic Resistance at Baseline

At Baseline, the integrase genotypic results were used to document resistance to raltegravir (RAL) and for the allocation of participants to one of two genotypic groups according to their RAL signature mutations to ensure a broad range of sensitivity to DTG. These results were not used to pre-define subgroup for analysis. (NCT00950859)
Timeframe: Baseline

Intervention	Participants (Number)
	Q148 + 2	Q 148 + 1	Mixture	Y143	N155	Other
Cohort I (DTG 50 mg OD)	3	4	2	12	4	2
Cohort II (DTG 50 mg BID)	2	8	1	6	6	1

[back to top]

Number of Participants With the Indicated Fold Increase in DTG FC (Fold Change in IC50 Relative to Wild-type Virus) Between Baseline and the Time of PDVF, as a Measure of Post-Baseline Phenotypic Resistance

The FC in IC50 (50% inhibitory concentration) for DTG relative to wild-type virus was determined for virus isolated at Baseline and at the time of PDVF.The number of participants with the indicated change (ratio) in the two values at the time of PDVF is presented. PDVF is defined in relation to Baseline plasma HIV-1 RNA levels: at Day 11, a decrease of <0.7 log 10 c/mL unless <400 c/mL; at Weeks 8 to <16, a decrease of <1.0 log 10 c/mL unless <400 c/mL or an increase of >=1.0 log 10 c/mL from nadir; and at or after Week 16, ≥400 c/mL . PDVF at Day 11 was based on a single plasma HIV-1 RNA evaluation and did not require confirmation. Confirmation testing was required for visits at or after Week 8. For the combination treatment phase, all HIV-1 RNA samples that meet a criterion for suspected PDVF must be confirmed by a second measurement performed at least 1 week but not more than 4 weeks apart from the date of original sample. (NCT00950859)
Timeframe: From Baseline (Day 1) until study completion (median 605 days for Cohort I, median 1181 days for Cohort II)

Intervention	Participants (Number)
	<1 fold	1-<2 fold	2-<4 fold	4-<8 fold	>=8 fold
Cohort I (DTG 50 mg OD)	3	4	1	1	8
Cohort II (DTG 50 mg BID)	0	2	0	2	3

[back to top]

Number of Participants With HIV-1 Associated Disease Progression With the Indicated Shifts to CDC Class C or Death

The number of participants with HIV-1 disease progression (AIDS or death) was assessed per the CDC 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. The CDC classifies HIV infection as Category A (participants with asymptomatic HIV infection, acute HIV infection with accompanying illness, or persistent generalized lymphadenopathy), Category B (participants with symptomatic non-AIDS condition, i.e., conditions that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or conditions are considered by physicians to have a clinical course or to require management that is complicated by HIV infection), and Category C (includes AIDS indicator conditions as defined by diagnostic or presumptive measures). (NCT00950859)
Timeframe: From the day of the first dose of study drug until study completion (median 605 days for Cohort I, median 1181 days for Cohort II)

Intervention	Participants (Number)
	From CDC class A to CDC class C	From CDC class B to CDC class C	From CDC class C to new CDC class C	From CDC Class A, B, or C to death
Cohort I (DTG 50 mg OD)	0	0	1	3
Cohort II (DTG 50 mg BID)	2	2	0	2

[back to top]

Number of Participants Who Achieved Plasma HIV-1 RNA <400 c/mL and <50 c/mL at Baseline and Weeks 4, 12, 24, 48, 72, and 96: TLOVR Analysis.

The number of participants with plasma HIV-1 RNA <400 c/mL or <50 c/mL was assessed at Weeks 4, 12, 24, 48, 72, and 96 per the Food and Drug Administration's Time to Loss of Virological Response (TLOVR) algorithm. Using the TLOVR algorithm, participants are considered to have failed on therapy if they never achieved confirmed RNA levels below the threshold, if they had confirmed rebound of RNA above the threshold, if they made a non-permitted change in background regimen, or if they permanently discontinued investigational product for any reason. (NCT00950859)
Timeframe: Baseline; Weeks 4, 12, 24, 48, 72, and 96

Intervention	Participants (Number)
	Baseline, <50 c/mL	Week 4, <50 c/mL	Week 12, <50 c/mL	Week 24, <50 c/mL	Week 48, <50 c/mL	Week 72, <50 c/mL	Week 96, <50 c/mL	Baseline, <400 c/mL	Week 4, <400 c/mL	Week 12, <400 c/mL	Week 24, <400 c/mL	Week 48, <400 c/mL	Week 72, <400 c/mL	Week 96, <400 c/mL
Cohort I (DTG 50 mg OD)	0	9	13	11	9	8	7	0	16	16	14	13	12	10
Cohort II (DTG 50 mg BID)	0	12	16	19	17	NA	NA	0	17	20	20	18	NA	NA

[back to top]

Number of Participants With the Indicated Treatment-emergent Major Mutations of Other Classes Detected at the Time of Protocol-defined Virologic Failure (PDVF), as a Measure of Genotypic Resistance

For participants meeting one of the criteria for PDVF, plasma samples collected at the time point of virologic failure were tested to evaluate any potential genotypic and/or phenotypic evolution of resistance. PDVF was defined as (A) Virologic Non-response: a decrease in plasma HIV-1 RNA of <1 log10 copies/mL by Week 4, with subsequent confirmation, unless plasma HIV-1 RNA is <400 copies/mL; confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24 without evidence of prior suppression to <400copies/mL or (B) Virologic Rebound: confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL; confirmed plasma HIV-1 RNA levels >0.5 log10 copies/mL above the nadir value, where nadir is the lowest HIV-1 value >=400 copies/mL. (NCT00951015)
Timeframe: From Baseline up to Week 96/Early Withdrawal

Intervention	Participants (Number)
DTG 10 mg QD	1
DTG 25 mg QD	0
EFV 600 mg QD	0

[back to top]

Number of Participants With Any Adverse Event (AE) and Any Serious Adverse Events (SAE)

An adverse event (AE) is defined as any untoward medical occurrence in a participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. A serious adverse event (SAE) is defined as any untoward medical occurrence that, at any dose: results in death; is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity; or is a congenital anomaly/birth defect. All clinically suspected cases of hypersensitivity reaction to abacavir in participants receiving abacavir/lamivudine were reported as SAEs. Medical or scientific judgment was to have been exercised in other situations. Refer to the general AE/SAE module for a list of AEs (occuring at a frequency threshold >=3%) and SAEs. (NCT00951015)
Timeframe: From Baseline up to Week 96/Early Withdrawal

,,,

Intervention	Participants (Number)
	Any AE	Any SAE
DTG 10 mg QD	50	5
DTG 25 mg QD	46	5
DTG 50 mg QD	46	7
EFV 600 mg QD	46	7

[back to top]

Relationship Between the Indicated Safety Parameters at Week 96 and the Indicated Plasma DTG PK Parameters

Relationships between log-transformed plasma DTG PK parameters (AUC[0-tau], Cmax, C0, C0avg, Ctau, and Cmin) and safety parameters (AE occurrence, maximum AE intensity, alanine aminotransferase [ALT], change from Baseline [CFB] in ALT, total bilirubin, CFB in total bilirubin, creatine kinase, CFB in creatine kinase, triglycerides, CFB in triglycerides, lipase, CFB in lipase, total cholesterol [TC], CFB in TC) was assessed using Pearson's correlation analyses. The Pearson's correlation coefficient is a measure of the correlation between safety parameters and plasma DTG PK parameters and ranges from -1 to 1. A value of 0 indicates no statistical association; a value close to -1 or 1 indicates a higher association. The presence of >=1 AE was used for AE occurrence. The most severe AE grade/intensity was used for maximum AE intensity. Maximum laboratory values per participant were used for safety parameters. CFB was calculated as the post-Baseline value minus the value at Baseline. (NCT00951015)
Timeframe: Week 96

Intervention	Pearson's correlation coefficient (Number)
	AUC(0-tau) versus AE occurrence, n=45	AUC(0-tau) versus maximum AE intensity, n=45	AUC(0-tau) versus ALT, n=45	AUC(0-tau) versus CFB in ALT, n=45	AUC(0-tau) versus total bilirubin, n=45	AUC(0-tau) versus CFB in total bilirubin, n=45	AUC(0-tau) versus creatine kinase, n=45	AUC(0-tau) versus CFB in creatine kinase, n=45	AUC(0-tau) vs Triglycerides, n=45	AUC(0-tau) versus CFB in triglycerides, n=45	AUC(0-tau) versus lipase, n=45	AUC(0-tau) versus CFB in lipase, n=45	AUC(0-tau) versus total cholesterol, n=45	AUC(0-tau) versus CFB in total cholesterol, n=45	Cmax versus AE occurrence, n=45	Cmax versus maximum AE intensity, n=45	Cmax versus ALT, n=45	Cmax versus CFB in ALT, n=45	Cmax versus total bilirubin, n=45	Cmax versus CFB in total bilirubin, n=45	Cmax versus creatine kinase, n=45	Cmax versus CFB in creatine kinase, n=45	Cmax versus triglycerides, n=45	Cmax versus CFB in triglycerides, n=45	Cmax versus lipase, n=45	Cmax versus CFB in lipase, n=45	Cmax versus total cholesterol, n=45	Cmax versus CFB in total cholesterol, n=45	C0 versus AE occurrence, n=133	C0 versus maximum AE intensity, n=133	C0 versus ALT, n=133	C0 versus CFB in ALT, n=133	C0 versus total bilirubin, n=133	C0 versus CFB in total bilirubin, n=133	C0 versus creatine kinase, n=133	C0 versus CFB in creatine kinase, n=133	C0 versus triglycerides, n=133	C0 versus CFB in triglycerides, n=133	C0 versus lipase, n=133	C0 versus CFB in lipase, n=133	C0 versus total cholesterol, n=133	C0 versus CFB in total cholesterol, n=133	C0avg versus AE occurrence, n=140	C0avg versus maximum AE intensity, n=140	C0avg versus ALT, n=140	C0avg versus CFB in ALT, n=140	C0avg versus total bilirubin, n=140	C0avg versus CFB in total bilirubin, n=140	C0avg versus creatine kinase, n=140	C0avg versus CFB in creatine kinase, n=140	C0avg versus triglycerides, n=140	C0avg versus CFB in triglycerides, n=140	C0avg versus lipase, n=140	C0avg versus CFB in lipase, n=140	C0avg versus total cholesterol, n=140	C0avg versus CFB in total cholesterol, n=140	Ctau versus AE occurrence, n=45	Ctau versus maximum AE intensity, n=45	Ctau versus ALT, n=45	Ctau versus CFB in ALT, n=45	Ctau versus total bilirubin, n=45	Ctau versus CFB in total bilirubin, n=45	Ctau versus creatine kinase, n=45	Ctau versus CFB in creatine kinase, n=45	Ctau versus triglycerides, n=45	Ctau versus CFB in triglycerides, n=45	Ctau versus lipase, n=45	Ctau versus CFB in lipase, n=45	Ctau versus total cholesterol, n=45	Ctau versus CFB in total cholesterol, n=45	Cmin versus AE occurrence, n=45	Cmin versus maximum AE intensity, n=45	Cmin versus ALT, n=45	Cmin versus CFB in ALT, n=45	Cmin versus total bilirubin, n=45	Cmin versus CFB in total bilirubin, n=45	Cmin versus creatine kinase, n=45	Cmin versus CFB in creatine kinase, n=45	Cmin versus triglycerides, n=45	Cmin versus CFB in triglycerides, n=45	Cmin versus lipase, n=45	Cmin versus CFB in lipase, n=45	Cmin versus total cholesterol, n=45	Cmin versus CFB in total cholesterol, n=45
Overall DTG	0.114	0.171	-0.196	-0.201	0.364	0.147	-0.168	-0.145	0.104	0.216	-0.066	0.092	-0.097	-0.153	0.061	0.110	-0.135	-0.135	0.265	0.033	-0.188	-0.161	0.134	0.244	-0.034	0.115	-0.101	-0.192	-0.080	-0.003	-0.196	-0.237	0.298	0.120	-0.094	-0.093	-0.058	-0.012	-0.187	-0.137	-0.179	-0.125	-0.028	0.036	-0.166	-0.177	0.319	0.109	-0.114	-0.110	0.057	0.092	-0.164	-0.120	-0.170	-0.083	0.190	0.205	-0.281	-0.285	0.446	0.237	-0.143	-0.125	0.061	0.172	-0.131	0.056	-0.039	-0.108	0.156	0.193	-0.236	-0.253	0.430	0.171	-0.132	-0.124	-0.042	0.057	-0.135	0.032	-0.194	-0.208

[back to top]

Relationship Between the Change From Baseline in CD4+ Cell Counts at Week 96 and the Indicated Plasma DTG PK Parameters

Relationships between plasma DTG PK parameters (AUC[0-tau] [area under the time concentration curve over the dosing interval], Cmax [maximal concentration], C0avg [average pre-dose concentration], and Ctau [concentration at the end of the dosing interval]) and the change from Baseline in CD4+ cell counts at Week 96 (calculated as the post-Baseline value minus the value at Baseline) was assessed using Pearson's correlation analyses. The Pearson's correlation coefficient is a measure of the correlation between CD4+ cell counts and plasma DTG PK parameters and ranges from -1 to 1. A value of 0 indicates no statistical association; a value close to -1 or 1 indicates a higher association.Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed.Only those participants available at the specified time points were analyzed (represented by n=X in the category titles) (NCT00951015)
Timeframe: Week 96

,,,

Intervention	Pearson's correlation coefficient (Number)
	AUC(0-tau), n=13, 14, 15, 0	Cmax, n=13, 14, 15, 0	C0avg, n=43, 40, 42, 0	Ctau, n=13, 14, 15, 0
DTG 10 mg QD	-0.100	-0.047	-0.009	-0.289
DTG 25 mg QD	0.379	0.332	-0.013	0.299
DTG 50 mg QD	0.008	0.234	0.206	-0.074
Overall DTG	-0.005	0.037	-0.011	-0.055

[back to top]

Relationship Between Gastrointestinal System Organ Class AEs of Special Interest at Week 96 and the Indicated Plasma DTG PK Parameters

Logistic regressions were performed to examine the correlation between plasma DTG PK parameters (AUC[0-tau] [area under the time concentration curve over the dosing interval], Cmax [maximal concentration], Ctau [concentration at the end of the dosing interval], and C0avg [average pre-dose concentration]) on log scales and the presence of gastrointestinal system organ class AEs (abdominal pain, diarrhea, nausea, and vomiting) at Week 96. Data are presented as estimates from logistic regression, which is a measure of the association between AEs of special interest and plasma DTG PK parameters. A value of 0 indicates no statistical association; a large absolute value of the estimate indicates higher association. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. Results are presented for participants in any DTG group (overall DTG).Only those participants available at the specified time points were analyzed represented by n=X in the category titles (NCT00951015)
Timeframe: Week 96

Intervention	estimated effect (Number)
	Abdominal pain versus AUC(0-tau), n=45	Abdominal pain versus Cmax, n=45	Abdominal pain versus Ctau, n=45	Abdominal pain versus C0avg, n=140	Diarrhoea versus AUC(0-tau), n=45	Diarrhoea versus Cmax, n=45	Diarrhoea versus Ctau, n=45	Diarrhoea versus C0avg, n=140	Nausea versus AUC(0-tau), n=45	Nausea versus Cmax, n=45	Nausea versus Ctau, n=45	Nausea versus C0avg, n=140	Vomiting versus AUC(0-tau), n=45	Vomiting versus Cmax, n=45	Vomiting versus Ctau, n=45	Vomiting versus C0avg, n=140
Overall DTG	-2.49	-2.98	-1.72	-0.41	-0.62	-0.98	-0.29	0.13	-0.31	-0.72	0.03	-0.32	-1.29	-1.61	-1.15	-0.89

[back to top]

Pre-dose Concentration (C0) and C0 Avg of DTG

The plasma DTG C0 of DTG was determined using limited/sparse PK sampling at Week 2, Week 12, and Week 24. C0 avg was calculated at Week 24 as the mean of the C0 of DTG at Week 2, Week 12, and Week 24. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. Only those participants available at the specified time points were analyzed (represented by n=X, X, X, X in the category titles). Different participants may have been analyzed at different time points, so the overall number of participants analyzed reflects everyone in the PK Summary Population. (NCT00951015)
Timeframe: Week 2, Week 12, and Week 24

Intervention	Microgram per milliliter (µg/mL) (Geometric Mean)
	C0, Week 2, n=46, 44, 43, 0	C0, Week 12, n=46, 45, 44, 0	C0, Week 24, n=45, 44, 44, 0	C0 avg, n=48, 46, 46, 0
DTG 10 mg QD	0.31	0.33	0.33	0.34
DTG 25 mg QD	0.57	0.47	0.57	0.56
DTG 50 mg QD	1.20	1.13	1.20	1.25

[back to top]

Plasma DTG Concentration

Blood samples for the determination of plasma DTG concentration were collected from the participants randomized to receive DTG, at the following time points: pre-dose and 2-4 hours post-dose at Weeks 2, Week 12, and Week 24. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. The Pharmacokinetic (PK) Summary Population is comprised of all participants who received DTG and underwent intensive PK sampling or limited PK sampling during the study and provided evaluable DTG PK parameters. Only those participants available at the specified time points were analyzed (represented by n=X, X, X, X in the category titles).Different participants may have been analyzed at different time points, so the overall number of participants analyzed reflects everyone in the PK Summary Population. (NCT00951015)
Timeframe: Week 2, Week 12, and Week 24

Intervention	Micrograms per milliliter (µg/mL) (Mean)
	Week 2, Pre-dose, n=46, 44, 43, 0	Week 2, 2-4 hours post-dose, n=31, 29, 29, 0	Week 12, Pre-dose, n= 46, 45, 44, 0	Week 12, 2-4 hours post-dose, n=48, 45, 45, 0	Week 24, Pre-dose, n=45, 44, 44, 0	Week 24, 2-4 hours post-dose, n=45, 45, 45, 0
DTG 10 mg QD	0.3580	1.0121	0.3648	1.0374	0.3766	1.0113
DTG 25 mg QD	0.6779	1.9716	0.5759	1.7907	0.6636	1.9021
DTG 50 mg QD	1.4044	3.8414	1.4169	3.6056	1.4534	3.5397

[back to top]

Number of Participants With the Indicated Type of HIV-1 Disease Progression (AIDS or Death)

Clinical disease progression (CDP) was assessed according to the Centers for Disease Control and Prevention (CDC) HIV-1 classification system. Category (CAT) A: one or more of the following conditions (CON), without any CON listed in Categories B and C: asymptomatic HIV infection, persistent generalized lymphadenopathy, acute (primary) HIV infection with accompanying illness or history of acute HIV infection. CAT B: symptomatic CON that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or that are considered by physicians to have a clinical course or to require management that is complicated by HIV infection; and not included among CON listed in clinical CAT C. CAT C: the clinical CON listed in the AIDS surveillance case definition. Indicators of CDP were defined as: CAT A at Baseline (BS) to CAT B event (EV), CAT A at BS to a CAT C EV; CAT B at BS to a CAT C EV; CAT C at BS to a new CAT C EV; or CAT A, B, or C at BS to death. (NCT00951015)
Timeframe: From Baseline up to Week 96

,,,

Intervention	Participants (Number)
	CAT A at Baseline to a CAT C event	CAT B at Baseline to a CAT C event	CAT C at Baseline to a new CAT C event	CAT A, B, or C at Baseline to death
DTG 10 mg QD	0	0	0	1
DTG 25 mg QD	0	0	0	0
DTG 50 mg QD	0	1	0	0
EFV 600 mg QD	0	0	0	0

[back to top]

Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Protocol-defined Virologic Failure (PDVF), as a Measure of Genotypic Resistance

For participants meeting one of the criteria for PDVF, plasma samples collected at the time point of virologic failure were tested to evaluate any potential genotypic and/or phenotypic evolution of resistance. PDVF was defined as (A) Virologic Non-response: a decrease in plasma HIV-1 RNA of <1 log10 copies/mL by Week 4, with subsequent confirmation, unless plasma HIV-1 RNA is <400 copies/mL; confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24 without evidence of prior suppression to <400copies/mL or (B) Virologic Rebound: confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL; confirmed plasma HIV-1 RNA levels >0.5 log10 copies/mL above the nadir value, where nadir is the lowest HIV-1 value >=400 copies/mL.On-treatment Genotypic Resistance Population: all participants in the ITT-E Population with available on-treatment genotypic data, excluding participants who were not protocol-defined virologic failures. (NCT00951015)
Timeframe: From Baseline up to Week 96/Early Withdrawal

Intervention	Participants (Number)
	A23A/V	S255N
DTG 10 mg QD	1	1
DTG 25 mg QD	0	0
EFV 600 mg QD	0	0

[back to top]

Number of Participants With the Indicated Grade 1 to Grade 4 Treatment-emergent Clinical Chemistry and Hematology Toxicities

Blood samples were collected for the measurement of clinical chemistry and hematology parameters. Toxicities were graded for severity according to the Division of AIDS (DAIDS) toxicity scales as: Grade 1 (mild), Grade 2 (moderate), Grade 3 (severe), or Grade 4 (potentially life threatening). (NCT00951015)
Timeframe: From Baseline up to Week 96/Early Withdrawal

,,,

Intervention	Participants (Number)
	Alanine amino transferase	Cholesterol	Creatinine kinase	Lipase	Triglycerides	Alkaline phosphatase	Amylase	Aspartate amino transferase	Carbon dioxide content/bicarbonate	Creatinine	Hypercalcemia	Hyperglycaemia	Hyperkalemia	Hypernatremia	Hypocalcemia	Hypoglycaemia	Hypokalemia	Hyponatremia	Low-density lipoprotein cholesterol	Magnesium	Phosphate, inorganic	Total bilirubin	Activated partial thromboplastin time	Hemoglobin	International normalized ratio	Platelet count	Prothrombin time	Total neutrophils	White blood cell count
DTG 10 mg QD	7	18	17	11	0	1	2	12	28	0	0	16	0	1	4	3	4	6	14	7	9	3	7	0	6	1	7	9	1
DTG 25 mg QD	11	16	6	13	1	0	3	8	24	4	0	15	0	1	5	3	1	12	15	6	15	4	12	1	9	4	8	7	1
DTG 50 mg QD	3	13	7	11	2	1	1	6	23	0	0	17	1	1	5	5	3	7	11	5	14	3	6	0	6	1	7	6	1
EFV 600 mg QD	19	24	5	9	1	10	4	9	30	0	1	17	1	0	8	4	3	13	20	4	11	0	5	1	5	1	4	10	1

[back to top]

Number of Participants With the Indicated Fold Increase in DTG FC (Fold Change in IC50 Relative to Wild-type Virus) at the Time of PDVF, as a Measure of Post-Baseline Phenotypic Resistance

The FC in IC50 (50% inhibitory concentration) for DTG relative to wild-type virus was determined for virus isolated at Baseline and at the time of PDVF. Fold increase in DTG FC at the time of PDVF was derived as the PDVF FC/Baseline FC ratio. PDVF was defined as (A) Virologic Non-response: a decrease in plasma HIV-1 RNA of <1 log10 copies/mL by Week 4, with subsequent confirmation, unless plasma HIV-1 RNA is <400 copies/mL; confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24 without evidence of prior suppression to <400copies/mL or (B) Virologic Rebound: confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL; confirmed plasma HIV-1 RNA levels >0.5 log10 copies/mL above the nadir value, where nadir is the lowest HIV-1 value >=400 copies/mL.On-treatment Phenotypic Resistance Population: all participants in the ITT-E Population with available on-treatment phenotypic data (NCT00951015)
Timeframe: From Baseline up to Week 96/Early Withdrawal

Intervention	Participants (Number)
	<1 fold	1-<2 fold	2-<4 fold	4-<8 fold	>=8 fold
DTG 10 mg QD	0	2	0	0	0
DTG 25 mg QD	1	0	0	0	0

[back to top]

Number of Participants With Plasma HIV-1 RNA <50 c/mL

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96. The analysis was performed using the time to loss of virological response (TLOVR) dataset. In the TLOVR dataset, participant responses at a specified threshold of HIV-1 RNA (<50 copies/mL) are determined by using the Food and Drug Administration's TLOVR algorithm. Using the TLOVR algorithm, participants are considered to have failed on therapy if they never achieved confirmed RNA levels below the threshold, if they had confirmed rebound of RNA above the threshold, if they made a non-permitted change in background regimen, or if they permanently discontinued investigational product for any reason. (NCT00951015)
Timeframe: Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96

,,,

Intervention	Participants (Number)
	Baseline	Week 1	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48	Week 60	Week 72	Week 84	Week 96
DTG 10 mg QD	0	6	22	37	46	50	51	51	51	50	49	48	48	48	47	42
DTG 25 mg QD	0	4	19	35	45	46	46	47	46	45	45	45	44	44	43	40
DTG 50 mg QD	0	4	11	31	43	45	47	47	47	46	46	46	46	45	46	45
EFV 600 mg QD	0	3	6	9	18	25	29	38	41	43	42	40	41	40	38	36

[back to top]

Number of Participants With Plasma HIV-1 RNA <400 c/mL

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96. The analysis was performed using the time to loss of virological response (TLOVR) dataset. In the TLOVR dataset, participant responses at a specified threshold of HIV-1 RNA (<400 c/mL) are determined by using the Food and Drug Administration's TLOVR algorithm. Using the TLOVR algorithm, participants are considered to have failed on therapy if they never achieved confirmed RNA levels below the threshold, if they had confirmed rebound of RNA above the threshold, if they made a non-permitted change in background regimen, or if they permanently discontinued investigational product for any reason. (NCT00951015)
Timeframe: Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96

,,,

Intervention	Participants (Number)
	Baseline	Week 1	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48	Week 60	Week 72	Week 84	Week 96
DTG 10 mg QD	0	25	45	52	52	52	52	52	52	52	50	50	50	50	50	46
DTG 25 mg QD	0	20	45	49	49	49	48	48	47	47	47	47	46	46	45	43
DTG 50 mg QD	0	16	41	48	49	49	49	49	48	48	48	48	48	47	47	46
EFV 600 mg QD	0	15	23	32	41	45	45	45	45	45	45	44	44	43	42	39

[back to top]

Number of Participants With Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 16

Plasma samples were collected for quantitative HIV-1 RNA analysis at Week 16. The analysis was performed using the time to loss of virological response (TLOVR) dataset. In the TLOVR dataset, participant responses at a specified threshold of HIV-1 RNA (<50 copies/mL) are determined by using the Food and Drug Administration's TLOVR algorithm. Using the TLOVR algorithm, participants are considered to have failed on therapy if they never achieved confirmed RNA levels below the threshold, if they had confirmed rebound of RNA above the threshold, if they made a non-permitted change in background regimen, or if they permanently discontinued investigational product for any reason. Data are reported per the Week 16 report. In later cuts of the data, the Week 16 values may have changed (because of the nature of the TLOVR algorithm).ITT-E Population included all randomized participants who received at least one dose of study medication (NCT00951015)
Timeframe: Week 16

Intervention	participants (Number)
DTG 10 mg QD	51
DTG 25 mg QD	47
DTG 50 mg QD	46
EFV 600 mg QD	29

[back to top]

AUC(0-tau) of DTG

The area under the time concentration curve over the dosing interval (AUC[0-tau]) of DTG was determined using non-compartmental analysis based on intensive PK sampling at the following time points: pre-dose; 2, 3, 4, 8, and 24 hours post-dose at Week 2. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. Only those participants available at the specified time points were analyzed. (NCT00951015)
Timeframe: Pre-dose and 2, 3, 4, 8, and 24 hours post-dose at Week 2

Intervention	Hours*µg/mL (Geometric Mean)
DTG 10 mg QD	16.0
DTG 25 mg QD	23.1
DTG 50 mg QD	48.1

[back to top]

Time to Maximal Drug Concentration (Tmax) of DTG

Tmax of DTG was determined using non-compartmental analysis based on intensive PK sampling at the following time points: pre-dose; 2, 3, 4, 8, and 24 hours post-dose at Week 2. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. (NCT00951015)
Timeframe: Pre-dose and 2, 3, 4, 8, and 24 hours post-dose at Week 2

Intervention	Hours (Median)
DTG 10 mg QD	2.0
DTG 25 mg QD	2.0
DTG 50 mg QD	2.0

[back to top]

Viral Change Over the Initial 2 Weeks of Treatment

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline and Week 2. Viral change is defined as the change in plasma HIV-1 RNA over the initial 2 weeks of treatment, calculated as the value at Week 2 minus the value at Baseline. Only those participants available at the specified time point were analyzed. (NCT00951015)
Timeframe: Baseline and Week 2

Intervention	Log10 c/mL (Mean)
DTG 10 mg QD	-2.387
DTG 25 mg QD	-2.365
DTG 50 mg QD	-2.392
EFV 600 mg QD	-1.930

[back to top]

Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Counts at the Indicated Time Points

Blood samples were collected for lymphocyte subset assessment by flow cytometry at Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. Only those participants available at the specified time points were analyzed (represented by n=X, X, X, X in the category titles). Different participants may have been analyzed at different time points, so the overall number of participants analyzed reflects everyone in the ITT-E Population. (NCT00951015)
Timeframe: Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96

,,,

Intervention	Cells per cubic millimeter (Median)
	Week 1, n=53, 50, 48, 50	Week 2, n=53, 50, 50, 47	Week 4, n=53, 50, 50, 45	Week 8, n=52, 50, 49, 44	Week 12, n=53, 48, 48, 45	Week 16, n=52, 49, 49, 44	Week 20, n=52, 48, 49, 44	Week 24, n=51, 49, 47, 44	Week 32, n=50, 48, 47, 44	Week 40, n=50, 48, 47, 44	Week 48, n=51, 47, 47, 45	Week 60, n=51, 48, 47, 43	Week 72, n=51, 47, 48, 44	Week 84, n=51, 47, 46, 42	Week 96, n=48, 44, 46, 39
DTG 10 mg QD	85.0	75.0	75.0	118.5	139.0	153.0	163.5	159.0	221.5	205.0	204.0	265.0	236.0	292.0	335.0
DTG 25 mg QD	94.5	79.0	89.0	156.5	137.5	176.0	200.0	206.0	195.5	204.5	249.0	278.0	285.0	313.0	391.5
DTG 50 mg QD	75.5	99.5	110.0	129.0	171.5	160.0	139.0	167.0	203.0	224.0	223.0	229.0	220.0	280.0	326.0
EFV 600 mg QD	42.5	55.0	89.0	104.5	127.0	115.5	136.0	109.5	146.5	171.5	174.0	221.0	195.0	296.5	301.0

[back to top]

Change From Baseline in HIV-1 RNA at the Indicated Time Points

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT00951015)
Timeframe: Baseline (Day 1), Week 1, Week 2, Week 4, Week 8, Week 12, Week 16, Week 20, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, Week 84, and Week 96

,,,

Intervention	Log10 c/mL (Mean)
	Week 1, n=53, 50, 48, 50	Week 2, n=53, 50, 50, 48	Week 4, n=53, 50, 50, 45	Week 8, n=52, 50, 49, 45	Week 12, n=53, 49, 49, 45	Week 16, n=52, 49, 49, 45	Week 20, n=52, 48, 49, 44	Week 24, n=52, 49, 48, 45	Week 32, n=52, 49, 47, 45	Week 40, n=51, 48, 47, 44	Week 48, n=51, 48, 48, 45	Week 60, n=50, 48, 48, 44	Week 72, n=51, 47, 48, 44	Week 84, n=51, 47, 47, 43	Week 96, n=48, 44, 46, 39
DTG 10 mg QD	-1.815	-2.387	-2.629	-2.657	-2.685	-2.718	-2.701	-2.700	-2.717	-2.647	-2.723	-2.741	-2.742	-2.725	-2.728
DTG 25 mg QD	-1.773	-2.365	-2.583	-2.666	-2.671	-2.668	-2.662	-2.657	-2.658	-2.665	-2.667	-2.675	-2.622	-2.670	-2.680
DTG 50 mg QD	-1.738	-2.392	-2.713	-2.848	-2.860	-2.859	-2.869	-2.853	-2.855	-2.855	-2.850	-2.825	-2.860	-2.855	-2.854
EFV 600 mg QD	-1.562	-1.930	-2.162	-2.450	-2.603	-2.698	-2.745	-2.773	-2.772	-2.795	-2.711	-2.765	-2.757	-2.743	-2.807

[back to top]

Maximal Concentration (Cmax), Minimal Concentration (Cmin), and Concentration at the End of Dosing Interval (Ctau) of DTG

The Cmax, Cmax, and Ctau of DTG were determined using non-compartmental analysis based on intensive PK sampling at the following time points: pre-dose; 2, 3, 4, 8, and 24 hours post-dose at Week 2. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. (NCT00951015)
Timeframe: Pre-dose and 2, 3, 4, 8, and 24 hours post-dose at Week 2

Intervention	µg/mL (Geometric Mean)
	Cmax	Cmin	Ctau
DTG 10 mg OD	1.10	0.33	0.37
DTG 25 mg OD	1.71	0.44	0.45
DTG 50 mg OD	3.40	0.94	1.05

[back to top]

Relationship Between the Change From Baseline in Plasma HIV-1 RNA at Week 2 and the Indicated Plasma DTG PK Parameters

Relationships between Week 2 plasma DTG PK parameters (AUC[0-tau] [area under the time concentration curve over the dosing interval], Cmax [maximal concentration], and Ctau [concentration at the end of the dosing interval]) and the change from Baseline in plasma HIV-1 RNA at Week 2 (calculated as the post-Baseline value minus the value at Baseline) was assessed using Pearson's correlation analyses. The Pearson's correlation coefficient is a measure of the correlation between plasma HIV-1 RNA and plasma DTG PK parameters and ranges from -1 to 1. A value of 0 indicates no statistical association; a value close to -1 or 1 indicates a higher association. Because PK was assessed for DTG, no participants in the EFV treatment group were analyzed. PK/Pharmacodynamic (PD) Analysis Population: all participants with available PD measures (e.g., safety and/or efficacy data) and with evaluable DTG plasma concentration data considered suitable for investigation of relationship with the PD measures (NCT00951015)
Timeframe: Week 2

,,,

Intervention	Pearson's correlation coefficient (Number)
	AUC(0-tau)	Cmax	Ctau
DTG 10 mg QD	0.426	0.452	0.273
DTG 25 mg QD	-0.018	-0.051	-0.100
DTG 50 mg QD	-0.258	-0.150	-0.263
Overall DTG	-0.086	-0.055	-0.129

[back to top]

Number of Participants With New HIV-associated Conditions of the Indicated Class

HIV-associated conditions were assessed according to the Centers for Disease Control and Prevention (CDC) HIV-1 classification system. Category (CAT) A: one or more of the following conditions (CON), without any CON listed in Categories B and C: asymptomatic HIV infection, persistent generalized lymphadenopathy, acute (primary) HIV infection with accompanying illness or history of acute HIV infection. CAT B: symptomatic CON that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or that are considered by physicians to have a clinical course or to require management that is complicated by HIV infection; and not included among CON listed in clinical CAT C. CAT C: the clinical CON listed in the acquired immunodeficiency syndrome (AIDS) surveillance case definition. (NCT00951015)
Timeframe: From Baseline up to Week 96

,,,

Intervention	Participants (Number)
	Category B	Category C	Death
DTG 10 mg QD	2	0	1
DTG 25 mg QD	0	0	0
DTG 50 mg QD	1	1	0
EFV 600 mg QD	1	0	0

[back to top]

Number of Participants With the Indicated Post-Baseline HIV-associated Conditions and Progression, Excluding Recurrences

Clinical disease progression (CDP) was assessed according to the Centers for Disease Control and Prevention (CDC) HIV-1 classification system. Category (CAT) A: one or more of the following conditions (CON), without any CON listed in Categories B and C: asymptomatic HIV infection, persistent generalized lymphadenopathy, acute (primary) HIV infection with accompanying illness or history of acute HIV infection. CAT B: symptomatic CON that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or that are considered by physicians to have a clinical course or to require management that is complicated by HIV infection; and not included among CON listed in clinical CAT C. CAT C: the clinical CON listed in the AIDS surveillance case definition. Indicators of CDP were defined as: CDC CAT A at Baseline to a CDC CAT C event (EV); CDC CAT B at Baseline to a CDC CAT C EV; CDC CAT C at Baseline to a new CDC CAT C EV; or CDC CAT A, B, or C at Baseline to death. (NCT01227824)
Timeframe: From Baseline until Week 96

Intervention	Participants (Number)
	Any category condition	Any Category B condition	Any Category C condition	Any death	Progression from CAT A to CAT C	Progression from CAT B to CAT C	Progression from CAT C to new CAT C	Progression from CAT A, B, or C to death
DTG 50 mg Once a Day	10	3	6	1	4	3	0	1
RTG 400 mg BID	8	3	4	1	2	1	1	1

[back to top]

Number of Participants With Detectable HIV-1 Virus That Has Genotypic or Phenotypic Evidence of INI Resistance.

Number of participants with detectable virus that has genotypic or phenotypic evidence of Integrase Inhibitor (INI) resistance were assessed at Week 48 and Week 96. Integrase inhibitors are a class of antiretroviral drug designed to block the action of integrase, a viral enzyme that inserts the viral genome into the deoxyribonucleic acid (DNA) of the host cell. (NCT01227824)
Timeframe: Week 48 and Week 96

Intervention	Participants (Number)
	Week 48, genotypic	Week 48, phenotypic	Week 96, genotypic	Week 96, phenotypic
DTG 50 mg Once a Day	0	1	0	1
RTG 400 mg BID	1	2	1	2

[back to top]

Maximum Plasma Concentration (Cmax) and Concentration at the End of a Dosing Interval (Ctau) of DTG

The maximum plasma concentration (Cmax) and concentration at the end of a dosing interval (Ctau) of DTG were assessed at Week 48. The predicted individual Cmax and Ctau were obtained from the final population PK model by simulation of the concentration-time profiles. Blood samples for PK assessments were collected at pre-dose (within 15 minutes prior to dose) at Week 4, Week 24, and Week 48 and 1 to 3 hours post-dose or 4 to 12 hours post-dose at Week 4 and Week 24. If 1 to 3 hour post-dose was completed at Week 4, then the 4 to12 hour post-dose must be obtained at Week 48, and vice versa. (NCT01227824)
Timeframe: Week 4, Week 24, and Week 48

Intervention	Micrograms per milliliter (µg/mL) (Geometric Mean)
	Cmax	Ctau
DTG 50 mg Once a Day	3.69	1.10

[back to top]

Percentage of Participants With Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) [HIV-1RNA] <50 Copies (c)/Milliliter (mL) Through Week 48

Percentage of participants with plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) with <50 c/mL was assessed using the Missing, Switch or Discontinuation = Failure (MSDF), as codified by the Food and Drug Administration (FDA) snapshot algorithm. The algorithm treats all participants without HIV-1 RNA data as non-responders, as well as participants who switch their concomitant Antiretroviral Therapy (ART) prior to Week 48 as follows: background ART substitutions not permitted per study; background ART substitutions permitted per study unless the decision to switch was documented as being before or at the first on-treatment visit where HIV-1 RNA was assessed. Otherwise, virologic success or failure will be determined by the last available HIV-1 RNA assessment while the subject was on-treatment. Intent-to-Treat Exposed (ITT-E) Population comprised all randomized participants who received at least one dose of study medication. (NCT01227824)
Timeframe: Baseline up to Week 48

Intervention	Percentage of participants (Number)
DTG 50 mg Once a Day	88
RTG 400 mg BID	85

[back to top]

Number of Participants With Plasma HIV-1 RNA <50 c/mL

The number of participants with plasma HIV-1 RNA level <50 c/mL was assessed at Week 96. (NCT01227824)
Timeframe: Week 96

Intervention	Participants (Number)
DTG 50 mg Once a Day	332
RTG 400 mg BID	314

[back to top]

Area Under the Plasma Concentration-time Curve From Time Zero to Time Tau [AUC(0-tau)] of DTG

AUC is defined as the area under the DTG concentration-time curve as a measure of drug exposure over time. AUC(0-tau) is defined as the area under the plasma concentration-time curve from time zero to time tau over a dosing interval at steady state, where tau is the length of the dosing interval of DTG. The predicted individual AUC(0-tau) were obtained from the final population PK model by an empirical Bayes estimation. Blood samples for PK assessments were collected at pre-dose (within 15 minutes prior to dose) at Week 4, Week 24, and Week 48 and 1 to 3 hours post-dose or 4 to 12 hours post-dose at Week 4 and Week 24. If 1 to 3 hours post-dose was completed at Week 4, then the 4 to12 hour post-dose must be obtained at Week 48, and vice versa. The Pharmacokinetic (PK) Concentration Population comprised of all participants who received DTG, had undergone PK sampling during the study, and provided evaluable DTG plasma concentration data. (NCT01227824)
Timeframe: Week 4, Week 24, and Week 48

Intervention	Microgramshour per milliliter(µghr/mL) (Geometric Mean)
DTG 50 mg Once a Day	53.6

[back to top]

Change From Baseline in Plasma HIV-1 RNA Over Time

Change from Baseline in plasma HIV-1 RNA over time was assessed at Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96. Baseline was defined as the measurements performed on Day 1. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants with data available at the specified time points were analyzed (represented by n=x,x in the category titles). (NCT01227824)
Timeframe: Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96

Intervention	log10 c/mL (Mean)
	Baseline n=411, 411	Week 4, n=402, 406	Week 8, n=397, 402	Week 12, n=396, 395	Week 16, n=395, 388	Week 24, n=393, 390	Week 32, n=386, 377	Week 40, n=375, 358	Week 48, n=374, 358	Week 60, n=366, 355	Week 72, n=361, 350	Week 84, n=352, 338	Week 96, n=342, 329
DTG 50 mg Once a Day	4.538	-2.817	-2.897	-2.908	-2.917	-2.896	-2.907	-2.920	-2.915	-2.912	-2.917	-2.932	-2.938
RTG 400 mg BID	4.599	-2.801	-2.886	-2.918	-2.943	-2.933	-2.947	-2.946	-2.942	-2.937	-2.932	-2.916	-2.901

[back to top]

Change From Baseline in Cluster of Differentiation (CD)4+ Cell Counts Over Time

CD4 lymphocyte cells (also called T-cells or T-helper cells) are the primary targets of HIV. The CD4 count and the CD4 percentage mark the degree of immuno compromise. The CD4 count is used to stage the participants disease, determine the risk of opportunistic illnesses, assess prognosis, and guide decisions about when to start ART. Changes from Baseline in CD4+ cell counts over time was assessed at Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96. Baseline was defined as measurements performed on Day 1. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants with data available at the specified time points were analyzed (represented by n=x,x in the category titles). (NCT01227824)
Timeframe: Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96

Intervention	Cells per cubic millimeter (cells/mm^3) (Mean)
	Baseline n=411, 411	Week 4, n=398, 403	Week 8, n=398, 402	Week 12, n=392, 397	Week 16, n=394, 392	Week 24, n=392, 389	Week 32, n=384, 375	Week 40, n=371, 357	Week 48, n=374, 357	Week 60, n=367, 355	Week 72, n=360, 350	Week 84, n=351, 338	Week 96, n=343, 328
DTG 50 mg Once a Day	379.2	93.3	121.6	130.7	155.1	199.3	223.4	224.1	238.9	247.8	247.8	281.3	292.2
RTG 400 mg BID	374.3	97.2	126.6	145.1	173.0	204.2	241.3	239.8	257.5	264.2	278.6	292.9	286.2

[back to top]

Absolute Values in Plasma HIV-1 RNA Over Time

Absolute values in plasma HIV-1 RNA over time was assessed at Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96. Only those participants with data available at the specified time points were analyzed (represented by n=x,x in the category titles). (NCT01227824)
Timeframe: Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96

Intervention	log10 c/mL (Mean)
	Baseline n=411, 411	Week 4, n=402, 406	Week 8, n=397, 402	Week 12, n=396, 395	Week 16, n=395, 388	Week 24, n=393, 390	Week 32, n=386, 377	Week 40, n=375, 358	Week 48, n=374, 358	Week 60, n=366, 355	Week 72, n=361, 350	Week 84, n=352, 338	Week 96, n=342, 329
DTG 50 mg Once a Day	4.538	1.718	1.646	1.626	1.620	1.643	1.620	1.603	1.606	1.605	1.601	1.607	1.599
RTG 400 mg BID	4.599	1.800	1.709	1.672	1.648	1.655	1.636	1.601	1.599	1.599	1.605	1.614	1.630

[back to top]

Absolute Values in CD4+ Cell Counts Over Time

CD4 lymphocyte cells (also called T-cells or T-helper cells) are the primary targets of HIV. The CD4 count and the CD4 percentage mark the degree of immuno compromise. The CD4 count is used to stage the patient's disease, determine the risk of opportunistic illnesses, assess prognosis, and guide decisions about when to start antiretroviral therapy absolute values in CD4+ cell counts over time was assessed at Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96. Only those participants with data available at the specified time points were analyzed (represented by n=x,x in the category titles). (NCT01227824)
Timeframe: Baseline and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96

Intervention	cells/mm^3 (Mean)
	Baseline n=411, 411	Week 4, n=398, 403	Week 8, n=398, 402	Week 12, n=392, 397	Week 16, n=394, 392	Week 24, n=392, 389	Week 32, n=384, 375	Week 40, n=371, 357	Week 48, n=374, 357	Week 60, n=367, 355	Week 72, n=360, 350	Week 84, n=351, 338	Week 96, n=343, 328
DTG 50 mg Once a Day	379.2	474.2	502.3	513.3	536.4	582.0	606.5	609.1	623.8	635.6	635.2	668.0	679.8
RTG 400 mg BID	374.3	471.8	502.4	518.3	550.1	580.8	618.7	623.1	641.2	648.5	664.0	677.5	672.4

[back to top]

Number of Participants With Plasma HIV-1 RNA <400 c/mL

The number of participants with plasma HIV-1 RNA level <400 c/mL was assessed at Week 48 and Week 96. (NCT01227824)
Timeframe: Week 48 and Week 96

Intervention	Participants (Number)
	Week 48	Week 96
DTG 50 mg Once a Day	369	338
RTG 400 mg BID	356	321

[back to top]

Number of Participants With the Indicated Grade 1 to 4 Clinical Chemistry and Hematology Toxicities/Laboratory Adverse Events (AEs)

All Grade 1 to 4 post-Baseline-emergent chemistry toxicities included alanine aminotransferase (ALT), alkaline phosphatase (ALP), asparate aminotransferase (AST), carbon dioxide (CO2) content/bicarbonate, cholesterol, creatine kinase (CK), creatinine, hyperglycemia, hyperkalemia, hypernatremia, hypoglycemia, hypokalemia, hyponatremia, low density lipoprotein (LDL) cholesterol calculation, lipase, phosphorus inorganic, total bilirubin, and triglycerides. All Grade 1 to 4 post-Baseline-emergent hematology toxities included hemoglobin, platelet count, total neutrophils, and white blood cell count. The Division of AIDS (DAIDS) defined toxicity grades as follows: Grade 1, mild; Grade 2, moderate; Grade 3, severe; Grade 4, potentially life threatening; Grade 5, death. Safety Population: all participants who received at least one dose of investigational product (NCT01227824)
Timeframe: From Baseline until Week 96

Intervention	Participants (Number)
	ALT	ALP	AST	CO2 content/bicarbonate	Cholesterol	CK	Creatinine	Hyperglycaemia	Hyperkalemia	Hypernatremia	Hypoglycaemia	Hypokalemia	Hyponatremia	LDL cholesterol calculation	Lipase	Phosphorus, inorganic	Total bilirubin	Triglycerides	Hemoglobin	Platelet count	Total neutrophils	White Blood Cell count
DTG 50 mg Once a Day	57	7	67	58	90	61	11	70	7	4	17	10	34	74	55	65	27	7	10	19	54	19
RTG 400 mg BID	70	15	75	67	73	47	7	87	4	6	27	15	48	49	62	71	24	8	5	19	48	7

[back to top]

DTG PK Parameters Including Maximum Plasma Drug Concentration (Cmax), Minimal Plasma Drug Concentration (Cmin), and Average Plasma Pre-dose Concentration (C0_avg)

Cmax, Cmin and C0_avg were assessed by population pharmacokinetic (PK) modeling using sparse PK samples which were collected as follows: one pre-dose sample and one post-dose sample at 1 to 3 hours/4 to 12 hours at Week 4, one pre-dose sample at Week 24, and one pre-dose sample and one post-dose sample at 1 to 3 hours/4 to 12 hours at Week 48. Cmax, Cmin and C0_avg were estimated and reported here. (NCT01231516)
Timeframe: Pre-dose and at 1 to 3 hours or 4 to 12 hours post-dose at Week 4; Pre-dose at Week 24; Pre-dose and 1 to 3 hours or 4 to 12 hours post-dose at Week 48

Intervention	microgram/milliliter (µg/mL) (Geometric Mean)
	C0_avg, n=342	Cmax, n=340	Cmin, n=340
DTG 50 mg OD	0.926	3.21	0.849

[back to top]

DTG PK Parameter Including Pre-dose Concentration (C0)

C0 was assessed by population PK modeling using sparse PK samples which were collected as follows: one pre-dose sample and one post-dose sample at 1 to 3 hours/4 to 12 hours at Week 4, one pre-dose sample at Week 24, and one pre-dose sample and one post-dose sample at 1 to 3 hours/4 to 12 hours at Week 48. DTG predose concentration (C0) at Week 4, Week 24, and Week 48 was estimated and reported here. (NCT01231516)
Timeframe: Pre-dose at Weeks 4, 24 and 48

Intervention	microgram/milliliter (µg/mL) (Geometric Mean)
	Week 4, n=329	Week 24, n=298	Week 48, n=276
DTG 50 mg OD	0.786	0.940	0.932

[back to top]

Change From Baseline in European Quality of Life-5 Dimensions-3 Levels (EQ-5D-3L) Utility Score

The EQ-5D-3L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 3 levels for each dimension including 1=no problems, 2=some problems, 3=extreme problems. The health state is defined by combining the levels of answers from each of the 5 questions. Each health state is referred to in terms of a 5 digit code. Health state 5 digit code is translated into utility score, which is valued up to 1 (perfect health) with lower values meaning worse state. EQ-5D-3L utility score ranges from -0.594 to 1. Higher scores indicate better health. Baseline was the latest pre-dose assessment value (Day 1) and change from Baseline=post-dose value minus Baseline value. (NCT01231516)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

Intervention	Scores on a scale (Mean)
	Week 24, n=350, 356	Week 48, n=350, 356
DTG 50 mg OD	0.010	0.028
RAL 400 mg BID	0.019	0.013

[back to top]

Change From Baseline in European Quality of Life-5 Dimensions-3 Levels (EQ-5D-3L) Thermometer Scores

The EQ-5D-3L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 3 levels for each dimension including 1=no problems, 2=some problems, 3=extreme problems. EQ-5D-3L included EQ visual Analogue scale (EQ VAS) 'Thermometer' which provided Self-rated current health status. Participants were asked to rate their current health status using the visual analogue scale 'Thermometer'. Score ranged from 0 (worst imaginable health state) to 100 (best imaginable health state). Higher scores indicate better heath. Baseline was the latest pre-dose assessment value (Day 1) and change from Baseline=post-dose value minus Baseline value. (NCT01231516)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

Intervention	Scores on a scale (Mean)
	Week 24, n=350, 355	Week 48, n=350, 355
DTG 50 mg OD	6.800	8.894
RAL 400 mg BID	4.645	5.597

[back to top]

Change From Baseline in CD4+ Cell Counts at Weeks 4, 8, 12,16, 24, 32, 40, 48, 96 and 144

Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline was the latest pre-dose assessment value (Day 1). Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Median and interquartile range is presented. (NCT01231516)
Timeframe: Baseline (Day 1) and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 96 and 144

Intervention	Cells per cubic millimeter (Median)
	Week 4, n=341, 351	Week 8, n=338, 346	Week 12, n=335, 345	Week 16, n=327, 338	Week 24, n=326, 326	Week 32, n=309, 309	Week 40, n=299, 292	Week 48, n=298, 286	Week 96, n=260, 22	Week 144, n= 192, 18
DTG 50 mg OD	53.0	60.5	74.0	76.0	99.0	107.0	125.0	144.0	198.5	243.0
RAL 400 mg BID	45.0	59.0	75.0	79.5	93.0	116.0	117.5	137.0	270	302.5

[back to top]

Absolute Values of Cluster of Differentiation 4+ (CD4+) Cell Counts at Baseline (Day 1) and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 96 and 144

Blood samples were collected at specified time points to assess CD4+ using flow cytometry. Median and interquartile range are presented. Baseline was the latest pre-dose assessment value (Day 1). (NCT01231516)
Timeframe: Baseline (Day 1) and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 96 and 144

Intervention	Cells per cubic millimeter (Median)
	Baseline (Day 1), n=354, 361	Week 4, n=341, 351	Week 8, n=338, 346	Week 12, n=335, 345	Week 16, n=327, 338	Week 24, n=326, 326	Week 32, n=309, 309	Week 40, n=299, 292	Week 48, n=298, 286	Week 96, n=260, 22	Week 144, n=192, 18
DTG 50 mg OD	204.5	266.0	280.0	296.0	299.0	334.5	332.0	376.0	387.0	436.5	500.0
RAL 400 mg BID	193.0	253.0	268.0	289.0	293.0	326.5	338.0	349.0	378.5	484.5	535.0

[back to top]

Number of Participants With Plasma HIV-1 RNA <400 c/mL at Week 24 and Week 48

"The number of participants with Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <400 c/mL at the visit of interest was assessed using the Missing, Switch or Discontinuation = Failure (MSDF), as codified by the Food and Drug Administration (FDA) snapshot algorithm. This algorithm treated all participants without HIV-1 RNA at the visit of interest as nonresponders, as well as participants who switched their concomitant ART prior to the visit of interest as follows: background ART substitutions non-permitted per protocol (one background ART substitution was permitted for safety or tolerability); background ART substitutions permitted per protocol unless the decision to switch was documented as being before or at the first on-treatment visit where HIV-1 RNA was assessed. Otherwise, virologic success or failure was determined by the last available HIV-1 RNA measurment (within window) for the timepoint of interest while the participant was on-treatment." (NCT01231516)
Timeframe: At Week 24 and Week 48

Intervention	Participants (Count of Participants)
	Week 24	Week 48
DTG 50 mg OD	307	278
RAL 400 mg BID	287	257

[back to top]

Number of Participants With Plasma HIV-1 RNA <50 c/mL at Week 24

"The number of participants with Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <50 c/mL at Week 24 was assessed using the Missing, Switch or Discontinuation = Failure (MSDF), as codified by the Food and Drug Administration (FDA) snapshot algorithm. This algorithm treated all participants without HIV-1 RNA at Week 24 as nonresponders, as well as participants who switched their concomitant ART prior to Week 24 as follows: background ART substitutions non-permitted per protocol (one background ART substitution was permitted for safety or tolerability); background ART substitutions permitted per protocol unless the decision to switch was documented as being before or at the first on-treatment visit where HIV-1 RNA was assessed. Otherwise, virologic success or failure was determined by the last available HIV-1 RNA measurement through Week 24 (within window) while the participant was on-treatment. The result below corresponds to the Week 24 interim analysis." (NCT01231516)
Timeframe: At Week 24

Intervention	Participants (Count of Participants)
DTG 50 mg OD	281
RAL 400 mg BID	252

[back to top]

Number of Participants (Par.) With Detectable Virus That Has Genotypic or Phenotypic Evidence of Treatment-emergent Integrase Inhibitor (INI) Resistance at Time of Protocol Defined Virology Failure (PDVF)

For par. meeting one of the criteria for PDVF, plasma samples collected at the time point of virologic failure and Baseline were tested to evaluate any potential genotypic and/or phenotypic evolution of resistance. PDVF was defined as (A) virologic non-response: a decrease in plasma HIV-1 RNA of <1 logarithm to base 10 (log10) copies/mL by Week 16, with subsequent confirmation, unless plasma HIV-1 RNA is <400 copies/ mL; confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24 or (B) virologic rebound: confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL; confirmed plasma HIV-1 RNA levels >1 log10 copies/mL above the nadir value, where nadir is >=400 copies/mL.Treatment-emergent IN mutations are those detected at the time of PDVF but not at Baseline. (NCT01231516)
Timeframe: Baseline (Day 1) until PDVF (Up to Week 48)

Intervention	Participants (Count of Participants)
DTG 50 mg OD	4
RAL 400 mg BID	17

[back to top]

DTG PK Parameters Including Area Under the Plasma Concentration-time Curve From Time Zero to Time Tau Over a Dosing Interval at Steady State (AUC[0-tau])

AUC is defined as the area under the DTG concentration-time curve as a measure of drug exposure over time. AUC(0-tau) is defined as the area under the plasma concentration-time curve from time zero to time tau over a dosing interval at steady state, where tau is the length of the dosing interval of DTG. AUC was assessed by population pharmacokinetic (PK) modeling using sparse PK samples which were collected as follows: one pre-dose sample and one post-dose sample at 1 to 3 hours/4 to 12 hours at Week 4, one pre-dose sample at Week 24, and one pre-dose sample and one post-dose sample at 1 to 3 hours/4 to 12 hours at Week 48. (NCT01231516)
Timeframe: Pre-dose and at 1 to 3 hours or 4 to 12 hours post-dose at Week 4; Pre-dose at Week 24; Pre-dose and 1 to 3 hours or 4 to 12 hours post-dose at Week 48

Intervention	Microgramshour/milliliter (µghr/mL) (Geometric Mean)
DTG 50 mg OD	44.7

[back to top]

Number of Participants With Post-Baseline HIV-associated Conditions, Excluding Recurrences, and Disease Progressions

Clinical disease progression (CDP) was assessed according to the Centers for Disease Control and Prevention (CDC) HIV-1 classification system. Category (CAT) A: one or more of following conditions (CON), without any CON listed in Categories B and C: Asymptomatic HIV infection, persistent generalized lymphadenopathy, acute (primary) HIV infection with accompanying illness or history of acute HIV infection. CAT B: Symptomatic CON that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or that are considered by physicians to have clinical course or to require management that is complicated by HIV infection; and not included among CON listed in clinical CAT C. CAT C:Clinical CON listed in acquired immunodeficiency syndrome (AIDS) surveillance case definition. Indicators of CDP defined as:CDC CAT A at Baseline (BS) to CDC CAT C event (EV); CDC CAT B at BS to CDC CAT C EV; CDC CAT C at BS to new CDC CAT C EV; or CDC CAT A, B, or C at BS to death. (NCT01231516)
Timeframe: Up to Week 480

Intervention	Participants (Count of Participants)
	Any CAT	CAT B	CAT C	Death	Progression from CAT A to CAT C	Progression from CAT B to CAT C	Progression from CAT C to New CAT C	Progression from CAT A, B, or C to Death
DTG 50 mg OD	32	16	12	6	2	0	9	6
RAL 400 mg BID	25	14	8	4	1	1	5	4

[back to top]

Percentage of Participants With HIV-1 Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 48

"The percentage of participants with Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <50 c/mL at Week 48 was assessed using the Missing, Switch or Discontinuation = Failure (MSDF), as codified by the Food and Drug Administration (FDA) snapshot algorithm. This algorithm treated all participants without HIV-1 RNA at Week 48 as nonresponders, as well as participants who switched their concomitant ART prior to Week 48 as follows: background ART substitutions non-permitted per protocol (one background ART substitution was permitted for safety or tolerability); background ART substitutions permitted per protocol unless the decision to switch was documented as being before or at the first on-treatment visit where HIV-1 RNA was assessed. Otherwise, virologic success or failure was determined by the last available HIV-1 RNA assessment while the participant was on-treatment in the randomized phase of the study." (NCT01231516)
Timeframe: At Week 48

Intervention	Percentage of participants (Number)
DTG 50 mg OD	71
RAL 400 mg BID	64

[back to top]

Number of Participants With Post-Baseline Emergent Grade 1 to 4 Clinical Chemistry and Hematology Toxicities

Blood samples were collected for the analysis of clinical chemistry and hematology parameters: Alanine aminotransferase (ALT), albumin, alkaline phosphate (ALP), aspartate aminotransferase (AST), carbon dioxide (CO2) content/bicarbonate, cholesterol, creatine kinase (CK), creatinine, hyperglycemia, hyperkalemia, hypernatremia, hypoglycemia, hypokalemia, hypoonatremia, LDL cholesterol, lipase, total bilirubin, triglycerides, hemoglibin, neutrophils, platelets, white blood cells. Any abnormality in clinical chemistry and hematology parameters were evaluated according to the DAIDS toxicity scale From Grade 1 to 4: Grade 1 (mild), Grade 2 (moderate), Grade 3 (severe) and Grade 4 (Potentially life-threatening).Higher the grade, more severe the symptoms. (NCT01231516)
Timeframe: From Week 48 to Week 480

Intervention	Participants (Count of Participants)
	ALT, Grades 1 to 4	ALT, Grades 2 to 4	ALT, Grades 3 to 4	Albumin, Grades 1 to 4	Albumin, Grades 2 to 4	Albumin, Grades 3 to 4	ALP, Grades 1 to 4	ALP, Grades 2 to 4	ALP, Grades 3 to 4	AST, Grades 1 to 4	AST, Grades 2 to 4	AST, Grades 3 to 4	CO2 content/bicarbonate, Grades 1 to 4	CO2 content/bicarbonate, Grades 2 to 4	CO2 content/bicarbonate, Grades 3 to 4	Cholesterol, Grades 1 to 4	Cholesterol, Grades 2 to 4	Cholesterol, Grades 3 to 4	CK, Grades 1 to 4	CK, Grades 2 to 4	CK, Grades 3 to 4	Creatinine, Grades 1 to 4	Creatinine, Grades 2 to 4	Creatinine, Grades 3 to 4	Hyperglycemia, Grades 1 to 4	Hyperglycemia, Grades 2 to 4	Hyperglycemia, Grades 3 to 4	Hyperkalemia, Grades 1 to 4	Hyperkalemia, Grades 2 to 4	Hyperkalemia, Grades 3 to 4	Hypernatremia, Grades 1 to 4	Hypernatremia, Grades 2 to 4	Hypernatremia, Grades 3 to 4	Hypoglycemia, Grades 1 to 4	Hypoglycemia, Grades 2 to 4	Hypoglycemia, Grades 3 to 4	Hypokalemia, Grades 1 to 4	Hypokalemia, Grades 2 to 4	Hypokalemia, Grades 3 to 4	Hyponatremia, Grades 1 to 4	Hyponatremia, Grades 2 to 4	Hyponatremia, Grades 3 to 4	LDL cholesterol, Grades 1 to 4	LDL cholesterol, Grades 2 to 4	LDL cholesterol, Grades 3 to 4	Lipase, Grades 1 to 4	Lipase, Grades 2 to 4	Lipase, Grades 3 to 4	Total bilirubin, Grades 1 to 4	Total bilirubin, Grades 2 to 4	Total bilirubin, Grades 3 to 4	Triglycerides, Grades 1 to 4	Triglycerides, Grades 2 to 4	Triglycerides, Grades 3 to 4	Hemoglobin, Grades 1 to 4	Hemoglobin, Grades 2 to 4	Hemoglobin, Grades 3 to 4	Neutrophils, Grades 1 to 4	Neutrophils, Grades 2 to 4	Neutrophils, Grades 3 to 4	Platelets, Grades 1 to 4	Platelets, Grades 2 to 4	Platelets, Grades 3 to 4	White Blood Cells, Grades 1 to 4	White Blood Cells, Grades 2 to 4	White Blood Cells, Grades 3 to 4
DTG 50 mg OD	36	11	4	3	3	0	20	4	1	36	14	1	100	12	0	138	66	11	35	11	2	20	8	2	94	40	7	9	4	2	7	1	0	22	2	0	29	1	0	55	2	0	107	46	15	67	35	12	52	42	18	23	23	11	11	6	2	37	14	7	22	11	4	17	7	0
RAL 400 mg BID	9	3	0	0	0	0	1	1	1	8	0	0	21	3	0	26	16	3	4	1	1	2	2	1	10	6	1	1	1	0	1	0	0	4	1	0	13	1	0	15	0	0	22	10	3	7	3	0	11	10	6	2	2	1	6	0	0	9	4	2	7	1	0	3	1	0

[back to top]

Number of Participants With Post-Baseline Emergent Grade 1 to 4 Clinical Chemistry and Hematology Toxicities

All Grade 1 to 4 post-Baseline-emergent chemistry toxicities included alanine aminotransferase (ALT), albumin, alkaline phosphatase (ALP), asparate aminotransferase (AST), carbon dioxide (CO2) content/bicarbonate, cholesterol, creatine kinase (CK), creatinine, hyperglycemia, hyperkalemia, hypernatremia, hypoglycemia, hypokalemia, hyponatremia, low density lipoprotein (LDL) cholesterol calculation, lipase, total bilirubin, and triglycerides. All Grade 1 to 4 post-Baseline-emergent hematology toxities included hemoglobin, platelet count, total neutrophils, and white blood cell count. The Division of AIDS (DAIDS) defined toxicity grades as follows: Grade 1, mild; Grade 2, moderate; Grade 3, severe; Grade 4, potentially life threatening; Grade 5, death. Higher the grade, more severe the symptoms. (NCT01231516)
Timeframe: From Baseline (Day 1) until Week 48, including participants with post-treatment events occurring after Week 48 for participants not entering the post-Week 48 Open-Label phase of the study

Intervention	Participants (Count of Participants)
	ALT	Albumin	ALP	AST	CO2 content/bicarbonate	Cholesterol	CK	Creatinine	Hyperglycaemia	Hyperkalemia	Hypernatremia	Hypoglycaemia	Hypokalemia	Hyponatremia	LDL cholesterol calculation	Lipase	Total bilirubin	Triglycerides	Hemoglobin	Platelet count	Total neutrophils	White Blood Cell count
DTG 50 mg OD	47	4	27	49	97	99	28	18	71	7	5	21	37	76	68	63	56	14	19	36	49	19
RAL 400 mg BID	46	3	42	52	109	103	29	13	80	6	7	14	41	79	82	68	53	24	27	32	49	29

[back to top]

Number of Participants With a Confirmed Plasma HIV-1 RNA Level >=1000 c/mL at or After Week 16 and Before Week 24, or a Confirmed Plasma HIV-1 RNA Level >=200 c/mL at or After Week 24

Data are presented as Kaplan Meier estimates of virologic failure (VF), defined as a confirmed plasma HIV-1 RNA level >=1000 c/mL at or after Week 16 and before Week 24, or a confirmed plasma HIV-1 RNA level >=200 c/mL at or after Week 24. A plasma HIV-1 RNA value was considered to be confirmed failure if a consecutive measurement satisfied the same failure criterion. The number of participants who experienced autoimmune deficiency syndrome (AIDS) Clinical Trials Group (ACTG) VFs was measured. For participants who withdrew from the study/were not documented to have reached confirmed VF at the cut off date of the Week 48 analysis, time to VF was to be censored at the planned visit week of the last measured plasma HIV-1 RNA sample. Data for participants who missed three consecutive scheduled plasma HIV-1 RNA measurements were to be censored at the planned visit week of the last assessment prior to the 3 consecutive missed visits. (NCT01263015)
Timeframe: From Baseline until Week 144) (average of 877.4 days for DTG; average of 788.8 study days for EFV/TDF/FTC)

Intervention	Participants (Number)
	ACTG virologic failures	Censored participants
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	11	403
EFV/TDF/FTC 600/200/300 mg Once Daily	8	411

[back to top]

Number of Participants With the Indicated Genotypic Resistance With Virological Failure (VF) Through 144

Whole blood samples were collected from participants to provide plasma for storage samples for potential viral genotypic and phenotypic analyses. Participants with confirmed virological failure (confirmed HIV-1 RNA >=50 copies/mL throughout the study and/or confirmed HIV-1 RNA >=200 copies/mL at Week 144) had plasma samples tested for HIV-1 RT genotype and HIV-1 integrase genotype from Baseline samples and from samples collected at the time of virological failure. Genotype testing was conducted at Day 1 and at the time of suspected protocol-defined virological failure (PDVF). A genotyping assessment was made of change across all amino acids within the integrase (IN)-encoding region, with particular attention paid to specific amino acid changes associated with the development of resistance to RAL, ELV, or DTG. (NCT01263015)
Timeframe: Through Week 144

Intervention	Participants (Number)
	Week 144, RT mutation K65K/R	Week 144, RT mutation K101E	Week 144, RT mutation K103K/N	Week 144, RT mutation K103N	Week 144, RT mutation G190G/A
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	0	0	0	0	0
EFV/TDF/FTC 600/200/300 mg Once Daily	1	1	2	2	2

[back to top]

Number of Participants With the Indicated Grade 1 to 4 Clinical and Hematology Toxicities at Week144

All Grade 1 to 4 post-Baseline-emergent chemistry toxicities included alanine aminotransferase (ALT), albumin, alkaline phosphatase (ALP), asparate aminotransferase (AST), carbon dioxide (CO2) content/bicarbonate, cholesterol, creatine kinase (CK), creatinine, hyperglycemia, hyperkalemia, hypernatremia, hypoglycemia, hypokalemia, hyponatremia, low density lipoprotein (LDL) cholesterol calculation, lipase, phosphorus inorganic, total bilirubin, and triglycerides. All Grade 1 to 4 post-Baseline-emergent hematology toxities included hemoglobin, platelet count, total neutrophils, and white blood cell count. The Division of AIDS (DAIDS) defined toxicity grades as follows: Grade 1, mild; Grade 2, moderate; Grade 3, severe; Grade 4, potentially life threatening; Grade 5, death. (NCT01263015)
Timeframe: From Baseline until Week 144

Intervention	Participants (Number)
	Week 144, ALT	Week 144, Albumin	Week 144, ALP	Week 144, AST	Week 144, CO2 content/bicarbonate	Week 144, Cholesterol	Week 144, CK	Week 144, Creatinine	Week 144, Hyperglycaemia	Week 144, Hyperkalemia	Week 144, Hypernatremia	Week 144, Hypoglycaemia	Week 144, Hypokalemia	Week 144, Hyponatremia	Week 144, LDL cholesterol calculation	Week 144, Lipase	Week 144, Phosphorus, inorganic	Week 144, Total bilirubin	Week 144, Triglycerides	Week 144, Hemoglobin	Week 144, Platelet count	Week 144, Total neutrophils	Week 144, White Blood Cell count
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	62	0	17	77	135	156	91	17	121	4	11	24	38	63	124	111	109	22	11	7	20	70	9
EFV/TDF/FTC 600/200/300 mg Once Daily	81	1	53	85	134	140	79	6	105	12	9	21	21	86	111	110	134	4	11	11	19	80	18

[back to top]

Number of Participants With the Indicated Post-baseline HIV-associated Conditions and Progression, Excluding Recurrences at Week 144

Clinical disease progression (CDP) was assessed according to the Centers for Disease Control and Prevention (CDC) HIV-1 classification system. Category (CAT) A: one or more of the following conditions (CON), without any CON listed in Categories B and C: asymptomatic HIV infection, persistent generalized lymphadenopathy, acute (primary) HIV infection with accompanying illness or history of acute HIV infection. CAT B: symptomatic CON that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or that are considered by physicians to have a clinical course or to require management that is complicated by HIV infection; and not included among CON listed in clinical CAT C. CAT C: the clinical CON listed in the AIDS surveillance case definition. Indicators of CDP were defined as: CDC CAT A at Baseline (BS) to a CDC CAT C event (EV); CDC CAT B at BS to a CDC CAT C EV; CDC CAT C at BS to a new CDC CAT C EV; or CDC CAT A, B, or C at BS to death. (NCT01263015)
Timeframe: From Baseline until Week 144

Intervention	Participants (Number)
	Week 144, Any category condition	Week 144, Any Category B condition	Week 144, Any Category C condition	Week 144, Any death	Week 144, Progression from CAT A to CAT C	Week 144, Progression from CAT C to new CAT C	Week 144, Progression from CAT A, B, or C to death
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	17	12	5	0	4	1	0
EFV/TDF/FTC 600/200/300 mg Once Daily	24	17	6	2	4	2	2

[back to top]

Percentage of Participants With Plasma Human Immunodeficiency Virus -1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 96 and Week 144

The percentage of participants with plasma HIV-1 RNA <50 c/mL at Week 96 and Week 144 was assessed. Plasma samples were collected for the quantitative assessment of HIV-1 RNA based on the Missing, Switch, or Discontinuation equals Failure (MSDF) algorithm,as codified by the Food and Drug Administration's Snapshot algorithm. This algorithm treats all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigationl product prior to the visit window) as non-responders, as well as participants who switched their concomitant antiretroviral therapy (ART) in certain scenarios. Since changes in ART were not permitted in this protocol, all such participants who changed ART were to be considered non-responders. Otherwise, virologic success or failure was to be determined by the last available HIV-1 RNA assessment while the participant was on treatment within the visit of interest window. (NCT01263015)
Timeframe: Week 96 and Week 144

Intervention	Percentage of participants (Number)
	Week 96	Week 144
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	77	71
EFV/TDF/FTC 600/200/300 mg Once Daily	70	63

[back to top]

Change From Baseline in the Symptom Bother Score (SBS) at Week 4 Through Week 48

"The Symptom Distress Module (SDM) is a 20-item, self-reported questionnaire measuring the presence/perceived distress linked to symptoms associated with HIV/its treatments. Developed with support from the AIDS Clinical Trials Group of the U.S. National Institute of Allergy and Infectious Diseases, it has demonstrated construct validity and has shown strong associations with physical/mental health summary scores and with disease severity. The SDM consists of 2 main scores: symptom count and the SBS, ranging from 0 (best) to 80 (worst) and based on the degree of bother that each symptom present posed. The SBS was calculated by adding the 20 individual bother item scores, which were calculated as: 0, I do not have this symptom; 1, It doesn't bother me; 2, It bothers me a little; 3, It bothers me; 4, It bothers me a lot. Estimates are calculated from an analysis of covariance (ANCOVA) model adjusting for age, sex, race, Baseline (BL) viral load, BL CD4+ cell count, and BL SBS." (NCT01263015)
Timeframe: Baseline and Week 4 through 48

Intervention	Scores on a scale (Least Squares Mean)
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	-1.818
EFV/TDF/FTC 600/200/300 mg Once Daily	-1.246

[back to top]

Change From Baseline in CD4+ Cell Counts at Week 144

Cluster of differentiation (CD4) lymphocyte cells (also called T-cells or T-helper cells) are the primary targets of HIV. The CD4 count and the CD4 percentage mark the degree of immunocompromise. The CD4 count is used to stage the patient's disease, determine the risk of opportunistic illnesses, assess prognosis, and guide decisions about when to start antiretroviral therapy. Change from Baseline was calculated as the Week 144 value minus the Baseline value. The least squares mean is the estimated mean change from Baseline in CD4+ cell counts at Week 144 calculated from a repeated measures model including the following covariates: treatment, visit, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, treatment*visit interaction, Baseline HIV-1 RNA*visit interaction, and Baseline CD4+ cell count*visit interaction. No assumptions were made about the correlations between a participant's readings of CD4+, i.e., the correlation matrix for within-participant errors is unstructured. (NCT01263015)
Timeframe: Baseline and Week 144

Intervention	cells per millimeters cubed (cells/mm^3) (Least Squares Mean)
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	378.48
EFV/TDF/FTC 600/200/300 mg Once Daily	331.57

[back to top]

Time to Viral Suppression (<50 c/mL)

Viral suppression is defined as the first viral load value<50 c/mL. The Kaplan-Meier method was used to estimate time to viral suppression, defined as the time from the first dose of study treatment until the first viral load value <50 c/mL was reached. Participants who withdrew for any reason without having suppressed prior to the analysis were censored. (NCT01263015)
Timeframe: From Baseline until Week 144) (average of 877.4 days for DTG; average of 788.8 study days for EFV/TDF/FTC)

Intervention	Days (Median)
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	28
EFV/TDF/FTC 600/200/300 mg Once Daily	84

[back to top]

Change From Baseline in CD4+ Cell Counts at Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96, 108, 120, 132 and 144

CD4 lymphocyte cells (also called T-cells or T-helper cells) are the primary targets of HIV. The CD4 count and the CD4 percentage mark the degree of immunocompromise. The CD4 count is used to stage the patient's disease, determine the risk of opportunistic illnesses, assess prognosis, and guide decisions about when to start antiretroviral therapy. Change from Baseline was calculated as the value at Indicated visit minus the Baseline value. Only those participants available at the indicated time points were assessed (represented by n=X, X in the category titles). (NCT01263015)
Timeframe: Baseline and Week 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96, 108, 120, 132 and 144

Intervention	cells per millimeters cubed (cells/mm^3) (Mean)
	Week 4, n=404,390	Week 8, n=396,382	Week 12, n=394,378	Week 16, n=386,366	Week 24, n=388,361	Week 32, n=380,353	Week 40, n=364,347	Week 48, n=368,344	Week 60, n=359,330	Week 72, n=354,319	Week 84, n=352,314	Week 96, n=343,309	Week 108, n=339,300	Week 120, n=332,287	Week 132, n=323,283	Week 144, n=313,270
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	117.6	164.6	187.5	214.7	216.9	250.5	265.5	267.5	271.3	306.1	315.2	322.6	349.3	347.0	377.9	379.5
EFV/TDF/FTC 600/200/300 mg Once Daily	80.9	124.4	153.0	174.1	177.8	208.1	216.2	209.5	235.3	269.6	272.1	286.0	298.9	311.0	327.2	333.3

[back to top]

Change From Baseline in Plasma HIV-1 RNA at Weeks 2, 4, 8, 12, 16, 24, 32, 40,48, 60, 72, 84, 96, 108, 120, 132 and 144

Blood samples were collected for the measurement of HIV-1 RNA in plasma. Changes from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants available at the indicated time points were assessed (represented by n=X, X in the category titles). (NCT01263015)
Timeframe: Baseline and at Weeks 2, 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96, 108, 120, 132 and 144

Intervention	log10 copies/mL (Mean)
	Week 2, n=387, 376	Week 4, n=404, 391	Week 8, n=395, 386	Week 12, n=394, 377	Week 16, n=386, 366	Week 24, n=389, 364	Week 32, n=380, 355	Week 40, n=370, 345	Week 48, n=370, 343	Week 60, n=360, 330	Week 72, n=354, 320	Week 84, n=353, 314	Week 96, n=345, 310	Week 108, n=340, 300	Week 120, n=333, 289	Week 132, n=323, 284	Week 144, n=313,269
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	-2.46	-2.88	-2.99	-3.01	-3.03	-3.05	-3.04	-3.05	-3.03	-3.03	-3.03	-3.02	-2.99	-3.01	-3.00	-3.03	-3.02
EFV/TDF/FTC 600/200/300 mg Once Daily	-1.96	-2.25	-2.60	-2.85	-2.98	-3.01	-3.05	-3.04	-3.04	-3.05	-3.06	-3.07	-3.06	-3.08	-3.07	-3.06	-3.04

[back to top]

Proportion of Subjects Responding Based on Plasma HIV-1 RNA <50 c/mL at Week 48

The percentage of participants with plasma HIV-1 RNA <50 c/mL at Week 48 was assessed. Plasma samples were collected for the quantitative assessment of HIV-1 RNA based on the Missing, Switch, or Discontinuation equals Failure (MSDF) algorithm,as codified by the Food and Drug Administration's Snapshot algorithm. This algorithm treats all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigationl product prior to the visit window) as non-responders, as well as participants who switched their concomitant antiretroviral therapy (ART) in certain scenarios. Since changes in ART were not permitted in this protocol, all such participants who changed ART were to be considered non-responders. Otherwise, virologic success or failure was to be determined by the last available HIV-1 RNA assessment while the participant was on treatment within the visit of interest window. (NCT01263015)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
DTG 50 mg Plus ABC/3TC 600/300 mg Once Daily	88
EFV/TDF/FTC 600/200/300 mg Once Daily	81

[back to top]

Number of Participants With HIV-1 RNA Less Than 50 Copies/mL at Week 24

The number of participants who had viral load <50 copies/mL at Week 24 based on the Food and Drug Administration's Snapshot algorithm was assessed. This algorithm treats all participants without HIV-1 RNA data at the visit of interest (VOI [due to missing data/discontinuation of investigational product prior to the visit window]) as nonresponders, as well as participants who switched their concomitant antiretroviral (ART) prior to the VOI as follows: background ART substitutions not permitted per protocol; background ART substitutions permitted per protocol, however the decision to switch was not documented as being before or at the first on-treatment visit after switching to optimized background regimen (i.e., Week 4) where HIV-1 RNA was assessed. Otherwise, virologic success/failure was to be determined by the last available HIV-1 RNA assessment while the participant was on treatment within the VOI analysis window. (NCT01328041)
Timeframe: Week 24

Intervention	participants (Number)
Dolutegravir 50 mg BID	126

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA at Day 8

Mean change from Baseline in Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) at Day 8 was calculated as the Day 8 value minus the Baseline value. The last observation was carried forward if a participant had missed the Day 8 visit. The Baseline observation was carried forward if a participant had discontinued the treatment before Day 8. Blood samples for assessment of HIV-1 RNA levels were collected at Baseline and Day 8. (NCT01328041)
Timeframe: Baseline and Day 8

Intervention	log10 copies/milliliter (mL) (Mean)
Dolutegravir 50 mg BID	-1.432

[back to top]

Ratio of CD4+/CD8+ Cell Count at Baseline and Weeks 4, 12, 24, and 48

The ratio of CD4+/CD8+ cell count (measured in cells/mm^3) was assessed at Baseline and at Weeks 4, 12, 24, and 48. The ratio was calculated as the CD4+ cell count divided by CD8+ cell count. (NCT01328041)
Timeframe: Baseline; Weeks 4, 12, 24, and 48

Intervention	ratio (Median)
	Baseline, n=180	Week 4, n=176	Week 12, n=170	Week 24, n=154	Week 48, n=140
Dolutegravir 50 mg BID	0.15	0.19	0.21	0.26	0.32

[back to top]

Number of Participants With the Maximum Post-Baseline-emergent Hematology Toxicities of the Indicated Grade

The severity of hematology toxicities was graded according to the DAIDS. The DAIDS displays events as Grades 1-5 based on this general guideline: Grade (G) 1, mild; G2, moderate; G3, severe; G4, life threatening; G5, death related to toxicity. (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	Participants (Number)
	Grade 1	Grade 2	Grade 3	Grade 4
Dolutegravir 50 mg BID	31	15	4	2

[back to top]

Number of Participants With the Maximum Post-Baseline-emergent Clinical Chemistry Toxicities of the Indicated Grade

The severity of clinical chemistry toxicities was graded according to the DAIDS toxicity scale. The DAIDS displays events as Grades 1-5 based on this general guideline: Grade (G) 1, mild; G2, moderate; G3, severe; G4, life threatening; G5, death related to toxicity. (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	participants (Number)
	Grade 1	Grade 2	Grade 3	Grade 4
Dolutegravir 50 mg BID	49	67	43	16

[back to top]

Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Protocol-defined Virologic Failure (PDVF) as a Measure of Genotypic Resistance

An analysis of changes at specific amino acids in the IN coding region associated with resistance to raltegravir, elvitegravir, or DTG was performed at Day 1 and at the time of PDVF. PDVF is a <0.5 log10 copies(c)/mL decrease in plasma HIV-1 RNA at Day 8 unless the absolute value is <400 c/mL. PDVF after Day 8 is defined as virological non-respones (decrease in plasma HIV-1 RNA of <1 log10 c/mL by Week 16, with subsequent confirmation, unless plasma HIV-1 RNA <400 c/mL and confirmed plasma HIV-1 RNA levels >=400 c/mL on or after Week 24) and virological rebound (confirmed rebound in plasma HIV-1 RNA levels to >=400 c/mL after prior confirmed suppression to <400 c/mL and confirmed plasma HIV-1 RNA levels >1 log10 c/mL above the nadir value [nadir: >=400 c/mL]). (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	participants (Number)
	Any IN mutation	T97A	T97T/A	E138A	E138E/A	E138E/K	E138K	E138T/A	N155H	N155N/H	Q148H	Q148Q/H	Q148R	Q148Q/R/K	G140G/S	G140S	L74L/M/V	L74L/M	L74I	E92E/Q	S147G	E157E/Q	V151V/M/I	Y143Y/H
Dolutegravir 50 mg BID	25	8	4	1	1	3	4	1	6	1	3	2	1	1	1	3	1	1	1	2	2	1	1	1

[back to top]

Number of Participants With the Indicated Fold Increase in DTG FC (Fold Change in IC50 Relative to Wild-type Virus) Between Baseline and the Time of PDVF, as a Measure of Post-Baseline Phenotypic Resistance

The FC in IC50 (50% inhibitory concentration) for DTG relative to wild-type virus was determined for virus isolated at Baseline and at the time of PDVF. The number of participants with the indicated change (ratio) in the two values at the time of PDVF is presented. PDVF is defined as a <0.5 log10 copies/mL decrease in plasma HIV-1 RNA at Day 8 unless the absolute value is <400 copies/mL. PDVF after Day 8 was defined for virological non-response (decrease in plasma HIV-1 RNA of less than 1 log10 copies/mL by Week 16, with subsequent confirmation, unless plasma HIV-1 RNA <400 copies/mL and confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24) and virological rebound (confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL and confirmed plasma HIV-1 RNA levels >1 log10 copies/mL above the nadir value, where nadir is >=400 copies/mL). (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	Participants (Number)
	<1 fold	1-<2 fold	2-<4 fold	4-<8 fold	>=8 fold	Missing
Dolutegravir 50 mg BID	6	16	4	4	12	3

[back to top]

Number of Participants With Adverse Events of the Indicated Severity, Per the Division of Acquired Immune Deficiency Syndrome (DAIDS) Grading Scale

An AE is defined as any untoward medical occurrence in a participant or clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product. An SAE is defined as any untoward medical occurrence that, at any dose, results in death, is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, is a congenital anomaly/birth defect, or is an event of possible drug-induced liver injury. AE/SAE severity was graded according to the DAIDS grading scale. The DAIDS displays events as Grades 1-4 based on this general guideline: Grade (G) 1, mild; G2, moderate; G3, severe; G4, potentially life threatening. (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	participants (Number)
	Grade 1	Grade 2	Grade 3	Grade 4
Dolutegravir 50 mg BID	45	64	44	16

[back to top]

Number of Participants With Plasma HIV-1 RNA Less Than 400 and 50 Copies/mL From Week 48 Every 12 Weeks up to Study Completion

The number of participants with plasma HIV-1 RNA less than 400 and 50 copies (c)/mL was assessed at Weeks 48, 60, 72, 84, 96, 108, 120, 132, 144, 156, 168 and 180 using data of observed cases. Only those participants available at the specified time points were analyzed (represented by n=X in the category titles). (NCT01328041)
Timeframe: From Week 48 every 12 weeks up to study completion.

Intervention	Participants (Number)
	HIV-1 RNA <50 c/mL, Week 48, n =146	HIV-1 RNA <50 c/mL, Week 60, n=142	HIV-1 RNA <50 c/mL, Week 72, n=138	HIV-1 RNA <50 c/mL, Week 84, n=138	HIV-1 RNA <50 c/mL, Week 96, n=120	HIV-1 RNA <50 c/mL, Week 108, n=98	HIV-1 RNA <50 c/mL, Week 120, n=82	HIV-1 RNA <50 c/mL, Week 132, n=61	HIV-1 RNA <50 c/mL, Week 144, n=45	HIV-1 RNA <50 c/mL, Week 156, n=32	HIV-1 RNA <50 c/mL, Week 168, n=24	HIV-1 RNA <50 c/mL, Week 180, n=6	HIV-1 RNA <400 c/mL, Week 48, n=146	HIV-1 RNA <400 c/mL, Week 60, n=142	HIV-1 RNA <400 c/mL, Week 72, n=138	HIV-1 RNA <400 c/mL, Week 84, n=138	HIV-1 RNA <400 c/mL, Week 96, n=120	HIV-1 RNA <400 c/mL, Week 108, n=98	HIV-1 RNA <400 c/mL, Week 120, n=82	HIV-1 RNA <400 c/mL, Week 132, n=61	HIV-1 RNA <400 c/mL, Week 144, n=45	HIV-1 RNA <400 c/mL, Week 156, n=32	HIV-1 RNA <400 c/mL, Week 168, n=24	HIV-1 RNA <400 c/mL, Week 180, n=6
Dolutegravir 50 mg BID	121	110	116	108	101	81	72	49	37	28	20	4	134	131	130	127	111	92	80	59	44	31	23	5

[back to top]

Number of Participants With Plasma HIV-1 RNA Less Than 400 and 50 Copies/mL at Baseline; Day 8; and Weeks 4, 8, 12, 16, 24, 32, 40, and 48

The number of participants with plasma HIV-1 RNA less than 400 and 50 copies (c)/mL at Baseline; Day 8; and Weeks 4, 8, 12, 16, 24, 32, 40 and 48 based on the Food and Drug Administration's Snapshot algorithm was assessed. This algorithm treats all participants without HIV-1 RNA data at the visit of interest (VOI [due to missing data/discontinuation of investigational product prior to the visit window]) as nonresponders, as well as participants who switched their concomitant antiretroviral (ART) prior to the VOI as follows: background ART substitutions not permitted per protocol; background ART substitutions permitted per protocol, however the decision to switch was not documented as being before or at the first on-treatment visit after switching to optimized background regimen (i.e., Week 4) where HIV-1 RNA was assessed. Otherwise, virologic success/failure was to be determined by the last available HIV-1 RNA assessment while the par. was on treatment within the VOI analysis window (NCT01328041)
Timeframe: Baseline; Day 8; and Weeks 4, 8, 12, 16, 24, 32, 40, and 48

Intervention	participants (Number)
	HIV-1 RNA <50 c/mL, Baseline	HIV-1 RNA <50 c/mL, Day 8	HIV-1 RNA <50 c/mL, Week 4	HIV-1 RNA <50 c/mL, Week 8	HIV-1 RNA <50 c/mL, Week 12	HIV-1 RNA <50 c/mL, Week 16	HIV-1 RNA <50 c/mL, Week 24	HIV-1 RNA <50 c/mL, Week 32	HIV-1 RNA <50 c/mL, Week 40	HIV-1 RNA <50 c/mL, Week 48	HIV-1 RNA <400 c/mL, Baseline	HIV-1 RNA <400 c/mL, Day 8	HIV-1 RNA <400 c/mL, Week 4	HIV-1 RNA <400 c/mL, Week 8	HIV-1 RNA <400 c/mL, Week 12	HIV-1 RNA <400 c/mL, Week 16	HIV-1 RNA <400 c/mL, Week 24	HIV-1 RNA <400 c/mL, Week 32	HIV-1 RNA <400 c/mL, Week 40	HIV-1 RNA <400 c/mL, Week 48
Dolutegravir 50 mg BID	1	28	98	112	116	116	126	117	108	116	8	82	145	146	142	139	135	127	119	125

[back to top]

Number of Participants With HIV-1 Disease Progression (Acquired Immune Deficiency Syndrome [AIDS] or Death)

The number of participants with HIV-1 disease progression (AIDS or death) was assessed per the Centers for Disease Control and Prevention (CDC) 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. The CDC classifies HIV infection as Category A (participants with asymptomatic HIV infection, acute HIV infection with accompanying illness, or persistent generalized lymphadenopathy), Category B (participants with symptomatic non-AIDS condition, i.e., conditions that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or conditions are considered by physicians to have a clinical course or to require management that is complicated by HIV infection), and Category C (includes AIDS indicator conditions as defined by diagnostic or presumptive measures). (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	Participants (Number)
	Progression from CDC Class A to Class C Event	Progression from CDC Class B to Class C Event	Progression from CDC Class C to New Class C Event	Progression from Classes A, B, or C to Death
Dolutegravir 50 mg BID	1	2	6	2

[back to top]

Number of Participants With Any Adverse Event (AE) or Any Serious Adverse Event (SAE)

An AE is defined as any untoward medical occurrence in a participant or clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product. An SAE is defined as any untoward medical occurrence that, at any dose, results in death, is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, is a congenital anomaly/birth defect, or is an event of possible drug-induced liver injury. (NCT01328041)
Timeframe: From the day of the first dose of study drug until end of treatment visit for each participant, up to Week 180 (median of 758 days)

Intervention	participants (Number)
	Any AE	Any SAE
Dolutegravir 50 mg BID	169	46

[back to top]

Median Change From Baseline in CD4+ Cell Counts at Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and From Week 48 Every 12 Weeks Until Study Completion

Median change from Baseline in CD4+ cell counts was assessed at Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96, 108, 120, 132, 144, 156, 168, and 180. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT01328041)
Timeframe: Baseline; Day 8; Weeks 4, 8, 12, 16, 24, 32, 40, 48, 60, 72, 84, 96, 108, 120, 132, 144, 156, 168 and 180. v

Intervention	Cells per millimeters cubed (cells/mm^3) (Median)
	CD4+, Day 8, n=181	CD4+, Week 4, n=178	CD4+, Week 8, n=178	CD4+, Week 12, n=171	CD4+, Week 16, n=165	CD4+, Week 24, n=163	CD4+, Week 32, n=147	CD4+, Week 40, n=143	CD4+, Week 48, n=145	CD4+, Week 60, n=142	CD4+, Week 72, n=138	CD4+, Week 84, n=137	CD4+, Week 96, n=117	CD4+, Week 108, n=98	CD4+, Week 120, n=82	CD4+, Week 132, n=61	CD4+, Week 144, n=46	CD4+, Week 156, n=32	CD4+, Week168, n=24	CD4+, Week180, n=6
Dolutegravir 50 mg BID	20.0	30.0	40.0	50.0	60.0	61.0	100.0	90.0	110.0	120.0	140.0	150.0	160.0	180.5	180.0	221.0	205.0	225.0	265.0	170.5

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA at Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and From Week 48 Every 12 Weeks up to Study Completion

Mean change from Baseline in plasma HIV-1 RNA was assesseed at Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, 48 , 60, 72, 84, 96, 108, 120, 132, 144, 156, 168, and 180 using data of the observed cases. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT01328041)
Timeframe: Baseline; Day 8; Weeks 4, 8, 12, 16, 24, 32, 40, and From Week 48 Every 12 Weeks up to Study completion (Up to Week 180)

Intervention	Log10 copies/mL (Mean)
	Day 8, n=182	Week 4, n=180	Week 8, n=179	Week 12, n=174	Week 16, n=165	Week 24, n=164	Week 32, n=146	Week 40, n=144	Week 48, n=146	Week 60, n=142	Week 72, n=138	Week 84, n=138	Week 96, n=120	Week 108, n=98	Week 120, n=82	Week 132, n=61	Week 144, n=45	Week 156, n=32	Week 168, n=24	Week 180, n=6
Dolutegravir 50 mg BID	-1.432	-2.088	-2.101	-2.113	-2.216	-2.211	-2.373	-2.301	-2.321	-2.356	-2.390	-2.311	-2.346	-2.394	-2.515	-2.456	-2.585	-2.595	-2.719	-2.425

[back to top]

Cmax and Ctau of DTG

The maximum plasma concentration (Cmax) and the concentration at the end of a dosing interval (Ctau) of DTG were assessed by a population pharmacokinetic (PK) modeling approach using pooled DTG PK data from multiple studies. For this study, blood samples for pharmacokinetic assessments were collected pre-dose on Day 8 and at Weeks 4 and 24, at 1-3 hours post-dose on Day 8, and at 1-3 hours or 4-12 hours post-dose at Weeks 4 and 24. (NCT01328041)
Timeframe: Day 8, Week 4, and Week 24

Intervention	Micrograms per milliliter (µg/mL) (Geometric Mean)
	Cmax	Ctau
Dolutegravir 50 mg BID	4.74	2.60

[back to top]

C0 Assessment of DTG

The plasma DTG concentration immediately prior to dosing at steady state (C0) was assessed at Day 8, Week 4, and Week 24. Blood samples for pharmacokinetic assessments were collected pre-dose and 1-3 hours post-dose on Day 8 and at Week 4 and 4-12 hours post-dose at Week 24. Different participants may have been analyzed at different time points, so the overall number of participants analyzed reflects everyone in the Pharmacokinetic Parameter Population. (NCT01328041)
Timeframe: Day 8, Week 4, and Week 24

Intervention	µg/mL (Geometric Mean)
	Day 8, n=148	Week 4, n=161	Week 24, n=135
Dolutegravir 50 mg BID	2.36	1.90	2.14

[back to top]

AUC(0-tau) and AUC(0-24) of DTG

The area under the time concentration curve over the dosing interval (AUC[0-tau]) and from 0 to 24 hours (AUC[0-24]) of DTG was assessed by a population PK modeling approach using pooled DTG PK data from multiple studies. For this study, blood samples for pharmacokinetic assessments were collected pre-dose on Day 8 and at Weeks 4 and 24, at 1-3 hours post-dose on Day 8, and at 1-3 hours or 4-12 hours post-dose at Weeks 4 and 24. (NCT01328041)
Timeframe: Day 8, Week 4, and Week 24

Intervention	µg*hour/mL (Geometric Mean)
	AUC(0-tau)	AUC(0-24)
Dolutegravir 50 mg BID	36.7	73.5

[back to top]

Absolute Values for CD4+ Cell Counts at Baseline, Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and 48 and for CD8+ Cell Counts at Baseline and Weeks 4, 12, 24, and 48

Absolute values for CD4+ cell counts were assessed at Baseline, Day 8 and Weeks 4, 8, 12, 16, and 24, and absolute values for CD8+ cell counts were assessed at Baseline and Weeks 4, 12, 24, and 48. (NCT01328041)
Timeframe: Baseline, Day 8 and Weeks 4, 8, 12, 16, 24, 32, 40, and 48

Intervention	Cells per millimeters cubed (cells/mm^3) (Median)
	CD4+, Baseline, n=183	CD4+, Day 8, n=181	CD4+, Week 4, n=178	CD4+, Week 8, n=178	CD4+, Week 12, n=171	CD4+, Week 16, n=165	CD4+, Week 24, n=163	CD4+, Week 32, n=147	CD4+, Week 40, n=143	CD4+, Week 48, n=145	CD8+, Week 4, n=181	CD8+, Week 4, n=176	CD8+, Week 12, n=170	CD8+, Week 24, n=154	CD8+, Week 48, n=140
Dolutegravir 50 mg BID	140.0	170.0	185.0	210.0	210.0	210.0	250.0	270.0	290.0	310.0	860.0	970.0	1015.0	1020.0	1000.0

[back to top]

Number of Participants With HIV-1 RNA Less Than 50 Copies/mL at Week 48

The number of participants who had viral load <50 copies/mL at Week 48 based on the Food and Drug Administration's Snapshot algorithm was assessed. This algorithm treats all participants without HIV-1 RNA data at the visit of interest (VOI [due to missing data/discontinuation of investigational product prior to the visit window]) as nonresponders, as well as participants who switched their concomitant antiretroviral (ART) prior to the VOI as follows: background ART substitutions not permitted per protocol; background ART substitutions permitted per protocol, however the decision to switch was not documented as being before or at the first on-treatment visit after switching to optimized background regimen (i.e., Week 4) where HIV-1 RNA was assessed. Otherwise, virologic success/failure was to be determined by the last available HIV-1 RNA assessment while the participant was on treatment within the VOI analysis window. (NCT01328041)
Timeframe: Week 48

Intervention	participants (Number)
Dolutegravir 50 mg BID	116

[back to top]

Number of Participants With HIV-1 Associated Disease Progression With the Indicated Shift to CDC Class C, or New CDC Class C or Death at Week 48

Intervention	Participants (Number)
DTG 50 mg QD	0
DRV 800 mg + RTV 100 mg QD	0

[back to top]

Percentage of Participants With Grade 2 or Higher Abnormalities in Fasting LDL Cholesterol Through Week 48

Hematology and clinical chemistry data were summarized according to the division of AIDS (DAIDS) table for grading the Severity of adverse events, version 1.0. Grade 1, Mild; Grade 2, Moderate; Grade 3 (G3), Severe; Grade 4 (G4), Life-threatening or disabling; Grade 5, Death. Data are presented for which an increase in fasting LDL cholesterol to Grade 2 or higher occurred. Only those participants with data available at the specified time points were analyzed. (NCT01449929)
Timeframe: From Baseline through Week 48

Intervention	Percentage of Participants (Number)
DTG 50 mg QD	2
DRV 800 mg + RTV 100 mg QD	7

[back to top]

Percentage of Participants With Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) at Week 48

"Assessment was done using Missing, Switch or Discontinuation = Failure (MSDF), as codified by the Food and Drug Administration (FDA) snapshot algorithm.This algorithm treated all participants without HIV-1 RNA data at Week 48 as nonresponders, as well as participants who switched their concomitant ART prior to Week 48 as follows: background ART substitutions non-permitted per protocol (one background ART substitution was permitted for safety or tolerability); background ART substitutions permitted per protocol unless the decision to switch was documented as being before or at the first on-treatment visit where HIV-1 RNA was assessed. Otherwise, virologic success or failure was determined by the last available HIV-1 RNA assessment while the participant was on-treatment in the snapshot window (Week 48 +/- 6 weeks). Modified Intent-To-Treat Exposed (mITT-E) Population:all randomized participants who received at least one dose of investigational product" (NCT01449929)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
DTG 50 mg QD	90
DRV 800 mg + RTV 100 mg QD	83

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <400 c/mL at Week 48

"The percentage of participants with Plasma HIV-1 RNA <400 c/mL at Week 48 was assessed MSDF, as codified by the FDA snapshot algorithm. This algorithm treated all participants without HIV-1 RNA data at Week 48 as nonresponders, as well as participants who switched their concomitant ART prior to Week 48 as follows: background ART substitutions non-permitted per protocol (one background ART substitution was permitted for safety or tolerability); background ART substitutions permitted per protocol unless the decision to switch was documented as being before or at the first on-treatment visit where HIV-1 RNA was assessed. Otherwise, virologic success or failure was determined by the last available HIV-1 RNA assessment while the participant was on-treatment in the snapshot window (Week 48 +/- 6 weeks)." (NCT01449929)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
DTG 50 mg QD	92
DRV 800 mg + RTV 100 mg QD	87

[back to top]

Human Immunodeficiency Virus Treatment Satisfaction Questionnaire (HIVTSQ) Convenience Score at Week 4, Week 24, and Week 48

Participant treatment satisfaction was measured using the self-reported scale (HIVTSQ), which consists of 10 items (1-satisfaction, 2-HIV control, 3-adverse effects, 4-level of demand, 5-convenience, 6-flexibility, 7-knowledge, 8-life habits, 9-recommendability, and 10-willingness to continue). Items are scored from 0 (very dissatisfied) to 6 (very satisfied), other than item 4, which has an inverted score from 6 (very demanding) to 0 (very undemanding). The convenience score is the score for item 5 (range: 0-6). Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). Different participants may have been analyzed for different visits, so the overall number of participants analyzed reflects everyone in the HIVTSQ mITT-E population. (NCT01449929)
Timeframe: Week 4, Week 24, and Week 48

Intervention	Scores on a scale (Mean)
	Week 4, n=204, 190	Week 24, n=211, 200,	Week 48, n=212, 201
DRV 800 mg + RTV 100 mg QD	5.2	5.4	5.4
DTG 50 mg QD	5.6	5.6	5.7

[back to top]

Human Immunodeficiency Virus Treatment Satisfaction Questionnaire (HIVTSQ) Lifestyle/Ease Sub Score at Week 4, Week 24, and Week 48

Participant treatment satisfaction was measured using the self-reported scale (HIVTSQ), which consists of 10 items (1-satisfaction, 2-HIV control, 3-adverse effects, 4-level of demand, 5-convenience, 6-flexibility, 7-knowledge, 8-life habits, 9-recommendability, and 10-willingness to continue). Items are scored from 0 (very dissatisfied) to 6 (very satisfied), other than item 4, which has an inverted score from 6 (very demanding) to 0 (very undemanding). The lifestyle/ease score is the sum of items 4, 5, 6, 7 and 8 (range: 0-30). Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). Different participants may have been analyzed for different visits, so the overall number of participants analyzed reflects everyone in the HIVTSQ mITT-E population. (NCT01449929)
Timeframe: Week 4, Week 24, and Week 48

Intervention	Scores on a scale (Mean)
	Week 4, n=202, 190	Week 24, n=210, 199	Week 48, n=211, 201
DRV 800 mg + RTV 100 mg QD	25.8	26.6	26.6
DTG 50 mg QD	26.7	27.5	27.6

[back to top]

Change From Baseline in Plasma HIV-1 RNA (log10 c/mL) at Weeks 4, 8, 12, 16, 24, 36 and 48

Change from Baseline in plasma HIV-1 RNA (log10 c/mL) was assessed at Weeks 4, 8, 12, 16, 24, 36 and 48 . Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). Different participants may have been analyzed for different visits, so the overall number of participants analyzed reflects everyone in the mITT-E Population. (NCT01449929)
Timeframe: Baseline, Weeks 4, 8, 12, 16, 24, 36 and 48

Intervention	Log10 copies per mL (Mean)
	Week 4, n=238, 235	Week 8, n=237, 236	Week 12, n=234, 227	Week 16, n=229, 228	Week 24, n=234, 227	Week 36, n=232, 218	Week 48, n=227, 212
DRV 800 mg + RTV 100 mg OD	-2.01	-2.40	-2.61	-2.71	-2.83	-2.85	-2.86
DTG 50 mg OD	-2.80	-2.86	-2.88	-2.86	-2.86	-2.87	-2.89

[back to top]

Number of Participants (Par.) With Detectable Virus That Has Genotypic or Phenotypic Evidence of Treatment-emergent Resistance to DTG, DRV+RTV and Other On-study ART at Time of Protocol Defined Virology Failure (PDVF)

An assessment was made of every change across all amino acids within the integrase (IN), reverse transcriptase (RT), and Protease (PRO) encoding region at Baseline and at time of suspected PDVF. PDVF is defined as the confirmed plasma HIV-1 RNA >200 c/mL >=Week 24. PDVF Genotypic Population included all participants in the mITT-E population with available on-treatment genotypic resistance data, at time of PDVF. Only those participants with data available at the specified time points were analyzed. (NCT01449929)
Timeframe: Baseline until PDVF up to Week 48

Intervention	Participants (Number)
DTG 50 mg OD	0
DRV 800 mg + RTV 100 mg OD	0

[back to top]

Change From Baseline in European Quality of Life -5 Dimensions (EQ-5D) Utility Scores at Week 24 and Week 48

The EQ-5D is a 5-question quality of life instrument that provides a utility score and visual analogue scale score that describes the participants' health status. The primary reason for including the EQ-5D is to elicit utility values for potential cost-effectiveness analysis for submission to health technology assessment agencies. The EQ-5D total score ranges from 0 (worst health state) to 1 (perfect health state) and 1 reflects the best outcome. Values represented are for adjusted mean. Estimates are calculated from an ANCOVA model adjusting for age, sex, race, baseline viral load, background dual NRTI therapy and Baseline EQ-5D utility score. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). (NCT01449929)
Timeframe: Baseline, Week 24, and Week 48

Intervention	Scores on a scale (Mean)
	Week 24, n=217, 213	Week 48, n=224, 217
DRV 800 mg + RTV 100 mg QD	0.02	0.01
DTG 50 mg QD	0.00	0.01

[back to top]

Change From Baseline in EQ-5D Thermometer Scores at Week 24 and Week 48

The European Quality of Life -5 Dimensions (EQ-5D) is a 5-question quality of life instrument that provides a utility score and visual analogue scale score that describes the participants' health status. The primary reason for including the EQ-5D is to elicit utility values for potential cost-effectiveness analysis for submission to health technology assessment agencies. Thermometer score is based on a visual analogue scale (VAS) ranging from 100 (best imaginable health state) to 0 (worst imaginable health state).Values represented are for adjusted mean. Estimates are calculated from an ANCOVA model adjusting for age, sex, race, Baseline viral load, background dual NRTI therapy and Baseline EQ-5D thermometer score. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). (NCT01449929)
Timeframe: Baseline, Week 24, and Week 48

Intervention	Scores on a scale (Mean)
	Week 24, n=221, 216	Week 48, n=224, 220
DRV 800 mg + RTV 100 mg QD	5.96	6.95
DTG 50 mg QD	4.95	5.78

[back to top]

Change From Baseline in CD4+ and CD8+ Cell Counts

Change from Baseline in CD4+ cell counts was assessed at Weeks 4, 8, 12, 16, 36 and 48. Change from Baseline in CD8+ cell counts was assessed at Weeks 4, 12, 24 and 48. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). Different participants may have been analyzed for different visits and parameters, so the overall number of participants analyzed reflects everyone in the mITT-E Population. (NCT01449929)
Timeframe: Baseline and Weeks 4, 8, 12, 16, 36 and 48 for CD4+ and Baseline and Weeks 4, 12, 24 and 48 for CD8+

Intervention	Cells per millimeters cubed (cells/mm^3) (Mean)
	CD4+ cell count, Week 4, n=237, 236	CD4+ cell count, Week 8, n=236, 236	CD4+ cell count, Week 12, n=234, 228	CD4+ cell count, Week 16, n=227, 227	CD4+ cell count, Week 24, n=233, 227	CD4+ cell count, Week 36, n=232, 218	CD4+ cell count, Week 48, n=227, 212	CD8+ cell count, Week 4, n=235, 235	CD8+ cell count, Week 12, n=231, 227	CD8+ cell count, Week 24, n=231, 224	CD8+ cell count, Week 48, n=224, 210
DRV 800 mg + RTV 100 mg QD	75.6	118.8	131.8	146.1	164.3	186.5	215.4	-3.7	-68.9	-132.9	-162.1
DTG 50 mg QD	80.1	126.9	135.2	156.8	165.1	206.1	243.8	-47.4	-42.0	-108.0	-109.5

[back to top]

Change From Baseline in Acquired Immune Deficiency Syndrome (AIDS) Clinical Trials Group (ACTG) Symptom Distress Module (SDM) Bother Score at Week 4, Week 24, and Week 48

SDM is a 20-item self-reported measure that addresses the presence and perceived distress linked to symptoms commonly associated with HIV or its treatment. Each item is rated from 0 to 4 where 0 (complete absence of symptom) and 4 (very bothersome symptom). Overall score calculated as the sum of the scores for each of the 20 items of the questionnaire and ranged from 0 (best health) and 80 (worst health). Values represented are for adjusted mean. Estimates are calculated from an ANCOVA model adjusting for age, sex, race, baseline viral load, background dual NRTI therapy and baseline symptom bother score. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. A positive change from Baseline indicates a decline in a participant's quality of life over that period. (NCT01449929)
Timeframe: Baseline, Week 4, Week 24, and Week 48

Intervention	Scores on a scale (Mean)
	Week 4, n=218, 210	Week 24, n=222, 214	Week 48, n= 222, 215
DRV 800 mg + RTV 100 mg QD	-2.19	-1.65	-0.77
DTG 50 mg QD	-3.20	-2.71	-2.46

[back to top]

Time to Virologic Suppression (<50 Copies/mL) Through Week 48

The time to viral suppression (i.e. first viral load value <50 copies/mL) through Week 48 was derived and summarized using Kaplan-Meier plots. Participants who withdrew for any reason without having suppressed prior to the analysis were censored. Confidence intervals were estimated using the Brookmeyer-Crowley method. (NCT01449929)
Timeframe: From Baseline through Week 48

Intervention	Days (Median)
DTG 50 mg QD	28.0
DRV 800 mg + RTV 100 mg QD	85.0

[back to top]

Change From Baseline in Fasting Low-density Lipoprotein (LDL) Cholesterol Through Week 48

Fasting LDL cholesterol change from Baseline was analyzed. Values represented are for adjusted means. Estimates are calculated from a repeated measures model including the following covariates: treatment, visit, Baseline plasma HIV-1 RNA, background dual NRTI therapy, Baseline LDL cholesterol, treatment*visit interaction and Baseline LDL cholesterol*visit interaction. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. Only those participants with data available at the specified time points were analyzed. (NCT01449929)
Timeframe: From Baseline through Week 48

Intervention	Millimoles per liter (mmol/L) (Mean)
DTG 50 mg QD	0.07
DRV 800 mg + RTV 100 mg QD	0.37

[back to top]

Number of Participants With the Indicated Grade 3 and Grade 4 Maximum Post-Baseline Chemistry and Hematology Laboratory Toxicities

Hematology and clinical chemistry data were summarized according to the division of AIDS (DAIDS) table for grading the Severity of adverse events, version 1.0. Grade 1, Mild; Grade 2, Moderate; Grade 3 (G3), Severe; Grade 4 (G4), Life-threatening or disabling; Grade 5, Death. Data are presented for only those parameters for which an increase to Grade 3 or Grade 4 occurred. (NCT01449929)
Timeframe: From Baseline through Week 48

Intervention	Participants (Number)
	Alanine Amino Transferase, G3	Alanine Amino Transferase, G4	Aspartate Amino Transferase, G3	Aspartate Amino Transferase, G4	Cholesterol, G3	Creatine Kinase, G3	Creatine Kinase, G4	Hyperglycaemia, G3	Hypoglycaemia, G3	LDL Cholesterol, G3	Lipase, G3	Lipase, G4	Phosphorus, inorganic, G3	Total Bilirubin, G3	Triglycerides, G3	Triglycerides, G4	Hemoglobin, G3	Hemoglobin, G4	Platelet count, G4	Total Neutrophils, G3	Total Neutrophils, G4
DRV 800 mg + RTV 100 mg QD	1	3	3	0	3	5	4	2	1	6	5	0	7	0	2	1	0	0	1	0	1
DTG 50 mg QD	2	1	6	2	0	8	8	1	0	2	5	2	7	1	1	0	1	1	0	5	3

[back to top]

Human Immunodeficiency Virus Treatment Satisfaction Questionnaire (HIVTSQ) Total Score at Week 4, Week 24, and Week 48

Participant treatment satisfaction was measured using the self-reported scale (HIVTSQ), which consists of 10 items (1-satisfaction, 2-HIV control, 3-adverse effects, 4-level of demand, 5-convenience, 6-flexibility, 7-knowledge, 8-life habits, 9-recommendability, and 10-willingness to continue). Items are scored from 0 (very dissatisfied) to 6 (very satisfied), other than item 4, which has an inverted score from 6 (very demanding) to 0 (very undemanding). The treatment satisfaction score (range: 0-60) was the sum of the individual items. HIVTSQ mITT-E Population=Only participants from USA, France, Germany, Italy, Spain for whom valid translations were available from the mITT-E Population. Only those participants available at the specified time points were analyzed (represented by n=X, X in the category titles). Different participants may have been analyzed for different visits, so the overall number of participants analyzed reflects everyone in the HIVTSQ mITT-E population. (NCT01449929)
Timeframe: Week 4, Week 24, and Week 48

Intervention	Scores on a scale (Mean)
	Week 4, n=206, 192	Week 24, n= 211, 200	Week 48, n=212, 201
DRV 800 mg + RTV 100 mg QD	52.4	54.3	54.5
DTG 50 mg QD	54.1	56.1	56.1

[back to top]

The Ratio of Total and Unbound DTG Concentrations Between Cerebrospinal Fluid (CSF) and Plasma at Week 2 and Week 16

Cerebrospinal fluid (CSF) is a clear, colorless bodily fluid produced in the choroid plexus of the brain. The CFS samples were collected at the Week 2 and Week 16 visits, within 1 hour of plasma pharmacokinetic (PK) sampling. The ratio (presented as a percentage) of CSF DTG concentration over paired plasma total DTG concentration (RCSF_plasma) was calculated at the Week 2 and Week 16 visits. (NCT01499199)
Timeframe: Week 2 and Week 16

Intervention	percentage (Median)
	Week 2, n=11	Week 16, n=12
Dolutegravir 50 mg OD	0.516	0.412

[back to top]

The Numbers of Participants (Par.) With Clinical Adverse Events or Laboratory Abnormalities

An AE is any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product. An SAE is any untoward medical occurrence that, at any dose, results in death, is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, is a congenital anomaly/birth defect, or is an event of possible drug-induced liver injury. Refer to the general Adverse AE/SAE module for a complete list of AEs/SAEs. Any abnormal laboratory test result (hematology, clinical chemistry, or urinalysis) or other safety assessments (e.g., electrocardiograms [ECGs], radiological scans, vital sign measurements), including those that worsen from Baseline, and were felt to be clinically significant in the medical and scientific judgment of the investigator, were recorded as AEs or SAEs. Clinically suspected cases of hypersensitivity to ABC were also SAEs. (NCT01499199)
Timeframe: Baseline (BL) through the date the last participant completed Week (W) 96 + the follow-up visit (if applicable)

Intervention	participants (Number)
	Any AE	Clinical chemistry toxicities	Hematology toxicities	Abnormal ECG (clinically significant)
Dolutegravir 50 mg OD	13	12	3	0

[back to top]

Plasma DTG Unbound Fraction at Week 2 and Week 16

The unbound fraction of DTG in plasma (presented as a percentage of unbound [i.e., free DTG not bound to cellular proteins] DTG plasma concentration over paired plasma total DTG concentration) was calculated at the Week 2 and Week 16 visits. (NCT01499199)
Timeframe: Week 2 and Week 16

Intervention	Percentage (Median)
	Week 2	Week 16
Dolutegravir 50 mg OD	0.488	0.701

[back to top]

Pearson Correlation Between CSF DTG Concentration and Absolute Values and Change From Baseline (CFB) in CSF HIV-1 RNA at Week 2, Week 16, and Overall

The Pearson Correlation Coefficient is a measure of the correlation between CSF DTG concentrations and absolute values/changes from Baseline in CSF HIV-1 RNA at Week 2 and Week 16. CSF HIV-1 RNA is measured as log10 copies per milliliter (copies/mL). (NCT01499199)
Timeframe: From Baseline to Week 16

Intervention	Pearson Correlation Coefficient (Mean)
	Week 2, Absolute Log10 CSF HIV-1 RNA, n=11	Week 2, CFB Log10 CSF HIV-1, n=11	Week 16, Absolute Log10 CSF HIV-1 RNA, n=11	Week 16, CFB Log10 CSF HIV-1, n=11	Overall, Absolute Log10 CSF HIV-1 RNA, n=11	Overall, CFB Log10 CSF HIV-1, n=11
Dolutegravir 50 mg OD	0.567	0.007	-0.775	-0.354	0.517	0.106

[back to top]

Number of Participants With Treatment-emergent Genotypic and Phenotypic Resistance to DTG and Other Antiretroviral Therapy (ART)

The number of participants with treatment-emergent genotypic and phenotypic resistance to integrase inhibitors (INIs), nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transctiptase inhibitors (NNRTIs), and protease inhibitors (PIs) was assessed. (NCT01499199)
Timeframe: Baseline through the date the last participant completed Week 96

Intervention	participants (Number)
	Treatment-emergent genotypic resistance	Treatment-emergent phenotypic resistance
Dolutegravir 50 mg OD	0	0

[back to top]

Number of Participants With the Indicated Number of Copies of HIV-1 RNA in Both the CSF and Plasma at Baseline, Week 2, and Week 16

The relationship between HIV-1 RNA suppression in plasma and the CSF was measured as a comparison and as a change in the number of participants in the cross tabulation of <50 copies/mL in plasma, <50 copies/mL in CSF, >=50 copies/mL in plasma, and >=50 copies/mL in CSF at Baseline, Week 2, and Week 16. (NCT01499199)
Timeframe: Baseline, Week 2, and Week 16

Intervention	participants (Number)
	Baseline, CSF<50 c/mL, Plasma<50 c/mL, n=13	Baseline, CSF<50 c/mL, Plasma>=50 c/mL, n=13	Baseline, CSF>=50 c/mL, Plasma<50 c/mL, n=13	Baseline, CSF>=50 c/mL, Plasma>=50 c/mL, n=13	Week 2, CSF<50 c/mL, Plasma<50 c/mL, n=12	Week 2, CSF<50 c/mL, Plasma>=50 c/mL, n=12	Week 2, CSF>=50 c/mL, Plasma<50 c/mL, n=12	Week 2, CSF>=50 c/mL, Plasma>=50 c/mL, n=12	Week 16, CSF<50 c/mL, Plasma<50 c/mL, n=11	Week 16, CSF<50 c/mL, Plasma>=50 c/mL, n=11	Week 16, CSF>=50 c/mL, Plasma<50 c/mL, n=11	Week 16, CSF>=50 c/mL, Plasma>=50 c/mL, n=11
Dolutegravir 50 mg OD	0	1	0	12	4	3	0	5	9	2	0	0

[back to top]

Number of Participants With Post-Baseline HIV-1-associated Conditions, Including Recurrences

The number of participants who reported a new or recurrent Centers for Disease Control and Prevention (CDC) Class B or Class C condition was assessed from Baseline though the date the last participant completed Week 96 + the follow-up visit (if applicable). Category (CAT) A: one or more of the following conditions (CON), without any CON listed in Categories B and C: asymptomatic HIV infection, persistent generalized lymphadenopathy, acute (primary) HIV infection with accompanying illness or history of acute HIV infection. CAT B: symptomatic CON that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or that are considered by physicians to have a clinical course or to require management that is complicated by HIV infection; and not included among CON listed in clinical CAT C. CAT C: the clinical CON listed in the AIDS surveillance case definition. (NCT01499199)
Timeframe: Baseline through the date the last participant completed Week 96 + follow-up visit (if applicable)

Intervention	participants (Number)
	New CDC Category B event	Recurring CDC Category B event	New CDC Category C event	Recurring CDC Category C event
Dolutegravir 50 mg OD	0	0	0	0

[back to top]

Number of Participants With CSF HIV-1 RNA <50 Copies/Milliliter (c/mL) at Baseline, Week 2, and Week 16

The antiviral activity of dolutegravir in CSF over time was measured as the number of participants with HIV-1 RNA <50 copies/milliliter (c/mL). (NCT01499199)
Timeframe: Baseline, Week 2, and Week 16

Intervention	participants (Number)
	Baseline, n=13	Week 2, n=12	Week 16, n=11
Dolutegravir 50 mg OD	1	7	11

[back to top]

DTG Concentrations in CSF at Weeks 2 and Week 16

CSF is a clear, colorless bodily fluid produced in the choroid plexus of the brain. The CFS samples were collected at the Week 2 and Week 16 visits, within 1 hour of plasma PK sampling. DTG concentration in CSF were calculated at the Week 2 and Week 16 visits. (NCT01499199)
Timeframe: Week 2 and Week 16

Intervention	Nanograms per milliliter (ng/mL) (Median)
	Week 2, n=11	Week 16, n=12
Dolutegravir 50 mg OD	18.2	13.2

[back to top]

Absolute Values and Change From Baseline in Plasma Human Immunodeficiency Virus (HIV-1) Ribonucleic Acid (RNA) Levels at Weeks 2, 4, 8, 12, 16, 24, 36, 48, 60, 72, 84, and 96

The plasma samples were collected at the Week 2, Week 4, Week 8, Week 12, Week 16, Week 24, Week 36, Week 48, Week 60, Week 72, Week 84, and Week 96 visits. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT01499199)
Timeframe: Baseline; Weeks 2, 4, 8, 12, 16, 24, 36, 48, 60, 72, 84, and 96

Intervention	log10 copies/mL (Median)
	Absolute value, Baseline, n=13	Absolute value, Week 2, n=12	Change from Baseline, Week 2, n=12	Absolute value, Week 4, n=12	Change from Baseline, Week 4, n=12	Absolute Value, Week 8, n=12	Change from Baseline, Week 8, n=12	Absolute value, Week 12, n=12	Change from Baseline, Week 12, n=12	Absolute value, Week 16, n=12	Change from Baseline, Week 16, n=12	Absolute Value, Week 24, n=12	Change from Baseline, Week 24, n=12	Absolute value, Week 36, n=11	Change from Baseline, Week 36, n=11	Absolute value, Week 48, n=11	Change from Baseline, Week 48, n=11	Absolute value, Week 60, n=11	Change from Baseline, Week 60, n=11	Absolute value, Week 72, n=11	Change from Baseline, Week 72, n=11	Absolute value, Week 84, n=11	Change from Baseline, Week 84, n=11	Absolute value, Week 96, n=11	Change from Baseline, Week 96, n=11
Dolutegravir 50 mg OD	4.73	2.05	-2.53	1.67	-3.04	1.59	-3.10	1.59	-3.04	1.59	-3.04	1.59	-3.11	1.59	-3.08	1.59	-3.00	1.59	-3.00	1.59	-3.08	1.59	-3.08	1.59	-3.08

[back to top]

Absolute Values and Change From Baseline in CSF HIV-1 RNA Levels at Week 2 and Week 16

The antiviral activity of dolutegravir in CSF over time was measured as absolute values and change from Baseline in HIV-1 RNA levels in CSF at Week 2 and Week 16. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT01499199)
Timeframe: Baseline, Week 2, and Week 16

Intervention	log10 c/mL (Median)
	Absolute value, Baseline, n=13	Absolute value, Week 2, n=12	Change from Baseline, Week 2, n=12	Absolute value, Week 16, n=11	Change from Baseline, Week 16, n=11
Dolutegravir 50 mg OD	3.64	0.98	-2.19	0.00	-3.42

[back to top]

Absolute Values and Change From Baseline in Cluster of Differentiation 8+ (CD8+) Cell Counts at Weeks 4, 12, 16, 24, 48, and 96

The absolute value for CD48+ cell count (cells per millimeters cubed [mm^3]) was assessed at Baseline, Week 4, Week 12, Week 16, Week 24, Week 48, and Week 96. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT01499199)
Timeframe: Baseline; Weeks 4, 12, 16, 24, 48, and 96

Intervention	cells/mm^3 (Median)
	Absolute CD8+ cell count, Baseline, n=13	Absolute CD8+ cell count, Week 4, n=12	Absolute CD8+ cell count, Week 12, n=12	Absolute CD8+ cell count, Week 16, n=12	Absolute CD8+ cell count, Week 24, n=11	Absolute CD8+ cell count, Week 48, n=11	Absolute CD8+ cell count, Week 96, n=11	Change from Baseline CD8+ cell count, Week 4, n=12	Change from Baseline CD8+ cell count,Week 12, n=11	Change from Baseline CD8+ cell count,Week 16, n=11	Change from Baseline CD8+ cell count,Week 24, n=11	Change from Baseline CD8+ cell count,Week 48, n=11	Change from Baseline CD8+ cell count,Week 96, n=11
Dolutegravir 50 mg OD	757	874	865	706	876	708	842	104	-53	-35	235	106	85

[back to top]

Absolute Values and Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Counts at Weeks 4, 8, 12, 16, 24, 36, 48, 60, 72, 84, and 96

The absolute value for CD4+ cell count (cells per millimeters cubed [mm^3]) was assessed at Baseline, Week 4, Week 8, Week 12, Week 16, Week 24, Week 36, Week 48, Week 60, Week 72, Week 84, and Week 96. Change from Baseline was calculated as the post-Baseline value minus the Baseline value. (NCT01499199)
Timeframe: Baseline; Weeks 4, 8, 12, 16, 24, 36, 48, 60, 72, 84, and 96

Intervention	cells/mm^3 (Median)
	Absolute CD4+ cell count, Baseline, n=13	Absolute CD4+ cell count, Week 4, n=12	Absolute CD4+ cell count, Week 8, n=12	Absolute CD4+ cell count, Week 12, n=12	Absolute CD4+ cell count, Week 16, n=12	Absolute CD4+ cell count, Week 24, n=12	Absolute CD4+ cell count, Week (Wk) 36, n=11	Absolute CD4+ cell count, Week 48, n=11	Absolute CD4+ cell count, Week 60, n=11	Absolute CD4+ cell count, Week 72, n=11	Absolute CD4+ cell count, Week 84, n=11	Absolute CD4+ cell count, Week 96, n=11	Change from Baseline CD4+ cell count, Week 4, n=12	Change from Baseline CD4+ cell count, Week 8, n=12	Change from Baseline CD4+ cell count, Wk 12, n=12	Change from Baseline CD4+ cell count, Wk 16, n=12	Change from Baseline CD4+ cell count, Wk 24, n=12	Change from Baseline CD4+ cell count, Wk 36, n=11	Change from Baseline CD4+ cell count, Wk 48, n=11	Change from Baseline CD4+ cell count, Wk 60, n=11	Change from Baseline CD4+ cell count, Wk 72, n=11	Change from Baseline CD4+ cell count, Wk 84, n=11	Change from Baseline CD4+ cell count, Wk 96, n=11
Dolutegravir 50 mg OD	260	578	645	589	573	634	706	666	702	823	907	843	162	247	263	226	264	480	311	382	519	543	467

[back to top]

Unbound DTG Plasma Concentrations at Week 2 and Week 16

Unbound (free, not bound to cellular proteins) plasma DTG concentrations were calculated at the Week 2 and Week 16 visits. (NCT01499199)
Timeframe: Week 2 and Week 16

Intervention	Nanograms per milliliter (ng/mL) (Median)
	Week 2	Week 16
Dolutegravir 50 mg OD	17.1	23.9

[back to top]

Total DTG Plasma Concentrations at Week 2 and Week 16

Total plasma DTG concentrations were calculated at the Week 2 and Week 16 visits. (NCT01499199)
Timeframe: Week 2 and Week 16

Intervention	Micrograms per milliliter (µg/mL) (Median)
	Week 2	Week 16
Dolutegravir 50 mg OD	3.36	3.21

[back to top]

Number of Participants With Plasma HIV-1 RNA <50 Copies Per Milliliter (c/mL) at Baseline and Weeks 2, 4, 8, 12, and 16

HIV-1 RNA response in plasma was measured as the number of participants with HIV-1 RNA less than 50 c/mL at Baseline, Week 2, Week 4, Week 8, Week 12, and Week 16. (NCT01499199)
Timeframe: Baseline; Weeks 2, 4, 8, 12, and 16

Intervention	participants (Number)
	Baseline	Week 2	Week 4	Week 8	Week 12	Week 16
Dolutegravir 50 mg OD	0	4	6	8	10	10

[back to top]

Change From Baseline in Cholesterol, Chloride, Carbon Dioxide (CO2)/Bicarbonate (HCO3), Glucose, High Density Lipoprotein Cholesterol, Potassium, Low Density Lipoprotein (LDL) Cholesterol, Sodium, Phosphorus, Triglycerides and Urea/Blood Urea Nitrogen

Blood samples were collected for the analysis of clinical chemistry parameters such as cholesterol, chloride, CO2/HCO3, glucose, high density lipoprotein (HDL) cholesterol, potassium, LDL cholesterol, sodium, phosphorus inorganic, triglycerides and urea/blood urea nitrogen (BUN). Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Millimoles per liter (Mean)
	Cholesterol; Baseline; n=8, 10	Cholesterol; Week 12; n=6, 8	Cholesterol; Week 24; n=6, 10	Cholesterol; Week 48; n=3, 7	Cholesterol; Week 60; n=2, 5	Cholesterol; Week 72; n=0, 1	Chloride; Baseline; n=14, 16	Chloride; Day 8; n=13, 15	Chloride; Day 28; n=13, 16	Chloride; Week 8; n=11, 16	Chloride; Week 12; n=12, 14	Chloride; Week 16; n=10, 16	Chloride; Week 24; n=11, 15	Chloride; Week 32; n=11, 14	Chloride; Week 40; n=8, 12	Chloride; Week 48; n=8, 13	Chloride; Week 60; n=5, 12	Chloride; Week 72; n=3, 4	Chloride; Week 84; n=0, 1	CO2/HCO3; Baseline; n=14, 16	CO2/HCO3; Day 8; n=13, 15	CO2/HCO3; Day 28; n=13, 16	CO2/HCO3; Week 8; n=11, 16	CO2/HCO3; Week 12; n=12, 14	CO2/HCO3; Week 16; n=10, 16	CO2/HCO3; Week 24; n=11, 15	CO2/HCO3; Week 32; n=11, 14	CO2/HCO3; Week 40; n=8, 12	CO2/HCO3; Week 48; n=8, 13	CO2/HCO3; Week 60; n=5, 12	CO2/HCO3; Week 72; n=3, 4	CO2/HCO3; Week 84; n=0, 1	Glucose; Baseline; n=12, 16	Glucose; Week 12; n=11, 14	Glucose; Week 24; n=10, 15	Glucose; Week 48; n=7, 13	Glucose; Week 60; n=3, 12	Glucose; Week 72; n=2, 4	HDL Cholesterol; Baseline; n=8, 10	HDL Cholesterol; Week 12; n=6, 8	HDL Cholesterol; Week 24; n=6, 10	HDL Cholesterol; Week 48; n=3, 7	HDL Cholesterol; Week 60; n=2, 5	HDL Cholesterol; Week 72; n=0, 1	Potassium; Baseline; n=14, 16	Potassium; Day 8; n=13, 15	Potassium; Day 28; n=13, 16	Potassium; Week 8; n=11, 16	Potassium; Week 12; n=12, 14	Potassium; Week 16; n=10, 16	Potassium; Week 24; n=11, 15	Potassium; Week 32; n=11, 14	Potassium; Week 40; n=8, 12	Potassium; Week 48; n=8, 13	Potassium; Week 60; n=5, 12	Potassium; Week 72; n=3, 4	Potassium; Week 84; n=0, 1	LDL Cholesterol; Baseline; n=8, 9	LDL Cholesterol; Week 12; n=6, 8	LDL Cholesterol; Week 24; n=6, 9	LDL Cholesterol; Week 48; n=3, 6	LDL Cholesterol; Week 60; n=2, 4	LDL Cholesterol; Week 72; n=0, 1	Sodium; Baseline; n=14, 16	Sodium; Day 8; n=13, 15	Sodium; Day 28; n=13, 16	Sodium; Week 8; n=11, 16	Sodium; Week 12; n=12, 14	Sodium; Week 16; n=10, 16	Sodium; Week 24; n=11, 15	Sodium; Week 32; n=11, 14	Sodium; Week 40; n=8, 12	Sodium; Week 48; n=8, 13	Sodium; Week 60; n=5, 12	Sodium; Week 72; n=3, 4	Sodium; Week 84; n=0, 1	Phosphorus, inorganic; Baseline; n=14, 16	Phosphorus, inorganic; Day 8; n=13, 15	Phosphorus, inorganic; Day 28; n=13, 16	Phosphorus, inorganic; Week 8; n=11, 16	Phosphorus, inorganic; Week 12; n=12, 14	Phosphorus, inorganic; Week 16; n=10, 16	Phosphorus, inorganic; Week 24; n=11, 15	Phosphorus, inorganic; Week 32; n=11, 14	Phosphorus, inorganic; Week 40; n=8, 12	Phosphorus, inorganic; Week 48; n=8, 13	Phosphorus, inorganic; Week 60; n=5, 12	Phosphorus, inorganic; Week 72; n=3, 4	Phosphorus, inorganic; Week 84; n=0, 1	Triglycerides; Baseline; n=8, 10	Triglycerides; Week 12; n=6, 8	Triglycerides; Week 24; n=6, 10	Triglycerides; Week 48; n=3, 7	Triglycerides; Week 60; n=2, 5	Triglycerides; Week 72; n=0, 1	Urea/BUN; Baseline; n=14, 16	Urea/BUN; Day 8; n=13, 15	Urea/BUN; Day 28; n=13, 16	Urea/BUN; Week 8; n=11, 16	Urea/BUN; Week 12; n=12, 14	Urea/BUN; Week 16; n=10, 16	Urea/BUN; Week 24; n=11, 15	Urea/BUN; Week 32; n=11, 14	Urea/BUN; Week 40; n=8, 12	Urea/BUN; Week 48; n=8, 13	Urea/BUN; Week 60; n=5, 12	Urea/BUN; Week 72; n=3, 4	Urea/BUN; Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	4.725	0.538	0.585	0.421	-0.020	1.350	105.4	0.4	-0.5	-1.8	0.1	-1.0	-1.2	0.0	1.3	-0.1	1.1	1.0	-2.0	20.8	0.1	1.1	1.6	1.9	1.8	1.5	0.8	-0.2	1.7	0.3	-0.3	4.0	5.56	0.04	-0.08	0.40	-0.18	0.20	1.090	0.156	0.130	0.136	0.010	0.350	4.13	-0.01	0.14	0.19	0.06	-0.08	0.27	0.27	0.12	0.28	0.03	0.02	0.20	2.591	0.500	0.596	0.322	-0.008	1.110	138.5	-0.1	-0.4	-0.4	0.4	0.2	-0.1	0.1	0.5	0.9	0.7	0.3	0.0	1.128	-0.123	-0.075	-0.075	-0.054	-0.053	-0.023	-0.050	-0.046	-0.031	-0.042	0.013	0.100	2.336	-0.260	-0.458	-0.486	-0.580	-0.240	5.72	-0.43	-0.13	-0.59	-0.50	-1.00	-0.27	0.57	0.29	0.88	0.54	0.50	0.00

[back to top]

Change From Baseline in Basophils, Eosinophils, Lymphocytes, Monocytes, Total Neutrophils, Platelet and White Blood Cell (WBC) Count

Blood samples were collected for the analysis of hematology parameters such as basophils, eosinophils. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Giga cells per liter (Mean)
	Basophils; Baseline; n=14, 16	Basophils; Day 8; n=14, 15	Basophils; Day 28; n=13, 16	Basophils; Week 8; n=11, 16	Basophils; Week 12; n=12, 14	Basophils; Week 16; n=12, 16	Basophils; Week 24; n=11, 15	Basophils; Week 32; n=11, 13	Basophils; Week 40; n=8, 12	Basophils; Week 48; n=8, 13	Basophils; Week 60; n=5, 12	Basophils; Week 72; n=3, 4	Basophils; Week 84; n=0, 1	Eosinophils; Baseline; n=14, 16	Eosinophils; Day 8; n=14, 15	Eosinophils; Day 28; n=13, 16	Eosinophils; Week 8; n=11, 16	Eosinophils; Week 12; n=12, 14	Eosinophils; Week 16; n=12, 16	Eosinophils; Week 24; n=11, 15	Eosinophils; Week 32; n=11, 13	Eosinophils; Week 40; n=8, 12	Eosinophils; Week 48; n=8, 13	Eosinophils; Week 60; n=5, 12	Eosinophils; Week 72; n=3, 4	Eosinophils; Week 84; n=0, 1	Lymphocytes; Baseline; n=14, 16	Lymphocytes; Day 8; n=14, 15	Lymphocytes; Day 28; n=13, 16	Lymphocytes; Week 8; n=11, 16	Lymphocytes; Week 12; n=12, 14	Lymphocytes; Week 16; n=12, 16	Lymphocytes; Week 24; n=11, 15	Lymphocytes; Week 32; n=11, 13	Lymphocytes; Week 40; n=8, 12	Lymphocytes; Week 48; n=8, 13	Lymphocytes; Week 60; n=5, 12	Lymphocytes; Week 72; n=3, 4	Lymphocytes; Week 84; n=0, 1	Monocytes; Baseline; n=14, 16	Monocytes; Day 8; n=14, 15	Monocytes; Day 28; n=13, 16	Monocytes; Week 8; n=11, 16	Monocytes; Week 12; n=12, 14	Monocytes; Week 16; n=12, 16	Monocytes; Week 24; n=11, 15	Monocytes; Week 32; n=11, 13	Monocytes; Week 40; n=8, 12	Monocytes; Week 48; n=8, 13	Monocytes; Week 60; n=5, 12	Monocytes; Week 72; n=3, 4	Monocytes; Week 84; n=0, 1	Total neutrophils; Baseline; n=14, 16	Total neutrophils; Day 8; n=14, 15	Total neutrophils; Day 28; n=13, 16	Total neutrophils; Week 8; n=11, 16	Total neutrophils; Week 12; n=12, 14	Total neutrophils; Week 16; n=12, 16	Total neutrophils; Week 24; n=11, 15	Total neutrophils; Week 32; n=11, 13	Total neutrophils; Week 40; n=8, 12	Total neutrophils; Week 48; n=8, 13	Total neutrophils; Week 60; n=5, 12	Total neutrophils; Week 72; n=3, 4	Total neutrophils; Week 84; n=0, 1	Platelet; Baseline; n=14, 16	Platelet; Day 8; n=14, 15	Platelet; Day 28; n=13, 16	Platelet; Week 8; n=11, 16	Platelet; Week 12; n=12, 14	Platelet; Week 16; n=12, 16	Platelet; Week 24; n=11, 15	Platelet; Week 32; n=11, 13	Platelet; Week 40; n=8, 12	Platelet; Week 48; n=8, 13	Platelet; Week 60; n=5, 12	Platelet; Week 72; n=3, 4	Platelet; Week 84; n=0, 1	WBC; Baseline; n=14, 16	WBC; Day 8; n=14, 15	WBC; Day 28; n=13, 16	WBC; Week 8; n=11, 16	WBC; Week 12; n=12, 14	WBC; Week 16; n=12, 16	WBC; Week 24; n=11, 15	WBC; Week 32; n=11, 13	WBC; Week 40; n=8, 12	WBC; Week 48; n=8, 13	WBC; Week 60; n=5, 12	WBC; Week 72; n=3, 4	WBC; Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0.015	0.002	0.004	0.004	0.000	0.005	0.007	0.005	0.003	0.008	0.004	0.008	0.010	0.158	0.005	0.033	0.090	0.240	0.141	0.159	0.075	0.011	0.122	0.098	0.053	0.240	1.418	0.040	0.297	0.536	0.525	0.594	0.647	0.818	0.519	0.563	0.663	0.623	0.640	0.306	0.027	0.031	0.037	0.065	0.089	0.017	0.017	0.011	0.018	-0.003	0.055	-0.230	1.869	0.072	0.659	0.344	0.357	1.030	0.746	0.875	0.390	0.986	1.507	2.363	2.060	176.9	16.5	30.8	29.1	39.2	52.6	58.7	55.6	44.9	53.5	51.5	64.0	88.0	3.78	0.15	1.03	1.02	1.19	1.86	1.59	1.78	0.93	1.70	2.25	3.10	2.70

[back to top]

Change From Baseline in Basophils, Eosinophils, Lymphocytes, Monocytes, Total Neutrophils, Platelet and White Blood Cell (WBC) Count

Intervention	Giga cells per liter (Mean)
	Basophils; Baseline; n=14, 16	Basophils; Day 8; n=14, 15	Basophils; Day 28; n=13, 16	Basophils; Week 8; n=11, 16	Basophils; Week 12; n=12, 14	Basophils; Week 16; n=12, 16	Basophils; Week 24; n=11, 15	Basophils; Week 32; n=11, 13	Basophils; Week 40; n=8, 12	Basophils; Week 48; n=8, 13	Basophils; Week 60; n=5, 12	Basophils; Week 72; n=3, 4	Eosinophils; Baseline; n=14, 16	Eosinophils; Day 8; n=14, 15	Eosinophils; Day 28; n=13, 16	Eosinophils; Week 8; n=11, 16	Eosinophils; Week 12; n=12, 14	Eosinophils; Week 16; n=12, 16	Eosinophils; Week 24; n=11, 15	Eosinophils; Week 32; n=11, 13	Eosinophils; Week 40; n=8, 12	Eosinophils; Week 48; n=8, 13	Eosinophils; Week 60; n=5, 12	Eosinophils; Week 72; n=3, 4	Lymphocytes; Baseline; n=14, 16	Lymphocytes; Day 8; n=14, 15	Lymphocytes; Day 28; n=13, 16	Lymphocytes; Week 8; n=11, 16	Lymphocytes; Week 12; n=12, 14	Lymphocytes; Week 16; n=12, 16	Lymphocytes; Week 24; n=11, 15	Lymphocytes; Week 32; n=11, 13	Lymphocytes; Week 40; n=8, 12	Lymphocytes; Week 48; n=8, 13	Lymphocytes; Week 60; n=5, 12	Lymphocytes; Week 72; n=3, 4	Monocytes; Baseline; n=14, 16	Monocytes; Day 8; n=14, 15	Monocytes; Day 28; n=13, 16	Monocytes; Week 8; n=11, 16	Monocytes; Week 12; n=12, 14	Monocytes; Week 16; n=12, 16	Monocytes; Week 24; n=11, 15	Monocytes; Week 32; n=11, 13	Monocytes; Week 40; n=8, 12	Monocytes; Week 48; n=8, 13	Monocytes; Week 60; n=5, 12	Monocytes; Week 72; n=3, 4	Total neutrophils; Baseline; n=14, 16	Total neutrophils; Day 8; n=14, 15	Total neutrophils; Day 28; n=13, 16	Total neutrophils; Week 8; n=11, 16	Total neutrophils; Week 12; n=12, 14	Total neutrophils; Week 16; n=12, 16	Total neutrophils; Week 24; n=11, 15	Total neutrophils; Week 32; n=11, 13	Total neutrophils; Week 40; n=8, 12	Total neutrophils; Week 48; n=8, 13	Total neutrophils; Week 60; n=5, 12	Total neutrophils; Week 72; n=3, 4	Platelet; Baseline; n=14, 16	Platelet; Day 8; n=14, 15	Platelet; Day 28; n=13, 16	Platelet; Week 8; n=11, 16	Platelet; Week 12; n=12, 14	Platelet; Week 16; n=12, 16	Platelet; Week 24; n=11, 15	Platelet; Week 32; n=11, 13	Platelet; Week 40; n=8, 12	Platelet; Week 48; n=8, 13	Platelet; Week 60; n=5, 12	Platelet; Week 72; n=3, 4	WBC; Baseline; n=14, 16	WBC; Day 8; n=14, 15	WBC; Day 28; n=13, 16	WBC; Week 8; n=11, 16	WBC; Week 12; n=12, 14	WBC; Week 16; n=12, 16	WBC; Week 24; n=11, 15	WBC; Week 32; n=11, 13	WBC; Week 40; n=8, 12	WBC; Week 48; n=8, 13	WBC; Week 60; n=5, 12	WBC; Week 72; n=3, 4
DTG 50 mg BID	0.016	0.006	0.005	-0.001	-0.001	-0.002	0.001	0.002	-0.000	0.006	-0.002	-0.003	0.087	0.016	0.023	0.041	0.023	0.024	-0.003	0.016	-0.015	-0.028	-0.038	-0.043	1.656	0.165	0.132	0.490	0.417	0.554	0.271	0.173	0.169	0.474	0.526	0.673	0.367	0.003	-0.042	-0.022	-0.053	-0.027	-0.067	-0.059	-0.030	-0.050	-0.088	0.003	2.327	0.090	0.196	0.480	0.022	0.780	-0.128	0.213	0.224	0.144	0.162	0.783	173.0	21.6	33.9	57.8	36.5	35.7	33.5	12.1	25.6	24.6	43.0	34.3	4.44	0.29	0.33	1.00	0.42	1.36	0.09	0.35	0.36	0.56	0.58	1.43

[back to top]

Change From Baseline in Alkaline Phosphatase (ALP), Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST) and Creatine Kinase

Blood samples were collected for the analysis of clinical chemistry parameters such as ALP, ALT, AST and creatine kinase. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	International units per liter (Mean)
	ALP; Baseline; n=14, 16	ALP; Day 8; n=13, 15	ALP; Day 28; n=13, 16	ALP; Week 8; n=11, 16	ALP; Week 12; n=12, 14	ALP; Week 16; n=10, 16	ALP; Week 24; n=11, 15	ALP; Week 32; n=11, 14	ALP; Week 40; n=8, 12	ALP; Week 48; n=8, 13	ALP; Week 60; n=5, 12	ALP; Week 72; n=3, 4	ALP; Week 84; n=0, 1	ALT; Baseline; n=14, 16	ALT; Day 8; n=13, 15	ALT; Day 28; n=13, 16	ALT; Week 8; n=11, 16	ALT; Week 12; n=12, 14	ALT; Week 16; n=10, 16	ALT; Week 24; n=11, 15	ALT; Week 32; n=11, 14	ALT; Week 40; n=8, 12	ALT; Week 48; n=8, 13	ALT; Week 60; n=5, 12	ALT; Week 72; n=3, 4	ALT; Week 84; n=0, 1	AST; Baseline; n=14, 16	AST; Day 8; n=13, 15	AST; Day 28; n=13, 16	AST; Week 8; n=11, 16	AST; Week 12; n=12, 14	AST; Week 16; n=10, 16	AST; Week 24; n=11, 15	AST; Week 32; n=11, 14	AST; Week 40; n=8, 12	AST; Week 48; n=8, 13	AST; Week 60; n=5, 12	AST; Week 72; n=3, 4	AST; Week 84; n=0, 1	Creatine Kinase; Baseline; n=14, 16	Creatine Kinase; Day 8; n=13, 15	Creatine Kinase; Day 28; n=13, 16	Creatine Kinase; Week 8; n=11, 16	Creatine Kinase; Week 12; n=12, 14	Creatine Kinase; Week 16; n=10, 16	Creatine Kinase; Week 24; n=11, 15	Creatine Kinase; Week 32; n=11, 14	Creatine Kinase; Week 40; n=8, 12	Creatine Kinase; Week 48; n=8, 13	Creatine Kinase; Week 60; n=5, 12	Creatine Kinase; Week 72; n=3, 4	Creatine Kinase; Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	114.9	-1.2	-0.6	20.6	-0.3	8.2	3.3	20.5	7.8	13.8	12.8	15.3	22.0	37.4	-3.8	-5.3	-9.2	-8.7	-10.1	-14.5	-10.6	-7.7	-9.2	-8.3	-29.3	-3.0	34.9	-2.0	-2.3	-6.3	-5.1	-6.6	-10.1	-7.4	-4.1	-5.4	-5.9	-13.8	-8.0	130.3	-1.5	37.0	-7.3	0.4	80.5	-6.0	23.4	66.3	16.1	18.8	-29.0	-134.0

[back to top]

Change From Baseline in Alkaline Phosphatase (ALP), Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST) and Creatine Kinase

Intervention	International units per liter (Mean)
	ALP; Baseline; n=14, 16	ALP; Day 8; n=13, 15	ALP; Day 28; n=13, 16	ALP; Week 8; n=11, 16	ALP; Week 12; n=12, 14	ALP; Week 16; n=10, 16	ALP; Week 24; n=11, 15	ALP; Week 32; n=11, 14	ALP; Week 40; n=8, 12	ALP; Week 48; n=8, 13	ALP; Week 60; n=5, 12	ALP; Week 72; n=3, 4	ALT; Baseline; n=14, 16	ALT; Day 8; n=13, 15	ALT; Day 28; n=13, 16	ALT; Week 8; n=11, 16	ALT; Week 12; n=12, 14	ALT; Week 16; n=10, 16	ALT; Week 24; n=11, 15	ALT; Week 32; n=11, 14	ALT; Week 40; n=8, 12	ALT; Week 48; n=8, 13	ALT; Week 60; n=5, 12	ALT; Week 72; n=3, 4	AST; Baseline; n=14, 16	AST; Day 8; n=13, 15	AST; Day 28; n=13, 16	AST; Week 8; n=11, 16	AST; Week 12; n=12, 14	AST; Week 16; n=10, 16	AST; Week 24; n=11, 15	AST; Week 32; n=11, 14	AST; Week 40; n=8, 12	AST; Week 48; n=8, 13	AST; Week 60; n=5, 12	AST; Week 72; n=3, 4	Creatine Kinase; Baseline; n=14, 16	Creatine Kinase; Day 8; n=13, 15	Creatine Kinase; Day 28; n=13, 16	Creatine Kinase; Week 8; n=11, 16	Creatine Kinase; Week 12; n=12, 14	Creatine Kinase; Week 16; n=10, 16	Creatine Kinase; Week 24; n=11, 15	Creatine Kinase; Week 32; n=11, 14	Creatine Kinase; Week 40; n=8, 12	Creatine Kinase; Week 48; n=8, 13	Creatine Kinase; Week 60; n=5, 12	Creatine Kinase; Week 72; n=3, 4
DTG 50 mg BID	91.9	1.9	-6.1	1.6	-0.8	3.1	1.7	6.9	2.3	28.0	6.0	-5.0	24.9	0.0	0.4	1.2	-5.4	-5.2	3.1	0.9	-1.6	7.9	0.8	8.7	28.9	1.0	-4.0	-2.9	-4.8	-4.0	1.7	-1.7	-4.9	9.0	-3.2	1.3	162.4	-2.1	-35.6	-16.4	-18.8	34.2	-24.4	2.3	-50.0	7.8	-12.2	35.0

[back to top]

Change From Baseline in Albumin Level

Blood samples were collected for the analysis of clinical chemistry parameters such as albumin. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT01568892)
Timeframe: Baseline, Week 24 and 48

Intervention	grams per liter (Mean)
	Albumin; Baseline; n=14, 16	Albumin; Week 24; n=11, 15	Albumin; Week 48; n=8, 13
DTG 50 mg BID	43.1	0.0	1.3
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	43.4	0.0	-0.8

[back to top]

Absolute Values in Plasma HIV-1 RNA Over Time

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1), Day 8, Day 28, Week 8, Week 12, Week 16, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, and Week 84. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84

Intervention	Log10 c/mL (Mean)
	Baseline, n=14, 16	Day 8, n=14, 16	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=7, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4	Week 84, n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	4.42	4.39	2.30	2.10	2.27	2.18	1.88	1.81	1.68	1.62	1.67	1.62	1.59

[back to top]

Absolute Values in Plasma HIV-1 RNA Over Time

Intervention	Log10 c/mL (Mean)
	Baseline, n=14, 16	Day 8, n=14, 16	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=7, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4
DTG 50 mg BID	4.02	2.95	2.14	2.35	2.51	2.57	2.65	2.72	2.35	2.47	2.15	2.35

[back to top]

Absolute Values in Cluster of Differentiation 8+ (CD8+) Cell Counts Over Time

Blood samples were collected for lymphocyte subset assessment by flow cytometry at Baseline; Day 28; and Weeks 12, 24, and 48. (NCT01568892)
Timeframe: Baseline; Day 28; Weeks 12, 24, and 48

Intervention	Cells per cubic millimeter (Median)
	Baseline, n=14, 16	Day 28, n=13, 16	Week 12, n=11, 14	Week 24, n=11, 15	Week 48, n=6, 12
DTG 50 mg BID	896.0	1135.0	1198.0	1160.0	1295.0
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	808.5	973.0	1184.0	1323.0	1147.0

[back to top]

Absolute Values in Cluster of Differentiation 4+ (CD4+) Cell Counts Over Time

Blood samples were collected for lymphocyte subset assessment by flow cytometry at Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84

Intervention	Cells per cubic millimeters (Median)
	Baseline, n=14, 16	Day 8, n=14, 15	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=8, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4	Week 84, n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	90.5	102.0	234.0	228.0	217.5	262.5	242.0	326.0	328.0	370.0	333.0	299.5	368.0

[back to top]

Absolute Values in Cluster of Differentiation 4+ (CD4+) Cell Counts Over Time

Intervention	Cells per cubic millimeters (Median)
	Baseline, n=14, 16	Day 8, n=14, 15	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=8, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4
DTG 50 mg BID	163.5	198.5	174.0	211.0	223.5	241.0	232.0	213.0	299.5	328.0	321.0	321.0

[back to top]

Number of Participants With Clinically Significant Electrocardiogram (ECG) Findings

Twelve lead ECG was performed using an automated ECG machine. The number of participants with abnormal-clinically significant ECG findings at any time on-treatment is reported. (NCT01568892)
Timeframe: Up to Week 24

Intervention	Participants (Count of Participants)
DTG 50 mg BID	1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	1

[back to top]

Mean Change From Baseline in Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) at Day 8

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1) and Day 8. Change from Baseline was calculated as the value at Day 8 minus the value at Baseline (Day 1). The analysis was performed using statistical modeling correcting for Baseline plasma HIV-1 RNA, Baseline Dolutegravir (DTG) fold change (FC), the overall susceptibility score (OSS) of the failing regimen, and the interaction between DTG FC and treatment. Means and differences were calculated using the average Baseline DTG FC of the entire Intent-to-Treat Exposed (ITT-E) Population. The last observation carried forward with discontinuation equals Baseline (LOCFDB) dataset was used for the analysis. For the LOCFDB dataset, missing values were carried forward from the previous, non-missing, available on-treatment assessment, except formissing values due to premature withdrawal or Day 8 missing values, which had the Baseline value imputed. (NCT01568892)
Timeframe: Baseline and Day 8

Intervention	Log 10 copies per milliliter (c/mL) (Least Squares Mean)
DTG 50 mg BID	-1.06
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0.10

[back to top]

Cmax of DTG

The maximal concentration (Cmax) of DTG was assessed by a population PK modeling approach using pooled DTG PK data from multiple studies. Blood samples for the determination of plasma DTG concentration were collected at the following time points: pre-dose and 1-3 hours post-dose on Day 8; pre-dose and within a post-dose window (1-3 hours or 4-12 hours) on Day 28 and Week 24. For Day 8 PK, only samples collected from participants randomized to the active DTG arm were analyzed. (NCT01568892)
Timeframe: Day 8, Day 28, and Week 24

Intervention	Micrograms per milliliter (µg/mL) (Geometric Mean)
Overall Study Arm	4.14

[back to top]

AUC(0-tau) of DTG

The area under the time concentration curve over the dosing interval (AUC[0-tau]) of DTG was assessed by a population pharmacokinetic (PK) modeling approach using pooled DTG PK data from multiple studies. Blood samples for the determination of plasma DTG concentration were collected at the following time points: pre-dose and 1-3 hours post-dose on Day 8; pre-dose and within a post-dose window (1-3 hours or 4-12 hours) on Day 28 and Week 24. For Day 8 PK, only samples collected from participants randomized to the active DTG arm were analyzed. (NCT01568892)
Timeframe: Day 8, Day 28, and Week 24

Intervention	µghour per mL (µghr/mL) (Geometric Mean)
Overall Study Arm	37.9

[back to top]

Plasma DTG Pre-dose Concentration (C0) at Day 8, Day 28, and Week 24; and Average DTG C0 (C0 Avg) at Week 24

Blood samples for the determination of plasma DTG pre-dose concentration were collected pre-dose on Day 8, Day 28, and Week 24. For Day 8 PK, only samples collected from participants randomized to the active DTG arm were analyzed. C0 Avg was calculated at Week 24 as the mean of the concentration at Day 8, Day 28, and Week 24. (NCT01568892)
Timeframe: Day 8, Day 28, and Week 24

Intervention	µg/mL (Geometric Mean)
	Day 8 C0, n=10, 0	Day 28 C0, n=11, 16	Week 24 C0, n=10, 14	C0_avg, n=13, 16
DTG 50 mg BID	3.043	1.393	1.864	1.820

[back to top]

Plasma DTG Pre-dose Concentration (C0) at Day 8, Day 28, and Week 24; and Average DTG C0 (C0 Avg) at Week 24

Intervention	µg/mL (Geometric Mean)
	Day 28 C0, n=11, 16	Week 24 C0, n=10, 14	C0_avg, n=13, 16
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	2.154	2.201	2.307

[back to top]

Number of Participants With the Maximum Post-Baseline-emergent Hematology Toxicities of the Indicated Grade

Participants with post-Baseline-emergent hematology toxicities were analyzed. Hematology toxicities were graded for severity according to the DAIDS toxicity scales as: Grade 1 (mild), Grade 2 (moderate), Grade 3 (severe), or Grade 4 (potentially life threatening). (NCT01568892)
Timeframe: From the first dose of study medication until early withdrawal or through the Week 48 analysis data cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
	Grade 1	Grade 2	Grade 3	Grade 4
DTG 50 mg BID	2	2	0	0
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	3	5	1	0

[back to top]

Number of Participants With the Maximum Post-Baseline-emergent Clinical Chemistry Toxicities of the Indicated Grade

Participants with post-Baseline-emergent clinical chemistry toxicities were analyzed. Clinical chemistry toxicities were graded for severity according to the DAIDS toxicity scales as: Grade 1 (mild), Grade 2 (moderate), Grade 3 (severe), or Grade 4 (potentially life threatening). (NCT01568892)
Timeframe: From the first dose of study medication until early withdrawal or through the Week 48 analysis data cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
	Grade 1	Grade 2	Grade 3	Grade 4
DTG 50 mg BID	5	5	0	0
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	4	5	4	1

[back to top]

Number of Participants With the Indicated Type of HIV-1 Disease Progression (Acquired Immunodeficiency Syndrome [AIDS] or Death [DT])

The number of participants with HIV-1 disease progression (AIDS or death) was assessed per the Centers for Disease Control and Prevention (CDC) 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. The CDC classifies HIV infection as Category A (participants with asymptomatic HIV infection, acute HIV infection with accompanying illness, or persistent generalized lymphadenopathy), Category B (participants with symptomatic non-AIDS condition, i.e., conditions that are attributed to HIV infection or are indicative of a defect in cell-mediated immunity; or conditions are considered by physicians to have a clinical course or to require management that is complicated by HIV infection), and Category C (includes AIDS indicator conditions as defined by diagnostic or presumptive measures). (NCT01568892)
Timeframe: From the day of the first dose of study drug until early withdrawal or the Week 48 analysis cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
	From CDC Class A to CDC Class C	From CDC Class B to CDC Class C	From CDC Class C to new CDC Class C	From CDC Class A, B, or C to Death
DTG 50 mg BID	0	0	0	2
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0	0	0	0

[back to top]

Number of Participants With the Indicated Treatment-emergent Integrase (IN) Mutations Detected at the Time of Defined Virologic Failure (PDVF), as a Measure of Genotypic Resistance

For participants meeting one of the criteria for PDVF, plasma samples collected at the time point of virologic failure were tested to evaluate any potential genotypic and/or phenotypic evolution of resistance. PDVF was defined as (A) Virologic Non-response: a decrease in plasma HIV-1 RNA of <1 log10 copies/mL by Day 28, with subsequent confirmation, unless plasma HIV-1 RNA is <400 copies/mL; confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24 or (B) Virologic Rebound: confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL; confirmed plasma HIV-1 RNA levels >1 log10 copies/mL above the nadir value, where nadir is >=400 copies/mL.Treatment-emergent IN mutations are those detected at the time of PDVF but not at Baseline. (NCT01568892)
Timeframe: From the first dose of study medication until early withdrawal or through the Week 48 analysis data cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
	Any integrase mutation	L74L/M	T97A	E138E/K	E138K	S147G	N155N/H
DTG 50 mg BID	4	1	2	1	1	1	1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	1	0	1	0	0	0	0

[back to top]

Number of Participants With the Indicated Fold Increase in Fold Change (FC) in the 50% Inhibitory Concentration Relative to Wild-type Virus for DTG (i.e. PDVF FC/Baseline FC Ratio) at the Time of PDVF, as a Measure of Phenotypic Resistance

For participants meeting one of the criteria for PDVF, plasma samples collected at the time point of virologic failure were tested to evaluate any potential genotypic and/or phenotypic evolution of resistance. The FC in IC50 (50% inhibitory concentration) for DTG relative to wild-type virus was determined for virus isolated at Baseline and at the time of PDVF. The number of participants with the indicated change (ratio) in the two values at the time of PDVF is presented. PDVF was defined as (A) Virologic Non-response: a decrease in plasma HIV-1 RNA of <1 log10 copies/mL by Day 28, with subsequent confirmation, unless plasma HIV-1 RNA is <400 copies/mL; confirmed plasma HIV-1 RNA levels >=400 copies/mL on or after Week 24 or (B) Virologic Rebound: confirmed rebound in plasma HIV-1 RNA levels to >=400 copies/mL after prior confirmed suppression to <400 copies/mL; confirmed plasma HIV-1 RNA levels >1 log10 copies/mL above the nadir value, where nadir is >=400 copies/mL. (NCT01568892)
Timeframe: From the first dose of study medication until early withdrawal or through the Week 48 analysis data cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
	4-<8 fold increase in DTG FC	>=8 fold increase in DTG FC
DTG 50 mg BID	0	4
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	1	0

[back to top]

Number of Participants With Plasma HIV-1 RNA <50 c/mL Over Time

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1); Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, and 48. Number of participants with plasma HIV-1 RNA level <50 c/mL was obtained using Food and Drug Administration's (FDA's) snapshot algorithm, where all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) were treated as non-responders. Also, participants who switched their concomitant antiretroviral therapy (ART) prior to the visit of interest as follows were also treated as non-responders: background ART substitutions not permitted per protocol; background ART substitutions permitted per protocol; however, the decision to switch is not documented as being before or at the first On-treatment visit after switching to optimized background regimen (OBR) (i.e. Day 28) where HIV-1 RNA is assessed. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40 and 48

Intervention	Participants (Count of Participants)
	Baseline	Day 8	Day 28	Week 8	Week 12	Week 16	Week 24	Week 32	Week 40	Week 48
DTG 50 mg BID	0	1	6	5	6	5	6	4	4	3
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0	0	6	9	8	8	8	9	7	9

[back to top]

Number of Participants With Plasma HIV-1 RNA <400 c/mL Over Time

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1); Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40 and 48. Number of participants with plasma HIV-1 RNA level <400 c/mL was obtained using FDA's snapshot algorithm, where all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) were treated as non-responders. Also, participants who switch their concomitant ART prior to the visit of interest as follows were also treated as non-responders: background ART substitutions not permitted per protocol; background ART substitutions permitted per protocol; however the decision to switch is not documented as being before or at the first On-treatment visit after switching to OBR (i.e. Day 28) where HIV-1 RNA is assessed. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40 and 48

Intervention	Participants (Count of Participants)
	Baseline	Day 8	Day 28	Week 8	Week 12	Week 16	Week 24	Week 32	Week 40	Week 48
DTG 50 mg BID	2	4	9	7	7	7	6	6	5	6
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0	0	12	13	10	12	11	10	10	10

[back to top]

Number of Participants With Any Adverse Event (Serious and Non-serious) of the Indicated Grade

An adverse event (AE) is defined as any untoward medical occurrence in a participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. A serious adverse event (SAE) is defined as any untoward medical occurrence that, at any dose: results in death; is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity; or is a congenital anomaly/birth defect. Medical or scientific judgment should be exercised in other situations. Adverse events were graded for severity according to the Division of AIDS (DAIDS) toxicity scales as: Grade 1 (mild), Grade 2 (moderate), Grade 3 (severe), or Grade 4 (potentially life threatening). (NCT01568892)
Timeframe: From the first dose of study medication until early withdrawal or through the Week 48 analysis data cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
	Grade 1	Grade 2	Grade 3	Grade 4
DTG 50 mg BID	0	7	2	2
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	4	6	3	1

[back to top]

Median Change From Baseline in CD8+ Cell Counts Over Time

Blood samples were collected for lymphocyte subset assessment by flow cytometry at Baseline; Day 28; and Weeks 12, 24, and 48. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT01568892)
Timeframe: Baseline; Day 28; Weeks 12, 24, and 48

Intervention	Cells per cubic millimeter (Median)
	Baseline, n=14, 16	Day 28, n=13, 16	Week 12, n=11, 14	Week 24, n=11, 15	Week 48, n=6, 12
DTG 50 mg BID	896.0	227.0	151.0	79.0	88.0
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	808.5	177.0	288.0	543.0	124.0

[back to top]

Median Change From Baseline in CD4+ Cell Counts Over Time

Blood samples were collected for lymphocyte subset assessment by flow cytometry at Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84

Intervention	Cells per cubic millimeters (Median)
	Baseline, n=14, 16	Day 8, n=14, 15	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=8, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4	Week 84, n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	90.5	0.0	68.5	87.5	79.0	70.0	117.0	135.5	125.5	156.0	146.0	174.0	269.0

[back to top]

Median Change From Baseline in CD4+ Cell Counts Over Time

Intervention	Cells per cubic millimeters (Median)
	Baseline, n=14, 16	Day 8, n=14, 15	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=8, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4
DTG 50 mg BID	163.5	7.0	14.0	34.0	49.0	76.5	39.0	48.0	90.5	115.0	170.0	163.0

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA Over Time

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1), Day 8, Day 28, Week 8, Week 12, Week 16, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, and Week 84. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84

Intervention	Log10 c/mL (Mean)
	Baseline, n=14, 16	Day 8, n=14, 16	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=7, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4	Week 84, n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	4.42	-0.03	-2.12	-2.32	-2.02	-2.24	-2.53	-2.62	-2.70	-2.77	-2.71	-3.31	-3.75

[back to top]

Mean Change From Baseline in Plasma HIV-1 RNA Over Time

Plasma samples were collected for quantitative HIV-1 RNA analysis at Baseline (Day 1), Day 8, Day 28, Week 8, Week 12, Week 16, Week 24, Week 32, Week 40, Week 48, Week 60, Week 72, and Week 84. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline; Day 8; Day 28; Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72, and 84

Intervention	Log10 c/mL (Mean)
	Baseline, n=14, 16	Day 8, n=14, 16	Day 28, n=13, 16	Week 8, n=11, 16	Week 12, n=12, 14	Week 16, n=12, 16	Week 24, n=11, 15	Week 32, n=11, 14	Week 40, n=7, 12	Week 48, n=8, 13	Week 60, n=5, 12	Week 72, n=3, 4
DTG 50 mg BID	4.02	-1.07	-1.87	-1.89	-1.54	-1.48	-1.38	-1.31	-1.48	-1.34	-1.91	-2.08

[back to top]

Change From Baseline in Total Bilirubin (T. Bil) and Creatinine Levels

Blood samples were collected for the analysis of clinical chemistry parameters such as T. Bil and creatinine. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Micromoles per liter (Mean)
	T. Bil.; Baseline; n=14, 16	T. Bil.; Day 8; n=13, 15	T. Bil.; Day 28; n=13, 16	T. Bil.; Week 8; n=11, 16	T. Bil.; Week 12; n=12, 14	T. Bil.; Week 16; n=10, 16	T. Bil.; Week 24; n=11, 15	T. Bil.; Week 32; n=11, 14	T. Bil.; Week 40; n=8, 12	T. Bil.; Week 48; n=8, 13	T. Bil.; Week 60; n=5, 12	T. Bil.; Week 72; n=3, 4	T. Bil.; Week 84; n=0, 1	Creatinine; Baseline; n=14, 16	Creatinine; Day 8; n=13, 15	Creatinine; Day 28; n=13, 16	Creatinine; Week 8; n=11, 16	Creatinine; Week 12; n=12, 14	Creatinine; Week 16; n=10, 16	Creatinine; Week 24; n=11, 15	Creatinine; Week 32; n=11, 14	Creatinine; Week 40; n=8, 12	Creatinine; Week 48; n=8, 13	Creatinine; Week 60; n=5, 12	Creatinine; Week 72; n=3, 4	Creatinine; Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	7.5	-1.1	2.1	3.1	-0.6	1.9	2.1	2.3	3.3	3.2	2.3	9.5	2.0	88.96	0.11	13.58	15.79	9.85	7.68	13.31	15.96	12.94	12.85	11.72	13.25	1.80

[back to top]

Change From Baseline in Total Bilirubin (T. Bil) and Creatinine Levels

Intervention	Micromoles per liter (Mean)
	T. Bil.; Baseline; n=14, 16	T. Bil.; Day 8; n=13, 15	T. Bil.; Day 28; n=13, 16	T. Bil.; Week 8; n=11, 16	T. Bil.; Week 12; n=12, 14	T. Bil.; Week 16; n=10, 16	T. Bil.; Week 24; n=11, 15	T. Bil.; Week 32; n=11, 14	T. Bil.; Week 40; n=8, 12	T. Bil.; Week 48; n=8, 13	T. Bil.; Week 60; n=5, 12	T. Bil.; Week 72; n=3, 4	Creatinine; Baseline; n=14, 16	Creatinine; Day 8; n=13, 15	Creatinine; Day 28; n=13, 16	Creatinine; Week 8; n=11, 16	Creatinine; Week 12; n=12, 14	Creatinine; Week 16; n=10, 16	Creatinine; Week 24; n=11, 15	Creatinine; Week 32; n=11, 14	Creatinine; Week 40; n=8, 12	Creatinine; Week 48; n=8, 13	Creatinine; Week 60; n=5, 12	Creatinine; Week 72; n=3, 4
DTG 50 mg BID	10.0	0.8	-0.2	0.0	0.5	0.6	0.2	-0.4	0.0	-0.8	-2.4	-1.3	86.94	10.96	12.72	12.15	6.86	8.22	1.63	0.98	3.58	4.21	4.96	0.93

[back to top]

Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP)

Vital signs including SBP and DBP were measured at Baseline, Week 24 and Week 48. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT01568892)
Timeframe: Baseline and Weeks 24 and 48

Intervention	millimeters of mercury (Mean)
	SBP; Baseline; n=14, 16	SBP; Week 24; n=11, 15	SBP; Week 48; n=6, 12	DBP; Baseline; n=14, 16	DBP; Week 24; n=11, 15	DBP; Week 48; n=6, 12
DTG 50 mg BID	120.4	2.0	-0.7	78.9	-0.5	-1.2
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	113.4	2.8	3.1	75.1	-1.2	-3.2

[back to top]

Change From Baseline in Red Blood Cell Count

Blood samples were collected for the analysis of hematology parameters such as RBC. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Trillion cells per liter (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12, 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4	Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	4.09	-0.04	-0.06	0.12	0.15	0.13	0.18	0.18	0.09	0.15	0.28	0.25	-0.60

[back to top]

Change From Baseline in Red Blood Cell Count

Intervention	Trillion cells per liter (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12, 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4
DTG 50 mg BID	4.09	0.00	-0.08	-0.14	-0.05	-0.03	0.02	-0.04	-0.08	-0.00	-0.06	-0.20

[back to top]

Change From Baseline in Mean Corpuscle Volume

Blood samples were collected for the analysis of hematology parameters such as mean corpuscle volume. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Femtoliter (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12, 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4	Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	97.8	0.3	0.3	-0.3	-1.5	-2.2	-2.0	-2.4	-0.7	-1.0	-1.2	2.3	18.0

[back to top]

Change From Baseline in Mean Corpuscle Volume

Intervention	Femtoliter (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12, 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4
DTG 50 mg BID	99.1	0.1	1.2	0.3	1.1	0.3	-0.3	-1.0	2.5	2.0	1.4	0.3

[back to top]

Change From Baseline in Lipase Levels

Blood samples were collected for the analysis of clinical chemistry parameters such as lipase level. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Units per liter (Mean)
	Lipase; Baseline; n=14, 16	Lipase; Day 8; n=14, 15	Lipase; Day 28; n=13, 16	Lipase; Week 8; n=11, 16	Lipase; Week 12; n=11, 14	Lipase; Week 16; n=10, 16	Lipase; Week 24; n=11, 15	Lipase; Week 32; n=11, 14	Lipase; Week 40; n=8, 12	Lipase; Week 48; n=8, 13	Lipase; Week 60; n=5, 12	Lipase; Week 72; n=3, 4	Lipase; Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	34.0	12.5	17.7	13.6	3.0	-0.8	10.5	20.6	5.6	3.4	5.9	41.0	-9.0

[back to top]

Change From Baseline in Lipase Levels

Intervention	Units per liter (Mean)
	Lipase; Baseline; n=14, 16	Lipase; Day 8; n=14, 15	Lipase; Day 28; n=13, 16	Lipase; Week 8; n=11, 16	Lipase; Week 12; n=11, 14	Lipase; Week 16; n=10, 16	Lipase; Week 24; n=11, 15	Lipase; Week 32; n=11, 14	Lipase; Week 40; n=8, 12	Lipase; Week 48; n=8, 13	Lipase; Week 60; n=5, 12	Lipase; Week 72; n=3, 4
DTG 50 mg BID	29.1	3.4	3.3	2.6	-2.4	7.6	-2.7	0.8	0.6	3.8	5.0	16.0

[back to top]

Change From Baseline in Hemoglobin Level

Blood samples were collected for the analysis of hematology parameters such as hemoglobin. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Grams per liter (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4	Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	129.9	-1.3	-0.9	2.6	2.1	1.9	1.5	1.5	0.7	0.5	5.0	7.0	-6.0

[back to top]

Change From Baseline in Hemoglobin Level

Intervention	Grams per liter (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4
DTG 50 mg BID	132.9	-1.0	-2.5	-4.5	-1.0	0.0	-0.6	-2.4	-0.9	0.0	-1.8	-4.3

[back to top]

Change From Baseline in Hematocrit Level

Blood samples were collected for the analysis of hematology parameters such as hematocrit level. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. NA indicates data was not available. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Weeks 8, 12, 16, 24, 32, 40, 48, 60, 72 and 84

Intervention	Proportion of red blood cells in blood (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12, 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4	Week 84; n=0, 1
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0.3974	-0.0049	-0.0043	0.0092	0.0054	0.0021	0.0062	0.0062	0.0063	0.0078	0.0200	0.0248	-0.0090

[back to top]

Change From Baseline in Hematocrit Level

Intervention	Proportion of red blood cells in blood (Mean)
	Baseline; n=14, 16	Day 8; n=14, 15	Day 28; n=13, 16	Week 8; n=11, 16	Week 12; n=12, 14	Week 16; n=12, 16	Week 24; n=11, 15	Week 32; n=11, 13	Week 40; n=8, 12	Week 48; n=8, 13	Week 60; n=5, 12	Week 72; n=3, 4
DTG 50 mg BID	0.4024	-0.0015	-0.0066	-0.0105	-0.0027	-0.0033	-0.0025	-0.0081	-0.0005	0.0065	-0.0024	-0.0170

[back to top]

Change From Baseline in Heart Rate

Vital signs including heart rate was measured at Baseline, Week 24 and Week 48. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT01568892)
Timeframe: Baseline and Weeks 24 and 48

Intervention	beats per minute (Mean)
	Baseline; n=14, 16	Week 24; n=11, 15	Week 48; 6, 12
DTG 50 mg BID	72.5	-1.4	2.2
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	75.9	0.7	-2.5

[back to top]

Change From Baseline in Creatinine Clearance

Creatinine clearance was calculated using Cockcroft-Gault formula. Baseline was defined as the last pre-treatment value. Change from Baseline was calculated as the post-Baseline value minus the value at Baseline. (NCT01568892)
Timeframe: Baseline, Day 8, Day 28, Week 8, Week 16, Week 24, Week 32 and Week 48

Intervention	Milliliters per minute (Mean)
	Baseline; n=14, 16	Day 8; n=1, 0	Day 28; n=13, 16	Week 16; n=10, 15	Week 24; n=11, 15	Week 32; n=9, 14	Week 48; n=6, 12
DTG 50 mg BID	106.8	-13.0	-10.5	-7.3	-2.3	-1.4	-6.8

[back to top]

Change From Baseline in Creatinine Clearance

Intervention	Milliliters per minute (Mean)
	Baseline; n=14, 16	Day 28; n=13, 16	Week 8; n=0, 1	Week 16; n=10, 15	Week 24; n=11, 15	Week 32; n=9, 14	Week 48; n=6, 12
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	104.8	-10.4	-12.0	-12.5	-13.9	-16.0	-16.5

[back to top]

Change From Baseline in Cholesterol, Chloride, Carbon Dioxide (CO2)/Bicarbonate (HCO3), Glucose, High Density Lipoprotein Cholesterol, Potassium, Low Density Lipoprotein (LDL) Cholesterol, Sodium, Phosphorus, Triglycerides and Urea/Blood Urea Nitrogen

Intervention	Millimoles per liter (Mean)
	Cholesterol; Baseline; n=8, 10	Cholesterol; Week 12; n=6, 8	Cholesterol; Week 24; n=6, 10	Cholesterol; Week 48; n=3, 7	Cholesterol; Week 60; n=2, 5	Chloride; Baseline; n=14, 16	Chloride; Day 8; n=13, 15	Chloride; Day 28; n=13, 16	Chloride; Week 8; n=11, 16	Chloride; Week 12; n=12, 14	Chloride; Week 16; n=10, 16	Chloride; Week 24; n=11, 15	Chloride; Week 32; n=11, 14	Chloride; Week 40; n=8, 12	Chloride; Week 48; n=8, 13	Chloride; Week 60; n=5, 12	Chloride; Week 72; n=3, 4	CO2/HCO3; Baseline; n=14, 16	CO2/HCO3; Day 8; n=13, 15	CO2/HCO3; Day 28; n=13, 16	CO2/HCO3; Week 8; n=11, 16	CO2/HCO3; Week 12; n=12, 14	CO2/HCO3; Week 16; n=10, 16	CO2/HCO3; Week 24; n=11, 15	CO2/HCO3; Week 32; n=11, 14	CO2/HCO3; Week 40; n=8, 12	CO2/HCO3; Week 48; n=8, 13	CO2/HCO3; Week 60; n=5, 12	CO2/HCO3; Week 72; n=3, 4	Glucose; Baseline; n=12, 16	Glucose; Week 12; n=11, 14	Glucose; Week 24; n=10, 15	Glucose; Week 48; n=7, 13	Glucose; Week 60; n=3, 12	Glucose; Week 72; n=2, 4	HDL Cholesterol; Baseline; n=8, 10	HDL Cholesterol; Week 12; n=6, 8	HDL Cholesterol; Week 24; n=6, 10	HDL Cholesterol; Week 48; n=3, 7	HDL Cholesterol; Week 60; n=2, 5	Potassium; Baseline; n=14, 16	Potassium; Day 8; n=13, 15	Potassium; Day 28; n=13, 16	Potassium; Week 8; n=11, 16	Potassium; Week 12; n=12, 14	Potassium; Week 16; n=10, 16	Potassium; Week 24; n=11, 15	Potassium; Week 32; n=11, 14	Potassium; Week 40; n=8, 12	Potassium; Week 48; n=8, 13	Potassium; Week 60; n=5, 12	Potassium; Week 72; n=3, 4	LDL Cholesterol; Baseline; n=8, 9	LDL Cholesterol; Week 12; n=6, 8	LDL Cholesterol; Week 24; n=6, 9	LDL Cholesterol; Week 48; n=3, 6	LDL Cholesterol; Week 60; n=2, 4	Sodium; Baseline; n=14, 16	Sodium; Day 8; n=13, 15	Sodium; Day 28; n=13, 16	Sodium; Week 8; n=11, 16	Sodium; Week 12; n=12, 14	Sodium; Week 16; n=10, 16	Sodium; Week 24; n=11, 15	Sodium; Week 32; n=11, 14	Sodium; Week 40; n=8, 12	Sodium; Week 48; n=8, 13	Sodium; Week 60; n=5, 12	Sodium; Week 72; n=3, 4	Phosphorus, inorganic; Baseline; n=14, 16	Phosphorus, inorganic; Day 8; n=13, 15	Phosphorus, inorganic; Day 28; n=13, 16	Phosphorus, inorganic; Week 8; n=11, 16	Phosphorus, inorganic; Week 12; n=12, 14	Phosphorus, inorganic; Week 16; n=10, 16	Phosphorus, inorganic; Week 24; n=11, 15	Phosphorus, inorganic; Week 32; n=11, 14	Phosphorus, inorganic; Week 40; n=8, 12	Phosphorus, inorganic; Week 48; n=8, 13	Phosphorus, inorganic; Week 60; n=5, 12	Phosphorus, inorganic; Week 72; n=3, 4	Triglycerides; Baseline; n=8, 10	Triglycerides; Week 12; n=6, 8	Triglycerides; Week 24; n=6, 10	Triglycerides; Week 48; n=3, 7	Triglycerides; Week 60; n=2, 5	Urea/BUN; Baseline; n=14, 16	Urea/BUN; Day 8; n=13, 15	Urea/BUN; Day 28; n=13, 16	Urea/BUN; Week 8; n=11, 16	Urea/BUN; Week 12; n=12, 14	Urea/BUN; Week 16; n=10, 16	Urea/BUN; Week 24; n=11, 15	Urea/BUN; Week 32; n=11, 14	Urea/BUN; Week 40; n=8, 12	Urea/BUN; Week 48; n=8, 13	Urea/BUN; Week 60; n=5, 12	Urea/BUN; Week 72; n=3, 4
DTG 50 mg BID	3.819	0.433	0.308	0.567	0.375	104.1	0.5	0.4	0.5	-0.8	1.4	0.9	1.1	0.5	1.5	2.0	2.0	22.5	0.2	0.4	1.2	1.7	-0.2	0.9	1.5	0.9	-0.4	0.8	2.0	4.84	-0.01	0.17	0.13	0.20	0.45	0.956	0.117	0.025	0.117	-0.025	4.16	-0.09	0.19	0.12	0.03	-0.06	0.17	-0.04	-0.01	0.15	0.06	0.37	2.218	0.293	0.032	0.330	0.125	138.8	0.2	-0.2	0.2	-0.5	1.3	0.5	0.8	1.0	0.9	2.4	1.3	1.018	0.012	0.065	0.018	0.033	0.080	-0.050	-0.036	0.000	0.025	0.020	0.017	1.410	0.047	0.547	0.260	0.590	5.64	0.04	-0.23	-0.09	0.25	-0.05	-0.09	-0.55	-0.19	0.38	0.30	0.50

[back to top]

Number of Participants Who Discontinued Study Treatment Due to AEs

The number of participants who permanently discontinued study treatment due to AEs is presented. (NCT01568892)
Timeframe: From the first dose of study medication until early withdrawal or through the Week 48 analysis data cut-off date (median of 55 study weeks)

Intervention	Participants (Count of Participants)
DTG 50 mg BID	2
Placebo BID in DB Phase; DTG 50 mg BID in Open-label Phase	0

[back to top]

Early Mortality

Proportion of deaths in each group (NCT01837277)
Timeframe: 6 months

Intervention	Participants (Count of Participants)
Dolutegravir	9
Efavirenz	13

[back to top]

Number of Participants With Adverse Events

Number of participants with adverse events (NCT01896921)
Timeframe: 96 weeks

Intervention	Participants (Count of Participants)
Maraviroc + Raltegravir or Dolutegravir	3

[back to top]

Number of Patients Virologically Suppressed (HIV RNA <50 Copies/ml) at 48 Weeks.

Number of patients virologically suppressed (HIV RNA <50 copies/ml) at 48 weeks. (NCT01896921)
Timeframe: 48 weeks

Intervention	Participants (Count of Participants)
Maraviroc + Raltegravir or Dolutegravir	5

[back to top]

Number of Patients Who Are Virologically Suppressed (HIV RNA < 50 Copies/ml)

Number of patients who are virologically suppressed (HIV RNA < 50 copies/ml) (NCT01896921)
Timeframe: 96 weeks

Intervention	Participants (Count of Participants)
Maraviroc + Raltegravir or Dolutegravir	4

[back to top]

Change From Baseline in Carbon Dioxide, Electrolytes, Lipids, Glucose, Urea at Indicated Time Points

Clinical chemistry parameters were assessed at Baseline (Day 1), Weeks 4, 12, 24, 36 and 48. Change from Baseline in carbon dioxide, electrolytes (chloride, hyperkalemia, hypernatremia, hypokalemia, hyponatremia, phosphate, potassium, sodium), lipids (cholesterol [CHLS], high density lipoprotein [HDL] CHLS direct, low density lipoprotein (LDL) CHLS calculation, LDL CHLS direct, triglycerides), glucose (hyperglycaemia, hypoglycaemia) and urea are summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. Laboratory parameters were assessed in Safety Population which comprised of all participants who received at least one dose of study treatment. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Millimoles per liter (Mean)
	Carbon Dioxide, Week 4, n= 244, 237	Carbon Dioxide, Week 12, n= 236, 226	Carbon Dioxide, Week 24, n= 224, 212	Carbon Dioxide, Week 36, n= 219, 204	Carbon Dioxide, Week 48, n= 208, 192	Chloride, Week 4, n= 245, 237	Chloride, Week 12, n= 236, 226	Chloride, Week 24, n= 225, 212	Chloride, Week 36, n= 219, 204	Chloride, Week 48, n= 208, 192	CHLS, Week 4, n= 1, 3	CHLS, Week 12, n= 224, 221	CHLS, Week 24, n= 218, 201	CHLS, Week 36, n= 205, 191	CHLS, Week 48, n= 195, 175	Glucose, Week 12, n= 226, 224	Glucose, Week 24, n= 219, 204	Glucose, Week 36, n= 211, 196	Glucose, Week 48, n= 197, 180	HDL CHLS, Direct, Week 4, n= 1, 3	HDL CHLS, Direct, Week 12, n= 224, 221	HDL CHLS, Direct, Week 24, n= 218, 201	HDL CHLS, Direct, Week 36, n= 205, 191	HDL CHLS, Direct, Week 48, n= 195, 175	Hyperglycaemia, Week 12, n= 226, 224	Hyperglycaemia, Week 24, n= 219, 204	Hyperglycaemia, Week 36, n= 211, 196	Hyperglycaemia, Week 48, n= 197, 180	Hyperkalemia, Week 4, n= 244, 237	Hyperkalemia, Week 12, n= 236, 226	Hyperkalemia, Week 24, n= 224, 212	Hyperkalemia, Week 36, n= 219, 204	Hyperkalemia, Week 48, n= 208, 192	Hypernatremia, Week 4, n= 245, 237	Hypernatremia, Week 12, n= 236, 226	Hypernatremia, Week 24, n= 225, 212	Hypernatremia, Week 36, n= 219, 204	Hypernatremia, Week 48, n= 208, 192	Hypoglycaemia, Week 12, n= 226, 224	Hypoglycaemia, Week 24, n= 219, 204	Hypoglycaemia, Week 36, n= 211, 196	Hypoglycaemia, Week 48, n= 197, 180	Hypokalemia, Week 4, n= 244, 237	Hypokalemia, Week 12, n= 236, 226	Hypokalemia, Week 24, n= 224, 212	Hypokalemia, Week 36, n= 219, 204	Hypokalemia, Week 48, n= 208, 192	Hyponatremia, Week 4, n= 245, 237	Hyponatremia, Week 12, n= 236, 226	Hyponatremia, Week 24, n= 225, 212	Hyponatremia, Week 36, n= 219, 204	Hyponatremia, Week 48, n= 208, 192	LDL CHLS Calculation, Week 4, n= 1, 3	LDL CHLS Calculation, Week 12, n= 221, 219	LDL CHLS Calculation, Week 24, n= 213, 201	LDL CHLS Calculation, Week 36, n= 201, 188	LDL CHLS Calculation, Week 48, n= 190, 175	LDL CHLS, Direct, Week 12, n= 0, 1	Phosphate, Week 4, n= 245, 237	Phosphate, Week 12, n= 236, 226	Phosphate, Week 24, n= 225, 212	Phosphate, Week 36, n= 219, 204	Phosphate, Week 48, n= 208, 192	Potassium, Week 4, n= 244, 237	Potassium, Week 12, n= 236, 226	Potassium, Week 24, n= 224, 212	Potassium, Week 36, n= 219, 204	Potassium, Week 48, n= 208, 192	Sodium, Week 4, n= 245, 237	Sodium, Week 12, n= 236, 226	Sodium, Week 24, n= 225, 212	Sodium, Week 36, n= 219, 204	Sodium, Week 48, n= 208, 192	Triglycerides, Week 4, n= 1, 3	Triglycerides, Week 12, n= 224, 221	Triglycerides, Week 24, n= 218, 201	Triglycerides, Week 36, n= 205, 191	Triglycerides, Week 48, n= 195, 175	Urea, Week 4, n= 245, 237	Urea, Week 12, n= 236, 226	Urea, Week 24, n= 225, 212	Urea, Week 36, n= 219, 204	Urea, Week 48, n= 208, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0.6	0.8	0.3	0.6	0.4	-0.5	0.2	-0.1	0	0	-0.017	-0.058	-0.001	0	0.109	0.22	0.26	0.34	0.24	0	0.005	0.053	0.036	0.081	0.22	0.26	0.34	0.24	0.12	0.1	0.06	0.13	0.04	-0.5	0.1	0.2	0.2	0.5	0.22	0.26	0.34	0.24	0.12	0.1	0.06	0.13	0.04	-0.5	0.1	0.2	0.2	0.5	-0.123	-0.14	-0.111	-0.099	-0.021	-0.44	-0.032	0.026	0.026	0.009	0	0.12	0.1	0.06	0.13	0.04	-0.5	0.1	0.2	0.2	0.5	0.237	0.167	0.125	0.157	0.107	0.1	0.16	0.12	-0.03	0.02

[back to top]

Change From Baseline in Carbon Dioxide, Electrolytes, Lipids, Glucose, Urea at Indicated Time Points

Intervention	Millimoles per liter (Mean)
	Carbon Dioxide, Week 4, n= 244, 237	Carbon Dioxide, Week 12, n= 236, 226	Carbon Dioxide, Week 24, n= 224, 212	Carbon Dioxide, Week 36, n= 219, 204	Carbon Dioxide, Week 48, n= 208, 192	Chloride, Week 4, n= 245, 237	Chloride, Week 12, n= 236, 226	Chloride, Week 24, n= 225, 212	Chloride, Week 36, n= 219, 204	Chloride, Week 48, n= 208, 192	CHLS, Week 4, n= 1, 3	CHLS, Week 12, n= 224, 221	CHLS, Week 24, n= 218, 201	CHLS, Week 36, n= 205, 191	CHLS, Week 48, n= 195, 175	Glucose, Week 12, n= 226, 224	Glucose, Week 24, n= 219, 204	Glucose, Week 36, n= 211, 196	Glucose, Week 48, n= 197, 180	HDL CHLS, Direct, Week 4, n= 1, 3	HDL CHLS, Direct, Week 12, n= 224, 221	HDL CHLS, Direct, Week 24, n= 218, 201	HDL CHLS, Direct, Week 36, n= 205, 191	HDL CHLS, Direct, Week 48, n= 195, 175	Hyperglycaemia, Week 12, n= 226, 224	Hyperglycaemia, Week 24, n= 219, 204	Hyperglycaemia, Week 36, n= 211, 196	Hyperglycaemia, Week 48, n= 197, 180	Hyperkalemia, Week 4, n= 244, 237	Hyperkalemia, Week 12, n= 236, 226	Hyperkalemia, Week 24, n= 224, 212	Hyperkalemia, Week 36, n= 219, 204	Hyperkalemia, Week 48, n= 208, 192	Hypernatremia, Week 4, n= 245, 237	Hypernatremia, Week 12, n= 236, 226	Hypernatremia, Week 24, n= 225, 212	Hypernatremia, Week 36, n= 219, 204	Hypernatremia, Week 48, n= 208, 192	Hypoglycaemia, Week 12, n= 226, 224	Hypoglycaemia, Week 24, n= 219, 204	Hypoglycaemia, Week 36, n= 211, 196	Hypoglycaemia, Week 48, n= 197, 180	Hypokalemia, Week 4, n= 244, 237	Hypokalemia, Week 12, n= 236, 226	Hypokalemia, Week 24, n= 224, 212	Hypokalemia, Week 36, n= 219, 204	Hypokalemia, Week 48, n= 208, 192	Hyponatremia, Week 4, n= 245, 237	Hyponatremia, Week 12, n= 236, 226	Hyponatremia, Week 24, n= 225, 212	Hyponatremia, Week 36, n= 219, 204	Hyponatremia, Week 48, n= 208, 192	LDL CHLS Calculation, Week 4, n= 1, 3	LDL CHLS Calculation, Week 12, n= 221, 219	LDL CHLS Calculation, Week 24, n= 213, 201	LDL CHLS Calculation, Week 36, n= 201, 188	LDL CHLS Calculation, Week 48, n= 190, 175	LDL CHLS, Direct, Week 24, n= 1, 0	LDL CHLS, Direct, Week 36, n= 1, 0	Phosphate, Week 4, n= 245, 237	Phosphate, Week 12, n= 236, 226	Phosphate, Week 24, n= 225, 212	Phosphate, Week 36, n= 219, 204	Phosphate, Week 48, n= 208, 192	Potassium, Week 4, n= 244, 237	Potassium, Week 12, n= 236, 226	Potassium, Week 24, n= 224, 212	Potassium, Week 36, n= 219, 204	Potassium, Week 48, n= 208, 192	Sodium, Week 4, n= 245, 237	Sodium, Week 12, n= 236, 226	Sodium, Week 24, n= 225, 212	Sodium, Week 36, n= 219, 204	Sodium, Week 48, n= 208, 192	Triglycerides, Week 4, n= 1, 3	Triglycerides, Week 12, n= 224, 221	Triglycerides, Week 24, n= 218, 201	Triglycerides, Week 36, n= 205, 191	Triglycerides, Week 48, n= 195, 175	Urea, Week 4, n= 245, 237	Urea, Week 12, n= 236, 226	Urea, Week 24, n= 225, 212	Urea, Week 36, n= 219, 204	Urea, Week 48, n= 208, 192
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-0.4	-0.2	-0.5	0	-0.6	0.6	1	0.7	0.9	0.7	-0.1	0.298	0.317	0.33	0.447	0.3	0.17	0.17	0.18	-0.1	0.182	0.201	0.204	0.231	0.3	0.17	0.17	0.18	-0.01	0.03	-0.04	0.03	-0.04	0	0.7	0.6	0.9	0.6	0.3	0.17	0.17	0.18	-0.01	0.03	-0.04	0.03	-0.04	0	0.7	0.6	0.9	0.6	0.08	0.125	0.111	0.112	0.213	-0.64	-0.23	0	0.02	0.021	0.029	0.016	-0.01	0.03	-0.04	0.03	-0.04	0	0.7	0.6	0.9	0.6	-0.18	-0.04	0.036	0.037	0.018	-0.04	0.08	0.03	0.08	0.1

[back to top]

Change From Baseline in CD4+ Cell Count at Indicated Timepoints-Continuation Phase

Change from Baseline in cluster of differentiation 4(CD4+) cell count were assessed at indicated time points. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 96, Week 432

Intervention	Cells per cubic millimeter (Mean)
	Week 96, n=99	Week 432, n=3
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	286.5	254.7

[back to top]

Change From Baseline in Creatinine Clearance at Indicated Time Points

Clinical chemistry parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in creatinine clearance is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Milliliter per minute (Mean)
	Week 4, n= 245, 237	Week 12, n= 236, 226	Week 24, n= 225, 212	Week 36, n= 219, 204	Week 48, n= 208, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-7.5	-7	-9.1	-7.5	-7.7
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-16.3	-17.3	-16.2	-16.8	-15.9

[back to top]

Change From Baseline in Erythrocyte Mean Corpuscular Volume at Indicated Time Points

Hematology parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in erythrocyte mean corpuscular volume (EMCV) is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Femtoliter (Mean)
	Week 4, n= 243, 234	Week 12, n= 233, 220	Week 24, n= 225, 211	Week 36, n= 218, 203	Week 48, n= 207, 190
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0.5	1.9	3.1	3.1	3.7
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.9	3.4	5.5	6.0	7.1

[back to top]

Change From Baseline in Erythrocytes at Indicated Time Points

Hematology parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in erythrocytes is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	10^12 cells per liter (Mean)
	Week 4, n= 243, 234	Week 12, n= 233, 220	Week 24, n= 225, 211	Week 36, n= 218, 203	Week 48, n= 207, 190
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-0.07	-0.09	-0.09	-0.08	-0.05
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-0.04	-0.07	-0.08	-0.10	-0.10

[back to top]

Change From Baseline in Hematocrit Count at Indicated Time Points

Hematology parameters were assessed at Baseline (Day 1), Weeks 4, 12, 24, 36 and 48. Change from Baseline in hematocrit is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Proportion of red blood cells in blood (Mean)
	Week 4, n= 243, 234	Week 12, n= 233, 220	Week 24, n= 225, 211	Week 36, n= 218, 203	Week 48, n= 207, 190
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-0.0042	0.0000	0.0051	0.0062	0.0107
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.0003	0.0081	0.0157	0.0167	0.0212

[back to top]

Change From Baseline in Lipase at Indicated Timepoints

Clinical chemistry parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in lipase is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Units per liter (Mean)
	Week 4, n= 245, 237	Week 12, n= 236, 226	Week 24, n= 225, 212	Week 36, n= 219, 204	Week 48, n= 208, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-1.3	-2.1	-6	-6.3	-7.8
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-1.2	-2.2	-6	-6.3	-6.5

[back to top]

Change From Baseline in Plasma HIV-1 RNA at Indicated Time Points-Continuation Phase

Change from the Baseline in plasma HIV-1 RNA were assessed at indicated time points. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 96 and Week 432

Intervention	Log10 copies/mL (Mean)
	Week 96, n=99	Week 432, n=3
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	-2.911	-3.107

[back to top]

Change From Baseline in Plasma HIV-1 RNA at Indicated Time Points-Randomized Phase

Intervention	Log10 copies/mL (Mean)
	Week 4, n=245, 238	Week 12, n=236, 226	Week 24, n=225, 212	Week 36, n=221, 204	Week 48, n=207, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-1.923	-2.541	-2.726	-2.772	-2.752
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-2.591	-2.756	-2.789	-2.838	-2.874

[back to top]

Change From Baseline in Total CHLS/HDL CHLS Ratio at Indicated Timepoints

Clinical chemistry parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in Total CHLS/HDL CHLS ratio is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Ratio (Mean)
	Week 4, n= 1, 4	Week 12, n= 233, 223	Week 24, n= 224, 209	Week 36, n= 212, 198	Week 48, n= 207, 186
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0.2159	-0.1092	-0.1922	-0.1433	-0.1444
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.1264	-0.2736	-0.3098	-0.3286	-0.2886

[back to top]

Change From Baseline in Type I Collagen C-telopeptides at Indicated Timepoints

Bone markers were assessed at Baseline (Day 1), Weeks 24, 48. Change from Baseline in Type I collagen C-telopeptides (T-1 CCT) is summarized. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Weeks 24 and 48

Intervention	Nanograms per liter (Mean)
	Week 24, n=221, 207	Week 48, n=202, 185
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	272.4	267.9
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	89.8	75.9

[back to top]

Change From Baseline in Urine Albumin Creatinine Ratio at Indicated Time Points

Change from Baseline in urine albumin creatinine ratio at Week 24 and Week 48 is summarized. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 24 and Week 48

Intervention	milligrams per millimole (Mean)
	Week 24, n= 179, 186	Week 48, n= 170, 164
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-1.03	-0.10
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-1.15	-0.68

[back to top]

Change From Baseline in Vitamin D, Vitamin D2 and Vitamin D3 at Week 24 and Week 48

Bone markers were assessed at Baseline (Day 1), Weeks 24, 48. Change from Baseline in vitamin D, vitamin D2 and vitamin D3 is summarized. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Weeks 24 and 48

Intervention	Nanomoles per liter (Mean)
	Vitamin D, Week 24, n=223, 208	Vitamin D, Week 48, n=206, 186	Vitamin D2, Week 24, n=223, 208	Vitamin D2, Week 48, n=206, 186	Vitamin D3, Week 24, n=223, 208	Vitamin D3, Week 48, n=206, 186
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	16.3	8.9	1.0	0.9	15.2	7.9
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	1.8	-1.9	0.3	0.1	1.5	-1.9

[back to top]

HIVTSQs Total Score at Indicated Timepoints

The HIV treatment satisfaction questionnaire (HIVTSQ) is a 10-item self-reported scale that measures overall satisfaction with treatment and by specific domains e.g. convenience, flexibility. The HIVTSQ items are summed up to produce a treatment satisfaction total score (0 to 60) and an individual satisfaction rating for each item (0 to 6) and two subscales: general satisfaction/clinical and lifestyle/ease subscales. The higher the score, the greater the improvement in treatment satisfaction as compared to the past few weeks. A smaller score represents a decline in treatment satisfaction compared to the past few weeks. Statistical analysis was performed based on Wilcoxon rank sum test. (NCT01910402)
Timeframe: Weeks 4, 12, 24 and 48

Intervention	Score on a scale (Mean)
	Week 4, n=243, 239	Week 12, n=236, 226	Week 24, n=225, 211	Week 48, n=206, 191
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	51.9	53.6	54.3	55.4
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	54.0	56.1	56.8	57.0

[back to top]

Number of Participants With AEs by Maximum Toxicity-Continuation Phase

Number of participants with Grade 1-4 AEs were assessed in Continuation Phase. AEs are categorized into following grades as per The Division of Aqcuired Immuno Deficiency Syndrome (AIDS) Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table)- Grade 1- mild, Grade 2- moderate; Grade 3- severe and Grade 4- potentially life-threatening. Higher the grade, more severe the symptoms. (NCT01910402)
Timeframe: From Weeks 48 to 432

Intervention	Participants (Count of Participants)
	Grade 1	Grade 2	Grade 3	Grade 4
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	32	48	7	6

[back to top]

Number of Participants With AEs by Maximum Toxicity-Randomized Phase

Number of participants with Grade 1-4 AEs by maximum toxicity were assessed from the start of study treatment and until end of the Randomization phase. AEs are categorized into following grades as per The Division of Aqcuired Immuno Deficiency Syndrome (AIDS) Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table)- Grade 1- mild, Grade 2- moderate; Grade 3- severe and Grade 4- potentially life-threatening. Higher the grade, more severe the symptoms. (NCT01910402)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Grade 1	Grade 2	Grade 3	Grade 4
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	60	91	37	9
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	79	94	18	3

[back to top]

Number of Participants With Any Adverse Events (AEs), and Serious Adverse Events (SAEs)-Randomized Phase

An AE is defined as any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product. An SAE is any untoward medical occurrence that, at any dose results in death, is life-threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, or is a congenital anomaly/birth defect or other events that may jeopardize the participant or may require medical or surgical intervention to prevent one of the outcome listed above, liver injury and impaired liver function and grade 4 laboratory abnormalities. Number of participants with any AEs, and SAEs have been presented. (NCT01910402)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Any AEs	Any SAEs
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	197	20
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	195	12

[back to top]

Number of Participants With Any AEs, and SAEs in Continuation Phase

An AE is defined as any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product. An SAE is any untoward medical occurrence that, at any dose results in death, is life-threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, or is a congenital anomaly/birth defect or other events that may jeopardize the participant or may require medical or surgical intervention to prevent one of the outcome listed above, liver injury and impaired liver function and grade 4 laboratory abnormalities. Number of participants with any AEs, and SAEs have been presented. (NCT01910402)
Timeframe: From Weeks 48 to 432

Intervention	Participants (Count of Participants)
	Any AEs	Any SAEs
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	93	13

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities-Continuation Phase

Number of participants with grades 1-4 emergent chemistry toxicities were assessed in Continuation Phase. Chemistry toxicities were categorized into following grades as per The Division of AIDS Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table)- Grade 1- mild, Grade 2- moderate; Grade 3- severe and Grade 4- potentially life-threatening. Higher the grade, more severe the symptoms. Data has been reported for clinical chemistry parameters including hyperglycaemia, hypernatremia, hypoglycaemia, hypokalemia, hyponatremia, alanine aminotransferase, albumin, alkaline phosphatase, aspartate aminotransferase, bilirubin, carbon dioxide, cholesterol, creatine kinase, creatinine, LDL cholesterol calculation, LDL cholesterol direct, lipase, phosphate, potassium, sodium, triglycerides and glucose. (NCT01910402)
Timeframe: From Weeks 48 to 432

Intervention	Participants (Count of Participants)
	Hyperglycaemia, Grade 1, n=143	Hyperglycaemia, Grade 2, n=143	Hyperglycaemia, Grade 3, n=143	Hyperglycaemia, Grade 4, n=143	Hypernatremia, Grade 1, n=146	Hypernatremia, Grade 2, n=146	Hypernatremia, Grade 3, n=146	Hypernatremia, Grade 4, n=146	Hypoglycaemia, Grade 1, n=143	Hypoglycaemia, Grade 2, n=143	Hypoglycaemia, Grade 3, n=143	Hypoglycaemia, Grade 4, n=143	Hypokalemia, Grade 1, n=146	Hypokalemia, Grade 2, n=146	Hypokalemia, Grade 3, n=146	Hypokalemia, Grade 4, n=146	Hyponatremia, Grade 1, n=146	Hyponatremia, Grade 2, n=146	Hyponatremia, Grade 3, n=146	Hyponatremia, Grade 4, n=146	Alanine aminotransferase, Grade 1, n=146	Alanine aminotransferase, Grade 2, n=146	Alanine aminotransferase, Grade 3, n=146	Alanine aminotransferase, Grade 4, n=146	Alkaline phosphatase, Grade 1, n=146	Alkaline phosphatase, Grade 2, n=146	Alkaline phosphatase, Grade 3, n=146	Alkaline phosphatase, Grade 4, n=146	Aspartate aminotransferase, Grade 1, n=146	Aspartate aminotransferase, Grade 2, n=146	Aspartate aminotransferase, Grade 3, n=146	Aspartate aminotransferase, Grade 4, n=146	Bilirubin, Grade 1, n=146	Bilirubin, Grade 2, n=146	Bilirubin, Grade 3, n=146	Bilirubin, Grade 4, n=146	Carbon dioxide, Grade 1, n=146	Carbon dioxide, Grade 2, n=146	Carbon dioxide, Grade 3, n=146	Carbon dioxide, Grade 4, n=146	Cholesterol, Grade 1, n=71	Cholesterol, Grade 2, n=71	Cholesterol, Grade 3, n=71	Cholesterol, Grade 4, n=71	Creatine kinase, Grade 1, n=146	Creatine kinase, Grade 2, n=146	Creatine kinase, Grade 3, n=146	Creatine kinase, Grade 4, n=146	Creatinine, Grade 1, n=146	Creatinine, Grade 2, n=146	Creatinine, Grade 3, n=146	Creatinine, Grade 4, n=146	LDL cholesterol calculation, Grade 1, n=70	LDL cholesterol calculation, Grade 2, n=70	LDL cholesterol calculation, Grade 3, n=70	LDL cholesterol calculation, Grade 4, n=70	LDL cholesterol direct, Grade 1, n=2	LDL cholesterol direct, Grade 2, n=2	LDL cholesterol direct, Grade 3, n=2	LDL cholesterol direct, Grade 4, n=2	Lipase, Grade 1, n=146	Lipase, Grade 2, n=146	Lipase, Grade 3, n=146	Lipase, Grade 4, n=146	Phosphate, Grade 1, n=146	Phosphate, Grade 2, n=146	Phosphate, Grade 3, n=146	Phosphate, Grade 4, n=146	Potassium, Grade 1, n=146	Potassium, Grade 2, n=146	Potassium, Grade 3, n=146	Potassium, Grade 4, n=146	Sodium, Grade 1, n=146	Sodium, Grade 2, n=146	Sodium, Grade 3, n=146	Sodium, Grade 4, n=146	Triglycerides, Grade 1, n=71	Triglycerides, Grade 2, n=71	Triglycerides, Grade 3, n=71	Triglycerides, Grade 4, n=71	Glucose, Grade 1, n=143	Glucose, Grade 2, n=143	Glucose, Grade 3, n=143	Glucose, Grade 4, n=143
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	24	9	3	0	2	0	0	0	1	0	0	1	13	0	0	0	36	0	0	0	7	3	0	2	5	0	0	0	10	2	0	2	4	1	3	0	58	7	0	0	9	9	3	0	6	1	1	1	5	0	0	1	5	8	2	0	1	0	0	0	9	6	1	1	2	15	2	0	13	0	0	0	37	0	0	0	0	1	0	0	24	9	3	1

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities-Randomized Phase

Number of participants with Grade 1-4 emergent chemistry toxicities were assessed from the start of study treatment and end of Randomized Phase. Chemistry toxicities were categorized into following grades as per The Division of AIDS Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table)- Grade 1- mild, Grade 2- moderate; Grade 3- severe and Grade 4- potentially life-threatening. Higher the grade, more severe the symptoms. Data has been reported for clinical chemistry parameters including hyperglycaemia, hyperkalemia, hypernatremia, hypoglycaemia, hypokalemia, hyponatremia, alanine aminotransferase, albumin, alkaline phosphatase, aspartate aminotransferase, bilirubin, carbon dioxide, cholesterol, creatine kinase, creatinine, LDL cholesterol calculation, LDL cholesterol direct, lipase, phosphate, potassium, sodium, triglycerides and glucose. (NCT01910402)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Hyperglycaemia, Grade 1	Hyperglycaemia, Grade 2	Hyperglycaemia, Grade 3	Hyperglycaemia, Grade 4	Hyperkalemia, Grade 1	Hyperkalemia, Grade 2	Hyperkalemia, Grade 3	Hyperkalemia, Grade 4	Hypernatremia, Grade 1	Hypernatremia, Grade 2	Hypernatremia, Grade 3	Hypernatremia, Grade 4	Hypoglycaemia, Grade 1	Hypoglycaemia, Grade 2	Hypoglycaemia, Grade 3	Hypoglycaemia, Grade 4	Hypokalemia, Grade 1	Hypokalemia, Grade 2	Hypokalemia, Grade 3	Hypokalemia, Grade 4	Hyponatremia, Grade 1	Hyponatremia, Grade 2	Hyponatremia, Grade 3	Hyponatremia, Grade 4	Alanine aminotransferase, Grade 1	Alanine aminotransferase, Grade 2	Alanine aminotransferase, Grade 3	Alanine aminotransferase, Grade 4	Albumin, Grade 1	Albumin, Grade 2	Albumin, Grade 3	Albumin, Grade 4	Alkaline phosphatase, Grade 1	Alkaline phosphatase, Grade 2	Alkaline phosphatase, Grade 3	Alkaline phosphatase, Grade 4	Aspartate aminotransferase, Grade 1	Aspartate aminotransferase, Grade 2	Aspartate aminotransferase, Grade 3	Aspartate aminotransferase, Grade 4	Bilirubin, Grade 1	Bilirubin, Grade 2	Bilirubin, Grade 3	Bilirubin, Grade 4	Carbon dioxide, Grade 1	Carbon dioxide, Grade 2	Carbon dioxide, Grade 3	Carbon dioxide, Grade 4	Cholesterol, Grade 1	Cholesterol, Grade 2	Cholesterol, Grade 3	Cholesterol, Grade 4	Creatine kinase, Grade 1	Creatine kinase, Grade 2	Creatine kinase, Grade 3	Creatine kinase, Grade 4	Creatinine, Grade 1	Creatinine, Grade 2	Creatinine, Grade 3	Creatinine, Grade 4	LDL cholesterol calculation, Grade 1	LDL cholesterol calculation, Grade 2	LDL cholesterol calculation, Grade 3	LDL cholesterol calculation, Grade 4	LDL cholesterol direct, Grade 1	LDL cholesterol direct, Grade 2	LDL cholesterol direct, Grade 3	LDL cholesterol direct, Grade 4	Lipase, Grade 1	Lipase, Grade 2	Lipase, Grade 3	Lipase, Grade 4	Phosphate, Grade 1	Phosphate, Grade 2	Phosphate, Grade 3	Phosphate, Grade 4	Potassium, Grade 1	Potassium, Grade 2	Potassium, Grade 3	Potassium, Grade 4	Sodium, Grade 1	Sodium, Grade 2	Sodium, Grade 3	Sodium, Grade 4	Triglycerides, Grade 1	Triglycerides, Grade 2	Triglycerides, Grade 3	Triglycerides, Grade 4	Glucose, Grade 1	Glucose, Grade 2	Glucose, Grade 3	Glucose, Grade 4
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	11	9	3	0	0	1	0	0	0	0	0	0	5	1	0	0	19	0	0	0	57	0	0	0	7	4	2	0	2	2	0	0	14	1	0	0	7	4	2	0	52	86	57	5	54	3	0	0	31	9	2	0	5	1	0	1	7	3	0	0	21	9	2	0	1	0	0	0	7	3	2	1	11	9	2	0	19	1	0	0	57	0	0	0	0	2	0	0	15	10	3	0
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	17	16	4	1	1	0	0	0	1	0	0	0	6	3	1	0	17	1	0	0	44	1	0	0	5	6	1	1	3	0	0	0	3	2	0	0	12	4	1	1	2	0	0	0	65	4	0	0	52	28	4	0	3	1	3	0	3	0	1	0	38	13	7	0	3	1	0	0	12	5	3	0	5	7	1	0	18	1	0	0	45	1	0	0	0	5	2	0	22	19	4	1

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities-Continuation Phase

Number of participants with Grade 1-4 emergent hematology toxicities were assessed in Continuation Phase. Hematology toxicities were categorized into following grades as per The Division of AIDS Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table)- Grade 1- mild, Grade 2- moderate; Grade 3- severe and Grade 4- potentially life-threatening. Higher the grade, more severe the symptoms. Data has been reported for clinical chemistry parameters including hemoglobin, leukocytes, neutrophils and platelets. (NCT01910402)
Timeframe: From Weeks 48 to 432

Intervention	Participants (Count of Participants)
	Hemoglobin, Grade 1	Hemoglobin, Grade 2	Hemoglobin, Grade 3	Hemoglobin, Grade 4	Leukocytes, Grade 1	Leukocytes, Grade 2	Leukocytes, Grade 3	Leukocytes, Grade 4	Neutrophils, Grade 1	Neutrophils, Grade 2	Neutrophils, Grade 3	Neutrophils, Grade 4	Platelets, Grade 1	Platelets, Grade 2	Platelets, Grade 3	Platelets, Grade 4
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	5	1	0	0	2	0	1	0	10	2	1	1	3	1	0	0

[back to top]

Change From Baseline in CD4+ Cell Count at Indicated Timepoints-Randomized Phase

Change from Baseline in cluster of differentiation 4 (CD4+) cell count were assessed at indicated time points. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Cells per cubic millimeter (Mean)
	Week 4, n=245, 237	Week 12, n=236, 224	Week 24, n=226, 210	Week 36, n=219, 204	Week 48, n=208, 191
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	73.7	124.4	163.0	191.4	230.7
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	94.9	143.8	200.6	230.7	248.8

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities-Randomized Phase

Number of participants with Grade 1-4 emergent hematology toxicities were assessed from the start of study treatment and end of Randomized Phase. Hematology toxicities were categorized into following grades as per The Division of AIDS Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table)- Grade 1- mild, Grade 2- moderate; Grade 3- severe and Grade 4- potentially life-threatening. Higher the grade, more severe the symptoms. Data has been reported for clinical chemistry parameters including hemoglobin, leukocytes, neutrophils and platelets. (NCT01910402)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Hemoglobin, Grade 1	Hemoglobin, Grade 2	Hemoglobin, Grade 3	Hemoglobin, Grade 4	Leukocytes, Grade 1	Leukocytes, Grade 2	Leukocytes, Grade 3	Leukocytes, Grade 4	Neutrophils, Grade 1	Neutrophils, Grade 2	Neutrophils, Grade 3	Neutrophils, Grade 4	Platelets, Grade 1	Platelets, Grade 2	Platelets, Grade 3	Platelets, Grade 4
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	21	3	1	0	6	2	0	0	12	9	2	1	1	2	0	0
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	7	2	1	0	5	1	0	0	15	7	0	1	6	0	1	0

[back to top]

Number of Participants With Post-Baseline HIV-1 Disease Progression for DTG 50 mg/ABC 600 mg/3TC 300 mg QD (Randomized + Continuation Phase)

Number of participants with post-Baseline HIV-1disease progression were assessed during study period. The CDC Classification System for HIV Infection is the medical classification system used by the United States Centers for Disease Control and Prevention (CDC) to classify HIV disease and infection. The clinical categories of HIV infection are defined as follows: Category A: Mildly symptomatic, Category B: Moderately symptomatic, Category C: Severely symptomatic. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Only those participants available at the specified time points were analyzed. Different participants may have been analyzed at different time points, so the overall number of participants analyzed reflects everyone in the ITT population. (NCT01910402)
Timeframe: Up to week 432

Intervention	Participants (Count of Participants)
	CDC Class A to CDC Class C	CDC Class B to CDC Class C	CDC Class C to new CDC Class C	CDC Class A, B or C to Death
DTG 50 mg/ABC 600 mg/3TC 300 mg QD	6	1	0	2

[back to top]

Number of Participants With Post-Baseline HIV-1 Disease Progression-Randomized Phase

Intervention	Participants (Count of Participants)
	CDC Class A to CDC Class C	CDC Class B to CDC Class C	CDC Class C to new CDC Class C	CDC Class A, B or C to Death
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	4	2	0	1
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	5	1	0	1

[back to top]

Number of Participants With Treatment Emergent Resistances for ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200mg QD (Randomized Phase)

Number of participants, who meet confirmed virologic withdrawal criteria, with treatment emergent genotypic resistance to integrase strand transfer inhibitor (INSTI), Non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor (NRTI), protease inhibitors (PI) will be summarized. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. On-treatment Genotypic Resistance Population comprised of all participants in the ITTE population with available On-treatment genotypic resistance data at the time confirmed virologic withdrawal criterion was met. (NCT01910402)
Timeframe: Up to week 48

Intervention	Participants (Count of Participants)
	INSTI; n= 3	NNRTI; n=4	NRTI; n=4	PI; n=4
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200mg QD-Randomized Phase	1	0	1	0

[back to top]

Number of Participants With Treatment Emergent Resistances for DTG 50 mg/ABC 600 mg/3TC 300 mg QD (Randomized + Continuation Phase)

Intervention	Participants (Count of Participants)
	INSTI; n= 6	NNRTI; n=8	NRTI; n=8	PI; n=8
DTG 50 mg/ABC 600 mg/3TC 300 mg QD	0	1	1	0

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 and <400 c/mL Over Time-Randomized Phase

Percentage of participants with plasma HIV-1 RNA <50 and <400 c/mL were assessed at Baseline, Weeks 4, 12, 24 , 36 and 48 using the Snapshot algorithm (Missing, Switch or Discontinuation = Failure). The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Percentage values are rounded off. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Percentage of participants (Number)
	HIV-1 RNA <50 c/mL, Baseline (Day 1)	HIV-1 RNA <50 c/mL, Week 4	HIV-1 RNA <50 c/mL, Week 12	HIV-1 RNA <50 c/mL, Week 24	HIV-1 RNA <50 c/mL, Week 36	HIV-1 RNA <50 c/mL, Week 48	HIV-1 RNA <400 c/mL, Baseline (Day 1)	HIV-1 RNA <400 c/mL, Week 4	HIV-1 RNA <400 c/mL, Week 12	HIV-1 RNA <400 c/mL, Week 24	HIV-1 RNA <400 c/mL, Week 36	HIV-1 RNA <400 c/mL, Week 48
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0	13	49	77	77	71	1	54	84	82	81	76
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0	64	81	85	85	82	1	90	91	88	86	83

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL in Continuation Phase

Plasma samples were collected for quantitative analysis of HIV-1 RNA. Percentage of participants with plasma HIV-1 RNA <50 c/mL were reported. Percentage values are rounded off. (NCT01910402)
Timeframe: Week 96 and Week 432

Intervention	Percentage of participants (Number)
	Week 96, n=99	Week 432, n=3
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	100	100

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 Copies/mL at Week 48 by Subgroups

Percentage of participants with plasma HIV-1 RNA <50 copies/mL at Week 48 by subgroups (age, race, country, Baseline plasma HIV-1 RNA [BPHR], Baseline CD4+ cell count [BCCC], Baseline Centers for Disease Control and Prevention [CDC] category and HIV-1 subtype) were assessed using the Snapshot algorithm (Missing, Switch or Discontinuation = Failure). Analysis was performed using a stratified analysis with CMH weights, adjusting for Baseline plasma HIV-1 RNA ( =100,000 c/mL) and CD4+ cell count (=<350 cells/mm^3 or >350 cells/mm^3). Different participants may have been analyzed at different time points, so the overall number of participants analyzed reflects everyone in the ITT population. Percentage values are rounded off. (NCT01910402)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
	Age, <50 Years, n=212, 212	Age, >=50 Years, n=36, 35	Race, White, n=115, 107	Race, Non-White, n=133,140	Race, African-American/African Heritage, n=102,108	Non-African-American/African Heritage, n=146, 139	BPHR, <1000, n=5, 10	BPHR, 1000 to <10,000, n=66, 62	BPHR, 10,000 to <50,000, n=83, 81	BPHR, 50,000 to <=100,000, n=25, 28	BPHR, >100,000, n=69, 66	BCCC, <200, n=64, 49	BCCC, >=200, n=184, 198	BCCC, <50, n=9, 15	BCCC, 50 to <200, n=55, 34	BCCC, 200 to <350, n=66, 74	BCCC, 350 to <500, n=56, 65	BCCC, >=500, n=62, 59	CDC category, A, n=210, 208	CDC category, B, n=27, 30	CDC category, C, n=11, 9	HIV-1 subtype: B vs Non-B, B, n=95, 111	HIV-1 subtype: B vs Non-B, non-B, n=140, 131	Argentina, n=24, 20	Canada, n=11, 9	France, n=7, 8	Italy, n=17, 11	Mexico, n=6, 5	Portugal, n=4, 5	Russia, n=28, 22	South Africa, n=33, 33	Spain, n=23, 31	Thailand, n=19, 21	USA, n=62, 69	United Kingdom, n=14, 11
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	80	92	86	78	74	88	60	83	84	80	80	81	82	67	84	89	79	77	81	81	91	80	84	92	91	100	88	100	75	89	67	70	95	74	93

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 Copies/mL at Week 48 by Subgroups

Intervention	Percentage of participants (Number)
	Age, <50 Years, n=212, 212	Age, >=50 Years, n=36, 35	Race, White, n=115, 107	Race, Non-White, n=133,140	Race, African-American/African Heritage, n=102,108	Non-African-American/African Heritage, n=146, 139	BPHR, <1000, n=5, 10	BPHR, 1000 to <10,000, n=66, 62	BPHR, 10,000 to <50,000, n=83, 81	BPHR, 50,000 to <=100,000, n=25, 28	BPHR, >100,000, n=69, 66	BCCC, <200, n=64, 49	BCCC, >=200, n=184, 198	BCCC, <50, n=9, 15	BCCC, 50 to <200, n=55, 34	BCCC, 200 to <350, n=66, 74	BCCC, 350 to <500, n=56, 65	BCCC, >=500, n=62, 59	CDC category, A, n=210, 208	CDC category, B, n=27, 30	CDC category, C, n=11, 9	HIV-1 subtype: B vs Non-B, B, n=95, 111	HIV-1 subtype: B vs Non-B, non-B, n=140, 131	Argentina, n=24, 20	Canada, n=11, 9	France, n=7, 8	Italy, n=17, 11	Mexico, n=6, 5	Portugal, n=4, 5	Puerto Rico, n=0, 2	Russia, n=28, 22	South Africa, n=33, 33	Spain, n=23, 31	Thailand, n=19, 21	USA, n=62, 69	United Kingdom, n=14, 11
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	71	74	80	64	67	75	80	77	74	64	64	69	72	60	74	73	74	68	71	77	56	69	73	80	89	75	64	60	60	100	82	76	77	52	67	64

[back to top]

Change From Baseline in Albumin at Indicated Timepoints

Clinical chemistry parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in albumin is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Grams per liter (Mean)
	Week 4, n= 245, 237	Week 12, n= 236, 226	Week 24, n= 225, 212	Week 36, n= 219, 204	Week 48, n= 208, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-0.5	0.1	0.8	0.6	1.3
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.1	0.5	1.4	1.4	1.7

[back to top]

Change From Baseline in Basophils, Eosinophils, Lymphocytes, Monocytes at Indicated Time Points

Hematology parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in basophils, eosinophils, lymphocytes, monocytes is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	10^9 cells per liter (Mean)
	Basophils, Week 4, n= 241, 234	Basophils, Week 12, n= 228, 216	Basophils, Week 24, n= 221, 208	Basophils, Week 36, n= 214, 203	Basophils, Week 48, n= 206, 189	Eosinophils, Week 4, n= 241, 234	Eosinophils, Week 12, n= 228, 216	Eosinophils, Week 24, n= 221, 208	Eosinophils, Week 36, n= 214, 203	Eosinophils, Week 48, n= 206, 189	Lymphocytes, Week 4, n= 241, 234	Lymphocytes, Week 12, n= 228, 216	Lymphocytes, Week 24, n= 221, 208	Lymphocytes, Week 36, n= 214, 203	Lymphocytes, Week 48, n= 206, 189	Monocytes, Week 4, n= 241, 234	Monocytes, Week 12, n= 228, 216	Monocytes, Week 24, n= 221, 208	Monocytes, Week 36, n= 214, 203	Monocytes, Week 48, n= 206, 189
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0.003	0.003	0.003	0.003	0.006	0.021	-0.001	0.005	0.014	0.007	0.119	0.156	0.192	0.178	0.261	-0.015	-0.031	-0.015	-0.028	-0.024
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.003	0.002	0.004	0.004	0.005	0.040	0.037	0.028	0.048	0.030	0.208	0.257	0.317	0.362	0.359	-0.001	-0.010	0.008	-0.006	0.001

[back to top]

Change From Baseline in Bilirubin and Creatinine at Indicated Timepoints

Clinical chemistry parameters were assessed at Baseline (Day 1), Weeks 4, 12, 24, 36 and 48. Change from Baseline in bilirubin and creatinine are summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Micromoles per liter (Mean)
	Bilirubin, Week 4, n= 244, 237	Bilirubin, Week 12, n= 236, 226	Bilirubin, Week 24, n= 225, 212	Bilirubin, Week 36, n= 219, 204	Bilirubin, Week 48, n= 208, 192	Creatinine, Week 4, n= 245, 237	Creatinine, Week 12, n= 236, 226	Creatinine, Week 24, n= 225, 212	Creatinine, Week 36, n= 219, 204	Creatinine, Week 48, n= 208, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	27.2	22.8	25	23.8	23.7	4.89	5.83	5.8	5.37	5.86
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-0.8	-0.6	-0.2	-0.2	-0.3	8.4	9.2	9.16	10.08	9.29

[back to top]

Change From Baseline in Bone Specific Alkaline Phosphatase, Osteocalcin and Procollagen 1 N-terminal Propeptide at Indicated Timepoints

Bone markers were assessed at Baseline (Day 1), Weeks 24, 48. Change from Baseline in bone specific alkaline phosphatase (BSAP), osteocalcin and procollagen 1 N-terminal propeptide (PTP) is summarized. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Weeks 24 and 48

Intervention	Micrograms per liter (Mean)
	BSAP, Week 24, n=219, 207	BSAP, Week 48, n=202, 184	Osteocalcin, Week 24, n=209, 197	Osteocalcin, Week 48, n=194, 178	PTP, Week 24, n=223, 206	PTP, Week 48, n=205, 186
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	6.00	7.60	14.38	16.30	32.0	34.1
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	1.33	2.64	3.73	5.15	10.1	11.2

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 Copies/mL at Week 48

Percentage of participants with plasma human immunodeficiency virus type 1(HIV-1) ribonucleic acid (RNA) <50 copies per milliliter (c/mL) were assessed at Week 48 using the Snapshot algorithm. Analysis was performed using a stratified analysis with Cochran-Mantel-Haenszel (CMH) weights, adjusting for Baseline plasma HIV-1 RNA ( =100,000 c/mL) and CD4+ cell count (=<350 cells per millimeter cube (cells/mm^3) or >350 cells/mm^3). Intent-to-Treat Exposed (ITT-E) Population comprised of all randomized participants who received at least one dose of study medication. Percentage values are rounded off. (NCT01910402)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	82
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	71

[back to top]

Change From Baseline in TC/HDL Ratio at Week 48

Change from Baseline in mean total cholesterol (TC)/HDL ratio is summarized at Week 48. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. Adjusted mean is the estimated mean change from Baseline in fasted TC/HDL at Week 48 in each arm calculated from a model adjusted for the following covariates: treatment, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age and triglycerides/HDL at Baseline. Participants on lipid lowering therapy at Baseline were excluded from analysis. Measurements collected after a participant initiates lipid lowering therapy were set to missing. Missing values were imputed using multiple imputation under a multivariate normal model adjusting for Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, fasted triglycerides and TC/HDL ratio at Baseline, Week 12 and Week 36. (NCT01910402)
Timeframe: Baseline (Day 1) and Week 48

Intervention	Ratio (Least Squares Mean)
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-0.264
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-0.158

[back to top]

Change From Baseline in Triglycerides at Week 48

Change from Baseline in mean triglycerides is summarized at Week 48. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. Adjusted mean is the estimated mean change from Baseline in fasted triglycerides at Week 48 in each arm calculated from a model adjusted for the following covariates: treatment, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age and triglycerides at Baseline. Participants on lipid lowering therapy at Baseline were excluded from analysis. Measurements collected after a participant initiates lipid lowering therapy were set to missing. Missing values were imputed using multiple imputation under a multivariate normal model adjusting for Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, fasted triglycerides and TC/HDL ratio at Baseline, Week 12 and Week 36. (NCT01910402)
Timeframe: Baseline (Day 1) and Week 48

Intervention	Millimoles per liter (Least Squares Mean)
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.045
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0.070

[back to top]

Number of Participants Who Withdrew From Treatment Due to AEs-Continuation Phase

An AE is defined as any untoward medical occurrence in a participant temporally associated with the use of a medicinal product (MP), whether or not considered related to the MP. An AE can therefore be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of an MP. An SAE is defined as any untoward medical occurrence that, at any dose, results in death, is life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, is a congenital anomaly/birth defect, is an important medical event that jeopardizes the participant or may require medical or surgical intervention to prevent one of the other outcomes listed in the above definition, or is associated with liver injury and impaired liver function. (NCT01910402)
Timeframe: From Weeks 48 to 432

Intervention	Participants (Count of Participants)
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	4

[back to top]

Number of Participants Who Withdrew From Treatment Due to AEs-Randomized Phase

Intervention	Participants (Count of Participants)
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	10
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	17

[back to top]

Change From Baseline in Alanine Aminotransferase, Alkaline Phosphatase, Aspartate Aminotransferase, Creatine Kinase at Indicated Time Points

Clinical chemistry parameters were assessed at Baseline (Day 1), Week 4, 12, 24, 36 and Week 48. Change from Baseline in alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, creatine kinase is summarized. Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	International units per liter (Mean)
	Alanine aminotransferase, Week 4, n= 245, 237	Alanine aminotransferase, Week 12, n= 236, 226	Alanine aminotransferase, Week 24, n= 225, 212	Alanine aminotransferase, Week 36, n= 219, 204	Alanine aminotransferase, Week 48, n= 208, 192	Alkaline phosphatase, Week 4, n= 245, 237	Alkaline phosphatase, Week 12, n= 236, 226	Alkaline phosphatase, Week 24, n= 225, 212	Alkaline phosphatase, Week 36, n= 219, 204	Alkaline phosphatase, Week 48, n= 208, 192	Aspartate aminotransferase, Week 4, n= 244, 237	Aspartate aminotransferase, Week 12, n= 236, 226	Aspartate aminotransferase, Week 24, n= 224, 212	Aspartate aminotransferase, Week 36, n= 219, 204	Aspartate aminotransferase, Week 48, n= 208, 192	Creatine Kinase, Week 4, n= 245, 237	Creatine Kinase, Week 12, n= 236, 226	Creatine Kinase, Week 24, n= 225, 212	Creatine Kinase, Week 36, n= 219, 204	Creatine Kinase, Week 48, n= 208, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	-3.4	-2.3	-3.7	-5.3	-1.5	9.4	15.1	22.4	20.4	21.9	-3.6	-4	-5.1	-6.5	-3.7	35.6	7.3	5.8	7.2	3.8
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	-3.3	-5.2	-5.4	-4.9	-5.7	-1.5	-2.1	0.5	0.6	2.9	-3.3	-6.2	-6.3	-6.4	-7.5	-0.3	6.9	10.3	11.9	23.8

[back to top]

Absolute Values in CD4+ Cell Count at Indicated Timepoints-Continuation Phase

Absolute values in CD4+ cell count were assessed at indicated time points. (NCT01910402)
Timeframe: Week 96 and Week 432

Intervention	Cells per cubic millimeter (Mean)
	Week 96, n=99	Week 432, n=3
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	635.3	553.0

[back to top]

Absolute Values in CD4+ Cell Count at Indicated Timepoints-Randomized Phase

Absolute values in CD4+ cell count were assessed at indicated time points. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Cells per cubic millimeter (Mean)
	Baseline (Day 1), n=248, 247	Week 4, n=245, 237	Week 12, n=236, 224	Week 24, n=226, 210	Week 36, n=219, 204	Week 48, n=208, 191
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	380.3	455.1	506.2	542.5	569.2	608.5
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	369.7	465.0	509.5	563.8	592.8	608.8

[back to top]

Absolute Values in Plasma HIV-1 RNA at Indicated Time Points-Continuation Phase

Absolute Values in plasma HIV-1 RNA were assessed at indicated time points. (NCT01910402)
Timeframe: Week 96 and Week 432

Intervention	Log10 copies/mL (Mean)
	Week 96, n=99	Week 432, n=3
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Continuation Phase	1.591	1.590

[back to top]

Absolute Values in Plasma HIV-1 RNA at Indicated Time Points-Randomized Phase

Absolute Values in plasma HIV-1 RNA were assessed at indicated time points. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. (NCT01910402)
Timeframe: Baseline (Day 1), Week 4, Week 12, Week 24, Week 36 and Week 48

Intervention	Log10 copies/mL (Mean)
	Baseline (Day 1), n=248, 247	Week 4, n=245, 238	Week 12, n=236, 226	Week 24, n=225, 212	Week 36, n=221, 204	Week 48, n=207, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	4.441	2.516	1.908	1.710	1.658	1.657
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	4.481	1.895	1.748	1.724	1.666	1.619

[back to top]

Bone Specific Alkaline Phosphatase, Osteocalcin, Procollagen 1 N-terminal Propeptide, Type 1 Collagen C-Telopeptide, Vitamin D Ratio of Week 48 Results Over Baseline

Bone markers were assessed at indicated timepoints. Bone specific alkaline phosphatase (BSAP), osteocalcin and procollagen 1 N-terminal propeptide (PTP), Type 1 Collagen C-Telopeptide, vitamin D ratio of Week 48 results over Baseline is calculated. Bone biomarkers were analyzed based on log transformed data. Estimates of adjusted mean and difference were calculated from an Analysis of covariance (ANCOVA) model adjusting for age, baseline viral load Baseline CD4+ cell count, Baseline biomarker level, body mass index category, smoking status and baseline Vitamin D use. Adjusted mean of log-transformed change from Baseline are transformed back to Week 48/Baseline ratio for each treatment group. Adjusted difference of log-transformed change from Baseline between treatment groups is transformed back to the ratio of Week 48/Baseline ratio in DTG/ABC/3TC FDC to ATV+RTV+TDF/FTC FDC. (NCT01910402)
Timeframe: Baseline (Day 1) and Week 48

Intervention	Ratio (Number)
	BSAP, n=202, 183	PTP, n=202, 184	Osteocalcin, n=194, 178	Type 1 Collagen C-Telopeptide, n=202, 184	Vitamin D, n=206, 186
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	1.629	1.752	2.039	1.918	1.158
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	1.188	1.214	1.282	1.257	0.987

[back to top]

Change From Baseline at Week 48 in SF-12 Total Score, MCS and PCS

The 12-Item Short Form Health Survey (SF-12) is 12 item abbreviated form of SF-36 survey. SF-12 questions make up 8 scales: Physical Functioning, Role Physical, Bodily Pain, General Health, Vitality, Social Functioning, Role Emotional, Mental Health. SF-12 is a self-reported outcome measure assessing psychological wellness and the impact of health on an individual's everyday life. SF-12 total score ranges from 20 to 60 and higher score indicate a higher level of functioning. SF-12 total score was calculated by a clinician scoring 12-question survey filled by participants. Transformed physical component summary score (PCS) and transformed mental component summary score (MCS) are derived using the sum of all 12 items and scored onto a 0-100 scale such that a higher score indicates a better health state and better functioning. The Baseline value was defined as the latest pre-dose assessment (Day 1) value. Change from Baseline was calculated as post-dose visit value minus Baseline value. (NCT01910402)
Timeframe: Baseline (Day 1) and Week 48

Intervention	Score on a scale (Mean)
	Total Score, Week 48, n=205, 192	MCS, Week 48, n=205, 192	PCS, Week 48, n=205, 192
ATV 300 mg+RTV 100 mg+TDF 300 mg/FTC 200 mg QD-Randomized Phase	0.1	2.329	1.444
DTG 50 mg/ABC 600 mg/3TC 300 mg QD-Randomized Phase	0.0	2.397	1.905

[back to top]

Rectal Tissue Concentrations of Ralegravir and Dolutegravir

(NCT02218320)
Timeframe: 2 to 6 hours post dose

Intervention	ng/g (Median)
Group A	5308
Group B	810

[back to top]

RNA Concentrations From Gastrointestinal Tissues

We measured RNA concentrations in copies/1000cells for both drug groups (NCT02218320)
Timeframe: 2 to 6 hours post dose

Intervention	copies/1000cells (Median)
Group A	0.05
Group B	0.16

[back to top]

Percentage of Total CD8+ T-cells With CCR5 Expression

Local immunologic markers in gastrointestinal tract tissues (NCT02218320)
Timeframe: 2 to 6 hours post dose

Intervention	percentage of total cells (Median)
Group A	0.15
Group B	0.64

[back to top]

Change in LDL Cholesterol From Baseline to Week 48

Change in Low-density lipoprotein (LDL) cholesterol between arms will be presented in the attached statistical analysis table (NCT02263326)
Timeframe: Baseline and Week 48

Intervention	mg/dL (Median)
Dolutegravir Plus Lamivudine	2
Continue Current ART Regimen	-3

[back to top]

Change in Creatinine Clearance From Baseline to Week 48

Change in Creatinine Clearance between arms will be presented in the attached statistical analysis table (NCT02263326)
Timeframe: Baseline and Week 48

Intervention	ml/min (Median)
Dolutegravir Plus Lamivudine	-4
Continue Current ART Regimen	0

[back to top]

Change in CD4 Count From Baseline to Week 48

Change in CD4 count between arms will be presented in the attached statistical analysis table (NCT02263326)
Timeframe: Baseline and 48 weeks

Intervention	cells/mm^3 (Median)
Dolutegravir Plus Lamivudine	39
Continue Current ART Regimen	28

[back to top]

Residual Viremia by HIV-1 Single-copy Assay

Difference in HIV-1 detection by the HIV-1 single copy assay between arms will be presented in statistical analysis (NCT02263326)
Timeframe: 48 weeks

Intervention	copies/mL (Mean)
Dolutegravir Plus Lamivudine	4.7
Continue Current ART Regimen	4.2

[back to top]

Proportion of Participants With Virologic Success

Proportion of participants with virologic success (<50 copies/mL) based on FDA snapshot definition (NCT02263326)
Timeframe: 48 weeks

Intervention	proportion of participants (Number)
Dolutegravir Plus Lamivudine	0.9091
Continue Current ART Regimen	0.8889

[back to top]

Proportion of Participants With Treatment Failure

Proportion of participants with treatment failure (defined as virologic failure (HIV RNA >50 copies/mL), loss to follow-up, or treatment discontinuation) between those who switch to DTG + lamivudine and those who continue their current ART regimen (NCT02263326)
Timeframe: 24 weeks

Intervention	proportion of participants (Number)
Dolutegravir Plus Lamivudine	0.0682
Continue Current ART Regimen	0.0667

[back to top]

Drug Resistance Associated Mutations

Drug resistance mutations measured by HIV genotyping in patients with confirmed virologic failure (NCT02263326)
Timeframe: 48 weeks

Intervention	Participants (Count of Participants)
Dolutegravir Plus Lamivudine	0
Continue Current ART Regimen	0

[back to top]

Change in Total Cholesterol From Baseline to Week 48

Change in Total Cholesterol between arms will be presented in the attached statistical analysis table (NCT02263326)
Timeframe: Baseline and 48 weeks

Intervention	mg/dL (Median)
Dolutegravir Plus Lamivudine	0
Continue Current ART Regimen	-1

[back to top]

Proportion of Treated Participants With HIV-1 RNA to <50 Copies/mL at Week 48

Proportion of participants completing Week 48 with an HIV-1 RNA level less than 50 copies/mL (NCT02384395)
Timeframe: Week 48

Intervention	proportion of participants (Number)
DTG/3TC/ABC FDC	0.88

[back to top]

Median Change HIV-1 RNA Level Among Participants Completing Week 24 Visit

(NCT02384395)
Timeframe: Baseline, Week 24

Intervention	copies/mL (Median)
DTG/3TC/ABC FDC	-590211

[back to top]

Number of Participants With Grade 3 or Higher Adverse Event (AE)

Sign/symptom, lab toxicity, or clinical events, or Grade 3 or higher AE that is definitely, probably, or possibly related to study treatment (NCT02384395)
Timeframe: Baseline through Week 96

Intervention	Participants (Count of Participants)
DTG/3TC/ABC FDC	1

[back to top]

Number of Participants With Viral Load Measurement <200 Copies/mL at Week 24

Total number of participants on study at Week 24 with an HIV-1 RNA level less than 200 copies/mL (NCT02384395)
Timeframe: Week 24

Intervention	Participants (Count of Participants)
DTG/3TC/ABC FDC	34

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <40 c/mL at Weeks 48 and 96-Stage 1

Blood samples were collected for quantitative analysis of plasma HIV-1 RNA. Response was assessed using the last plasma HIV-1 RNA value in the predefined visit window to classify a participant's response status. The percentage of responders with HIV-1 RNA <40 c/mL at Weeks 48 and 96 using mITT Population (observed) which consisted of participants in the mITT Population excluding participants who had no HIV-1 RNA result data in the assessment visit windows due to discontinuation and who discontinued on or after the date of site notification of study termination by the sponsor (October 10, 2016) is presented. The study was terminated early during the primary end point analysis of Stage 1; hence, data was not collected for Week 96 analysis. (NCT02386098)
Timeframe: Weeks 48 and 96

Intervention	Percentage of participants (Number)
	Week 48; n=8, 9
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	75.0
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	66.7

[back to top]

Percentage of Participants With HIV-1 RNA <200 c/mL at Weeks 24, 48 and 96-Stage 1

Blood samples were collected for quantitative analysis of plasma HIV-1 RNA. Response was assessed using the last plasma HIV-1 RNA value in the predefined visit window to classify a participant's response status. The percentage of responders with HIV-1 RNA <200 c/mL at Weeks 24, 48 and 96 using mITT Population (observed) which consisted of participants in the mITT Population excluding participants who had no HIV-1 RNA result data in the assessment visit windows due to discontinuation and who discontinued on or after the date of site notification of study termination by the sponsor (October 10, 2016) is presented. The study was terminated early during the primary end point analysis of Stage 1; hence, data was not collected for Week 96 analysis. (NCT02386098)
Timeframe: Weeks 24, 48 and 96

Intervention	Percentage of participants (Number)
	Week 24; n=32, 29	Week 48; n=8, 9
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	93.8	100
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	89.7	100

[back to top]

Change From Baseline in Logarithm to the Base 10 (log10) HIV-1 RNA Over Time-Stage 1

Blood samples were collected for analysis of HIV-1 RNA. Baseline is the last value on or before the start of study treatment. Change from Baseline was calculated as the value at specified visit minus the Baseline value. Change from Baseline in plasma HIV-1 RNA (log10) is summarized over time for the mITT Population using observed values, which excluded participants without HIV-1 RNA result data in the assessment visit windows due to discontinuation and who discontinued on or after the date of site notification of study termination by the sponsor (10 October 2016). NA indicates data was not available. The standard deviation could not be calculated as a single participant was analyzed at the specified time point. (NCT02386098)
Timeframe: Baseline and up to Week 72

Intervention	log10 c/mL (Mean)
	Week 2; n=10, 5	Week 4; n=37, 33	Week 8; n=37, 30	Week 12; n=36, 32	Week 16; n=34, 32	Week 24; n=32, 29	Week 32; n=23, 23	Week 40; n=21, 15	Week 48; n=8, 9	Week 60; n=4, 3	Week 72; n=1, 1
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	-4.232	-4.400	-4.103	-4.394	-4.402	-4.220	-4.381	-4.366	-4.508	-5.037	-3.326
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	-4.050	-3.922	-4.145	-4.113	-4.074	-4.079	-3.364	-4.400	-4.680	-4.977	-5.713

[back to top]

Number of Participants With Occurrence of New Acquired Immunodeficiency Syndrome (AIDS) Defining Events-Stage 1

The occurrence of new AIDS defining events that is, Centers for Disease Control (CDC) Class C events in participants is presented. (NCT02386098)
Timeframe: Up to Week 96

Intervention	Participants (Count of Participants)
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	1
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	0

[back to top]

Percentage of Participants With Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) <40 Copies Per Milliliter (c/mL) at Week 24-Stage 1

Blood samples were collected for quantitative analysis of plasma HIV-1 RNA. Percentage of participants with plasma HIV-1 RNA <40 c/mL at Week 24 was assessed using the Food and Drug Administration (FDA) snapshot algorithm which used the last on-treatment plasma HIV-1 RNA measurement, within an FDA-specified visit window (18 to 30 weeks), to determine response. Analysis was performed on the modified intent to treat (mITT) Population which comprised of all randomized participants who received atleast one dose of BMS-955176 or TDF. (NCT02386098)
Timeframe: Week 24

Intervention	Percentage of participants (Number)
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	73.7
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	60.0

[back to top]

Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Count Over Time-Stage 1

The CD4+ cell count was assessed using flow cytometry. Baseline is the last value on or before the start of study treatment. Change from Baseline was calculated as the value at specified visit minus the Baseline value. NA indicates data was not available. The standard deviation could not be calculated as a single participant was analyzed at the specified time point. (NCT02386098)
Timeframe: Baseline and up to Week 72

Intervention	Cells per microliter (Mean)
	Week 4; n=37, 33	Week 8; n=36, 30	Week 12; n=35, 32	Week 16; n=34, 31	Week 24; n=31, 28	Week 32; n=23, 22	Week 40; n=20, 15	Week 48; n=7, 9	Week 60; n=4, 2	Week 72; n=1, 1
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	57.6	77.6	90.4	83.2	127.2	90.0	139.5	125.0	127.0	0.0
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	26.7	53.7	115.1	93.8	109.5	122.1	137.1	175.1	158.5	171.0

[back to top]

Change From Baseline in Percentage of CD4+ Cells Over Time-Stage 1

The percentage of CD4+ cells was assessed using flow cytometry. Baseline is the last value on or before the start of study treatment. Change from Baseline was calculated as the value at specified visit minus the Baseline value. NA indicates data was not available. The standard deviation could not be calculated as a single participant was analyzed at the specified time point. (NCT02386098)
Timeframe: Baseline and up to Week 72

Intervention	Percentage of CD4+ cells (Mean)
	Week 4; n=37, 33	Week 8; n=36, 30	Week 12; n=35, 32	Week 16; n=34, 31	Week 24; n=31, 28	Week 32; n=23, 22	Week 40; n=20, 15	Week 48; n=7, 9	Week 60; n=4, 2	Week 72; n=1, 1
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	1.94	1.80	3.41	3.14	4.71	4.13	5.38	7.09	7.95	12.50
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	1.82	1.69	2.88	3.66	4.72	4.81	5.38	7.16	10.05	10.70

[back to top]

Number of Participants With Serious Adverse Events (SAEs) and Adverse Events (AEs) Leading to Discontinuation (AELD)-Stage 1

An SAE is any untoward medical occurrence that at any dose: results in death; is life-threatening; requires inpatient hospitalization or causes prolongation of existing hospitalization; results in persistent or significant disability/incapacity; is a congenital anomaly/birth defect; or medical events that may jeopardize the participant or require intervention (medical or surgical) to prevent one of the outcomes mentioned before. The number of participants with SAEs and AELDs are presented. (NCT02386098)
Timeframe: Up to Week 96

Intervention	Participants (Count of Participants)
	SAEs	AELD
Stage 1: BMS-955176 120 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	4	2
Stage 1: TDF 300 mg QD+ATV/r 300/100 mg QD+DTG 50 mg QD	3	1

[back to top]

Percentage of Participants With HIV-1 RNA < 50 Copies/mL as Determined by the FDA-defined Snapshot Algorithm.

The percentage of participants achieving HIV-1 RNA < 50 copies/mL at Week 24 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02397694)
Timeframe: Week 24

Intervention	percentage of participants (Number)
BIC + F/TAF	96.9
DTG + F/TAF	93.9

[back to top]

Percentage of Participants With Treatment Emergent Adverse Events (TEAEs) During Double-Blinded Randomized Phase

(NCT02397694)
Timeframe: First dose date up to last dose (maximum duration: 58 Weeks) plus 30 days (During Double-Blinded Randomized Phase)

Intervention	percentage of participants (Number)
BIC + F/TAF	87.7
DTG + F/TAF	72.7

[back to top]

The Change From Baseline in CD4+ Cell Count at Week 24

(NCT02397694)
Timeframe: Baseline; Week 24

Intervention	CD4 Cell Count (/μL) (Mean)
BIC + F/TAF	190
DTG + F/TAF	155

[back to top]

The Change From Baseline in CD4+ Cell Count at Week 48

(NCT02397694)
Timeframe: Baseline; Week 48

Intervention	CD4 Cell Count (/μL) (Mean)
BIC + F/TAF	258
DTG + F/TAF	188

[back to top]

The Change From Baseline in Cluster of Differentiation 4 Positive (CD4+) Cell Count at Week 12

(NCT02397694)
Timeframe: Baseline; Week 12

Intervention	CD4 Cell Count (/μL) (Mean)
BIC + F/TAF	170
DTG + F/TAF	173

[back to top]

The Change From Baseline in log10 HIV-1 RNA at Week 12

(NCT02397694)
Timeframe: Baseline; Week 12

Intervention	log10 copies/mL (Mean)
BIC + F/TAF	-3.03
DTG + F/TAF	-3.15

[back to top]

The Change From Baseline in log10 HIV-1 RNA at Week 24

(NCT02397694)
Timeframe: Baseline; Week 24

Intervention	log10 copies/mL (Mean)
BIC + F/TAF	-3.09
DTG + F/TAF	-3.12

[back to top]

Percentage of Participants With Treatment Emergent Laboratory Abnormalities During Double-Blind Randomized Phase

(NCT02397694)
Timeframe: First dose date up to last dose (maximum duration: 58 Weeks) plus 30 days (During Double-Blinded Randomized Phase)

Intervention	percentage of participants (Number)
BIC + F/TAF	87.5
DTG + F/TAF	87.5

[back to top]

PK Parameter:Ctau for BIC, FTC and TFV

Ctau was defined as the observed drug concentration at the end of the dosing interval. (NCT02397694)
Timeframe: 0.5, 1, 1.5, 2, 3, 4, 6, 8, and 24 hours postdose at Week 4 or 8

Intervention	ng/mL (Mean)
	BIC	FTC	TFV
BIC + F/TAF	3508.6	76.6	10.7
DTG + F/TAF	NA	102.6	12.2

[back to top]

Percentage of Participants With HIV-1 RNA < 50 Copies/mL as Determined by the FDA-defined Snapshot Algorithm at Week 12

The percentage of participants achieving HIV-1 RNA < 50 copies/mL at Week 12 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02397694)
Timeframe: Week 12

Intervention	percentage of participants (Number)
BIC + F/TAF	93.8
DTG + F/TAF	93.9

[back to top]

The Change From Baseline in log10 HIV-1 RNA at Week 48

(NCT02397694)
Timeframe: Baseline; Week 48

Intervention	log10 copies/mL (Mean)
BIC + F/TAF	-3.09
DTG + F/TAF	-3.11

[back to top]

PK Parameter: AUCtau for BIC, FTC, TAF, and TFV

AUCtau is defined as the area under the concentration-time curve of the drug over time. (NCT02397694)
Timeframe: 0.5, 1, 1.5, 2, 3, 4, 6, 8, and 24 hours postdose at Week 4 or 8

Intervention	h*ng/mL (Mean)
	BIC	FTC	TAF	TFV
BIC + F/TAF	139778.8	11605.4	247.4	316.0
DTG + F/TAF	NA	14689.8	245.6	369.4

[back to top]

PK Parameter: Cmax for Bictegravir (BIC), Emtricitabine (FTC), Tenofovir Alafenamide (TAF) and Tenofavir (TFV) at Steady-State

Cmax is the maximum observed plasma concentration of the drug. (NCT02397694)
Timeframe: 0.5, 1, 1.5, 2, 3, 4, 6, 8, and 24 hours postdose at Week 4 or 8

Intervention	ng/mL (Mean)
	BIC	FTC	TAF	TFV
BIC + F/TAF	9344.3	1919.1	249.1	19.1
DTG + F/TAF	NA	2157.1	260.8	20.9

[back to top]

PK Parameter: t1/2 of BIC, FTC, TAF, and TFV

t1/2 was defined as the terminal elimination half-life of the drug (NCT02397694)
Timeframe: 0.5, 1, 1.5, 2, 3, 4, 6, 8, and 24 hours postdose at Week 4 or 8

Intervention	hours (Median)
	BIC	FTC	TAF	TFV
BIC + F/TAF	16.73	5.46	0.37	37.74
DTG + F/TAF	NA	5.70	0.42	34.47

[back to top]

PK Parameter: Tmax for BIC, FTC, TAF, and TFV at Steady-State

Tmax was defined as the time to Cmax. (NCT02397694)
Timeframe: 0.5, 1, 1.5, 2, 3, 4, 6, 8, and 24 hours postdose at Week 4 or 8

Intervention	hours (Median)
	BIC	FTC	TAF	TFV
BIC + F/TAF	2.00	1.50	1.00	1.50
DTG + F/TAF	NA	1.50	1.00	2.00

[back to top]

Percentage of Participants With HIV-1 RNA < 50 Copies/mL as Determined by the FDA-defined Snapshot Algorithm at Week 48

The percentage of participants achieving HIV-1 RNA < 50 copies/mL at Week 48 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02397694)
Timeframe: Week 48

Intervention	percentage of participants (Number)
BIC + F/TAF	96.9
DTG + F/TAF	90.9

[back to top]

Dolutegravir AUC Pharmacokinetics

Determine Dolutegravir area-under-the concentration time curve (AUC) when administered alone and when co-administered with simeprevir. (NCT02404805)
Timeframe: Pre-dose and, 1, 2, 3, 4, 5, 6, 8, 10, 12 and 24 hours post-dose on day 7

Intervention	ng*h/mL (Geometric Mean)
Dolutegravir Administered Alone	68186
Simeprevir and Dolutegravier Co-administered	78433

[back to top]

Simeprevir AUC Pharmacokinetics

Determine simeprevir area-under-the concentration time curve (AUC) when administered alone and when being co-administered with Dolutegravier. (NCT02404805)
Timeframe: Pre-dose and, 1, 2, 3, 4, 5, 6, 8, 10, 12 and 24 hours post-dose on day 7

Intervention	ng*h/mL (Geometric Mean)
Simeprevir Administered Alone	30946
Simeprevir and Dolutegravier Co-administered	30333

[back to top]

Change in CD4+ T-cell Count

Changes in CD4+ T-cell count were calculated as the CD4+ T-cell count at a given time point minus the CD4+ T-cell count at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Weeks 24, 48, and 96

Intervention	cells/mm^3 (Mean)
	Change from Baseline in CD4 Count (Week 24)	Change from Baseline in CD4 Count (Week 48)	Change from Baseline in CD4 Count (Week 96)
Arm A: Placebo MVC and Placebo DTG	-13	-43	-10
Arm B: DTG and Placebo MVC	-33	-19	10
Arm C: MVC and DTG	42	21	44

[back to top]

Number of Participants With Plasma HIV-1 RNA Greater Than or Equal to 50 Copies/mL

The number of participants with Plasma HIV-1 RNA greater than or equal to 50 copies/mL was assessed at each given time point. (NCT02519777)
Timeframe: Measured at Weeks 24, 48, and 96

Intervention	Participants (Count of Participants)
	HIV RNA (Week 24)	HIV RNA (Week 48)	HIV RNA (Week 96)
Arm A: Placebo MVC and Placebo DTG	3	3	1
Arm B: DTG and Placebo MVC	1	0	6
Arm C: MVC and DTG	1	1	2

[back to top]

Change in Log10 MIP-1 Beta in Cerebrospinal Fluid (CSF) at Week 48 From Baseline

Changes in Log10 MIP-1 Beta in CSF were calculated as the Log10 MIP-1 Beta in CSF at Week 48 minus the Log10 MIP-1 Beta in CSF at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 pg/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	-0.24
Arm B: DTG and Placebo MVC	-0.32
Arm C: MVC and DTG	0.17

[back to top]

Change in Log10 sTNFr-II in Plasma at Week 48 From Baseline

Changes in Log10 sTNFr-II in Plasma were calculated as the Log10 sTNFr-II in Plasma at Week 48 minus the Log10 sTNFr-II in Plasma at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 pg/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	0.02
Arm B: DTG and Placebo MVC	0.01
Arm C: MVC and DTG	0.00

[back to top]

Change in Log10 sCD14 in Plasma at Week 48 From Baseline

Changes in Log10 sCD14 in Plasma were calculated as the Log10 sCD14 in Plasma at Week 48 minus the Log10 sCD14 in Plasma at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 ng/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	0.04
Arm B: DTG and Placebo MVC	0.03
Arm C: MVC and DTG	0.01

[back to top]

Change in Log10 Neopterin in CSF at Week 48 From Baseline

Changes in Log10 Neopterin in CSF were calculated as the Log10 Neopterin in CSF at Week 48 minus the Log10 Neopterin in CSF at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 nmol/L (Mean)
Arm A: Placebo MVC and Placebo DTG	0.01
Arm B: DTG and Placebo MVC	-0.06
Arm C: MVC and DTG	-0.17

[back to top]

Change in Normalized Composite Neurocognitive Test Score at Weeks 24, 72, and 96 From Baseline

"The normalized composite neurocognitive test score (total z-score) was defined as the average of the z-scores from the following tests:~Domestic and International Participants:~Grooved pegboard dominant~Grooved pegboard non-dominant~HVLT-R Learning trials~HVLT-R Delayed recall~HVLT-R Delayed recognition~Semantic verbal fluency~Domestic only:~Stroop color naming~Stroop word reading~Stroop interference trial~Letter fluency~Trail Making A~Trail Making B~WAIS-III Symbol search~Digit Symbol~International only:~Timed Gait~Finger Tapping Dominant~Finger Tapping Non-dominant~Color Trail 1~Color Trail 2~Z-scores were calculated using a demographically appropriate norming process. Higher z-scores correspond with better neurocognitive performance. Change was calculated as the total z-score at the given time point minus the total z-score at Baseline." (NCT02519777)
Timeframe: Measured at Baseline and Weeks 24, 72, and 96

Intervention	total neurocognitive z-score (Mean)
	Change of Normalized Composite Neurocognitive Test Score (Week 24)	Change of Normalized Composite Neurocognitive Test Score (Week 72)	Change of Normalized Composite Neurocognitive Test Score (Week 96)
Arm A: Placebo MVC and Placebo DTG	0.14	0.29	0.37
Arm B: DTG and Placebo MVC	0.18	0.32	0.34
Arm C: MVC and DTG	0.20	0.37	0.38

[back to top]

Change in Functional Status Scores

Functional status scores were calculated based on the instrumental activities of daily living (IADLs) forms. IADL scores were calculated as the sum of the eight IADL tasks where the task scores were equal to 1 if a participant did not need assistance with the task and equal to 0 if a participant needed some level of help with the task. The maximum possible functional status score was 8, while the minimum possible functional status score was 0, with higher functional status scores indicating a higher level of functionality. (NCT02519777)
Timeframe: Measured at Baseline and Weeks 24, 48, 72, and 96

Intervention	units on a scale (Mean)
	Change from Baseline in IADL Score (Week 24)	Change from Baseline in IADL Score (Week 48)	Change from Baseline in IADL Score (Week 72)	Change from Baseline in IADL Score (Week 96)
Arm A: Placebo MVC and Placebo DTG	0.29	0.38	0.40	0.16
Arm B: DTG and Placebo MVC	0.43	0.45	0.30	0.28
Arm C: MVC and DTG	0.15	0.10	0.13	0.20

[back to top]

Change in CD8+ T-cell Count

Changes in CD8+ T-cell count were calculated as the CD8+ T-cell count at a given time point minus the CD8+ T-cell count at baseline. (NCT02519777)
Timeframe: Measured at Baseline and Weeks 24, 48, and 96

Intervention	cells/mm^3 (Mean)
	Change from Baseline in CD8 Count (Week 24)	Change from Baseline in CD8 Count (Week 48)	Change from Baseline in CD8 Count (Week 96)
Arm A: Placebo MVC and Placebo DTG	-29	-45	-43
Arm B: DTG and Placebo MVC	-61	-82	-33
Arm C: MVC and DTG	44	35	44

[back to top]

CD8+ T-cell Counts

CD8+ T-cell counts were recorded at the given time point (NCT02519777)
Timeframe: Measured at Weeks 24, 48, and 96

Intervention	cells/mm^3 (Mean)
	CD8 Count (Week 24)	CD8 Count (Week 48)	CD8 Count (Week 96)
Arm A: Placebo MVC and Placebo DTG	757	742	747
Arm B: DTG and Placebo MVC	752	731	773
Arm C: MVC and DTG	862	856	879

[back to top]

CD4+ T-cell Counts

CD4+ T-cell counts were recorded at the given time point (NCT02519777)
Timeframe: Measured at Weeks 24, 48, and 96

Intervention	cells/mm^3 (Mean)
	CD4 Count (Week 24)	CD4 Count (Week 48)	CD4 Count (Week 96)
Arm A: Placebo MVC and Placebo DTG	660	638	674
Arm B: DTG and Placebo MVC	669	691	720
Arm C: MVC and DTG	773	758	788

[back to top]

Number of Participants With Treatment Related Adverse Events (AEs)

Treatment Related Adverse Events were determined by the study sites indicating a relationship between an adverse event and the study treatment. (NCT02519777)
Timeframe: Measured from treatment initiation through Week 96

Intervention	Participants (Count of Participants)
Arm A: Placebo MVC and Placebo DTG	3
Arm B: DTG and Placebo MVC	5
Arm C: MVC and DTG	7

[back to top]

Change in Normalized Composite Neurocognitive Test Score at Week 48 From Baseline

"The normalized composite neurocognitive test score (total z-score) was defined as the average of the z-scores from the following tests:~Domestic (US-based) and International Participants:~Grooved pegboard dominant~Grooved pegboard non-dominant~Hopkins Verbal Learning Test (HVLT-R) Learning trials~HVLT-R Delayed recall~HVLT-R Delayed recognition~Semantic verbal fluency~Domestic only:~Stroop color naming~Stroop word reading~Stroop interference trial~Letter fluency~Trail Making A~Trail Making B~WAIS-III Symbol search~Digit Symbol~International only:~Timed Gait~Finger Tapping Dominant~Finger Tapping Non-dominant~Color Trail 1~Z-scores were calculated using a demographically appropriate norming process. Higher z-scores correspond with better neurocognitive performance. Change was calculated as the total z-score at Week 48 minus the total z-score at Baseline." (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	total neurocognitive z-score (Mean)
Arm A: Placebo MVC and Placebo DTG	0.20
Arm B: DTG and Placebo MVC	0.26
Arm C: MVC and DTG	0.31

[back to top]

Change in Log10 VCAM in Plasma at Week 48 From Baseline

Changes in Log10 VCAM in Plasma were calculated as the Log10 VCAM in Plasma at Week 48 minus the Log10 VCAM in Plasma at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 pg/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	0.01
Arm B: DTG and Placebo MVC	0.00
Arm C: MVC and DTG	0.00

[back to top]

Change in Log10 MIP-1 Beta in Plasma at Week 48 From Baseline

Changes in Log10 MIP-1 Beta in Plasma were calculated as the Log10 MIP-1 Beta in Plasma at Week 48 minus the Log10 MIP-1 Beta in Plasma at Baseline. Results below the lower limit of quantification were set to the lower limit value of 11. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 pg/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	0.05
Arm B: DTG and Placebo MVC	-0.02
Arm C: MVC and DTG	0.30

[back to top]

Change in Log10 NFL in CSF at Week 48 From Baseline

Changes in Log10 NFL in CSF were calculated as the Log10 NFL in CSF at Week 48 minus the Log10 NFL in CSF at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 pg/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	-0.02
Arm B: DTG and Placebo MVC	-0.05
Arm C: MVC and DTG	0.00

[back to top]

Change in Log10 IP-10 in CSF at Week 48 From Baseline

Changes in Log10 IP-10 in CSF were calculated as the Log10 IP-10 in CSF at Week 48 minus the Log10 IP-10 in CSF at Baseline. (NCT02519777)
Timeframe: Measured at Baseline and Week 48

Intervention	Log10 pg/mL (Mean)
Arm A: Placebo MVC and Placebo DTG	0.02
Arm B: DTG and Placebo MVC	-0.11
Arm C: MVC and DTG	-0.36

[back to top]

Proportion of Participants With Plasma HIV-1 RNA <200 Copies/mL- ITT Missing = Ignored

Proportion of participants with HIV-1 RNA < 200 copies/mL by week, ITT (missing = ignored) population. (NCT02582684)
Timeframe: Weeks 2, 4, 8, 12, 16, 20, 24, 32, 40 and 48

Intervention	proportion of participants (Number)
	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	0.71	0.94	0.98	0.98	0.98	0.99	0.97	0.95	0.96	0.96

[back to top]

Proportion of Participants With Plasma HIV-1 RNA <50 Copies/mL - Missing = Ignored

Proportion of participants with HIV-1 RNA < 50 copies/mL by week, ITT (missing = ignored) population. (NCT02582684)
Timeframe: Weeks 2, 4, 8, 12, 16, 20, 24, 32, 40 and 48

Intervention	proportion of participants (Number)
	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	0.41	0.70	0.88	0.94	0.94	0.94	0.96	0.93	0.95	0.94

[back to top]

Proportion of Participants With Plasma HIV-1 RNA <50 Copies/mL- As Treated

Proportion of participants with HIV-1 RNA < 50 copies/mL by week, as treated population. (NCT02582684)
Timeframe: Weeks 2, 4, 8, 12, 16, 20, 24, 32, 40 and 48

Intervention	proportion of participants (Number)
	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	0.41	0.70	0.88	0.94	0.94	0.94	0.96	0.95	0.97	0.97

[back to top]

CD4+ Cell Count

CD4+ cell counts by study week. (NCT02582684)
Timeframe: Baseline, weeks 4, 12, 24, and 48

Intervention	cells/mm^3 (Median)
	Week 0	Week 4	Week 12	Week 24	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	387	473	520	582	579

[back to top]

Number of HIV-1 Drug Resistance Mutation Occurrences in Participants

Number of HIV-1 drug resistance mutation occurrences participants with virologic failure and FDA snapshot non-successes. Participants that had one drug class resistance mutation may have one or more mutations. (NCT02582684)
Timeframe: at the time of virologic failure

Intervention	number of mutation occurrences (Number)
	NRTI mutation	NNRTI mutation	INI mutation
Arm 1: DTG 50 MG + 3TC 300 mg	1	1	1

[back to top]

Fasting Lipids and Glucose

Fasting lipids include: total cholesterol, triglycerides, LDL cholesterol, HDL cholesterol, and glucose. Fasting was set to be 8 hours prior to the sample collection. (NCT02582684)
Timeframe: Baseline and week 48

Intervention	mg/dL (Median)
	Baseline Total Cholesterol	Week 48 Total Cholesterol	Baseline LDL Cholesterol	Week 48 LDL Cholesterol	Baseline HDL Cholesterol	Week 48 HDL Cholesterol	Baseline Triglycerides	Week 48 Triglycerides	Baseline Glucose	Week 48 Glucose
Arm 1: DTG 50 MG + 3TC 300 mg	151	154	85	86	39	46	91	98	84	86

[back to top]

Proportion of Participants With Plasma HIV-1 RNA <200 Copies/mL- As Treated

Proportion of participants with HIV-1 RNA < 200 copies/mL by week, as treated population. (NCT02582684)
Timeframe: Weeks 2, 4, 8, 12, 16, 20, 24, 32, 40 and 48

Intervention	proportion of participants (Number)
	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	0.71	0.94	0.98	0.98	0.98	0.99	0.98	0.97	0.99	1.00

[back to top]

Creatinine Clearance

Creatinine clearance was estimated by the Cockcroft-Gault equation. (NCT02582684)
Timeframe: Baseline, weeks 4, 12, 24, 32, 40 and 48

Intervention	mL/min (Median)
	Week 0	Week 4	Week 12	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	126.0	112.9	112.0	114.7	115.5	112.7	114.4

[back to top]

Change in CD4+ Cell Count

Change in CD4+ cell counts by study week. Change was calculated as value at the later visit minus the value at baseline. (NCT02582684)
Timeframe: Baseline, weeks 4, 12, 24, and 48

Intervention	cells/mm^3 (Median)
	Change from Baseline to Week 4	Change from Baseline to Week 12	Change from Baseline to Week 24	Change from Baseline to Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	78	122	167	182

[back to top]

Number of Participants With Grade 3 of Higher Adverse Events

Number of participants who experienced an AE (sign/symptom or laboratory abnormality) of Grade 3 or higher. The AEs were graded by the clinicians according to the Division of AIDS (DAIDS) AE Grading Table (see reference in the Protocol Section) as follows: Grade 1=Mild, Grade 2=Moderate, Grade 3=Severe, Grade 4=Potentially Life-Threatening. (NCT02582684)
Timeframe: from study treatment dispensation through up to week 52 or until study discontinuation

Intervention	Participants (Count of Participants)
Arm 1: DTG 50 MG + 3TC 300 mg	16

[back to top]

Proportion of Participants With Plasma HIV-1 RNA < 200 Copies/mL - Missing = Failure

Proportion of participants with HIV-1 RNA < 200 copies/mL by week, ITT (missing/off study/off treatment = failure) population. (NCT02582684)
Timeframe: Weeks 2, 4, 8, 12, 16, 20, 24, 32, 40 and 48

Intervention	proportion of participants (Number)
	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	0.68	0.90	0.95	0.93	0.92	0.95	0.92	0.89	0.91	0.87

[back to top]

Proportion of Participants With Plasma HIV-1 RNA < 50 Copies/mL - Missing = Failure

Proportion of participants with HIV-1 RNA < 50 copies/mL by week, ITT (Intention To Treat; missing/off study/off treatment = failure) population. (NCT02582684)
Timeframe: Weeks 2, 4, 8, 12, 16, 20, 24, 32, 40 and 48

Intervention	proportion of participants (Number)
	Week 2	Week 4	Week 8	Week 12	Week 16	Week 20	Week 24	Week 32	Week 40	Week 48
Arm 1: DTG 50 MG + 3TC 300 mg	0.40	0.68	0.85	0.89	0.88	0.90	0.90	0.88	0.89	0.84

[back to top]

Percentage of Participants With an Occurrence of QTcF Greater Than 500 Milliseconds (ms)

Participants who experienced QTcF greater than 500 ms at least once at any time from week 2 to 24. QTcF calculated as average of 1-3 available QTcF values per visit. (NCT02583048)
Timeframe: At weeks 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24

Intervention	Percentage of participants (Number)
Arm 1: Bedaquiline	0
Arm 2: Delamanid	0
Arm 3: Bedaquiline and Delamanid	0

[back to top]

Mean Change From Baseline in QTcF

Mean change from baseline in QTcF (ie, QTcF prolongation) in milliseconds (ms), where baseline QTcF was represented by QTcF durations measured at week 0, and post-baseline QTcF was represented by QTcF durations measured at weeks 8 through 24 (pooled). QTcF calculated as average of 1-3 available QTcF values per visit. (NCT02583048)
Timeframe: Baseline and at weeks 8, 10, 12, 14, 16, 18, 20, 22 and 24

Intervention	milliseconds (ms) (Mean)
Arm 1: Bedaquiline	12.3
Arm 2: Delamanid	8.6
Arm 3: Bedaquiline and Delamanid	20.7

[back to top]

N-monodesmethyl Metabolite of BDQ PK Parameter Cmax Determined Based on BDQ Metabolite Levels From Individual Participants Enrolled in Arms 1 and 3

This evaluates the effect of DLM on the BDQ Metabolite N-monodesmethyl BDQ PK parameter Cmax obtained from participants enrolled in Arms 1 and 3 (without and with co-administration of DLM). Cmax defines maximum concentration observed over the first 22 hours of the BDQ dosing interval. (NCT02583048)
Timeframe: Intensive BDQ Metabolite PK samples at pre-dose, 5h, 7h, 10h and 22h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 1: Bedaquiline	404.8	248.5	232.9
Arm 3: Bedaquiline and Delamanid	429.8	241.5	196.8

[back to top]

Percentage of Participants Who Discontinued Study TB Drug(s) For Any Reason

Percentage of participants who discontinued study TB drug(s) for any reason (NCT02583048)
Timeframe: From initiation of study TB treatment (week 0) to week 24

Intervention	Percentage of participants (Number)
Arm 1: Bedaquiline	11
Arm 2: Delamanid	19
Arm 3: Bedaquiline and Delamanid	22

[back to top]

Percentage of Participants With an Increase in QTcF From Baseline of Greater Than 60 Milliseconds (ms)

Participants who experienced QTcF increase from baseline greater than 60 ms at least once at any time from week 2 to 24. QTcF calculated as average of 1-3 available QTcF values per visit. (NCT02583048)
Timeframe: Baseline and at weeks 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24

Intervention	Percentage of participants (Number)
Arm 1: Bedaquiline	4
Arm 2: Delamanid	0
Arm 3: Bedaquiline and Delamanid	7

[back to top]

Percentage of Participants Who Died

Among participants who took at least one dose of study TB treatment, percentage of participants who died on or before week 24. Note that the all-cause mortality includes deaths that occurred at any time during treatment or follow-up through week 128. (NCT02583048)
Timeframe: From initiation of study TB treatment (week 0) to week 24

Intervention	Percentage of participants (Number)
Arm 1: Bedaquiline	0
Arm 2: Delamanid	0
Arm 3: Bedaquiline and Delamanid	0

[back to top]

Percentage of Participants With an Occurrence of QTcF >480 and ≤500 Milliseconds (ms)

Participants who experienced QTcF >480 and ≤500 ms at least once at any time from week 2 to 24. QTcF calculated as average of 1-3 available QTcF values per visit. (NCT02583048)
Timeframe: At weeks 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24

Intervention	Percentage of participants (Number)
Arm 1: Bedaquiline	0
Arm 2: Delamanid	0
Arm 3: Bedaquiline and Delamanid	0

[back to top]

Percentage of Participants With an Occurrence of QTcF Increase From Baseline of >30 and ≤60 Milliseconds (ms)

Participants who experienced QTcF increase from baseline of >30 and ≤60 ms at least once at any time from week 2 to 24. QTcF calculated as average of 1-3 available QTcF values per visit. (NCT02583048)
Timeframe: Baseline and at weeks 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24

Intervention	Percentage of participants (Number)
Arm 1: Bedaquiline	32
Arm 2: Delamanid	41
Arm 3: Bedaquiline and Delamanid	37

[back to top]

BDQ PK Parameter Area Under the Concentration Time Curve (AUC 0-22h) Calculated Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 1 and 3

This evaluates the effect of DLM on the BDQ PK parameter AUC 0-22h obtained from participants enrolled in Arms 1 and 3 (without and with co-administration of DLM). AUC 0-22h defines area under the concentration-time curve over the period of 22 hours post-dose. (NCT02583048)
Timeframe: Intensive BDQ PK samples at pre-dose, 5h, 7h, 10h and 22h post-dose at Weeks 2, 8 and 24

Intervention	ng*h/mL (Mean)
	Week 2	Week 8	Week 24
Arm 1: Bedaquiline	31570.9	19234.6	21048.5
Arm 3: Bedaquiline and Delamanid	32399.4	20176.1	19522.6

[back to top]

BDQ PK Parameter Maxmum Plasma Concentration (Cmax) Determined Based on BDQ Levels From Individual Participants Enrolled in Arms 1 and 3

This evaluates the effect of DLM on the BDQ PK parameter Cmax obtained from participants enrolled in Arms 1 and 3 (without and with co-administration of DLM). Cmax defines maximum concentration observed over the first 22 hours of the BDQ dosing interval. (NCT02583048)
Timeframe: Intensive BDQ PK samples at pre-dose, 5h, 7h, 10h and 22h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 1: Bedaquiline	2434.3	1455.6	1507.3
Arm 3: Bedaquiline and Delamanid	2405.2	1477.2	1368.2

[back to top]

BDQ PK Parameter Minimum Plasma Concentration (Cmin) Determined Based on BDQ Levels From Individual Participants Enrolled in Arms 1 and 3

This evaluates the effect of DLM on the BDQ PK parameter Cmin obtained from participants enrolled in Arms 1 and 3 (without and with co-administration of DLM). Cmin defines minimum concentration observed over the first 22 hours of the BDQ dosing interval. (NCT02583048)
Timeframe: Intensive BDQ PK samples at pre-dose, 5h, 7h, 10h and 22h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 1: Bedaquiline	796.8	505.9	653.4
Arm 3: Bedaquiline and Delamanid	850.9	601.9	629.4

[back to top]

Changes in QTcF From Baseline

Change from baseline in QTcF, calculated as the difference between each post-baseline week and week 0. (QTcF calculated as average of 1-3 available QTcF values per visit.) (NCT02583048)
Timeframe: Baseline and at weeks 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 and 28.

Intervention	milliseconds (ms) (Median)
	Change from baseline to Week 2	Change from baseline to Week 4	Change from baseline to Week 6	Change from baseline to Week 8	Change from baseline to Week 10	Change from baseline to Week 12	Change from baseline to Week 14	Change from baseline to Week 16	Change from baseline to Week 18	Change from baseline to Week 20	Change from baseline to Week 22	Change from baseline to Week 24	Change from baseline to Week 28
Arm 1: Bedaquiline	16.70	15.00	15.30	12.00	10.30	9.30	12.70	15.35	17.65	9.30	12.00	11.70	13.30
Arm 2: Delamanid	4.15	8.70	9.30	7.00	7.80	10.30	5.30	7.35	11.70	13.65	9.00	13.00	6.00
Arm 3: Bedaquiline and Delamanid	13.15	14.30	15.30	20.30	18.30	20.30	21.30	21.00	12.70	21.00	20.85	24.00	17.65

[back to top]

DLM Metabolite DM6705 PK AUC 0-11h Determined Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 2 and 3

This evaluates the effect of BDQ on the DLM Metabolite DM6705 PK parameter AUC 0-11h obtained from participants enrolled in Arms 2 and 3 (without and with co-administration of BDQ). AUC 0-11h defines area under the concentration-time curve over the first 11 hours of the DLM dosing interval. (NCT02583048)
Timeframe: Intensive DLM PK samples at pre-dose, 4h, 8h, and 11h post-dose at weeks 2, 8 and 24

Intervention	ng*h/mL (Mean)
	Week 2	Week 8	Week 24
Arm 2: Delamanid	628.0	953.9	749.9
Arm 3: Bedaquiline and Delamanid	621.2	990.9	742.5

[back to top]

DLM Metabolite DM6705 PK Parameter Cmax Determined Based on DLM Metabolite Levels From Individual Participants Enrolled in Arms 2 and 3

This evaluates the effect of BDQ on the DLM Metabolite DM6705 PK parameter Cmax obtained from participants enrolled in Arms 2 and 3 (without and with co-administration of BDQ). Cmax defines maximum concentration observed over the first 11 hours of the DLM dosing interval. (NCT02583048)
Timeframe: Intensive DLM PK samples at pre-dose, 4h, 8h, and 11h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 2: Delamanid	66.6	99.7	82.1
Arm 3: Bedaquiline and Delamanid	64.3	105.4	75.6

[back to top]

DLM Metabolite DM6705 PK Parameter Cmin Determined Based on DLM Metabolite Levels From Individual Participants Enrolled in Arms 2 and 3

This evaluates the effect of BDQ on the DLM Metabolite DM6705 PK parameter Cmin obtained from participants enrolled in Arms 2 and 3 (without and with co-administration of BDQ). Cmin defines minimum concentration observed over the first 11 hours of the DLM dosing interval. (NCT02583048)
Timeframe: Intensive DLM PK samples at pre-dose, 4h, 8h, and 11h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 2: Delamanid	61.9	90.6	75.7
Arm 3: Bedaquiline and Delamanid	58.5	94.4	71.0

[back to top]

DLM PK Area Under the Concentration Time Curve (AUC 0-11h) Determined Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 2 and 3

This evaluates the effect of BDQ on the DLM PK parameter AUC 0-11h obtained from participants enrolled in Arms 2 and 3 (without and with co-administration of BDQ). AUC 0-11h defines area under the concentration-time curve over the first 11 hours of the DLM dosing interval. (NCT02583048)
Timeframe: Intensive DLM PK samples at pre-dose, 4h, 8h, and 11h post-dose at weeks 2, 8 and 24

Intervention	ng*h/mL (Mean)
	Week 2	Week 8	Week 24
Arm 2: Delamanid	2789.6	2547.6	2473.0
Arm 3: Bedaquiline and Delamanid	2654.9	2823.2	2324.9

[back to top]

DLM PK Parameter Cmax Determined Based on DLM Levels From Individual Participants Enrolled in Arms 2 and 3

This evaluates the effect of BDQ on the DLM PK parameter Cmax obtained from participants enrolled in Arms 2 and 3 (without and with co-administration of BDQ). Cmax defines maximum concentration observed over the first 11 hours of the DLM dosing interval. (NCT02583048)
Timeframe: Intensive DLM PK samples at pre-dose, 4h, 8h, and 11h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 2: Delamanid	317.8	294.1	290.3
Arm 3: Bedaquiline and Delamanid	298.3	320.9	259.0

[back to top]

N-monodesmethyl Metabolite of BDQ PK Parameter AUC 0-22h Calculated Based on Intensive PK Samples Obtained From Individual Participants Enrolled in Arms 1 and 3

This evaluates the effect of DLM on the N-monodesmethyl Metabolite of BDQ PK parameter AUC 0-22h obtained from participants enrolled in Arms 1 and 3 (without and with co-administration of DLM). AUC 0-22h defines area under the concentration-time curve over the period of 22 hours post-dose. (NCT02583048)
Timeframe: Intensive BDQ PK samples at pre-dose, 5h, 7h, 10h and 22h post-dose at Weeks 2, 8 and 24

Intervention	ng*h/mL (Mean)
	Week 2	Week 8	Week 24
Arm 1: Bedaquiline	8435.5	5067.5	4771.4
Arm 3: Bedaquiline and Delamanid	8713.4	4963.4	4033.5

[back to top]

N-monodesmethyl Metabolite of BDQ PK Parameter Cmin Determined Based on BDQ Metabolite Levels From Individual Participants Enrolled in Arms 1 and 3

This evaluates the effect of DLM on the N-monodesmethyl Metabolite of BDQ PK parameter Cmin obtained from participants enrolled in Arms 1 and 3 (without and with co-administration of DLM). Cmin defines minimum concentration observed over the first 22 hours of the BDQ dosing interval. (NCT02583048)
Timeframe: Intensive BDQ Metabolite PK samples at pre-dose, 5h, 7h, 10h and 22h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 1: Bedaquiline	353.3	200.0	204.0
Arm 3: Bedaquiline and Delamanid	361.6	204.7	174.0

[back to top]

Percentage of Participants With an Occurrence of Grade 3 or Higher Adverse Event

Participants with an occurrence of an adverse event (laboratory value, sign/symptom, diagnosis) of grade 3 or 4. Severity grading based on DAIDS AE Grading Table Version 2.0. Participants were counted once at the highest grade (grade 3 or grade 4). (NCT02583048)
Timeframe: From initiation of study TB treatment (week 0) to week 24

Intervention	Percentage of participants (Number)
	Grade 3 adverse event	Grade 4 adverse event
Arm 1: Bedaquiline	36	4
Arm 2: Delamanid	11	11
Arm 3: Bedaquiline and Delamanid	19	19

[back to top]

Post-Baseline QTcF

Baseline and post-baseline absolute QTcF in milliseconds (ms) estimated using an ANOVA model, where baseline QTcF was represented by QTcF durations measured at week 0, and post-baseline QTcF was represented by QTcF durations measured at weeks 8 through 24 (pooled). QTcF calculated as average of 1-3 available QTcF values per visit. Interim analysis conducted when week 24 QT data was available for ≥12 participants stipulated 99.9% confidence interval; original coverage of 95% was widened to 95.1%. (NCT02583048)
Timeframe: Baseline and at weeks 8, 10, 12, 14, 16, 18, 20, 22, and 24.

Intervention	milliseconds (ms) (Least Squares Mean)
	Baseline	Post-baseline
Arm 1: Bedaquiline	397.4	409.7
Arm 2: Delamanid	404.9	413.4
Arm 3: Bedaquiline and Delamanid	391.7	412.4

[back to top]

DLM PK Parameter Cmin Determined Based on DLM Levels From Individual Participants Enrolled in Arms 2 and 3

This evaluates the effect of BDQ on the DLM PK parameter Cmin obtained from participants enrolled in Arms 2 and 3 (without and with co-administration of BDQ). Cmin defines minimum concentration observed over the first 11 hours of the DLM dosing interval. (NCT02583048)
Timeframe: Intensive DLM PK samples at pre-dose, 4h, 8h, and 11h post-dose at weeks 2, 8 and 24

Intervention	ng/mL (Mean)
	Week 2	Week 8	Week 24
Arm 2: Delamanid	224.8	198.2	220.9
Arm 3: Bedaquiline and Delamanid	206.8	217.2	182.2

[back to top]

Change From Baseline in CD4+ Cell Count at Week 96

(NCT02607956)
Timeframe: Baseline, Week 96

Intervention	cells/μL (Mean)
B/F/TAF	237
DTG + F/TAF	281

[back to top]

Change From Baseline in CD4+ Cell Count at Week 48 Open-Label

(NCT02607956)
Timeframe: Baseline, open-label Week 48

Intervention	cells/μL (Mean)
All B/F/TAF	304
DTG + F/TAF to B/F/TAF	9

[back to top]

Change From Baseline in CD4+ Cell Count at Week 96 Open-Label

(NCT02607956)
Timeframe: Baseline, open-label Week 96

Intervention	cells/µL (Mean)
All B/F/TAF	336
DTG + F/TAF to B/F/TAF	-10

[back to top]

Change From Baseline in CD4+ Cell Count at Week 48

(NCT02607956)
Timeframe: Baseline, Week 48

Intervention	cells/μL (Mean)
B/F/TAF	180
DTG + F/TAF	201

[back to top]

Change From Baseline in CD4+ Cell Count at Week 144

(NCT02607956)
Timeframe: Baseline, Week 144

Intervention	cells/μL (Mean)
B/F/TAF	278
DTG + F/TAF	289

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 96 Open-Label as Defined by Missing = Excluded Algorithm

The percentage of participants with HIV-1 RNA < 50 copies/mL was analyzed using Missing = Excluded for imputing missing HIV-1 RNA values using the All B/F/TAF Analysis Set for the all B/F/TAF analysis. All missing data was excluded in the computation of the percentages (ie, missing data points were excluded from both the numerator and denominator in the computation). The denominator for percentages at a visit was the number of participants in the all B/F/TAF analysis set with nonmissing HIV-1 RNA value at that visit. (NCT02607956)
Timeframe: Baseline, open-label Week 96

Intervention	percentage of participants (Number)
All B/F/TAF	99.5
DTG + F/TAF to B/F/TAF	99.1

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 96 Open-Label as Defined by Missing = Failure Algorithm

The percentage of participants with HIV-1 RNA < 50 copies/mL was analyzed using Missing = Failure for imputing missing HIV-1 RNA values using the All B/F/TAF Analysis Set for the all B/F/TAF analysis. All missing data was treated as HIV-1 RNA ≥ 50 copies/mL. The denominator for percentages was the number of participants in all B/F/TAF analysis set. (NCT02607956)
Timeframe: Baseline, open-label Week 96

Intervention	percentage of participants (Number)
All B/F/TAF	68.1
DTG + F/TAF to B/F/TAF	87.5

[back to top]

Change From Baseline in log10 HIV-1 RNA at Week 48

(NCT02607956)
Timeframe: Baseline, Week 48

Intervention	log10 copies/mL (Mean)
B/F/TAF	-3.07
DTG + F/TAF	-3.12

[back to top]

Change From Baseline in log10 HIV-1 RNA at Week 96

(NCT02607956)
Timeframe: Baseline, Week 96

Intervention	log10 copies/mL (Mean)
B/F/TAF	-3.08
DTG + F/TAF	-3.10

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 20 Copies/mL at Week 144 as Defined by the US FDA-Defined Snapshot Algorithm

The percentage of participants achieving HIV-1 RNA < 20 copies/mL at Week 144 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02607956)
Timeframe: Week 144

Intervention	percentage of participants (Number)
B/F/TAF	77.5
DTG + F/TAF	79.1

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 20 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm

The percentage of participants achieving HIV-1 RNA < 20 copies/mL at Week 48 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02607956)
Timeframe: Week 48

Intervention	percentage of participants (Number)
B/F/TAF	82.2
DTG + F/TAF	87.1

[back to top]

Change From Baseline in log10 HIV-1 RNA at Week 144

(NCT02607956)
Timeframe: Baseline, Week 144

Intervention	log10 copies/mL (Mean)
B/F/TAF	-3.06
DTG + F/TAF	-3.11

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 144 as Defined by the US FDA-Defined Snapshot Algorithm

The percentage of participants achieving HIV-1 RNA < 50 copies/mL at Week 144 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02607956)
Timeframe: Week 144

Intervention	percentage of participants (Number)
B/F/TAF	81.9
DTG + F/TAF	84.0

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm

Intervention	percentage of participants (Number)
B/F/TAF	89.4
DTG + F/TAF	92.9

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 48 Open-Label as Defined by Missing = Excluded Algorithm

Intervention	percentage of participants (Number)
All B/F/TAF	99.2
DTG + F/TAF to B/F/TAF	99.6

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 48 Open-Label as Defined by Missing = Failure Algorithm

Intervention	percentage of participants (Number)
All B/F/TAF	75.3
DTG + F/TAF to B/F/TAF	84.5

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 50 Copies/mL at Week 96 as Defined by the US FDA-Defined Snapshot Algorithm

The percentage of participants achieving HIV-1 RNA < 50 copies/mL at Week 96 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02607956)
Timeframe: Week 96

Intervention	percentage of participants (Number)
B/F/TAF	84.1
DTG + F/TAF	86.5

[back to top]

Percentage of Participants Who Achieved HIV-1 RNA < 20 Copies/mL at Week 96 as Defined by the US FDA-Defined Snapshot Algorithm

The percentage of participants achieving HIV-1 RNA < 20 copies/mL at Week 96 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT02607956)
Timeframe: Week 96

Intervention	percentage of participants (Number)
B/F/TAF	77.5
DTG + F/TAF	80.3

[back to top]

Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 144

Blood samples were collected to perform evaluation of renal biomarkers which included Serum Cystatin C. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. Adjusted mean and standard error is presented. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 144

Intervention	Milligrams per Liter (mg/L) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	-0.12
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	-0.11

[back to top]

Change From Baseline in EQ-5D-5L Utility Score at Week 96

EQ-5D-5L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has 1 question assessing each of 5 dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. The health state is defined by combining the levels of answers from each of the 5 questions. Each health state is referred to in terms of a 5 digit code. Health state 5 digit code is translated into utility score, which is valued up to 1 (perfect health) with lower values meaning worse state. EQ-5D-5L utility score ranges from -0.281 to 1. Higher scores indicate better health. Baseline was the latest pre-dose assessment (Day 1) and change from Baseline=post-dose value minus Baseline value. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Scores on a scale (Mean)
DTG + 3TC-Double Blind Phase	0.0079
DTG + TDF/FTC-Double Blind Phase	0.0091

[back to top]

Change From Baseline in EQ-5D-5L Utility Score at Week 144

Intervention	Scores on a scale (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	0.0143
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	0.0135

[back to top]

Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 96

Blood samples were collected to perform evaluation of bone biomarker serum vitamin D. Baseline value is defined as the latest pre-dose assessment (Day 1). Change from Baseline was calculated as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, baseline plasma HIV-1 RNA (factor), baseline CD4+ cell count (factor), age, sex (factor), race (factor), BMI (factor), smoking status (factor), current Vitamin D use (factor), baseline biomarker value, treatment and visit interaction, and baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 96

Intervention	Nanomoles per Liter (nmol/L) (Mean)
DTG + 3TC-Double Blind Phase	-2.2
DTG + TDF/FTC-Double Blind Phase	0.7

[back to top]

Change From Baseline in EQ-5D-5L Thermometer Scores at Week 96

EQ-5D-5L questionnaire provided a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. EQ-5D-5L included EQ visual Analogue scale (EQ VAS) 'Thermometer' which provided Self-rated current health status. Score ranges from 0 (worst imaginable health state) to 100 (best imaginable health state). MMRM was run on the LOCF dataset, using the observed margins (OM) option. Baseline was the latest pre-dose assessment value (Day 1) and change from Baseline=post-dose value minus Baseline value. Adjusted mean and standard error is presented. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Scores on a scale (Mean)
DTG + 3TC-Double Blind Phase	4.1
DTG + TDF/FTC-Double Blind Phase	2.4

[back to top]

Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 144

Blood samples were collected to perform evaluation of fasting lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio. Baseline value was defined as the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error has been presented. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 144

Intervention	Ratio (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	-0.229
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	-0.386

[back to top]

Change From Baseline in EQ-5D-5L Thermometer Scores at Week 144

Intervention	Scores on a scale (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	5.2
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	3.0

[back to top]

CD4+ Cell Counts at Week 144

Intervention	Cells per cubic millimeter (cells/mm^3) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	767.8
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	758.2

[back to top]

Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 144

Intervention	Nanomoles per Liter (nmol/L) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	-2.0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	2.9

[back to top]

CD4+ Cell Counts at Week 96

Intervention	Cells per cubic millimeter (cells/mm^3) (Mean)
DTG + 3TC Double Blind Phase	732.8
DTG + TDF/FTC-Double Blind Phase	711.5

[back to top]

Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 96

Intervention	Ratio (Mean)
DTG + 3TC-Double Blind Phase	-0.213
DTG + TDF/FTC-Double Blind Phase	-0.402

[back to top]

Percentage of Participants With Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/mL (c/mL) at Week 48

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using Food and Drug Administration (FDA) Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant antiretroviral therapy (ART) prior to the visit of interest. This endpoint was analyzed using a stratified analysis with Cochran-Mantel-Haenszel (CMH) weights. Intent-To-Treat Exposed (ITT-E) Population was used which comprised of all randomized participants who received at least one dose of study treatment. Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
DTG + 3TC-Double Blind Phase	90
DTG + TDF/FTC-Double Blind Phase	93

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 96

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. This endpoint was analyzed using a stratified analysis with Cochran-Mantel-Haenszel weights. Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 96

Intervention	Percentage of participants (Number)
DTG + 3TC-Double Blind Phase	84
DTG + TDF/FTC-Double Blind Phase	89

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 24

Intervention	Percentage of participants (Number)
DTG + 3TC-Double Blind Phase	92
DTG + TDF/FTC-Double Blind Phase	93

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 144

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. This endpoint was analyzed using a stratified analysis with CMH weights. Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 144

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase + Open-label Phase	79
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	83

[back to top]

Change From Baseline in Bone Biomarkers-Serum Bone Specific Alkaline Phosphatase (Bone-ALP), Serum Osteocalcin, Serum Procollagen 1 N-Terminal Propeptide (PINP) and Serum Type I Collagen C-Telopeptides (CTX-1) at Weeks 24, 48

Blood samples were collected to perform evaluation of bone biomarkers which included bone-ALP, Serum Osteocalcin, PINP and CTX-1. Baseline value is defined as the latest pre-dose assessment (Day 1). Change from Baseline was calculated as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, baseline plasma HIV-1 RNA (factor), baseline CD4+ cell count (factor), age, sex (factor), race (factor), BMI (factor), smoking status (factor), current Vitamin D use (factor), baseline biomarker value, treatment and visit interaction, and baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Micrograms per Liter (ug/L) (Mean)
	Bone-ALP, Week 24, n=334, 332	Bone-ALP, Week 48, n=321, 331	Serum Osteocalcin, Week 24, n=335, 334	Serum Osteocalcin, Week 48, n=322, 330	PINP, Week 24, n=337, 336	PINP, Week 48, n=321, 334	CTX-1, Week 24, n=337, 334	CTX-1, Week 48, n=323, 331
DTG + 3TC-Double Blind Phase	0.91	1.21	2.56	0.78	4.5	0.5	0.1192	0.1338
DTG + TDF/FTC-Double Blind Phase	3.13	3.79	6.74	6.01	18.3	13.1	0.2820	0.3352

[back to top]

Time to Viral Suppression (HIV-1 RNA <50 c/mL) up to Week 144

Time of viral suppression is defined as the first viral load value <50 c/mL. Nonparametric Kaplan-Meier method was performed. Participants who withdrew for any reason without being suppressed were censored at date of withdrawal. Participants who have not been withdrawn and have not had viral suppression at time of the analysis were censored at last viral load date. Confidence Interval (CI) was estimated using the Brookmeyer-Crowley method. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Days (Median)
DTG + 3TC - Double-blind Phase + Open-label Phase	29.0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	29.0

[back to top]

CD4+ Cell Counts at Weeks 24 and 48

Intervention	Cells per cubic millimeter (cells/mm^3) (Mean)
	Week 24, n=340,341	Week 48, n=324,334
DTG + 3TC Double Blind Phase	655.3	687.7
DTG + TDF/FTC-Double Blind Phase	632.8	675.3

[back to top]

Change From Baseline in Bone Biomarker-Serum Vitamin D at Weeks 24, 48

Intervention	Nanomoles per Liter (nmol/L) (Mean)
	Serum Vitamin D, Week 24, n=337, 337	Serum Vitamin D, Week 48, n=322, 333
DTG + 3TC-Double Blind Phase	5.9	-3.1
DTG + TDF/FTC-Double Blind Phase	12.4	3.1

[back to top]

Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 144

Intervention	Micrograms per Liter (ug/L) (Mean)
	Bone-ALP, Week 144, n=281, 295	Serum Osteocalcin, Week 144, n=281, 299	PINP, Week 144, n=281,299	CTX-1, Week 144, n=281, 296
DTG + 3TC - Double-blind Phase + Open-label Phase	-0.25	0.29	4.6	0.0750
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	1.43	3.21	13.8	0.2164

[back to top]

Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 96

Intervention	Micrograms per Liter (ug/L) (Mean)
	Bone-ALP, Week 96, n=296, 317	Serum Osteocalcin, Week 96, n=297, 320	PINP, Week 96, n=297, 319	CTX-1, Week 96, n=297, 315
DTG + 3TC-Double Blind Phase	0.30	0.40	15.0	0.1351
DTG + TDF/FTC-Double Blind Phase	2.37	4.57	28.3	0.2943

[back to top]

Change From Baseline in EuroQol - 5 Dimensions - 5 Levels (EQ-5D-5L) Thermometer Scores at Weeks 4, 24 48

EQ-5D-5L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. EQ-5D-5L included EQ visual Analogue scale (EQ VAS) 'Thermometer' which provided Self-rated current health status. Score ranges from 0 (worst imaginable health state) to 100 (best imaginable health state). MMRM was run on the LOCF dataset, using the observed margins (OM) option. Baseline was the latest pre-dose assessment value (Day 1) and change from Baseline=post-dose value minus Baseline value. (NCT02831673)
Timeframe: Baseline (Day 1) and Weeks 4, 24, 48

Intervention	Scores on a scale (Mean)
	Week 4, n=349, 348	Week 24, n=352, 350	Week 48, n=352, 350
DTG + 3TC-Double Blind Phase	2.3	3.7	4.3
DTG + TDF/FTC-Double Blind Phase	1.2	3.2	2.8

[back to top]

Change From Baseline in EuroQol - 5 Dimensions - 5 Levels (EQ-5D-5L) Utility Score at Weeks 4, 24, 48

Intervention	Scores on a scale (Mean)
	Week 4, n=349, 348	Week 24, n=352, 351	Week 48, n=352, 351
DTG + 3TC-Double Blind Phase	0.0130	0.0131	0.0134
DTG + TDF/FTC-Double Blind Phase	0.0078	0.0168	0.0129

[back to top]

Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 144

Blood samples were collected to perform evaluation of fasting lipids which included Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides. Baseline value was defined as the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 144

Intervention	Millimoles per liter (Mean)
	Serum or Plasma Cholesterol, Week 144,	HDL Cholesterol, Direct, Week 144	LDL Cholesterol, Week 144,	Triglycerides, Week 144
DTG + 3TC - Double-blind Phase + Open-label Phase	0.367	0.181	0.170	0.117
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	-0.037	0.098	-0.105	-0.104

[back to top]

Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 96

Intervention	Millimoles per liter (Mean)
	Serum or Plasma Cholesterol, Week 96	HDL Cholesterol, Direct, Week 96	LDL Cholesterol, Week 96,	Triglycerides, Week 96,
DTG + 3TC-Double Blind Phase	0.379	0.199	0.147	0.129
DTG + TDF/FTC-Double Blind Phase	-0.104	0.090	-0.154	-0.112

[back to top]

Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 96

Blood samples were collected to perform evaluation of fasting LDL cholesterol. Any abnormalities were evaluated by the investigator and graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Percentage of participants with Grade 2 or greater laboratory abnormalities in fasting LDL cholesterol by Week 96 have been presented. Participants without any post-Baseline fasting LDL cholesterol value prior to Week 96 or those who had Baseline lipids-lowering agents were not included. Lipid Last Observation Carried Forward (LOCF) data was used such that the last available fasted, on-treatment lipid value prior to the initiation of a lipid-lowering agent was used in place of future observed values. Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 96

Intervention	Percentage of participants (Number)
DTG + 3TC-Double Blind Phase	5
DTG + TDF/FTC-Double Blind Phase	4

[back to top]

Change From Baseline in Renal Biomarkers-Serum Cystatin C and Serum Retinol Binding Protein (RBP) at Weeks 24, 48

Blood and/or urine were collected to perform evaluation of renal inflammation biomarkers which included Serum Cystatin C and Serum Retinol Binding Protein (RBP). Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, baseline plasma HIV-1 RNA (factor), baseline CD4+ cell count (factor), age, sex (factor), race (factor), presence of diabetes mellitus (factor), presence of hypertension (factor), baseline biomarker value, treatment and visit interaction, and baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Milligrams per Liter (mg/L) (Mean)
	Serum Cystatin C, Week 24, n=338, 336	Serum Cystatin C, Week 48, n=324, 332	Serum RBP, Week 24, n=332, 334	Serum RBP, Week 48, n=322, 332
DTG + 3TC-Double Blind Phase	-0.05	-0.07	1.6	0.5
DTG + TDF/FTC-Double Blind Phase	-0.03	-0.04	1.9	0.6

[back to top]

Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) and Serum or Plasma GFR From Creatinine Adjusted Using CKD-EPI at Weeks 24, 48

Blood and/or urine were collected to perform evaluation of renal inflammation biomarkers which included Serum GFR from cystatin C adjusted using CKD-EPI (GFR-cystatin C adjusted)and Serum or Plasma GFR from creatinine adjusted using CKD-EPI. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, baseline plasma HIV-1 RNA (factor), baseline CD4+ cell count (factor), age, sex (factor), race (factor), presence of diabetes mellitus (factor), presence of hypertension (factor), baseline biomarker value, treatment and visit interaction, and baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Milliliter/minute/1.73*meter^2 (Mean)
	GFR-cystatin C adjusted, Week 24, n=338, 336	GFR-cystatin C adjusted, Week 48, n=324, 332	GFR-creatinine adjusted, Week 24, n=340, 341	GFR-creatinine adjusted, Week 48, n=326,335
DTG + 3TC-Double Blind Phase	4.4	7.0	-13.5	-12.1
DTG + TDF/FTC-Double Blind Phase	2.2	4.1	-16.7	-15.6

[back to top]

Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 144

Blood samples were collected to perform evaluation of renal biomarkers which included Serum GFR from cystatin C adjusted using CKD-EPI and Serum or Plasma GFR from creatinine adjusted for BSA using CKD-EPI. Baseline value is the latest pre-dose Assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 144

Intervention	Milliliter/minute/1.73*meter^2 (Mean)
	GFR Cystatin C adjusted, Week 144, n=283,298	GFR creatinine adjusted, Week 144, n=271, 289
DTG + 3TC - Double-blind Phase + Open-label Phase	13.0	-16.7
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	12.1	-19.3

[back to top]

Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 96

Intervention	Milliliter/minute/1.73*meter^2 (Mean)
	GFR Cystatin C adjusted, Week 96	GFR creatinine adjusted, Week 96
DTG + 3TC-Double Blind Phase	11.3	-15.3
DTG + TDF/FTC-Double Blind Phase	9.3	-19.0

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 144 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age group, Gender and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from ANCOVA model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 144

Intervention	Cells per cubic millimeter (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=214,223	Baseline plasma HIV-1 RNA,>100000, n=56, 64	Baseline CD4+ cell count,<=200, n=17, 24	Baseline CD4+ cell count,>200, n=253, 263	Age group, <35,n=155, 167	Age group-1, 35 to <50, n=92, 87	Age group-1, >=50, n=23,33	Female, n=43, 43	Male, n=227, 244	Race group, White, n=190,201	Race group, African Am/African H., n=26, 26	Race group, Asian, n=26, 34	Race group, Other, n=28,26
DTG + 3TC - Double-blind Phase + Open-label Phase	295.7	334.3	290.2	304.7	298.0	305.6	337.4	346.6	295.9	314.2	243.8	244.0	346.2
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	296.1	329.6	272.9	306.2	316.0	302.1	242.2	321.7	300.0	314.0	295.1	264.1	279.9

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 24 and 48

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is defined as the the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error has been presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for the following covariates/factors: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, treatment and visit interaction, and Baseline CD4+ cell count and visit interaction, with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and Weeks 24, 48

Intervention	Cells per cubic millimeter (Mean)
	Week 24, n=340,341	Week 48, n=324,334
DTG + 3TC-Double Blind Phase	192.2	222.2
DTG + TDF/FTC-Double Blind Phase	175.1	217.7

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 24 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age, Gender, and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from ANCOVA model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 24

Intervention	Cells per cubic millimeter (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=268,268	Baseline plasma HIV-1 RNA,>100000, n=72,73	Baseline CD4+ cell count,<=200, n=29,27	Baseline CD4+ cell count,>200, n=311, 314	Age, <35,n= 203,199	Age, 35 to <50, n=109, 100	Age, >=50, n=28, 42	Female, n=57,50	Male, n=283,291	Race, White, n=236,235	Race, African Am/African H., n=36,33	Race, Asian, n=34, 41	Race, Other, n=34,32
DTG + 3TC-Double Blind Phase	187.72	206.63	157.01	195.11	202.76	172.05	188.79	199.45	190.21	204.78	143.84	169.80	174.30
DTG + TDF/FTC-Double Blind Phase	167.93	205.96	120.17	180.73	177.62	179.87	159.34	181.78	175.05	182.27	170.51	165.36	149.34

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 48 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age group, Gender and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from Analysis of Covariance (ANCOVA) model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 48

Intervention	Cells per cubic millimeter (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=257,264	Baseline plasma HIV-1 RNA,>100000, n=67,70	Baseline CD4+ cell count,<=200, n=26, 27	Baseline CD4+ cell count,>200, n=298, 307	Age group-1, <35,n= 194, 192	Age group-1, 35 to <50, n=104, 101	Age group-1, >=50, n=26, 41	Female, n=54, 49	Male, n=270, 285	Race, White, n=224, 231	Race, African Am/African H., n=33, 31	Race, Asian, n=34, 41	Race, Other, n=33, 31
DTG + 3TC-Double Blind Phase	220.0	238.5	200.5	225.9	233.6	208.7	212.6	237.1	221.2	226.0	209.4	246.4	200.2
DTG + TDF/FTC-Double Blind Phase	212.4	235.5	177.9	220.7	225.2	211.2	194.8	226.8	215.6	219.7	239.9	197.2	202.7

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 96 by Subgroups

Intervention	Cells per cubic millimeter (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=240,253	Baseline plasma HIV-1 RNA,>100000, n=61,67	Baseline CD4+ cell count,<=200, n=21,26	Baseline CD4+ cell count,>200, n=280,294	Age group-1, <35,n= 179,185	Age group-1, 35 to <50, n=97,95	Age group-1, >=50, n=25, 40	Female, n=49,46	Male, n=252, 274	Race group, White, n=210,223	Race group, African Am/African H., n=31,29	Race group, Asian, n=29,38	Race group, Other, n=31,30
DTG + 3TC-Double Blind Phase	254.8	300.2	240.5	265.9	270.2	259.5	237.6	277.9	261.4	275.2	228.5	212.1	273.4
DTG + TDF/FTC-Double Blind Phase	252.9	260.1	244.4	255.1	263.0	262.0	195.9	259.1	253.5	260.0	230.2	244.8	247.3

[back to top]

Number of Participants Who Discontinue Treatment Due to AEs Over Weeks 24, 48, 96

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. . Number of participants who discontinued treatment due to AEs have been reported. (NCT02831673)
Timeframe: Up to Week 24, Week 48 and Week 96

Intervention	Participants (Count of Participants)
	Up to Week 24	Up to Week 48	Up to Week 96
DTG + 3TC-Double Blind Phase	6	7	14
DTG + TDF/FTC-Double Blind Phase	4	8	11

[back to top]

Number of Participants With AEs by Maximum Severity Grades up to Week 144

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. AEs were evaluated by the investigator and graded according to the DAIDS toxicity scales from Grade 1 to 5 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening, 5=Death). The higher the grade, the more severe the symptoms. Number of participants with adverse events by maximum grade have been presented. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	Grade 1 AEs	Grade 2 AEs	Grade 3 AEs	Grade 4 AEs	Grade 5 AEs
DTG + 3TC - Double-blind Phase + Open-label Phase	33	229	37	7	1
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	35	242	34	5	0

[back to top]

Number of Participants With Any AE and SAE up to Week 148

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Any untoward event resulting in death, life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, congenital anomaly/birth defect, any other situation according to medical or scientific judgment that may not be immediately life-threatening or result in death or hospitalization but may jeopardize the participant or may require medical or surgical intervention or protocol defined event associated with liver injury and impaired liver function were categorized as SAE. Safety Population was used which comprised of all participants who received at least one dose of study treatment. (NCT02831673)
Timeframe: Up to Week 148

Intervention	Participants (Count of Participants)
	Any AE	Any SAE
DTG + 3TC - Double-blind Phase + Open-label Phase	307	37
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	316	38

[back to top]

Number of Participants With Any Drug Related AEs and Drug Related AEs by Maximum Grade up to Week 144

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. AEs were evaluated by the investigator and graded according to the DAIDS toxicity scales from Grade 1 to 5. (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening, 5=Death). The higher the grade, the more severe the symptoms. Number of participants with drug related AEs and drug related AEs by by maximum grade have been presented. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	Any drug related AE	Drug related AEs with maximum toxicity Grade 1	Drug related AEs with maximum toxicity Grade 2	Drug related AEs with maximum toxicity Grade 3	Drug related AEs with maximum toxicity Grade 4	Drug related AEs with maximum toxicity Grade 5
DTG + 3TC - Double-blind Phase + Open-label Phase	77	51	19	7	0	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	101	70	28	3	0	0

[back to top]

Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 144

Blood samples were collected to perform evaluation of fasting LDL cholesterol. Any abnormalities were evaluated by the investigator and graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). Percentage of participants with Grade 2 or greater laboratory abnormalities in fasting LDL cholesterol by Week 144 have been presented. Participants without any post-Baseline fasting LDL cholesterol value prior to Week 144 or those who had Baseline lipids-lowering agents were not included. Lipid Last Observation Carried Forward (LOCF) data was used such that the last available fasted, on-treatment lipid value prior to the initiation of a lipid-lowering agent was used in place of future observed values. Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 144

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase + Open-label Phase	5
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	4

[back to top]

Number of Participants Who Discontinue Treatment Due to AEs Over Week 144

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Number of participants who discontinued treatment due to AEs have been reported. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
DTG + 3TC - Double-blind Phase + Open-label Phase	18
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	17

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 96

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+ cells. Analysis was performed by flow cytometry. Baseline value is defined as the the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error has been presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for the following covariates/factors: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, treatment and visit interaction, and Baseline CD4+ cell count and visit interaction, with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Cells per cubic millimeter (Mean)
DTG + 3TC - Double-blind Phase	264.7
DTG + TDF/FTC-Double Blind Phase	253.8

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 144

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+ cells. Analysis was performed by flow cytometry. Baseline value is defined as the the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error has been presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for the following covariates/factors: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, treatment and visit interaction, and Baseline CD4+ cell count and visit interaction, with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 144

Intervention	Cells per cubic millimeter (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	301.8
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	303.2

[back to top]

Change From Baseline in Renal Biomarker-Serum RBP at Week 96

Blood and/or urine samples were collected to perform evaluation of renal biomarkers which included Serum RBP. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 96

Intervention	Microgram per millimoles (ug/mmol) (Mean)
DTG + 3TC-Double Blind Phase	1.535
DTG + TDF/FTC-Double Blind Phase	7.704

[back to top]

Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Weeks 24, 48

Blood and/or urine were collected to perform evaluation of renal inflammation biomarker which included Serum or Plasma Creatinine. Baseline value is defined as the latest pre-dose assessment (Day 1). Change from Baseline was calculated as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, baseline plasma HIV-1 RNA (factor), baseline CD4+ cell count (factor), age, sex (factor), race (factor), presence of diabetes mellitus (factor), presence of hypertension (factor), baseline biomarker value, treatment and visit interaction, and baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Micromoles per Liter (umol/L) (Mean)
	Serum or Plasma Creatinine, Week 24, n=340, 343	Serum or Plasma Creatinine, Week 48, n=326, 335
DTG + 3TC-Double Blind Phase	11.88	10.39
DTG + TDF/FTC-Double Blind Phase	15.07	13.61

[back to top]

Change From Baseline in Renal Biomarker-Serum RBP at Week 144

Intervention	Microgram per millimoles (ug/mmol) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	1.760
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	8.855

[back to top]

Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 96

Intervention	Micromoles per Liter (umol/L) (Mean)
DTG + 3TC-Double Blind Phase	12.75
DTG + TDF/FTC-Double Blind Phase	16.10

[back to top]

Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 144

Intervention	Micromoles per Liter (umol/L) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	12.89
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	15.87

[back to top]

Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 96

Blood samples were collected to perform evaluation of renal inflammation biomarkers which included Serum Cystatin C . Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, baseline plasma HIV-1 RNA (factor), baseline CD4+ cell count (factor), age, sex (factor), race (factor), presence of diabetes mellitus (factor), presence of hypertension (factor), baseline biomarker value, treatment and visit interaction, and baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831673)
Timeframe: Baseline (Day 1) and at Week 96

Intervention	Milligrams per Liter (mg/L) (Mean)
DTG + 3TC-Double Blind Phase	-0.11
DTG + TDF/FTC-Double Blind Phase	-0.09

[back to top]

Number of Participants With HIV-1 Disease Progression up to Week 144

HIV-associated conditions were recorded during the study and was assessed according to the 2014 Centers for Disease Control and Prevention (CDC) Classification System for HIV Infection in Adults. Disease progressions summarize participants who had HIV infection stage 3 associated conditions or death. Indicators of clinical disease progression were defined as: CDC Category Stage 1 at enrollment to Stage 3 event; CDC Category Stage 2 at enrolment to Stage 3 event; CDC Category Stage 3 at enrollment to New Stage 3 Event; CDC Category Stage 1, 2 or 3 at enrolment to Death. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	No HIV-1 disease progression	From CDC Stage 1 to CDC Stage 3 Event	From CDC Stage 2 to CDC Stage 3 Event	From CDC Stage 3 to New CDC Stage 3 Event	From CDC Stage 1, 2 or 3 to Death
DTG + 3TC - Double-blind Phase + Open-label Phase	352	0	2	1	1
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	356	0	2	0	0

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities up to Week 144

Blood samples were collected up to Week 144 for assessment of Alanine Aminotransferase (ALT), Albumin, Alkaline Phosphatase (ALP), Aspartate aminotransferase (AST), Bilirubin, Carbon dioxide (CO2), Cholesterol, Creatine kinase (CK), Creatinine, Direct Bilirubin, Glomerular filtration rate (GFR) from creatinine adjusted for body surface area (BSA), Hypercalcemia, Hyperglycemia, Hyperkalemia, Hypernatremia, Hypocalcemia, Hypoglycemia, Hypokalemia, Hyponatremia, Low density lipid (LDL) Cholesterol, Lactate Dehydrogenase, Lipase, Phosphate, and Triglycerides. Any abnormality was graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Only those participants with maximum post-Baseline emergent chemistry toxicities in any of the chemistry parameters have been presented (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	ALT, Grades 1 to 4	ALT, Grades 2 to 4	ALT, Grades 3 to 4	ALT, Grade 1	ALT, Grade 2	ALT, Grade 3	ALT, Grade 4	Albumin, Grades 1 to 4	Albumin, Grades 2 to 4	Albumin, Grades 3 to 4	Albumin, Grade 1	Albumin, Grade 2	Albumin, Grade 3	Albumin, Grade 4	ALP, Grades 1 to 4	ALP, Grades 2 to 4	ALP, Grades 3 to 4	ALP, Grade 1	ALP, Grade 2	ALP, Grade 3	ALP, Grade 4	AST, Grades 1 to 4	AST, Grades 2 to 4	AST, Grades 3 to 4	AST, Grade 1	AST, Grade 2	AST, Grade 3	AST, Grade 4	Bilirubin, Grades 1 to 4	Bilirubin, Grades 2 to 4	Bilirubin, Grades 3 to 4	Bilirubin, Grade 1	Bilirubin, Grade 2	Bilirubin, Grade 3	Bilirubin, Grade 4	CO2, Grades 1 to 4	CO2, Grades 2 to 4	CO2, Grades 3 to 4	CO2, Grade 1	CO2, Grade 2	CO2, Grade 3	CO2, Grade 4	Cholesterol, Grades 1 to 4	Cholesterol, Grades 2 to 4	Cholesterol, Grades 3 to 4	Cholesterol, Grade 1	Cholesterol, Grade 2	Cholesterol, Grade 3	Cholesterol, Grade 4	CK, Grades 1 to 4	CK, Grades 2 to 4	CK, Grades 3 to 4	CK, Grade 1	CK, Grade 2	CK, Grade 3	CK, Grade 4	Creatinine, Grades 1 to 4	Creatinine, Grades 2 to 4	Creatinine, Grades 3 to 4	Creatinine, Grade 1	Creatinine, Grade 2	Creatinine, Grade 3	Creatinine, Grade 4	Direct Bilirubin, Grades 1 to 4	Direct Bilirubin, Grades 2 to 4	Direct Bilirubin, Grades 3 to 4	Direct Bilirubin, Grade 1	Direct Bilirubin, Grade 2	Direct Bilirubin, Grade 3	Direct Bilirubin, Grade 4	GFR from creatinine adjusted for BSA Grades 1 to 4	GFR from creatinine adjusted for BSA Grades 2 to 4	GFR from creatinine adjusted for BSA Grades 3 to 4	GFR from creatinine adjusted for BSA, Grade 1	GFR from creatinine adjusted for BSA, Grade 2	GFR from creatinine adjusted for BSA Grades 3	GFR from creatinine adjusted for BSA, Grade 4	Hypercalcaemia, Grades 1 to 4	Hypercalcaemia, Grades 2 to 4	Hypercalcaemia, Grades 3 to 4	Hypercalcaemia, Grade 1	Hypercalcaemia, Grade 2	Hypercalcaemia, Grade 3	Hypercalcaemia, Grade 4	Hyperglycemia, Grades 1 to 4	Hyperglycemia, Grades 2 to 4	Hyperglycemia, Grades 3 to 4	Hyperglycemia, Grade 1	Hyperglycemia, Grade 2	Hyperglycemia, Grade 3	Hyperglycemia, Grade 4	Hyperkalemia, Grades 1 to 4	Hyperkalemia, Grades 2 to 4	Hyperkalemia, Grades 3 to 4	Hyperkalemia, Grade 1	Hyperkalemia, Grade 2	Hyperkalemia, Grade 3	Hyperkalemia, Grade 4	Hypernatremia, Grades 1 to 4	Hypernatremia, Grades 2 to 4	Hypernatremia, Grades 3 to 4	Hypernatremia, Grade 1	Hypernatremia, Grade 2	Hypernatremia, Grade 3	Hypernatremia, Grade 4	Hypocalcaemia, Grades 1 to 4	Hypocalcaemia, Grades 2 to 4	Hypocalcaemia, Grades 3 to 4	Hypocalcaemia, Grade 1	Hypocalcaemia, Grade 2	Hypocalcaemia, Grade 3	Hypocalcaemia, Grade 4	Hypoglycemia, Grades 1 to 4	Hypoglycemia, Grades 2 to 4	Hypoglycemia, Grades 3 to 4	Hypoglycemia, Grade 1	Hypoglycemia, Grade 2	Hypoglycemia, Grade 3	Hypoglycemia, Grade 4	Hypokalemia, Grades 1 to 4	Hypokalemia, Grades 2 to 4	Hypokalemia, Grades 3 to 4	Hypokalemia, Grade 1	Hypokalemia, Grade 2	Hypokalemia, Grade 3	Hypokalemia, Grade 4	Hyponatremia, Grades 1 to 4	Hyponatremia, Grades 2 to 4	Hyponatremia, Grades 3 to 4	Hyponatremia, Grade 1	Hyponatremia, Grade 2	Hyponatremia, Grade 3	Hyponatremia, Grade 4	LDL Cholesterol, Grades 1 to 4	LDL Cholesterol, Grades 2 to 4	LDL Cholesterol, Grades 3 to 4	LDL Cholesterol, Grade 1	LDL Cholesterol, Grade 2	LDL Cholesterol, Grade 3	LDL Cholesterol, Grade 4	Lactate Dehydrogenase, Grades 1 to 4	Lactate Dehydrogenase, Grades 2 to 4	Lactate Dehydrogenase, Grades 3 to 4	Lactate Dehydrogenase, Grade 1	Lactate Dehydrogenase, Grade 2	Lactate Dehydrogenase, Grade 3	Lactate Dehydrogenase, Grade 4	Lipase, Grades 1 to 4	Lipase, Grades 2 to 4	Lipase, Grades 3 to 4	Lipase, Grade 1	Lipase, Grade 2	Lipase, Grade 3	Lipase, Grade 4	Phosphate, Grades 1 to 4	Phosphate, Grades 2 to 4	Phosphate, Grades 3 to 4	Phosphate, Grade 1	Phosphate, Grade 2	Phosphate, Grade 3	Phosphate, Grade 4	Triglycerides, Grades 1 to 4	Triglycerides, Grades 2 to 4	Triglycerides, Grades 3 to 4	Triglycerides, Grade 1	Triglycerides, Grade 2	Triglycerides, Grade 3	Triglycerides, Grade 4
DTG + 3TC - Double-blind Phase + Open-label Phase	55	23	14	32	9	7	7	1	1	0	0	1	0	0	8	3	0	5	3	0	0	52	27	8	25	19	6	2	42	14	4	28	10	2	2	126	8	0	118	8	0	0	77	24	0	53	24	0	0	76	43	26	33	17	15	11	21	1	0	20	1	0	0	14	14	14	0	0	14	0	185	185	13	0	172	13	0	7	0	0	7	0	0	0	91	38	3	53	35	3	0	1	0	0	1	0	0	0	6	0	0	6	0	0	0	14	4	0	10	4	0	0	22	8	2	14	6	1	1	6	0	0	6	0	0	0	25	2	0	23	2	0	0	57	17	5	40	12	5	0	3	0	0	3	0	0	0	65	35	10	30	25	8	2	70	35	2	35	33	2	0	80	12	7	68	5	6	1
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	81	25	9	56	16	4	5	1	0	0	1	0	0	0	10	1	0	9	1	0	0	79	31	13	48	18	9	4	51	17	4	34	13	4	0	116	9	0	107	9	0	0	40	13	1	27	12	1	0	75	52	36	23	16	21	15	31	3	2	28	1	2	0	13	13	13	0	0	13	0	226	226	27	0	199	25	2	4	0	0	4	0	0	0	81	25	2	56	23	2	0	4	1	1	3	0	0	1	3	0	0	3	0	0	0	13	3	1	10	2	1	0	17	3	1	14	2	0	1	7	1	0	6	1	0	0	28	0	0	28	0	0	0	35	14	4	21	10	4	0	5	1	0	4	1	0	0	80	49	18	31	31	10	8	68	47	6	21	41	6	0	62	14	3	48	11	2	1

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities up to Week 144

Blood samples were collected up to Week 144 for assessment of hemoglobin, leukocytes, neutrophils and platelets. Any abnormality was graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Only those participants with maximum post-Baseline emergent hematology toxicities in any of the listed hematology parameters have been presented. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	Hemoglobin, Grades 1 to 4	Hemoglobin, Grades 2 to 4	Hemoglobin, Grades 3 to 4	Hemoglobin, Grade 1	Hemoglobin, Grade 2	Hemoglobin, Grade 3	Hemoglobin, Grade 4	Leukocytes, Grades 1 to 4	Leukocytes, Grades 2 to 4	Leukocytes, Grades 3 to 4	Leukocytes, Grade 1	Leukocytes, Grade 2	Leukocytes, Grade 3	Leukocytes, Grade 4	Neutrophils, Grades 1 to 4	Neutrophils, Grades 2 to 4	Neutrophils, Grades 3 to 4	Neutrophils, Grade 1	Neutrophils, Grade 2	Neutrophils, Grade 3	Neutrophils, Grade 4	Platelets, Grades 1 to 4	Platelets, Grades 2 to 4	Platelets, Grades 3 to 4	Platelets, Grade 1	Platelets, Grade 2	Platelets, Grade 3	Platelets, Grade 4
DTG + 3TC - Double-blind Phase + Open-label Phase	9	1	0	8	1	0	0	16	4	0	12	4	0	0	25	19	7	6	12	5	2	14	8	1	6	7	0	1
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	7	1	0	6	1	0	0	3	2	0	1	2	0	0	18	11	6	7	5	5	1	11	4	1	7	3	1	0

[back to top]

Number of Participants With Treatment-emergent Genotypic Resistance up to Week 144

Number of participants, who met confirmed virologic withdrawal (CVW) criteria, with treatment emergent genotypic resistance to Integrase strand transfer inhibitor (INSTI) and/or Nucleoside reverse transcriptase inhibitor (NRTI) was summarized. The Viral Genotypic Population comprised of all participants in the ITT-E population who have available on-treatment genotypic resistance data. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	INSTI Mutations	Major mutations of NRTI
DTG + 3TC - Double-blind Phase + Open-label Phase	0	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	0	0

[back to top]

Number of Participants With Treatment-emergent Phenotypic Resistance up to Week 144

Number of participants, who meet CVW criteria, with treatment emergent phenotypic resistance to INSTI and/or NRTI were summarized. Assessment of antiviral activity of anti-retroviral therapy (ART) using phenotypic test results was interpreted through a proprietary algorithm (from Monogram Biosciences) and provides the overall susceptibility of the drug. Partially sensitive and resistant calls were considered resistant in this analysis. The Viral Phenotypic Population comprised of all participants in the ITT-E population who have available on-treatment phenotypic resistance data. (NCT02831673)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	INSTI, DTG, Sensitive, n=,5,4	INSTI, DTG, Resistant, n=5,4	INSTI, EGV, Sensitive, n=5,4	INSTI, EGV, Resistant, n=5,4	INSTI, RAL, Sensitive, n=5,4	INSTI, RAL, Resistant, n=5,4	NRTI, 3TC, Sensitive, n=5,5	NRTI, 3TC, Resistant, n=5,5	NRTI, ABC, Sensitive, n=5,5	NRTI, ABC, Resistant, n=5,5	NRTI, AZT, Sensitive, n=5,5	NRTI, AZT, Resistant, n=5,5	NRTI, D4T, Sensitive, n=5,5	NRTI, D4T, Resistant, n=5,5	NRTI, DDI, Sensitive, n=5,5	NRTI, DDI, Resistant, n=5,5	NRTI, FTC, Sensitive, n=5,5	NRTI, FTC, Resistant, n=5,5	NRTI, TDF, Sensitive, n=5,5	NRTI, TDF, Resistant, n=5,5
DTG + 3TC - Double-blind Phase + Open-label Phase	5	0	5	0	5	0	5	0	5	0	5	0	5	0	5	0	5	0	5	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	4	0	4	0	4	0	5	0	5	0	5	0	5	0	5	0	5	0	5	0

[back to top]

Percentage Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Weeks 24, 48

Intervention	Percentage change (Mean)
	Total/HDL Cholesterol Ratio, Week 24, n=294, 297	Total/HDL Cholesterol Ratio, Week 48, n=280, 289
DTG + 3TC-Double Blind Phase	-4.0	-0.2
DTG + TDF/FTC-Double Blind Phase	-4.6	-4.4

[back to top]

Percentage Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Weeks 24, 48

Blood samples were collected to perform evaluation of fasting lipids which included Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides. Baseline value is defined as the latest pre-dose assessment (Day 1). Percentage change from Baseline was calculated as 100 multiplied by ([post-dose visit value minus Baseline value] divided by Baseline value). (NCT02831673)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Percentage change (Mean)
	Serum or Plasma Cholesterol, Week 24, n=294, 297	Serum or Plasma Cholesterol, Week 48, n=280, 289	HDL Cholesterol, Direct, Week 24, n=294, 297	HDL Cholesterol, Direct, Week 48, n=280, 289	LDL Cholesterol, Week 24, n=294, 297	LDL Cholesterol, Week 48, n=280, 289	Triglycerides ,Week 24, n=294, 297	Triglycerides , Week 48, n=280, 289
DTG + 3TC-Double Blind Phase	9.4	10.5	16.4	15.0	12.4	14.8	8.5	12.8
DTG + TDF/FTC-Double Blind Phase	-4.7	-2.4	3.4	5.0	-8.1	-4.0	4.3	4.4

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 144

Percentage of participants by subgroups (by age, gender, Baseline CD4+ cell count, Baseline HIV-1 RNA, race) with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. Data was presented by subgroups: age (<35, 35 to <50, >=50 years); gender (males and females), Baseline CD4+ cell count (<=200 cells/mm^3, >200 cells/mm^3), Baseline HIV-1 RNA (<=100000, >100000) and Race (White, African American/African H., Asian and other). Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 144

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count, <=200,n=31, 29	Baseline CD4+ cell count, >200,n=325,329	Female, n=59, 52	Male, n=297,306,	Age, <35,n= 211, 205	Age, 35 to <50,n=116, 107	Age, >=50, n=29,46	Baseline plasma HIV-1 RNA, <=100000,n=282,282	Baseline plasma HIV-1 RNA, >100000,n=74, 76	Race, White, n=244,247	Race, African American/African H., n=39,36	Race, Asian, n=37, 42	Race, Other, n=36, 33
DTG + 3TC - Double-blind Phase + Open-label Phase	58	81	71	80	77	81	83	79	78	82	69	73	78
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	83	83	85	82	83	83	78	82	87	85	72	81	79

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 48

Percentage of participants by subgroups (by age, gender, Baseline CD4+ cell count, Baseline HIV-1 RNA, race) with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. Data was presented by subgroups: age (<35, 35 to <50, >=50 years); gender (males and females), Baseline CD4+ cell count (<=200, >200), Baseline HIV-1 RNA (<=100000, >100000) and Race (White, African American/African H., Asian, Other). Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count, <=200,n=31,29	Baseline CD4+ cell count, >200,n=325,329	Female, n=59, 52	Male, n=297, 306	Age, <35,n= 211, 205	Age, 35 to <50,n=116, 107	Age, >=50, n=29, 46	Baseline plasma HIV-1 RNA, <=100000,n=282,282	Baseline plasma HIV-1 RNA, >100000,n=74, 76	Race, White, n=244,247	Race, African American/African H., n=39, 36	Race, Asian, n=37, 42	Race, Other, n=36, 33
DTG + 3TC-Double Blind Phase	81	91	88	90	92	86	90	90	88	90	87	92	89
DTG + TDF/FTC-Double Blind Phase	90	93	94	92	93	94	87	93	91	94	81	98	94

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 96

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count, <=200,n=31, 29	Baseline CD4+ cell count, >200,n=325,329	Female, n=59, 52	Male, n=297,306,	Age, <35,n= 211, 205	Age, 35 to <50,n=116, 107	Age, >=50, n=29,46	Baseline plasma HIV-1 RNA, <=100000,n=282,282	Baseline plasma HIV-1 RNA, >100000,n=74, 76	Race, White, n=244,247	Race, African American/African H., n=39,36	Race, Asian, n=37, 42	Race, Other, n=36, 33
DTG + 3TC-Double Blind Phase	65	86	83	85	84	84	86	85	81	86	79	78	86
DTG + TDF/FTC-Double Blind Phase	90	89	88	90	90	89	87	90	88	90	81	90	91

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count, Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 24

Percentage of participants by subgroups (by age, gender, Baseline CD4+ cell count, Baseline HIV-1 RNA, race) with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. Data was presented by subgroups: age (<35, 35 to <50, >=50 years); gender (males and females), Baseline CD4+ cell count (<=200, >200), Baseline HIV-1 RNA (<=100000, >100000) and Race (White, African American/African H., Asian, Other). Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Week 24

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count, <=200,n=31,29	Baseline CD4+ cell count, >200,n=325,329	Female, n=59, 52	Male, n=297, 306	Age, <35,n= 211, 205	Age, 35 to <50,n=116, 107	Age, >=50, n=29, 46	Baseline plasma HIV-1 RNA, <=100000,n=282,282	Baseline plasma HIV-1 RNA, >100000,n=74, 76	Race, White, n=244,247	Race, African American/African H., n=39, 36	Race, Asian, n=37, 42	Race, Other, n=36, 33
DTG + 3TC-Double Blind Phase	90	93	93	92	93	91	93	93	92	93	92	89	94
DTG + TDF/FTC-Double Blind Phase	86	94	96	92	95	93	85	95	87	95	81	93	94

[back to top]

Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Weeks 24, 48

Blood samples were collected to perform evaluation of fasting LDL cholesterol. Any abnormalities were evaluated by the investigator and graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Percentage of participants with Grade 2 or greater laboratory abnormalities in fasting LDL cholesterol by Weeks 24 and 48 have been presented. Participants without any post-Baseline fasting LDL cholesterol value prior to Week 48 or those who had Baseline lipids-lowering agents are not included. Lipid Last Observation Carried Forward (LOCF) data was used such that the last available fasted, on-treatment lipid value prior to the initiation of a lipid-lowering agent was used in place of future observed values. Percentage values are rounded to the nearest whole digit. (NCT02831673)
Timeframe: Weeks 24 and Week 48

Intervention	Percentage of participants (Number)
	Week 24, n=309, 316	Week 48, n=318, 320
DTG + 3TC-Double Blind Phase	4	4
DTG + TDF/FTC-Double Blind Phase	2	3

[back to top]

Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 144

Blood and/or urine were collected to perform evaluation of renal inflammation biomarkers which included Urine and Serum B2M, Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine. Baseline value is defined as the latest pre-dose assessment (Day 1). Ratio to Baseline was calculated as ratio of post-dose visit value over Baseline value. Statistical analysis of changes from baseline were performed on log-transformed data. Results were transformed back via exponential transformation such that treatment comparisons are assessed via odds ratios. Estimated ratio of geometric means (each visit over Baseline) and 95% confidence interval (CI) have been presented. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 144

Intervention	Ratio (Geometric Mean)
	Urine Albumin/Creatinine , Week 144, n=207, 212	Urine B2M/Urine Creatinine , Week 144, n=100, 102	Urine Phosphate, Week 144, n=274, 294	Urine Protein/Creatinine , Week 144, n=225,232	Urine RBP 4/Urine Creatinine, Week 144, n=276, 292
DTG + 3TC - Double-blind Phase + Open-label Phase	1.050	0.751	1.040	0.988	1.648
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	1.146	1.518	0.955	1.210	2.425

[back to top]

Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 96

Blood and/or urine were collected to perform evaluation of renal inflammation biomarkers which included Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine. Baseline value is defined as the latest pre-dose assessment (Day 1). Ratio to Baseline was calculated as ratio of post-dose visit value over Baseline value. Statistical analysis of changes from baseline were performed on log-transformed data. Results were transformed back via exponential transformation such that treatment comparisons are assessed via odds ratios. Estimated ratio of geometric means (each visit over Baseline) and 95% confidence interval (CI) have been presented. (NCT02831673)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Ratio (Geometric Mean)
	Urine Albumin/Creatinine, Week 96, n=222, 243	Urine B2M/Urine Creatinine , Week 96, n=107, 104	Urine Phosphate, Week 96, n=292, 316	Urine Protein/Creatinine, Week 96, n=238, 258	Urine RBP 4/Urine Creatinine, Week 96, n=289, 311
DTG + 3TC-Double Blind Phase	0.924	0.794	1.113	0.868	1.310
DTG + TDF/FTC-Double Blind Phase	1.101	1.441	1.066	1.053	1.771

[back to top]

Ratio to Baseline in Renal Biomarkers-Urine and Serum Beta-2 Microglobulin (B2M), Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine at Weeks 24, 48

Intervention	Ratio (Geometric Mean)
	Serum B2M, Week 24, n=338, 335	Serum B2M, Week 48, n=324, 332	Urine B2M, Week 24, n=121, 95	Urine B2M, Week 48, n=119, 103	Urine Albumin/Creatinine, Week 24, n=254, 252	Urine Albumin/Creatinine , Week 48, n=237, 244	Urine B2M/Urine Creatinine, Week 24, n=121, 95	Urine B2M/Urine Creatinine, Week 48, n=114, 100	Urine Phosphate, Week 24, n=330, 332	Urine Phosphate, Week 48, n=316, 330	Urine Protein/Creatinine, Week 24, n=269, 265	Urine Protein/Creatinine, Week 48, n=252, 269	Urine RBP 4, Week 24, n=332, 330	Urine RBP 4, Week 48, n=318, 328	Urine RBP 4/Urine Creatinine, Week 24, n=329, 330	Urine RBP 4/Urine Creatinine, Week 48, n=304, 318
DTG + 3TC-Double Blind Phase	0.798	0.806	0.887	0.900	1.014	0.934	0.852	0.888	1.115	1.061	0.850	0.879	0.934	1.115	0.919	1.147
DTG + TDF/FTC-Double Blind Phase	0.872	0.892	1.351	1.338	1.050	1.048	1.331	1.278	1.012	1.075	1.016	1.061	1.073	1.490	1.110	1.500

[back to top]

Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 144

Blood samples were collected to perform evaluation of fasting lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio. Baseline value is the latest pre-dose assessment (Day 1). Baseline value was defined as the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and at Week 144

Intervention	Ratio (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	-0.245
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	-0.359

[back to top]

Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Week 96

Blood samples were collected to perform evaluation of fasting lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio. Baseline value is the latest pre-dose assessment (Day 1). Baseline value was defined as the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and at Week 96

Intervention	Ratio (Mean)
DTG + 3TC - Double-blind Phase	-0.113
DTG + TDF/FTC - Double-blind Phase	-0.395

[back to top]

Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 144

Blood and/or urine samples were collected to perform evaluation of renal biomarkers which included Serum Cystatin C. Baseline value is the latest pre-dose assessment. Change from Baseline was defined as value at indicated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline and at Week 144

Intervention	mg/L (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	-0.11
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	-0.08

[back to top]

Change From Baseline in Renal Biomarker-Serum Cystatin C at Week 96

Intervention	mg/L (Mean)
DTG + 3TC - Double-blind Phase	-0.09
DTG + TDF/FTC - Double-blind Phase	-0.08

[back to top]

Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 144

Blood and samples were collected to perform evaluation of renal biomarker which included Serum or Plasma Creatinine. Baseline value is defined as the the latest pre-dose assessment. Change from Baseline was calculated as value at the inidcated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. Adjusted mean and standard error has been presented. (NCT02831764)
Timeframe: Baseline and at Week 144

Intervention	Micromoles per Liter (umol/L) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	12.28
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	15.14

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 144

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count, <=200,n=32, 26	Baseline CD4+ cell count, >200,n=328,333	Female, n=54, 46	Male, n=306, 313	Age, <35,n= 209, 203	Age, 35 to <50,n=115, 122	Age, >=50, n=36, 34	Baseline plasma HIV-1 RNA, <=100000,n=294, 282	Baseline plasma HIV-1 RNA, >100000,n=66, 77	Race, White, n=240,252	Race, African American/African H., n=51, 35	Race, Asian, n=34, 30	Race, Other, n=35, 42
DTG + 3TC - Double-blind Phase + Open-label Phase	75	85	78	85	83	86	83	84	86	88	65	85	89
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	69	86	83	85	83	85	88	85	81	87	74	83	79

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 48

Percentage of participants by subgroups (by age, gender, Baseline CD4+ cell count, Baseline HIV-1 RNA, race) with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. Data was presented by subgroups: age (<35, 35 to <50, >=50 years); gender (males and females), Baseline CD4+ cell count (<=200 cells/mm^3, >200 cells/mm^3 for group-1), Baseline HIV-1 RNA (<=100000, >100000) and Race (White, African American/African H., Asian and other). Percentage values are rounded-off. (NCT02831764)
Timeframe: Week 48

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count Group-1, <=200,n=32, 26	Baseline CD4+ cell count Group-1, >200,n=328,333	Female, n=54, 46	Male, n=306, 313	Age, <35,n= 209,203	Age, 35 to <50,n=115, 122	Age, >=50, n=36, 34	Baseline plasma HIV-1 RNA, <=100000,n=294,282	Baseline plasma HIV-1 RNA, >100000,n=66, 77	Race, White, n=240, 252	Race, African American/African H., n=51, 35	Race, Asian, n=34, 30	Race, Other, n=35, 42
DTG + 3TC - Double-blind Phase	78	95	89	94	92	97	89	92	97	96	80	97	86
DTG + TDF/FTC - Double-blind Phase	96	94	87	95	94	94	94	95	90	96	86	90	90

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 96

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count, <=200,n=32, 26	Baseline CD4+ cell count, >200,n=328,333	Female, n=54, 46	Male, n=306, 313	Age, <35,n= 209, 203	Age, 35 to <50,n=115, 122	Age, >=50, n=36, 34	Baseline plasma HIV-1 RNA, <=100000,n=294, 282	Baseline plasma HIV-1 RNA, >100000,n=66, 77	Race, White, n=240,252	Race, African American/African H., n=51, 35	Race, Asian, n=34, 30	Race, Other, n=35, 42
DTG + 3TC - Double-blind Phase	72	89	81	89	88	90	83	88	86	92	69	88	89
DTG + TDF/FTC - Double-blind Phase	85	90	85	90	91	89	88	91	84	91	86	90	83

[back to top]

Percentage of Participants by Subgroups (by Age, Gender, Baseline CD4+ Cell Count, Baseline HIV-1 RNA, Race) With Plasma HIV-1 RNA <50 c/mL at Week 24

Percentage of participants by subgroups (by age, gender, Baseline CD4+ cell count, Baseline HIV-1 RNA, race) with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. Data was presented by subgroups: age (<35, 35 to <50, >=50 years); gender (males and females), Baseline CD4+ cell count (<=200 cells/mm^3, >200 cells/mm^3 for group-1), Baseline HIV-1 RNA (<=100000, >100000 c/mL) and Race (White, African American/African heritage (H.), Asian other). Percentage values are rounded-off. (NCT02831764)
Timeframe: Week 24

Intervention	Percentage of participants (Number)
	Baseline CD4+ cell count Group-1, <=200,n=32,26	Baseline CD4+ cell count Group-1, >200,n=328,333	Female, n=54, 46	Male, n=306, 313	Age, <35,n= 209, 203	Age, 35 to <50,n=115, 122	Age, >=50, n=36, 34	Baseline plasma HIV-1 RNA, <=100000,n=294,282	Baseline plasma HIV-1 RNA, >100000,n=66, 77	Race, White, n=240, 252	Race, African American/African H., n=51, 35	Race, Asian, n=34, 30	Race, Other, n=35, 42
DTG + 3TC - Double-blind Phase	78	95	93	94	93	96	94	94	92	95	90	97	89
DTG + TDF/FTC - Double-blind Phase	92	94	89	95	94	94	91	95	90	95	89	90	93

[back to top]

Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Weeks 24, 48

Blood samples were collected to perform evaluation of fasting LDL cholesterol. Any abnormalities were evaluated by the investigator and graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Percentage of participants with Grade 2 or greater laboratory abnormalities in fasting LDL cholesterol by Weeks 24 and 48 have been presented. Participants without any post-Baseline fasting LDL cholesterol value prior to Week 48 or those who had Baseline lipids-lowering agents were not included. Lipid Last Observation Carried Forward (LOCF) data was used such that the last available fasted, on-treatment lipid value prior to the initiation of a lipid-lowering agent was used in place of future observed values. Percentage values are rounded-off. (NCT02831764)
Timeframe: Weeks 24 and 48

Intervention	Percentage of participants (Number)
	Week 24, n=313, 320	Week 48, n=324, 332
DTG + 3TC - Double-blind Phase	4	4
DTG + TDF/FTC - Double-blind Phase	0	2

[back to top]

Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 144

Blood and/or urine were collected to perform evaluation of renal inflammation biomarkers: Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine. Baseline value was the latest pre-dose assessment. Change from Baseline was performed on log-transformed data. Ratio to Baseline was calculated as ratio of post-dose visit value over Baseline value. Biomarkers were Adjusted for treatment, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, loge transformed Baseline biomarker value, treatment and visit interaction, and loge transformed Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Week 144

Intervention	Ratio (Geometric Mean)
	Urine Albumin/Creatinine, Week 144, n=230, 221	Urine B2M/Urine Creatinine, Week 144, n=108, 93	Urine Phosphate, Week 144, n=301, 301	Urine Protein/Creatinine, Week 144, n=236, 246	Urine RBP 4/Urine Creatinine, Week 144, n=294, 289
DTG + 3TC - Double-blind Phase + Open-label Phase	1.036	0.872	1.083	0.999	1.159
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	1.067	1.494	1.084	1.180	1.567

[back to top]

Ratio to Baseline in Renal Biomarkers- Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine and Urine RBP 4/Urine Creatinine at Week 96

Intervention	Ratio (Geometric Mean)
	Urine Albumin/Creatinine, Week 96, n=239, 243	Urine B2M/Urine Creatinine, Week 96, n=101, 96	Urine Phosphate, Week 96, n=316, 322	Urine Protein/Creatinine, Week 96, n=251, 261	Urine RBP 4/Urine Creatinine, Week 96, n=314, 318
DTG + 3TC - Double-blind Phase	0.939	0.844	1.156	0.887	1.030
DTG + TDF/FTC - Double-blind Phase	0.997	1.259	1.069	1.016	1.287

[back to top]

Ratio to Baseline in Renal Biomarkers-Urine and Serum Beta-2 Microglobulin (B2M), Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine at Weeks 24, 48

Blood and/or urine were collected to perform evaluation of renal inflammation biomarkers: Urine and Serum B2M, Urine Albumin/Creatinine, Urine B2M/Urine Creatinine, Urine Phosphate, Urine Protein/Creatinine, Urine RBP 4 and Urine RBP 4/Urine Creatinine. Baseline value was the latest pre-dose assessment. Change from Baseline was performed on log-transformed data. Ratio to Baseline was calculated as ratio of post-dose visit value over Baseline value. Geometric mean ratio and 95% CI of geometric mean ratio have been presented. Biomarkers were Adjusted for treatment, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, loge transformed Baseline biomarker value, treatment and visit interaction, and loge transformed Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and Weeks 24, 48

Intervention	Ratio (Geometric Mean)
	Serum B2M, Week 24, n=344,346	Serum B2M, Week 48, n=335,336	Urine B2M, Week 24, n=124,106	Urine B2M, Week 48, n=109, 103	Urine Albumin/Creatinine, Week 24, n=259, 251	Urine Albumin/Creatinine , Week 48, n=249, 240	Urine B2M/Urine Creatinine , Week 24, n=122, 104	Urine B2M/Urine Creatinine , Week 48, n=108, 103	Urine Phosphate, Week 24, n=343, 340	Urine Phosphate, Week 48, n=335, 332	Urine Protein/Creatinine, Week 24, n=263,279	Urine Protein/Creatinine , Week 48, n=259, 261	Urine RBP 4, Week 24, n=340, 338	Urine RBP 4, Week 48, n=333, 331	Urine RBP 4/Urine Creatinine, Week 24, n=338, 335	Urine RBP 4/Urine Creatinine, Week 48, n=331, 328
DTG + 3TC - Double-blind Phase	0.809	0.811	0.844	0.917	0.907	0.911	0.880	0.969	1.041	1.121	0.818	0.866	0.656	0.740	0.670	0.749
DTG + TDF/FTC - Double-blind Phase	0.882	0.887	1.129	1.323	1.021	0.971	1.126	1.307	1.063	1.056	0.991	1.007	0.824	0.819	0.811	0.844

[back to top]

Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 96

Blood samples were collected to perform evaluation of bone biomarker serum vitamin D. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count (factor), age, sex (factor), race (factor), BMI (factor), smoking status (factor), current Vitamin D use (factor), Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. Baseline value is defined as the latest pre-dose assessment. Change from Baseline was calculated as value at the indicated time point minus Baseline value. (NCT02831764)
Timeframe: Baseline and at Week 96

Intervention	Nanomoles per Liter (nmol/L) (Mean)
DTG + 3TC - Double-blind Phase	-1.7
DTG + TDF/FTC - Double-blind Phase	1.3

[back to top]

Change From Baseline in Renal Biomarker-Serum RBP at Week 96

Blood and/or urine samples were collected to perform evaluation of renal biomarkers which included Serum RBP. Baseline value is the latest pre-dose assessment. Change from Baseline was defined as value at indicated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Week 96

Intervention	Microgram per millimoles (ug/mmol) (Mean)
DTG + 3TC - Double-blind Phase	0.557
DTG + TDF/FTC - Double-blind Phase	2.483

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 144

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+ cells. Analysis was performed by flow cytometry. Baseline value is defined as the the latest pre-dose assessment. Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error has been presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for the following covariates/factors: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, treatment and visit interaction, and Baseline CD4+ cell count and visit interaction, with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and Week 144

Intervention	Cells/mm^3 (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	301.7
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	296.6

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 96

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+ cells. Analysis was performed by flow cytometry. Baseline value is defined as the the latest pre-dose assessment. Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error has been presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for the following covariates/factors: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, treatment and visit interaction, and Baseline CD4+ cell count and visit interaction, with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and Week 96

Intervention	Cells/mm^3 (Mean)
DTG + 3TC - Double-blind Phase	272.0
DTG + TDF/FTC - Double-blind Phase	264.6

[back to top]

Number of Participants Who Discontinue Treatment Due to AEs Over Week 144

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Number of participants who discontinued treatment due to AEs have been reported. (NCT02831764)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
DTG + 3TC - Double-blind Phase + Open-label Phase	13
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	16

[back to top]

Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 144

Blood samples were collected to perform evaluation of fasting LDL cholesterol. Any abnormalities were evaluated by the investigator and graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). Percentage of participants with Grade 2 or greater laboratory abnormalities in fasting LDL cholesterol by Week 144 have been presented. Participants without any post-Baseline fasting LDL cholesterol value prior to Week 144 or those who had Baseline lipids-lowering agents were not included. Lipid Last Observation Carried Forward (LOCF) data was used such that the last available fasted, on-treatment lipid value prior to the initiation of a lipid-lowering agent was used in place of future observed values. Percentage values are rounded-off. (NCT02831764)
Timeframe: Week 144

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase + Open-label Phase	6
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	4

[back to top]

Percentage of Participants With Grade 2 or Greater Laboratory Abnormalities in Fasting LDL Cholesterol by Week 96

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase	6
DTG + TDF/FTC - Double-blind Phase	2

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 144

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. This endpoint was analyzed using a stratified analysis with CMH weights. Percentage values are rounded off. (NCT02831764)
Timeframe: Week 144

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase + Open-label Phase	84
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	84

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 24

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. This endpoint was analyzed using a stratified analysis with CMH weights. Percentage values are rounded off. (NCT02831764)
Timeframe: Week 24

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase	94
DTG + TDF/FTC - Double-blind Phase	94

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 96

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (due to missing data or discontinuation of investigational product prior to the visit window) as non-responders, as well as participants who switch their concomitant ART prior to the visit of interest. This endpoint was analyzed using a stratified analysis with CMH weights. Percentage values are rounded off. (NCT02831764)
Timeframe: Week 96

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase	88
DTG + TDF/FTC - Double-blind Phase	90

[back to top]

Percentage of Participants With Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/mL (c/mL) at Week 48

Intervention	Percentage of participants (Number)
DTG + 3TC - Double-blind Phase	93
DTG + TDF/FTC - Double-blind Phase	94

[back to top]

Time to Viral Suppression (HIV-1 RNA <50 c/mL) up to Week 144

Intervention	Days (Median)
DTG + 3TC - Double-blind Phase + Open-label Phase	29.0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	29.0

[back to top]

CD4+ Cell Counts at Weeks 24 and 48

Intervention	Cells/mm^3 (Mean)
	Week 24, n=349,345	Week 48, n=337,340
DTG + 3TC - Double-blind Phase	650.4	688.1
DTG + TDF/FTC - Double-blind Phase	633.0	689.8

[back to top]

Change From Baseline in Bone Biomarker-Serum Vitamin D at Weeks 24, 48

Intervention	Nanomoles per Liter (nmol/L) (Least Squares Mean)
	Serum Vitamin D, Week 24, n=346, 344	Serum Vitamin D, Week 48, n=336, 335
DTG + 3TC - Double-blind Phase	11.2	0.3
DTG + TDF/FTC - Double-blind Phase	15.4	0.4

[back to top]

Change From Baseline in Bone Biomarkers-Serum Bone Specific Alkaline Phosphatase (Bone-ALP), Serum Osteocalcin, Serum Procollagen 1 N-Terminal Propeptide (PINP) and Serum Type I Collagen C-Telopeptides (CTX-1) at Weeks 24, 48

Blood samples were collected to perform evaluation of bone biomarkers which included bone-ALP, Serum Osteocalcin, PINP and CTX-1. Adjusted mean and standard error is presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count (factor), age, sex (factor), race (factor), BMI (factor), smoking status (factor), current Vitamin D use (factor), Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. Baseline value is defined as the latest pre-dose assessment. Change from Baseline was calculated as value at the indicated time point minus Baseline value. (NCT02831764)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Micrograms per Liter (ug/L) (Mean)
	Bone-ALP, Week 24, n=345, 346	Bone-ALP, Week 48, n=334, 337	Serum Osteocalcin, Week 24, n=345, 346	Serum Osteocalcin, Week 48, n=335, 336	PINP, Week 24, n=344, 346	PINP, Week 48, n=335, 337	CTX-1, Week 24, n=342, 342	CTX-1, Week 48, n=332, 333
DTG + 3TC - Double-blind Phase	0.72	1.24	2.13	0.40	1.7	0.4	0.1541	0.1345
DTG + TDF/FTC - Double-blind Phase	3.38	4.33	6.80	6.30	15.2	13.3	0.2812	0.3388

[back to top]

Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 144

Blood samples were collected to perform evaluation of bone biomarkers which included bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type CTX-1. Adjusted mean is the estimated mean change from Baseline in each arm calculated from a repeated measures model adjusting for: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count (factor), age, sex (factor), race (factor), BMI (factor), smoking status (factor), current vitamin D use (factor), Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. Baseline value is defined as the latest pre-dose assessment. Change from Baseline was calculated as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and at Week 144

Intervention	Micrograms per Liter (ug/L) (Mean)
	Bone-ALP, Week 144, n=302, 305	Serum Osteocalcin, Week 144, n=300, 304	PINP, Week 144, n=299, 300	CTX-1, Week 144, n=291, 298
DTG + 3TC - Double-blind Phase + Open-label Phase	-0.25	-1.02	-0.1	0.0505
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	1.88	2.87	9.4	0.1868

[back to top]

Change From Baseline in Bone Biomarkers-Serum Bone-ALP, Serum Osteocalcin, Serum PINP and Serum Type I CTX-1 at Week 96

Intervention	Micrograms per Liter (ug/L) (Mean)
	Bone-ALP, Week 96, n=315, 326	Serum Osteocalcin, Week 96, n=315, 326	PINP, Week 96, n=315, 325	CTX-1, Week 96, n=311, 318
DTG + 3TC - Double-blind Phase	0.26	0.13	7.0	0.0604
DTG + TDF/FTC - Double-blind Phase	2.39	3.90	19.5	0.1787

[back to top]

Change From Baseline in European Quality of Life [EuroQoL] - 5 Dimensions - 5 Levels (EQ-5D-5L) Utility Score at Weeks 4, 24, 48

EQ-5D-5L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has 1 question assessing each of 5 dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. The health state is defined by combining the levels of answers from each of the 5 questions. Each health state is referred to in terms of a 5 digit code. Health state 5 digit code is translated into utility score, which is valued up to 1 (perfect health) with lower values meaning worse state. EQ-5D-5L utility score ranges from -0.281 to 1. Higher scores indicate better health. MMRM was run on LOCF dataset. Baseline was the latest pre-dose assessment and change from Baseline=post-dose value minus Baseline value. (NCT02831764)
Timeframe: Baseline (Day 1) and Weeks 4, 24, 48

Intervention	Scores on a scale (Least Squares Mean)
	Week 4, n=359, 355	Week 24, n=360, 358	Week 48, n=360, 358
DTG + 3TC - Double-blind Phase	0.0111	0.0207	0.0189
DTG + TDF/FTC - Double-blind Phase	0.0130	0.0203	0.0208

[back to top]

Change From Baseline in EuroQol - 5 Dimensions - 5 Levels (EQ-5D-5L) Thermometer Scores at Weeks 4, 24, 48

EQ-5D-5L questionnaire provided a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. EQ-5D-5L included EQ visual Analogue scale (EQ VAS) 'Thermometer' which provided Self-rated current health status. Score ranges from 0 (worst imaginable health state) to 100 (best imaginable health state). MMRM was run on the LOCF dataset, using the observed margins (OM) option. Baseline was the latest pre-dose assessment value and change from Baseline=post-dose value minus Baseline value. (NCT02831764)
Timeframe: Baseline (Day 1) and Weeks 4, 24, 48

Intervention	Scores on a scale (Least Squares Mean)
	Week 4, n=358, 355	Week 24, n=359, 358	Week 48, n=359, 358
DTG + 3TC - Double-blind Phase	1.8	3.9	4.0
DTG + TDF/FTC - Double-blind Phase	3.1	4.5	4.6

[back to top]

Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 144

Intervention	Millimoles per liter (Mean)
	Serum or Plasma Cholesterol, Week 144, n=263, 278	HDL Cholesterol, Direct, Week 144, n=264, 278	LDL Cholesterol, Week 144, n=263, 278	Triglycerides, Week 144, n=264, 278
DTG + 3TC - Double-blind Phase + Open-label Phase	0.360	0.180	0.143	0.078
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	-0.015	0.093	-0.085	-0.057

[back to top]

Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Week 96

Intervention	Millimoles per liter (Mean)
	Serum or Plasma Cholesterol, Week 96, n=270, 289	HDL Cholesterol, Direct, Week 96, n=271, 289	LDL Cholesterol, Week 96, n=270, 289	Triglycerides, Week 96, n=271, 289
DTG + 3TC - Double-blind Phase	0.345	0.185	0.139	0.105
DTG + TDF/FTC - Double-blind Phase	-0.132	0.071	-0.160	-0.102

[back to top]

Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Weeks 24, 48

Blood and samples were collected to perform evaluation of renal biomarker which included Serum or Plasma Creatinine. Baseline value is defined as the the latest pre-dose assessment. Change from Baseline was calculated as value at the inidcated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Weeks 24, 48

Intervention	Micromoles per Liter (umol/L) (Mean)
	Serum or Plasma Creatinine, Week 24, n=346, 344	Serum or Plasma Creatinine, Week 48, n=335, 337
DTG + 3TC - Double-blind Phase	10.51	10.32
DTG + TDF/FTC - Double-blind Phase	13.53	13.44

[back to top]

Change From Baseline in Renal Biomarkers-Serum Cystatin C and Serum Retinol Binding Protein (RBP) at Weeks 24, 48

Blood and/or urine samples were collected to perform evaluation of renal biomarkers which included Serum Cystatin C and Serum RBP. Baseline value is the latest pre-dose assessment. Change from Baseline was defined as value at indicated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Weeks 24, 48

Intervention	Milligrams per Liter (mg/L) (Least Squares Mean)
	Serum Cystatin C, Week 24, n=345,345	Serum Cystatin C, Week 48, n=335,336	Serum RBP, Week 24, n=345,343	Serum RBP, Week 48, n=334, 334
DTG + 3TC - Double-blind Phase	-0.04	-0.05	1.2	0.6
DTG + TDF/FTC - Double-blind Phase	0.00	-0.04	1.4	-0.1

[back to top]

Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) and Serum or Plasma GFR From Creatinine Adjusted Using CKD-EPI at Weeks 24, 48

Blood samples were collected to perform evaluation of renal biomarkers which included Serum GFR from cystatin C adjusted using CKD-EPI (GFR-cystatin C adjusted) and Serum or Plasma GFR from creatinine adjusted using CKD-EPI. Baseline value is the latest pre-dose Assessment. Change from Baseline was defined as value at the indicated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Weeks 24, 48

Intervention	Milliliter/minute/1.73 meter^2 (Mean)
	GFR Cystatin C adjusted, Week 24, n=345,345	GFR Cystatin C adjusted, Week 48, n=335,336	GFR creatinine adjusted, Week 24, n=346,344	GFR creatinine adjusted, Week 48, n=335, 337
DTG + 3TC - Double-blind Phase	3.8	5.4	-12.0	-12.1
DTG + TDF/FTC - Double-blind Phase	0.2	3.6	-15.4	-15.4

[back to top]

Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 144

Blood samples were collected to perform evaluation of renal biomarkers which included Serum GFR from cystatin C adjusted using CKD-EPI and Serum or Plasma GFR from creatinine adjusted for BSA using CKD-EPI. Baseline value is the latest pre-dose Assessment. Change from Baseline was defined as value at the indicated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Week 144

Intervention	Milliliter/minute/1.73 meter^2 (Mean)
	GFR Cystatin C adjusted, Week 144, n=301,304	GFR creatinine adjusted, Week 144, n=292,292
DTG + 3TC - Double-blind Phase + Open-label Phase	10.3	-15.5
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	10.1	-18.2

[back to top]

Change From Baseline in Renal Biomarkers-Serum GFR From Cystatin C Adjusted Using CKD-EPI and Serum or Plasma GFR From Creatinine Adjusted for BSA Using CKD-EPI Method at Week 96

Blood samples were collected to perform evaluation of renal biomarkers which included Serum GFR from cystatin C adjusted using CKD-EPI and Serum or Plasma GFR from creatinine adjusted for BSA using CKD-EPI. Baseline value is the latest pre-dose Assessment. Change from Baseline was defined as value at the indicated time point minus Baseline value. Biomarkers were adjusted for treatment, visit, Baseline plasma HIV-1 RNA, baseline CD4+ cell count, age, sex, race, presence of diabetes mellitus, presence of hypertension, Baseline biomarker value, treatment and visit interaction, and Baseline biomarker value and visit interaction; with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and at Week 96

Intervention	Milliliter/minute/1.73 meter^2 (Mean)
	GFR Cystatin C adjusted, Week 96, n=316,326	GFR creatinine adjusted, Week 96, n=315,325
DTG + 3TC - Double-blind Phase	9.1	-14.2
DTG + TDF/FTC - Double-blind Phase	9.5	-17.5

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 144 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age group, Gender and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from ANCOVA model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 144

Intervention	Cells/mm^3 (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=241,234	Baseline plasma HIV-1 RNA,>100000, n=55,58	Baseline CD4+ cell count,<=200, n=25, 19	Baseline CD4+ cell count,>200, n=271, 273	Age group, <35,n=171, 159	Age group-1, 35 to <50, n=95, 103	Age group-1, >=50, n=30, 30	Female, n=40, 37	Male, n=256, 255	Race group, White, n=202, 211	Race group, African Am/African H., n=34, 24	Race group, Asian, n=29, 25	Race group, Other, n=31, 32
DTG + 3TC - Double-blind Phase + Open-label Phase	286.8	338.2	264.8	300.3	302.9	292.8	274.1	355.0	287.7	300.0	256.4	258.5	355.0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	277.8	354.7	208.9	297.9	277.1	329.2	250.0	381.8	279.6	296.5	377.6	245.4	240.7

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 24 and 48

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+ cells. Analysis was performed by flow cytometry. Baseline value is defined as the the latest pre-dose assessment. Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted least mean and standard error has been presented. Adjusted mean is the estimated mean change from Baseline at each visit in each arm calculated from a repeated measures model adjusting for the following covariates/factors: treatment, visit, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, treatment and visit interaction, and Baseline CD4+ cell count and visit interaction, with visit as the repeated factor. (NCT02831764)
Timeframe: Baseline and Weeks 24, 48

Intervention	Cells/mm^3 (Least Squares Mean)
	Week 24, n=349, 345	Week 48, n=337, 340
DTG + 3TC - Double-blind Phase	188.8	225.7
DTG + TDF/FTC - Double-blind Phase	163.2	217.2

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 24 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age group, Gender and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from ANCOVA model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 24

Intervention	Cells/mm^3 (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=283,273	Baseline plasma HIV-1 RNA,>100000, n=66,72	Baseline CD4+ cell count,<=200, n=29, 26	Baseline CD4+ cell count,>200, n=320, 319	Age group, <35,n= 201, 193	Age group-1, 35 to <50, n=113, 119	Age group-1, >=50, n=35, 33	Female, n=52, 42	Male, n=297, 303	Race group, White, n=236, 243	Race group, African Am/African H., n=48, 34	Race group, Asian, n=33, 28	Race group, Other, n=32, 40
DTG + 3TC - Double-blind Phase	186.01	193.90	167.95	189.91	190.12	180.50	198.74	213.58	183.41	186.48	195.18	154.03	222.21
DTG + TDF/FTC - Double-blind Phase	148.21	220.71	106.23	167.35	151.13	190.40	133.21	153.92	164.18	167.44	151.93	141.24	160.20

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 48 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age group, Gender and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from Analysis of Covariance (ANCOVA) model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 48

Intervention	Cells/mm^3 (Least Squares Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=273,271	Baseline plasma HIV-1 RNA,>100000, n=64,69	Baseline CD4+ cell count,<=200, n=28, 25	Baseline CD4+ cell count,>200, n=309, 315	Age group-1, <35,n= 193, 191	Age group-1, 35 to <50, n=112, 117	Age group-1, >=50, n=32, 32	Age group-2, <50,n= 305, 308	Age group-2, >=50, n= 32, 32	Female, n=48, 41	Male, n=289, 299	Race group, White, n=230, 244	Race group, African Am/African H., n=42, 31	Race group, Asian, n=33, 27	Race group, Other, n=32, 38
DTG + 3TC - Double-blind Phase	215.6	261.8	210.9	225.8	234.2	212.7	209.1	226.4	208.5	236.2	222.8	225.5	201.2	204.9	270.2
DTG + TDF/FTC - Double-blind Phase	208.7	248.7	153.2	221.7	201.7	244.2	203.9	217.8	204.1	263.6	210.0	214.2	239.0	189.3	232.6

[back to top]

Changes From Baseline in CD4+ Cell Counts at Week 96 by Subgroups

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells declines. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is the latest pre-dose assessment (Day 1). Change from Baseline was defined as value at the indicated time point minus Baseline value. Adjusted mean and standard error is presented for subgroups (Baseline plasma HIV-1 RNA, Baseline CD4+ cell count, Age group, Gender and race). For each subgroup, adjusted mean is the estimated mean change from Baseline in each arm calculated from ANCOVA model adjusting for the following covariates/factors: treatment, Baseline plasma HIV-1 RNA (factor), Baseline CD4+ cell count, subgroup, and treatment and relevant subgroup interaction. For CD4+ cell count subgroup, Baseline CD4+ cell count group is included as a factor only. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Cells/mm^3 (Mean)
	Baseline plasma HIV-1 RNA,<=100000, n=259,260	Baseline plasma HIV-1 RNA,>100000, n=59,67	Baseline CD4+ cell count,<=200, n=25, 23	Baseline CD4+ cell count,>200, n=293, 304	Age group-1, <35,n= 186, 187	Age group-1, 35 to <50, n=101, 110	Age group-1, >=50, n=31, 30	Female, n=44, 40	Male, n=274, 287	Race group, White, n=221, 234	Race group, African Am/African H., n=35, 30	Race group, Asian, n=31, 27	Race group, Other, n=31, 36
DTG + 3TC - Double-blind Phase	257.9	312.1	229.4	272.3	266.0	273.6	265.8	312.7	261.4	272.1	246.3	224.0	312.0
DTG + TDF/FTC - Double-blind Phase	257.5	297.4	202.9	269.4	257.7	286.8	233.1	307.6	259.3	258.3	303.7	264.0	278.9

[back to top]

Number of Participants Who Discontinue Treatment Due to AEs Over Weeks 24, 48, 96

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Number of participants who discontinued treatment due to AEs have been reported. (NCT02831764)
Timeframe: Up to Weeks 24, 48 and 96

Intervention	Participants (Count of Participants)
	Week 24	Week 48	Week 96
DTG + 3TC - Double-blind Phase	6	8	10
DTG + TDF/FTC - Double-blind Phase	4	8	12

[back to top]

Number of Participants With AEs by Maximum Severity Grades up to Week 148

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. AEs were evaluated by the investigator and graded according to the Division of Acquired Immunodeficiency Syndrome (DAIDS) toxicity scales from Grade 1 to 5 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening, 5=Death). The higher the grade, the more severe the symptoms. Number of participants with adverse events by maximum grade have been presented. (NCT02831764)
Timeframe: Up to Week 148

Intervention	Participants (Count of Participants)
	Grade 1 AEs	Grade 2 AEs	Grade 3 AEs	Grade 4 AEs	Grade 5 AEs
DTG + 3TC - Double-blind Phase + Open-label Phase	54	211	32	7	2
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	54	205	43	6	1

[back to top]

Number of Participants With Any Adverse Event (AE) and Serious AE (SAE) up to Week 148

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Any untoward event resulting in death, life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, congenital anomaly/birth defect, any other situation according to medical or scientific judgment that may not be immediately life-threatening or result in death or hospitalization but may jeopardize the participant or may require medical or surgical intervention or protocol-defined event associated with liver injury and impaired liver function were categorized as SAE. Safety Population was used which comprised of all participants who received at least one dose of study treatment. (NCT02831764)
Timeframe: Up to Week 148

Intervention	Participants (Count of Participants)
	Any AE	Any SAE
DTG + 3TC - Double-blind Phase + Open-label Phase	306	39
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	309	47

[back to top]

Change From Baseline in Renal Biomarker-Serum or Plasma Creatinine at Week 96

Intervention	Micromoles per Liter (umol/L) (Mean)
DTG + 3TC - Double-blind Phase	11.71
DTG + TDF/FTC - Double-blind Phase	14.75

[back to top]

Number of Participants With Any Drug Related AEs and Drug Related AEs by Maximum Grade up to Week 148

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. AEs were evaluated by the investigator and graded according to the DAIDS toxicity scales from Grade 1 to 5. (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening, 5=Death). The higher the grade, the more severe the symptoms. Number of participants with drug related AEs and drug related AEs by by maximum grade have been presented. (NCT02831764)
Timeframe: Up to Week 148

Intervention	Participants (Count of Participants)
	Any drug related AE	Drug related AEs with maximum toxicity Grade 1	Drug related AEs with maximum toxicity Grade 2	Drug related AEs with maximum toxicity Grade 3	Drug related AEs with maximum toxicity Grade 4	Drug related AEs with maximum toxicity Grade 5
DTG + 3TC - Double-blind Phase + Open-label Phase	69	37	26	5	1	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	91	53	29	8	1	0

[back to top]

Number of Participants With HIV-1 Disease Progression up to Week 144

Intervention	Participants (Count of Participants)
	No disease progression	From CDC Stage 1 to CDC Stage 3 Event	From CDC Stage 2 to CDC Stage 3 Event	From CDC Stage 3 to New CDC Stage 3 Event	From CDC Stage 1, 2 or 3 to Death
DTG + 3TC - Double-blind Phase + Open-label Phase	356	0	2	1	2
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	357	0	1	0	1

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities up to Week 144

Blood samples were collected up to Week 144 for assessment of Alanine Aminotransferase (ALT), Albumin, Alkaline Phosphatase (ALP), Aspartate aminotransferase (AST), Bilirubin, Carbon dioxide (CO2), Cholesterol, Creatine kinase (CK), Creatinine, Direct Bilirubin, Glomerular filtration rate (GFR), Hypercalcemia, Hyperglycemia, Hyperkalemia, Hypernatremia, Hypocalcemia, Hypoglycemia, Hypokalemia, Hyponatremia, Low density lipid (LDL) Cholesterol, Lactate Dehydrogenase, Lipase, Phosphate, and Triglycerides. Any abnormality was graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Only those participants with maximum post-Baseline emergent chemistry toxicities in any of the chemistry parameters have been presented. (NCT02831764)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	ALT, Grades 1 to 4	ALT, Grades 2 to 4	ALT, Grades 3 to 4	ALT, Grade 1	ALT, Grade 2	ALT, Grade 3	ALT, Grade 4	Albumin, Grades 1 to 4	Albumin, Grades 2 to 4	Albumin, Grades 3 to 4	Albumin, Grade 1	Albumin, Grade 2	Albumin, Grade 3	Albumin, Grade 4	ALP, Grades 1 to 4	ALP, Grades 2 to 4	ALP, Grades 3 to 4	ALP, Grade 1	ALP, Grade 2	ALP, Grade 3	ALP, Grade 4	AST, Grades 1 to 4	AST, Grades 2 to 4	AST, Grades 3 to 4	AST, Grade 1	AST, Grade 2	AST, Grade 3	AST, Grade 4	Bilirubin, Grades 1 to 4	Bilirubin, Grades 2 to 4	Bilirubin, Grades 3 to 4	Bilirubin, Grade 1	Bilirubin, Grade 2	Bilirubin, Grade 3	Bilirubin, Grade 4	CO2, Grades 1 to 4	CO2, Grades 2 to 4	CO2, Grades 3 to 4	CO2, Grade 1	CO2, Grade 2	CO2, Grade 3	CO2, Grade 4	Cholesterol, Grades 1 to 4	Cholesterol, Grades 2 to 4	Cholesterol, Grades 3 to 4	Cholesterol, Grade 1	Cholesterol, Grade 2	Cholesterol, Grade 3	Cholesterol, Grade 4	CK, Grades 1 to 4	CK, Grades 2 to 4	CK, Grades 3 to 4	CK, Grade 1	CK, Grade 2	CK, Grade 3	CK, Grade 4	Creatinine, Grades 1 to 4	Creatinine, Grades 2 to 4	Creatinine, Grades 3 to 4	Creatinine, Grade 1	Creatinine, Grade 2	Creatinine, Grade 3	Creatinine, Grade 4	Direct Bilirubin, Grades 1 to 4	Direct Bilirubin, Grades 2 to 4	Direct Bilirubin, Grades 3 to 4	Direct Bilirubin, Grade 1	Direct Bilirubin, Grade 2	Direct Bilirubin, Grade 3	Direct Bilirubin, Grade 4	GFR, Grades 1 to 4	GFR, Grades 2 to 4	GFR, Grades 3 to 4	GFR, Grade 1	GFR, Grade 2	GFR, Grade 3	GFR, Grade 4	Hypercalcaemia, Grades 1 to 4	Hypercalcaemia, Grades 2 to 4	Hypercalcaemia, Grades 3 to 4	Hypercalcemia, Grade 1	Hypercalcaemia, Grade 2	Hypercalcaemia, Grade 3	Hypercalcaemia, Grade 4	Hyperglycaemia, Grades 1 to 4	Hyperglycaemia, Grades 2 to 4	Hyperglycaemia, Grades 3 to 4	Hyperglycaemia, Grade 1	Hyperglycaemia, Grade 2	Hyperglycaemia, Grade 3	Hyperglycaemia, Grade 4	Hyperkalemia, Grades 1 to 4	Hyperkalemia, Grades 2 to 4	Hyperkalemia, Grades 3 to 4	Hyperkalemia, Grade 1	Hyperkalemia, Grade 2	Hyperkalemia, Grade 3	Hyperkalemia, Grade 4	Hypernatremia, Grades 1 to 4	Hypernatremia, Grades 2 to 4	Hypernatremia, Grades 3 to 4	Hypernatremia, Grade 1	Hypernatremia, Grade 2	Hypernatremia, Grade 3	Hypernatremia, Grade 4	Hypocalcaemia, Grades 1 to 4	Hypocalcaemia, Grades 2 to 4	Hypocalcaemia, Grades 3 to 4	Hypocalcaemia, Grade 1	Hypocalcaemia, Grade 2	Hypocalcaemia, Grade 3	Hypocalcaemia, Grade 4	Hypoglycaemia, Grades 1 to 4	Hypoglycaemia, Grades 2 to 4	Hypoglycaemia, Grades 3 to 4	Hypoglycaemia, Grade 1	Hypoglycaemia, Grade 2	Hypoglycaemia, Grade 3	Hypoglycaemia, Grade 4	Hypokalemia, Grades 1 to 4	Hypokalemia, Grades 2 to 4	Hypokalemia, Grades 3 to 4	Hypokalemia, Grade 1	Hypokalemia, Grade 2	Hypokalemia, Grade 3	Hypokalemia, Grade 4	Hyponatremia, Grades 1 to 4	Hyponatremia, Grades 2 to 4	Hyponatremia, Grades 3 to 4	Hyponatremia, Grade 1	Hyponatremia, Grade 2	Hyponatremia, Grade 3	Hyponatremia, Grade 4	LDL Cholesterol, Grades 1 to 4	LDL Cholesterol, Grades 2 to 4	LDL Cholesterol, Grades 3 to 4	LDL Cholesterol, Grade 1	LDL Cholesterol, Grade 2	LDL Cholesterol, Grade 3	LDL Cholesterol, Grade 4	Lactate Dehydrogenase, Grades 1 to 4	Lactate Dehydrogenase, Grades 2 to 4	Lactate Dehydrogenase, Grades 3 to 4	Lactate Dehydrogenase, Grade 1	Lactate Dehydrogenase, Grade 2	Lactate Dehydrogenase, Grade 3	Lactate Dehydrogenase, Grade 4	Lipase, Grades 1 to 4	Lipase, Grades 2 to 4	Lipase, Grades 3 to 4	Lipase, Grade 1	Lipase, Grade 2	Lipase, Grade 3	Lipase, Grade 4	Phosphate, Grades 1 to 4	Phosphate, Grades 2 to 4	Phosphate, Grades 3 to 4	Phosphate, Grade 1	Phosphate, Grade 2	Phosphate, Grade 3	Phosphate, Grade 4	Triglycerides, Grades 1 to 4	Triglycerides, Grades 2 to 4	Triglycerides, Grades 3 to 4	Triglycerides, Grade 1	Triglycerides, Grade 2	Triglycerides, Grade 3	Triglycerides, Grade 4
DTG + 3TC - Double-blind Phase + Open-label Phase	77	30	13	47	17	6	7	2	2	0	0	2	0	0	10	2	0	8	2	0	0	71	30	15	41	15	8	7	46	13	4	33	9	0	4	111	10	0	101	10	0	0	98	23	1	75	22	1	0	91	49	29	42	20	11	18	18	5	0	13	5	0	0	11	11	11	0	0	11	0	198	198	20	0	178	20	0	4	0	0	4	0	0	0	106	49	3	57	46	2	1	7	2	1	5	1	0	1	4	1	0	3	1	0	0	17	6	1	11	5	1	0	22	6	4	16	2	3	1	9	0	0	9	0	0	0	23	0	0	23	0	0	0	66	21	6	45	15	6	0	4	3	0	1	3	0	0	72	37	9	35	28	6	3	75	50	7	25	43	7	0	89	22	4	67	18	4	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	71	29	15	42	14	8	7	1	1	1	0	0	1	0	17	3	1	14	2	1	0	83	32	14	51	18	11	3	56	16	3	40	13	2	1	111	4	0	107	4	0	0	50	12	0	38	12	0	0	83	47	28	36	19	11	17	28	2	1	26	1	1	0	10	10	10	0	0	10	0	219	219	29	0	190	28	1	5	1	1	4	0	0	1	86	38	3	48	35	2	1	7	1	1	6	0	1	0	7	0	0	7	0	0	0	21	11	3	10	8	2	1	21	5	1	16	4	0	1	5	1	0	4	1	0	0	22	3	1	19	2	0	1	40	13	2	27	11	2	0	2	0	0	2	0	0	0	81	43	17	38	26	13	4	78	51	7	27	44	7	0	75	15	1	60	14	1	0

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities up to Week 144

Blood samples were collected up to Week 144 for assessment of hemoglobin, leukocytes, neutrophils and platelet count. Any abnormality was graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). The higher the grade, the more severe the symptoms. Only those participants with maximum post-Baseline emergent hematology toxicities in any of the listed hematology parameters have been presented. (NCT02831764)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	Hemoglobin, Grades 1 to 4	Hemoglobin, Grades 2 to 4	Hemoglobin, Grades 3 to 4	Hemoglobin, Grade 1	Hemoglobin, Grade 2	Hemoglobin, Grade 3	Hemoglobin, Grade 4	Leukocytes, Grades 1 to 4	Leukocytes, Grades 2 to 4	Leukocytes, Grades 3 to 4	Leukocytes, Grade 1	Leukocytes, Grade 2	Leukocytes, Grade 3	Leukocytes, Grade 4	Neutrophils, Grades 1 to 4	Neutrophils, Grades 2 to 4	Neutrophils, Grades 3 to 4	Neutrophils, Grade 1	Neutrophils, Grade 2	Neutrophils, Grade 3	Neutrophils, Grade 4	Platelets, Grades 1 to 4	Platelets, Grades 2 to 4	Platelets, Grades 3 to 4	Platelets, Grade 1	Platelets, Grade 2	Platelets, Grade 3	Platelets, Grade 4
DTG + 3TC - Double-blind Phase + Open-label Phase	8	6	2	2	4	1	1	5	1	0	4	1	0	0	23	8	4	15	4	2	2	13	5	0	8	5	0	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	10	6	1	4	5	1	0	5	0	0	5	0	0	0	7	3	1	4	2	1	0	9	5	0	4	5	0	0

[back to top]

Number of Participants With Treatment-emergent Genotypic Resistance up to Week 144

Intervention	Participants (Count of Participants)
	INSTI Mutations	Major mutations of the NRTI
DTG + 3TC - Double-blind Phase + Open-label Phase	0	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	0	0

[back to top]

Number of Participants With Treatment-emergent Phenotypic Resistance up to Week 144

Number of participants, who met CVW criteria, with treatment emergent phenotypic resistance to INSTI and/or NRTI were summarized. Assessment of antiviral activity of anti-retroviral therapy (ART) using phenotypic test results were interpreted through a proprietary algorithm (from Monogram Biosciences) and provides the overall susceptibility of the drugs (DTG, 3TC, Abacavir [ABC], elvitegravir [EGV], raltegravir [RAL], zidovudine [AZT], stavudine [D4T], didanosine [DDI]), emtricitabine [FTC], tenofovir disiproxil fumarate [TDF]). Partially sensitive and resistant cells were considered resistant in this analysis. The Viral Phenotypic Population comprised of all participants in the ITT-E population who have available on-treatment phenotypic resistance data. (NCT02831764)
Timeframe: Up to Week 144

Intervention	Participants (Count of Participants)
	INSTI, DTG, Sensitive, n=7,2	INSTI, DTG, Resistant, n=7,2	INSTI, EGV, Sensitive, n=7,2	INSTI, EGV, Resistant, n=7,2	INSTI, RAL, Sensitive, n=7,2	INSTI, RAL, Resistant, n=7,2	NRTI, 3TC, Sensitive, n=7,3	NRTI, 3TC, Resistant, n=7,3	NRTI, ABC, Sensitive, n=7,3	NRTI, ABC, Resistant, n=7,3	NRTI, AZT, Sensitive, n=7,3	NRTI, AZT, Resistant, n=7,3	NRTI, D4T, Sensitive, n=7,3	NRTI, D4T, Resistant, n=7,3	NRTI, DDI, Sensitive, n=7,3	NRTI, DDI, Resistant, n=7,3	NRTI, FTC, Sensitive, n=7,3	NRTI, FTC, Resistant, n=7,3	NRTI, TDF, Sensitive, n=7,3	NRTI, TDF, Resistant, n=7,3
DTG + 3TC - Double-blind Phase + Open-label Phase	7	0	7	0	7	0	7	0	7	0	7	0	7	0	7	0	7	0	7	0
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	2	0	2	0	2	0	3	0	3	0	3	0	3	0	3	0	3	0	3	0

[back to top]

Percentage Change From Baseline in Fasting Lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio at Weeks 24, 48

Blood samples were collected to perform evaluation of fasting lipid-Serum or Plasma Total Cholesterol/HDL Cholesterol Ratio. Baseline value is the latest pre-dose assessment (Day 1). Percentage change from Baseline was calculated as 100 multiplied by ([post-dose visit value minus Baseline value] divided by Baseline value). Lipid last observation carried forwarded (LOCF) data was used such that the last available fasted, on-treatment lipid value prior to the initiation of a lipid-lowering agent was used in place of future observed values. Participants on lipid-lowering agents at Baseline were excluded. (NCT02831764)
Timeframe: Baseline (Day 1) and at Weeks 24, 48

Intervention	Percentage change (Mean)
	Total/HDL Cholesterol Ratio, Week 24, n=298, 310	Total/HDL Cholesterol Ratio, Week 48, n=298, 307
DTG + 3TC - Double-blind Phase	-4.4	-2.8
DTG + TDF/FTC - Double-blind Phase	-7.5	-4.5

[back to top]

Percentage Change From Baseline in Fasting Lipids-Serum or Plasma Cholesterol, Serum or Plasma High Density Lipoprotein (HDL) Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides at Weeks 24, 48

Blood samples were collected to perform evaluation of fasting lipids which included Serum or Plasma Cholesterol, Serum or Plasma HDL Cholesterol (Direct), Serum or Plasma LDL Cholesterol (Calculated or Direct) and Serum or Plasma Triglycerides. Baseline value is defined as the latest pre-dose assessment (Day 1). Percentage change from Baseline was calculated as 100 multiplied by ([post-dose visit value minus Baseline value] divided by Baseline value). (NCT02831764)
Timeframe: Baseline and at Weeks 24, 48

Intervention	Percentage change (Mean)
	Serum or Plasma Cholesterol, Week 24, n=298, 310	Serum or Plasma Cholesterol, Week 48, n=298, 307	HDL Cholesterol, Direct, Week 24, n=299, 310	HDL Cholesterol, Direct, Week 48, n=299, 307	LDL Cholesterol, Week 24, n=298, 309	LDL Cholesterol, Week 48, n=297, 307	Triglycerides,Week 24, n=299, 310	Triglycerides, Week 48, n=299, 307
DTG + 3TC - Double-blind Phase	5.0	9.3	13.9	15.3	3.8	10.7	7.0	7.3
DTG + TDF/FTC - Double-blind Phase	-4.5	-3.3	7.2	4.0	-7.8	-4.1	0.5	-0.3

[back to top]

CD4+ Cell Counts at Week 144

Intervention	Cells/mm^3 (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	763.8
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	770.4

[back to top]

Change From Baseline in Bone Biomarker-Serum Vitamin D at Week 144

Intervention	Nanomoles per Liter (nmol/L) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	1.1
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	1.4

[back to top]

CD4+ Cell Counts at Week 96

Intervention	Cells/mm^3 (Mean)
DTG + 3TC - Double-blind Phase	734.9
DTG + TDF/FTC - Double-blind Phase	739.9

[back to top]

Change From Baseline in EQ-5D-5L Thermometer Scores at Week 144

EQ-5D-5L questionnaire provided a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. EQ-5D-5L included EQ visual Analogue scale (EQ VAS) 'Thermometer' which provided Self-rated current health status. Score ranges from 0 (worst imaginable health state) to 100 (best imaginable health state). MMRM was run on the LOCF dataset, using the observed margins (OM) option. Baseline was the latest pre-dose assessment value and change from Baseline=post-dose value minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 144

Intervention	Scores on a scale (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	4.8
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	4.5

[back to top]

Change From Baseline in EQ-5D-5L Thermometer Scores at Week 96

EQ-5D-5L questionnaire provided a profile of participant function and a global health state rating. The five-item measure has one question assessing each of five dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. EQ-5D-5L included EQ visual Analogue scale (EQ VAS) 'Thermometer' which provided Self-rated current health status. Score ranges from 0 (worst imaginable health state) to 100 (best imaginable health state). MMRM was run on the LOCF dataset, using the observed margins (OM) option. Baseline was the latest pre-dose assessment value and change from Baseline=post-dose value minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Scores on a scale (Mean)
DTG + 3TC - Double-blind Phase	4.4
DTG + TDF/FTC - Double-blind Phase	5.1

[back to top]

Change From Baseline in EQ-5D-5L Utility Score at Week 144

EQ-5D-5L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has 1 question assessing each of 5 dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. The health state is defined by combining the levels of answers from each of the 5 questions. Each health state is referred to in terms of a 5 digit code. Health state 5 digit code is translated into utility score, which is valued up to 1 (perfect health) with lower values meaning worse state. EQ-5D-5L utility score ranges from -0.281 to 1. Higher scores indicate better health. MMRM was run on LOCF dataset. Baseline was the latest pre-dose assessment and change from Baseline=post-dose value minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 144

Intervention	Scores on a scale (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	0.0210
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	0.0131

[back to top]

Change From Baseline in EQ-5D-5L Utility Score at Week 96

EQ-5D-5L questionnaire provides a profile of participant function and a global health state rating. The five-item measure has 1 question assessing each of 5 dimensions: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression and 5 levels for each dimension including 1=no problems, 2=slight problems, 3=moderate problems, 4=severe problems and 5=extreme problems. The health state is defined by combining the levels of answers from each of the 5 questions. Each health state is referred to in terms of a 5 digit code. Health state 5 digit code is translated into utility score, which is valued up to 1 (perfect health) with lower values meaning worse state. EQ-5D-5L utility score ranges from -0.281 to 1. Higher scores indicate better health. MMRM was run on LOCF dataset. Baseline was the latest pre-dose assessment and change from Baseline=post-dose value minus Baseline value. Adjusted mean and standard error is presented. (NCT02831764)
Timeframe: Baseline (Day 1) and Week 96

Intervention	Scores on a scale (Mean)
DTG + 3TC - Double-blind Phase	0.0168
DTG + TDF/FTC - Double-blind Phase	0.0171

[back to top]

Change From Baseline in Renal Biomarker-Serum RBP at Week 144

Intervention	Microgram per millimoles (ug/mmol) (Mean)
DTG + 3TC - Double-blind Phase + Open-label Phase	0.560
DTG + TDF/FTC - Double-blind Phase + Open-label Phase	3.813

[back to top]

Time of Maximum Dolutegravir Concentration

Time of maximum dolutegravir concentration is assessed in hours for the time periods of after the first dose and during steady state. Blood samples for pharmacokinetics were obtained prior to dosing (hour 0) and 1, 2, 3, 4, 6, 8, and 24 hours after dosing. (NCT02924389)
Timeframe: Day 84 (hour 0 through 24)

Intervention	hours (Median)
	First-dose pharmacokinetics (Tmax)	Steady state pharmacokinetics (Tmax)
Anti-retroviral (ARV) Naïve Males and Females	1.5	3.0

[back to top]

Dolutegravir Concentration in Rectal Tissue

Rectal dolutegravir concentrations in rectal tissue stratified by virologic suppressors vs non-suppressors. (NCT02924389)
Timeframe: Week 2, Week 6, Week 12

Intervention	ng/mL (Median)
	Week 2	Week 6	Week 12
HIV RNA Non-suppressors	749	625	373
HIV RNA Suppressors	1606	724	473

[back to top]

Area Under the Dolutegravir Plasma Concentration vs Time Curve

The area under the dolutegravir plasma concentration vs time curve in a 24 hour period (AUC24h) is assessed in hours times micrograms per millimeters (h* µg/mL) for the time periods of after the first dose and during steady state. Blood samples for pharmacokinetics were obtained prior to dosing (hour 0) and 1, 2, 3, 4, 6, 8, and 24 hours after dosing. (NCT02924389)
Timeframe: Day 84 (hour 0 through 24)

Intervention	h* µg/mL (Median)
	First-dose pharmacokinetics (AUC24h)	Steady state pharmacokinetics (AUC24h)
Anti-retroviral (ARV) Naïve Males and Females	22.30	27.24

[back to top]

Dolutegravir Concentration

Dolutegravir concentrations in blood plasma are assessed as the maximum dolutegravir concentration (Cmax) and 24 hour trough (lowest) concentration (C24h) of dolutegravir in micrograms per milliliter (µg/mL). Blood samples for pharmacokinetics were obtained prior to dosing (hour 0) and 1, 2, 3, 4, 6, 8, and 24 hours after dosing. (NCT02924389)
Timeframe: Day 84 (hour 0 through 24)

Intervention	µg/mL (Median)
	First-dose pharmacokinetics (Cmax)	Steady state pharmacokinetics (Cmax)	Trough dolutegravir concentration (C24h)
Anti-retroviral (ARV) Naïve Males and Females	2.01	2.34	0.56

[back to top]

Percentage of Mothers With HIV-1 ARV Drug Resistance Mutations at the Time of Maternal Virologic Failure

Percentage of mothers with HIV-1 antiretroviral (ARV) drug resistance mutations at the time of maternal virologic failure. Virologic failure was defined as two consecutive plasma HIV-1 RNA viral loads <200 copies/mL on or after 24 weeks on study. Drug resistance mutations were assessed using the Stanford algorithm, and all ARV regimens were assessed for mutations. (NCT03048422)
Timeframe: From 24 weeks after randomization through Week 50 postpartum

Intervention	percentage of participants (Number)
Arm 1: Maternal DTG+FTC/TAF	0.92
Arm 2: Maternal DTG+FTC/TDF	1.86
Arm 3: Maternal EFV/FTC/TDF	6.16

[back to top]

Infant Creatinine Clearance

Infant creatinine clearance based on Schwartz formula (NCT03048422)
Timeframe: Delivery and 26 weeks postpartum

Intervention	mL/min (Mean)
	Delivery	26 Weeks Postpartum
Arm 1 Infants	52.7	134.8
Arm 2 Infants	53.1	123.6
Arm 3 Infants	49.0	135.0

[back to top]

Percentage of Mothers With HIV-1 RNA Viral Load Less Than 200 Copies/mL at Delivery

Percentage of mothers with plasma HIV-1 RNA viral load less than 200 copies/mL at delivery determined using real-time test results obtained at site laboratories. This outcome was evaluated in the non-inferiority (primary outcome) and superiority (secondary outcome) analyses. The intention-to-treat analysis included all randomized women who had viral load data available. The per-protocol analysis excluded women who modified randomized treatment (stopped, paused, switched, added any treatment) before viral load evaluation at delivery, with the exception of women who modified randomized treatment for use of a concomitant medication. (NCT03048422)
Timeframe: Delivery

Intervention	Percentage of participants (Number)
	Intention-to-Treat Analysis	Per-Protocol Analysis
Arm 3: Maternal EFV/FTC/TDF	91.0	91.4
Arms 1 and 2: Maternal DTG+FTC/TAF and DTG+FTC/TDF	97.5	97.5

[back to top]

Time to First HIV-1 RNA Less Than 200 Copies/mL Through Delivery

Time to first viral HIV-1 RNA less than 200 copies/mL through delivery, determined using real-time results obtained from site laboratories (NCT03048422)
Timeframe: Randomization to delivery

Intervention	weeks (Mean)
Arms 1 and 2: Maternal DTG+FTC/TAF and DTG+FTC/TDF	4.26
Arm 3: Maternal EFV/FTC/TDF	6.49

[back to top]

Percentage of Mothers With Virologic Success of HIV-1 RNA Less Than 200 Copies/mL at Delivery Based on FDA Snapshot Algorithm

Percentage of mothers with virologic success of HIV-1 RNA less than 200 copies/mL at delivery based on FDA snapshot algorithm using real-time test results obtained from site laboratories (NCT03048422)
Timeframe: Delivery

Intervention	percentage of participants (Number)
Arm 1: Maternal DTG+FTC/TAF	88.9
Arm 2: Maternal DTG+FTC/TDF	92.6
Arm 3: Maternal EFV/FTC/TDF	81.0

[back to top]

Percentage of Mothers With Virologic Success of HIV-1 RNA Less Than 200 Copies/mL at 50 Weeks Postpartum Based on FDA Snapshot Algorithm

Percentage of mothers with virologic success of HIV-1 RNA less than 200 copies/mL at 50 weeks postpartum based on FDA snapshot algorithm using real-time test results obtained from site laboratories (NCT03048422)
Timeframe: 50 weeks postpartum

Intervention	percentage of participants (Number)
Arm 1: Maternal DTG+FTC/TAF	75.6
Arm 2: Maternal DTG+FTC/TDF	77.7
Arm 3: Maternal EFV/FTC/TDF	76.3

[back to top]

Percentage of Mothers With HIV-1 RNA Less Than 50 Copies/mL at Delivery Measured at Central Laboratory

Percentage of mothers with HIV-1 RNA less than 50 copies/mL at delivery using batched test results obtained from central laboratory (NCT03048422)
Timeframe: Delivery

Intervention	percentage of participants (Number)
Arms 1 and 2: Maternal DTG+FTC/TAF and DTG+FTC/TDF	94.4
Arm 3: Maternal EFV/FTC/TDF	78.8

[back to top]

Percentage of Mothers With HIV-1 RNA Less Than 200 Copies/mL at 50 Weeks Postpartum

Percentage of mothers with HIV-1 RNA less than 200 copies/mL at 50 weeks postpartum using real-time test results obtained from site laboratories (NCT03048422)
Timeframe: 50 weeks postpartum

Intervention	percentage of participants (Number)
Arms 1 and 2: Maternal DTG+FTC/TAF and DTG+FTC/TDF	96.3
Arm 3: Maternal EFV/FTC/TDF	96.4

[back to top]

Percentage of Mother-Infant Pairs With Preterm Deliveries

Percentage of mother-infant pairs with preterm deliveries (<37 weeks gestation) resulting in live born infant (NCT03048422)
Timeframe: Delivery

Intervention	percentage of participants (Number)
Arm 1: Maternal DTG+FTC/TAF	5.8
Arm 2: Maternal DTG+FTC/TDF	9.4
Arm 3: Maternal EFV/FTC/TDF	12.1

[back to top]

Percentage of Mother-infant Pairs With an Adverse Pregnancy Outcome or Major Congenital Anomaly

Percentage of mother-infant pairs with an adverse pregnancy outcome or major congenital anomaly. Adverse pregnancy outcomes include spontaneous abortions (<20 weeks gestation), stillbirths (≥20 weeks gestation), preterm deliveries (<37 weeks gestation), and infants small for gestational age (<10th percentile per INTERGROWTH 21st Standards). Major congenital anomaly was defined consistent with the definition of malformation provided by Holmes and Westgate (i.e., a structural abnormality with surgical, medical, or cosmetic importance) and evaluated by an internal study team blinded to treatment arm. (NCT03048422)
Timeframe: Delivery through 50 weeks postpartum

Intervention	percentage of mother-infant pairs (Number)
Arm 1: Maternal DTG+FTC/TAF	24.1
Arm 2: Maternal DTG+FTC/TDF	32.9
Arm 3: Maternal EFV/FTC/TDF	33.2

[back to top]

Percentage of Mother-Infant Pairs With an Adverse Pregnancy Outcome

Percentage of mother-infant pairs with an adverse pregnancy outcome. Adverse pregnancy outcome includes spontaneous abortion (<20 weeks gestation), stillbirth (≥20 weeks gestation), preterm delivery (<37 completed weeks), or small for gestational age (<10th percentile per INTERGROWTH 21st Standards) (NCT03048422)
Timeframe: Delivery

Intervention	percentage of mother-infant pairs (Number)
Arms 1 and 2: Maternal DTG+FTC/TAF and DTG+FTC/TDF	28.4
Arm 3: Maternal EFV/FTC/TDF	32.7

[back to top]

Percentage of Mother-infant Pairs With an Adverse Pregnancy Outcome

Percentage of mother-infant pairs with an adverse pregnancy outcome. Adverse pregnancy outcome includes spontaneous abortion (<20 weeks gestation), stillbirth (≥20 weeks gestation), preterm delivery (<37 completed weeks), or small for gestational age (<10th percentile by INTERGROWTH 21st Standards) (NCT03048422)
Timeframe: Delivery

Intervention	percentage of mother-infant pairs (Number)
Arm 1: Maternal DTG+FTC/TAF	24.1
Arm 2: Maternal DTG+FTC/TDF	32.9
Arm 3: Maternal EFV/FTC/TDF	32.7

[back to top]

Percentage of Infants Born Small for Gestational Age

Percentage of infants born small for gestational age (<10th percentile adjusted for sex assigned at birth) based on Intergrowth 21st Standards (NCT03048422)
Timeframe: Birth

Intervention	percentage of participants (Number)
Arm 1 Infants	16.3
Arm 2 Infants	22.5
Arm 3 Infants	20.5

[back to top]

Maternal Change in Creatinine Clearance

Maternal change in creatinine clearance per week based on generalized estimating equations (NCT03048422)
Timeframe: Baseline to 50 weeks postpartum

Intervention	mL/min (Mean)
Arm 1: Maternal DTG+FTC/TAF	-0.980
Arm 2: Maternal DTG+FTC/TDF	-0.887
Arm 3: Maternal EFV/FTC/TDF	-0.935

[back to top]

Cumulative Probability of Women Experiencing Grade 3 or Higher Adverse Event

"The Kaplan-Meier estimate of the cumulative probability of women experiencing grade 3 or higher adverse events, including events resulting in death due to any cause.~Time to first maternal grade 3 or higher adverse event was defined as the first grade 3 or higher adverse event that occurred after randomization and before 74 weeks of follow-up. The timeframe of 74 weeks was determined by adding up 56 weeks of postpartum follow-up to the mean duration of antepartum follow-up, which was 18 weeks." (NCT03048422)
Timeframe: From randomization up to 74 weeks

Intervention	Cumulative probability per 100 persons (Number)
Arm 1: Maternal DTG+FTC/TAF	25.1
Arm 2: Maternal DTG+FTC/TDF	30.8
Arm 3: Maternal EFV/FTC/TDF	27.9
Arms 1 and 2: Maternal DTG+FTC/TAF and DTG+FTC/TDF	27.9
Arm 3: Maternal EFV/FTC/TDF	27.9

[back to top]

Cumulative Probability of Infants Experiencing Grade 3 or Higher Adverse Event

The Kaplan-Meier estimate of the cumulative probability of infants experiencing grade 3 or higher adverse events, including events resulting in death due to any cause. (NCT03048422)
Timeframe: From birth through Week 50 postpartum

Intervention	Cumulative probability per 100 persons (Number)
Arm 1 Infants	25.3
Arm 2 Infants	28.6
Arm 3 Infants	30.9

[back to top]

Cumulative Probability of Infants Experiencing Grade 3 or Higher Adverse Event

Intervention	Cumulative probability per 100 persons (Number)
Arms 1 and 2 Infants	26.8
Arm 3 Infants	30.9

[back to top]

Cumulative Probability of Infant HIV-infection

The Kaplan-Meier estimate of the cumulative probability of infants acquiring HIV-1 infection from birth through 50 weeks after birth based on nucleic acid test results. (NCT03048422)
Timeframe: Birth through 50 weeks after birth

Intervention	Cumulative probability per 100 persons (Number)
Arm 1 Infants	0.98
Arm 2 Infants	0.50
Arm 3 Infants	0.55

[back to top]

Cumulative Probability of Infant Deaths

The Kaplan-Meier estimate of the cumulative probability of infant deaths from birth through 50 weeks after birth. (NCT03048422)
Timeframe: Birth through 50 weeks after birth

Intervention	Cumulative probability per 100 persons (Number)
Arm 1 Infants	1.0
Arm 2 Infants	2.0
Arm 3 Infants	6.9

[back to top]

Count of Infants With HIV-1 Antiretroviral Drug Resistance Mutations at the Time of Infant HIV Diagnosis

Count of infants with HIV-1 antiretroviral drug resistance mutations (to any antiretroviral drug) at the time of infant HIV diagnosis, based on laboratory blood test results. (NCT03048422)
Timeframe: From birth through 50 weeks postpartum

Intervention	Participants (Count of Participants)
Arm 1 Infants	1
Arm 2 Infants	0
Arm 3 Infants	1

[back to top]

Change in Maternal Weight Postpartum

Change in maternal postpartum weight per week based on generalized estimating equations (NCT03048422)
Timeframe: Delivery to 50 weeks postpartum

Intervention	kg/week (Mean)
Arm 1: Maternal DTG+FTC/TAF	0.014
Arm 2: Maternal DTG+FTC/TDF	-0.008
Arm 3: Maternal EFV/FTC/TDF	-0.032

[back to top]

Change in Maternal Weight Overall

Change in maternal weight per week based on generalized estimating equations (NCT03048422)
Timeframe: Baseline to 50 weeks postpartum

Intervention	kg/week (Mean)
Arm 1: Maternal DTG+FTC/TAF	-0.027
Arm 2: Maternal DTG+FTC/TDF	-0.050
Arm 3: Maternal EFV/FTC/TDF	-0.084

[back to top]

Change in Maternal Weight Antepartum

Change in maternal antepartum weight per week based on generalized estimating equations (NCT03048422)
Timeframe: Baseline through before delivery (up to one day prior)

Intervention	kg/week (Mean)
Arm 1: Maternal DTG+FTC/TAF	0.378
Arm 2: Maternal DTG+FTC/TDF	0.319
Arm 3: Maternal EFV/FTC/TDF	0.291

[back to top]

Tlast of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2 (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	71.6813	71.7138
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	71.8243	71.8153

[back to top]

Tlag of DTG and 3TC in Fed State: Part 2

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC bilayer FDC tablet formulations was assessed in Period 3 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	0.0000	0.0000
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	0.1253	0.0000

[back to top]

Tlag of DTG and 3TC in Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.0000	0.0000
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	0.2522	0.0000

[back to top]

Tlag of DTG and 3TC in Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.0000	0.0000
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	0.0000	0.0000

[back to top]

Time to Reach Maximum Plasma Concentration (Tmax) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	2.0072	1.0047
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	2.0017	1.0008

[back to top]

Time to Reach Half the Maximum Plasma Concentration (t1/2) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	14.6917	17.0395
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	14.7557	17.3436

[back to top]

Time of the Last Quantifiable Concentration (Tlast) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	72.0031	71.9289
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	71.9303	71.9303

[back to top]

T1/2 of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	14.5843	18.3614
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	14.5816	19.8579

[back to top]

t1/2 of DTG and 3TC in the Fasted State: Part 2

Intervention	Hour (Median)
	DTG, n= 74,74	3TC, n= 73,74
A: DTG 50 mg + EPIVIR 300 mg	15.1538	17.8421
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	14.7893	18.1071

[back to top]

Percentage of Extrapolated AUC(0 to Inf) of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Percentage of AUC (Median)
	DTG, n= 74,74	3TC, n= 73,74
A: DTG 50 mg + EPIVIR 300 mg	3.8923	1.2518
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	3.5773	1.1432

[back to top]

Percentage of Extrapolated AUC (0-inf) in the Fed State: Part 2

Intervention	Percentage of AUC (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	3.6835	1.0443
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	3.8790	1.7467

[back to top]

Percentage of Extrapolated AUC (0-inf) in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Percentage of AUC (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	3.3305	0.8856
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	3.8870	1.4830

[back to top]

Percentage of Extrapolated AUC (0 to Inf) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Percentage of AUC (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	3.4967	1.0287
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	3.2582	0.9052

[back to top]

Number of Participants With Adverse Events (AEs) and Serious Adverse Events (SAEs): Part 1 and 2

An AE is any untoward medical occurrence in a clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Any untoward event resulting in death, life threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, congenital anomaly/birth defect, any other situation according to medical or scientific judgment or all events of possible drug-induced liver injury with hyperbilirubinaemia were categorized as SAE. Participants having any AE or SAE are presented. (NCT03078556)
Timeframe: Up to Week 11

,,,,,

Intervention	Participants (Count of Participants)
	AEs	SAEs
Part 1- A: DTG 50 mg + EPIVIR 300 mg	14	0
Part 1- B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	18	0
Part 1-Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	1	0
Part 2- A: DTG 50 mg + EPIVIR 300 mg	15	0
Part 2-C: DTG 50 mg and 3TC 300 mg Bilayer FDC	12	0
Part 2-Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	1	0

[back to top]

Last Quantifiable Concentration (Clast) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.0702	0.0056
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.0832	0.0050

[back to top]

Lambda z of DTG and 3TC in in the Fed State: Part 2

Intervention	Per hour (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	0.0463	0.0403
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	0.0457	0.0351

[back to top]

Apparent Oral Clearance (CL/F) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters per hour (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	1.1589	24.3236
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.9111	23.5104

[back to top]

Lambda z of DTG and 3TC in in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Per hour (Median)
	DTG, n=74,74	3TC, n= 73,74
A: DTG 50 mg + EPIVIR 300 mg	0.0457	0.0388
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	0.0469	0.0383

[back to top]

Concentration at 24 Hours Post-dose (C24) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.6373	0.0331
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.8059	0.0318

[back to top]

AUC(0-24) of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours*microgram per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	31.5664	11.6419
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	36.6126	12.5810

[back to top]

Cmax of Plasma DTG and 3TC in the Fed State: Part 2

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	3.1015	3.5824
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	3.7516	2.4453

[back to top]

AUC of 0 to 24 Hours (AUC[0-24]) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours*microgram per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	29.4257	11.3960
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	37.6112	11.9418

[back to top]

AUC (0-t) of Plasma DTG and 3TC in the Fed State: Part 2

Intervention	Hour*microgram per milliliter (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	55.2176	14.4706
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	72.7545	13.0923

[back to top]

AUC (0-t) of Plasma DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour*microgram per milliliter (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	60.3212	13.2818
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	69.2560	12.6491

[back to top]

AUC (0-Inf) of Plasma DTG and 3TC in the Fed State: Part 2

Intervention	Hours*microgram per milliliter (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	57.6561	14.6420
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	76.4283	13.3443

[back to top]

AUC (0-Inf) of Plasma DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours*microgram per milliliter (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	62.3435	13.4357
Bfed: DTG 50 mg/3TC 300 mg Monolayer FDC Fed	71.9777	12.8668

[back to top]

Lambda z of DTG and 3TC in in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Per hour (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.0475	0.0378
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	0.0475	0.0349

[back to top]

AUC (0-Inf) of Plasma DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at given time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted conditions in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
	DTG, n= 74,74	3TC, n= 73,74
A: DTG 50 mg + EPIVIR 300 mg	47.2391	12.7713
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	54.5594	13.5624

[back to top]

Area Under the Concentration-time Curve From Time 0 to the Last Quantifiable Time Point (AUC[0-t]) of Plasma DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	41.4207	12.1571
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	52.8754	12.6147

[back to top]

Area Under the Concentration-time Curve From Time 0 Extrapolated to Infinity [AUC (0-Inf)] of Plasma DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the pharmacokinetic (PK) profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour*micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	43.1456	12.3337
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	54.8793	12.7603

[back to top]

Apparent Oral Volume of Distribution (Vz/F) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	24.6254	616.7365
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	19.3399	598.8651

[back to top]

Apparent Elimination Rate Constant (Lambda z) of DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Per hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.0472	0.0407
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.0470	0.0400

[back to top]

Absorption Lag Time (Tlag) of DTG and 3TC in Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.0000	0.0000
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.0000	0.0000

[back to top]

Maximum Observed Concentration (Cmax) of Plasma DTG and 3TC in the Fasted State: Part 1

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of monolayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	2.4065	2.6650
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	3.0817	3.1885

[back to top]

Vz/F of DTG and 3TC in the Fed State: Part 2

Intervention	Liters (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	19.0954	535.8125
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	14.6215	641.3744

[back to top]

Vz/F of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	16.7520	593.2054
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	14.4964	643.0977

[back to top]

Vz/F of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters (Geometric Mean)
	DTG, n= 74, 74	3TC, n= 73, 74
A: DTG 50 mg + EPIVIR 300 mg	23.1159	650.7952
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	19.8124	599.5525

[back to top]

Tmax of DTG and 3TC in the Fed State: Part 2

Intervention	Hour (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	1.5007	1.0003
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	5.0019	2.7508

[back to top]

Tmax of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	1.5013	1.0001
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	5.0006	3.5003

[back to top]

Tmax of DTG and 3TC in the Fasted State: Part 2

Intervention	Hour (Median)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	2.5008	1.0063
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	2.5004	1.0011

[back to top]

Tlast of DTG and 3TC in the Fed State: Part 2

Intervention	Hours (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	72.0292	72.0292
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	71.8711	71.8711

[back to top]

Tlast of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	71.8265	71.8265
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	71.9758	71.9758

[back to top]

Cmax of Plasma DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	3.5068	3.5413
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	3.7900	2.5132

[back to top]

Cmax of Plasma DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	2.5531	2.4428
B: DTG 50 mg/ 3TC 300 mg Bilayer FDC	2.9132	3.2185

[back to top]

Clast of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.0800	0.0069
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	0.0862	0.0062

[back to top]

Clast of DTG and 3TC in in the Fed State: Part 2

Intervention	Micrograms per milliliter (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	0.0975	0.0059
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	0.1310	0.0091

[back to top]

Clast of DTG and 3TC in in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Median)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.1060	0.0048
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	0.1190	0.0066

[back to top]

CL/F of DTG and 3TC in the Fed State: Part 2

Intervention	Liters per hour (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	0.8672	20.4890
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	0.6542	22.4815

[back to top]

T1/2 of DTG and 3TC in the Fed State: Part 2

Intervention	Hour (Median)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	14.9828	17.2250
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	15.1718	19.7311

[back to top]

CL/F of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters per hour (Geometric Mean)
	DTG, n= 74, 74	3TC, n= 73, 74
A: DTG 50 mg + EPIVIR 300 mg	1.0584	23.4901
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	0.9164	22.1200

[back to top]

Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP): Part 1 and 2

SBP and DBP were measured in the supine or semi-supine position after 5 minutes rest. The Baseline value was considered to be the participant's last available assessment prior to time of the first dose. Change from Baseline was defined as post dose visit value minus Baseline value. Data for SBP and DBP for Part 1 and 2 is presented. (NCT03078556)
Timeframe: Up to Day 31 in Part 1 and Part 2

,,,,,

Intervention	Millimeters of mercury (Mean)
	DBP,4 hour,n=75,76,16,75,75,16	DBP,Day 2,n=74,75,16,75,75,16	DBP,Day 3,n=74,75,16,75,75,16	DBP,Day 4,n=73,75,16,75,75,16	SBP,4 hour,n=75,76,16,75,75,16	SBP,Day 2,n=74,75,16,75,75,16	SBP,Day 3,n=74,75,16,75,75,16	SBP,Day 4,n=73,75,16,75,75,16
Part 1- A: DTG 50 mg + EPIVIR 300 mg	0.1	-0.3	3.2	7.4	1.5	-0.5	4.0	8.2
Part 1- B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.2	-0.9	2.7	5.4	0.6	-1.4	2.7	7.5
Part 1-Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	-2.1	0.4	1.3	6.1	-0.8	0.4	2.9	7.0
Part 2- A: DTG 50 mg + EPIVIR 300 mg	-0.5	-1.7	1.7	4.9	0.0	-1.5	1.9	7.0
Part 2-C: DTG 50 mg and 3TC 300 mg Bilayer FDC	-0.3	-1.1	1.2	5.3	0.5	-1.7	1.6	7.2
Part 2-Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	0.0	3.1	3.4	8.3	1.0	1.9	2.3	7.6

[back to top]

Change From Baseline in Heart Rate (HR): Part 1 and 2

HR was measured in the supine or semi-supine position after 5 minutes rest. The Baseline value was considered to be the participant's last available assessment prior to time of the first dose. Change from Baseline was defined as post dose visit value minus Baseline value. Data for HR for Part 1 and 2 is presented. (NCT03078556)
Timeframe: Up to Day 31 in Part 1 and Part 2

,,,,,

Intervention	Beats per minute (Mean)
	4 hour,n=75,76,16,75,75,16	Day 2,n=74,75,16,75,75,16	Day 3,n=74,75,16,75,75,16	Day 4,n=73,75,16,75,75,16
Part 1- A: DTG 50 mg + EPIVIR 300 mg	0.6	2.2	5.1	7.5
Part 1- B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.4	1.9	6.0	8.9
Part 1-Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	4.9	2.9	5.8	9.6
Part 2- A: DTG 50 mg + EPIVIR 300 mg	0.1	1.6	5.3	8.9
Part 2-C: DTG 50 mg and 3TC 300 mg Bilayer FDC	-0.3	0.6	3.8	6.1
Part 2-Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	3.0	1.6	7.7	9.5

[back to top]

C24 of DTG and 3TC in the Fed State: Part 2

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	0.8355	0.0350
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	1.2273	0.0417

[back to top]

C24 of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.9216	0.0304
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	1.1916	0.0366

[back to top]

C24 of DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	0.7065	0.0366
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	0.8071	0.0350

[back to top]

AUC(0-t) of Plasma DTG and 3TC in the Fasted State: Part 2

Blood samples were collected at indicated time points to study the PK profile of DTG and 3TC when administered as FDC tablet compared to co-administration of separate tablet formulations of DTG and 3TC in fasted state. The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. PK parameters of bilayer FDC tablet formulation of DTG and 3TC was evaluated under fasted condition in Periods 1 and 2 of Part 2. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour*microgram/milliliter (Geometric Mean)
	DTG	3TC
A: DTG 50 mg + EPIVIR 300 mg	45.2043	12.4790
C: DTG 50 mg/ 3TC 300 mg Bilayer FDC	52.3372	13.3552

[back to top]

AUC(0-24) of DTG and 3TC in the Fed State: Part 2

Intervention	Hour*microgram per milliliter (Geometric Mean)
	DTG	3TC
C: DTG 50 mg and 3TC 300 mg Bilayer FDC	38.6325	13.7012
Cfed: DTG 50 mg and 3TC 300 mg Bilayer FDC Fed	48.2012	12.1065

[back to top]

AUC(0-24) of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hour*microgram per milliliter (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	43.1879	12.6113
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	46.8555	11.8076

[back to top]

CL/F of DTG and 3TC in the Fed State: Part 1

Blood samples for PK analysis of DTG and 3TC were collected at given time points to study the PK profile of DTG and 3TC FDC tablet(s). The 4-hour post-dose sample was drawn prior to the participant's first post-dose meal. At each time point, 2 mL of blood was collected. The effect of food on DTG and 3TC monolayer FDC tablet formulations was assessed in Period 3 of Part 1. (NCT03078556)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters per hour (Geometric Mean)
	DTG	3TC
B: DTG 50 mg/ 3TC 300 mg Monolayer FDC	0.8020	22.3285
Bfed: DTG 50 mg and 3TC 300 mg Monolayer FDC Fed	0.6947	23.3159

[back to top]

Apparent Oral Clearance (CL/F) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times.. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	Liters/hour (Geometric Mean)
DTG 10 mg	0.849
DTG 50 mg	0.856

[back to top]

Apparent Volume of Distribution During the Terminal Phase (Vz/F) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	Liters (Geometric Mean)
DTG 10 mg	19.4
DTG 50 mg	20.0

[back to top]

Area Under the Concentration-time Curve Over Time Zero (Pre-dose) to 24 Hours After Dose Administration (AUC[0-24]) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	h*ng/mL (Geometric Mean)
DTG 10 mg	37500
DTG 50 mg	36600

[back to top]

Area Under the Plasma Concentration-time Curve From Time of Dose Extrapolated to Infinite Time (AUC[0-infinity]) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the pharmacokinetic (PK) profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. The PK Population was defined as participants in the All Subjects Population for whom a PK sample was obtained and that had evaluable PK assay results. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	hoursnanograms/mL (hng/mL) (Geometric Mean)
DTG 10 mg	58900
DTG 50 mg	58400

[back to top]

Area Under the Plasma Concentration-time Curve From Time of Dose to Last Measurable Concentration AUC [0-t] of DTG for Part 1

Intervention	h*ng/mL (Geometric Mean)
DTG 10 mg	55800
DTG 50 mg	55200

[back to top]

AUC (0-24) of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	h*ng/mL (Geometric Mean)
DTG 5 mg (Test 1)	34000
DTG 5 mg (Test 2)	32300
DTG 25 mg (Reference)	20400

[back to top]

AUC (0-infinity) of DTG for Part 2

Intervention	h*ng/mL (Geometric Mean)
DTG 5 mg (Test 1)	51300
DTG 5 mg (Test 2)	48800
DTG 25 mg (Reference)	31600

[back to top]

AUC (0-t) of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	h*ng/mL (Geometric Mean)
DTG 5 mg (Test 1)	49000
DTG 5 mg (Test 2)	46700
DTG 25 mg (Reference)	30100

[back to top]

C24 of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	ng/mL (Geometric Mean)
DTG 5 mg (Test 1)	770
DTG 5 mg (Test 2)	741
DTG 25 mg (Reference)	493

[back to top]

Cmax of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	ng/mL (Geometric Mean)
DTG 5 mg (Test 1)	2690
DTG 5 mg (Test 2)	2700
DTG 25 mg (Reference)	1500

[back to top]

Ct of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	ng/mL (Geometric Mean)
DTG 5 mg (Test 1)	89.3
DTG 5 mg (Test 2)	84.4
DTG 25 mg (Reference)	58.2

[back to top]

DTG CL/F for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	Liters/hour (Geometric Mean)
DTG 5 mg (Test 1)	0.487
DTG 5 mg (Test 2)	0.513
DTG 25 mg (Reference)	0.792

[back to top]

Lambda Z of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	per hour (Geometric Mean)
DTG 5 mg (Test 1)	0.0443
DTG 5 mg (Test 2)	0.0448
DTG 25 mg (Reference)	0.0439

[back to top]

Last Observed Quantifiable Concentration (Ct) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	ng/mL (Geometric Mean)
DTG 10 mg	106
DTG 50 mg	114

[back to top]

Maximum Observed Concentration (Cmax) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	nanograms/milliliter (ng/mL) (Geometric Mean)
DTG 10 mg	2780
DTG 50 mg	2700

[back to top]

Number of Participants With Chemistry Toxicities of Grade 2 as Defined by Division of Acquired Immunodeficiency Syndrome (DAIDS) for Part 1

The DAIDS toxicity table provides descriptive terminology for grading the severity of adult adverse events. Laboratory grades also provide ranges for each parameter. Grade 1: mild, Grade 2: moderate, Grade 3: severe, Grade 4: potentially life threatening. low LDL (low-density lipid); HDL (high-density lipid). Data has been presented for clinical chemistry laboratory result parameter (serum sodium) with toxicity of Grade 2 for Part 1. (NCT03095638)
Timeframe: Up to 25 days in Part 1

Intervention	Participants (Number)
DTG 10 mg	1
DTG 50 mg	0

[back to top]

Number of Participants With Urinalysis Toxicities of Grade 2 as Defined by DAIDS for Part 1

The DAIDS toxicity table provides descriptive terminology for grading the severity of adult adverse events. Laboratory grades also provide ranges for each parameter. Grade 1: mild, Grade 2: moderate, Grade 3: severe, Grade 4: potentially life threatening, low LDL and HDL Data has been presented for urinalysis laboratory result parameter (urine protein by dipstick analysis) with toxicity of Grade 2 for Part 1. (NCT03095638)
Timeframe: Up to 25 days in Part 1

Intervention	Participants (Number)
DTG 10 mg	1
DTG 50 mg	0

[back to top]

Observed Concentration at 24 Hours After Dose Administration (C24) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	ng/mL (Geometric Mean)
DTG 10 mg	912
DTG 50 mg	916

[back to top]

Percentage of AUC (0-infinity) Obtained by Extrapolation (%AUCex) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	Percentage of AUC (Mean)
DTG 10 mg	5.17
DTG 50 mg	5.52

[back to top]

Plasma DTG Lag Time Before Observation of Drug Concentrations (Tlag) for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	hours (Median)
DTG 10 mg	0.00
DTG 50 mg	0.00

[back to top]

Plasma DTG Tlag for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	hours (Median)
DTG 5 mg (Test 1)	0.00
DTG 5 mg (Test 2)	0.00
DTG 25 mg (Reference)	0.00

[back to top]

t1/2 of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	hours (Geometric Mean)
DTG 5 mg (Test 1)	15.66
DTG 5 mg (Test 2)	15.48
DTG 25 mg (Reference)	15.78

[back to top]

Terminal Phase Half-life (t1/2) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	hours (Geometric Mean)
DTG 10 mg	15.81
DTG 50 mg	16.23

[back to top]

Terminal-phase Rate Constant (Lambda z) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	per hour (Geometric Mean)
DTG 10 mg	0.0439
DTG 50 mg	0.0427

[back to top]

Time to First Occurrence of Cmax (Tmax) of DTG for Part 1

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 1

Intervention	hours (Median)
DTG 10 mg	2.01
DTG 50 mg	2.00

[back to top]

Tmax of DTG for Part 2

Blood sample were collected at the indicated time points after administration of study treatment to investigate the pharmacokinetic profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	hours (Median)
DTG 5 mg (Test 1)	1.00
DTG 5 mg (Test 2)	1.00
DTG 25 mg (Reference)	1.75

[back to top]

Vz/F of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	Liters (Geometric Mean)
DTG 5 mg (Test 1)	11.0
DTG 5 mg (Test 2)	11.4
DTG 25 mg (Reference)	18.0

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum Alanine Amino Transferase (ALT), Serum Alkaline Phosphatase, Serum Aspartate Amino Transferase (AST), Serum Creatine Kinase for Part 1

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum ALT, serum alkaline phosphatase, serum AST, serum creatine kinase results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	International units/liter (IU/L) (Mean)
	Serum ALT, Day 2, n=14, 14	Serum ALT, Follow-up, n=5, 5	Serum alkaline phosphatase, Day 2, n=14, 14	Serum alkaline phosphatase, Follow-up, n=5, 5	Serum AST, Day 2, n=14, 14	Serum AST, Follow-up, n=5, 5	Serum creatine kinase, Day 2, n=14, 14	Serum creatine kinase, Follow-up, n=5, 5
DTG 10 mg	0.8	-1.6	1.5	1.4	0.6	-1.0	-43.6	-17.2
DTG 50 mg	-1.1	-1.0	0.8	1.0	-0.9	0.6	-37.1	0.8

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum Albumin and Serum Protein for Part 1

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum albumin and serum protein results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	Grams/liter (g/L) (Mean)
	Serum Albumin, Day 2, n=14, 14	Serum Albumin, Follow-up, n=5, 5	Serum Protein, Day 2, n=14, 14	Serum Protein, Follow-up, n=5, 5
DTG 10 mg	0.3	-1.2	2.3	0.8
DTG 50 mg	0.1	-0.4	2.4	1.8

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum Albumin and Serum Protein for Part 2

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum albumin and serum protein results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	g/L (Mean)
	Serum Albumin, Day 2, n=24, 24, 24	Serum Albumin, Follow-up, n=3, 2, 3	Serum Protein, Day 2, n=24, 24, 24	Serum Protein, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	0.5	1.7	2.7	0.3
DTG 5 mg (Test 1)	0.4	2.0	2.3	1.7
DTG 5 mg (Test 2)	1.1	-1.0	3.2	-4.0

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum ALT, Serum Alkaline Phosphate, Serum AST, Serum Creatine Kinase for Part 2

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum ALT, serum alkaline phosphatase, serum AST, serum creatine kinase results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	IU/L (Mean)
	Serum ALT, Day 2, n=24, 24, 24	Serum ALT, Follow-up, n=3, 2, 3	Serum alkaline phosphatase, Day 2, n=24, 24, 24	Serum alkaline phosphatase, Follow-up, n=3, 2, 3	Serum AST, Day 2, n=24, 24, 24	Serum AST, Follow-up, n=3, 2, 3	Serum Creatine kinase, Day 2, n=24, 24, 24	Serum Creatine kinase, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	-1.1	0.3	0.2	2.3	-1.3	-0.3	-37.2	23.3
DTG 5 mg (Test 1)	-0.4	2.0	0.5	4.3	-1.4	0.0	-35.2	-7.3
DTG 5 mg (Test 2)	-1.0	-1.0	1.8	1.0	-0.7	-3.0	-15.7	-10.5

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum Bilirubin, Serum Creatine and Serum Direct Bilirubin for Part 2

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum bilirubin, serum creatine and serum direct bilirubin results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	umol/L (Mean)
	Serum Bilirubin, Day 2, n=24, 24, 24	Serum Bilirubin, Follow-u, n=3, 2, 3	Serum Creatinine, Day 2, n=24, 24, 24	Serum Creatinine, Follow-u, n=3, 2, 3	Serum direct bilirubin, Day 2, n=24, 24, 24	Serum direct bilirubin, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	2.91	3.07	8.31	-5.00	0.36	0.30
DTG 5 mg (Test 1)	2.26	0.97	8.02	2.33	0.33	-0.07
DTG 5 mg (Test 2)	2.85	-0.80	9.83	-4.80	0.26	-0.45

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum Bilirubin, Serum Creatinine and Serum Direct Bilirubin for Part 1

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum bilirubin, serum creatinine and serum direct bilirubin results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	micromoles/liter (umol/L) (Mean)
	Serum Bilirubin, Day 2, n=14, 14	Serum Bilirubin, Follow-u, n=5, 5	Serum Creatinine, Day 2, n=14, 14	Serum Creatinine, Follow-u, n=5, 5	Serum direct bilirubin, Day 2, n=14, 14	Serum direct bilirubin, Follow-up, n=5,5
DTG 10 mg	3.29	0.10	9.91	4.58	0.24	0.10
DTG 50 mg	3.28	2.16	11.19	3.18	0.30	0.44

[back to top]

Change From Baseline in Clinical Chemistry Parameters Serum Glucose, Serum Calcium, Serum Potassium, Serum Sodium, Serum Urea for Part 2

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum glucose, serum calcium, serum potassium, serum sodium, serum urea results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	mmol/L (Mean)
	Serum Glucose, Day 2, n=24, 24, 24	Serum Glucose, Follow-up, n=3, 2, 3	Serum Calcium, Day 2, n=24, 24, 24	Serum Calcium, Follow-up, n=3, 2, 3	Serum Potassium, Day 2, n=24, 24, 24	Serum Potassium, Follow-up, n=3, 2, 3	Serum Sodium, Day 2, n=24, 24, 24	Serum Sodium, Follow-up, n=3, 2, 3	Serum Urea, Day 2, n=24, 24, 24	Serum Urea, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	-0.187	-0.150	0.036	-0.010	0.19	-0.27	-0.4	0.0	-0.376	-1.237
DTG 5 mg (Test 1)	-0.220	0.130	0.008	0.087	0.00	-0.03	-0.3	1.3	-0.868	0.067
DTG 5 mg (Test 2)	-0.223	-0.060	0.056	-0.035	0.04	0.05	0.2	0.5	-0.366	-0.585

[back to top]

Change From Baseline in Clinical Laboratory Parameters Serum Glucose, Serum Calcium, Serum Potassium, Serum Sodium, Serum Urea for Part 1

Blood samples for the assessment of chemistry parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for serum glucose, serum calcium, serum potassium, serum sodium, serum urea results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	millimoles/liter (mmol/L) (Mean)
	Serum glucose, Day 2, n=14, 14	Serum glucose, Follow-up, n=5, 5	Serum calcium, Day 2, n=14, 14	Serum calcium, Follow-up, n=5, 5	Serum Potassium, Day 2, n=14, 14	Serum Potassium, Follow-up, n=5, 5	Serum Sodium, Day 2, n=14, 14	Serum Sodium, Follow-up, n=5, 5	Serum Urea, Day 2, n=14, 14	Serum Urea, Follow-up, n=5, 5
DTG 10 mg	-0.091	-0.178	0.001	-0.024	0.08	-0.26	-1.3	-1.6	-0.394	0.248
DTG 50 mg	0.071	0.022	-0.005	-0.044	0.09	-0.26	-0.7	-0.6	-0.444	-0.248

[back to top]

Change From Baseline in Hematology Parameter Blood Erythrocyte MCH for Part 2

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood erythrocyte MCH results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	pg (Mean)
	Blood erythrocyte MCH, Day 2, n=24, 24, 24	Blood erythrocyte MCH, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	0.05	0.03
DTG 5 mg (Test 1)	0.12	0.03
DTG 5 mg (Test 2)	0.05	-0.25

[back to top]

Change From Baseline in Hematology Parameter Blood Erythrocyte MCV for Part 2

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood erythrocyte MCV results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	fL (Mean)
	Blood erythrocyte MCV, Day 2, n=24, 24, 24	Blood erythrocyte MCV, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	0.29	-0.20
DTG 5 mg (Test 1)	-0.03	0.07
DTG 5 mg (Test 2)	-0.13	-0.25

[back to top]

Change From Baseline in Hematology Parameter Blood Erythrocyte Mean Corpuscular Hemoglobin (MCH) for Part 1

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood erythrocyte MCH results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	Picograms (pg) (Mean)
	Blood erythrocyte MCH, Day 2, n=14, 14	Blood erythrocyte MCH, Follow-up, n=5, 5
DTG 10 mg	0.08	0.00
DTG 50 mg	-0.02	-0.22

[back to top]

Change From Baseline in Hematology Parameter Blood Erythrocyte Mean Corpuscular Volume (MCV) for Part 1

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood erythrocyte MCV results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	Femtoliters (fL) (Mean)
	Blood erythrocyte MCV, Day 2, n=14, 14	Blood erythrocyte MCV, Follow-up, n=5,5
DTG 10 mg	-0.01	-0.38
DTG 50 mg	0.26	0.26

[back to top]

Change From Baseline in Hematology Parameter Blood Erythrocytes for Part 1

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood erythrocyte results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	10^12 cells/Liter (Mean)
	Blood erythrocytes, Day 2, n=14, 14	Blood erythrocyte, Follow-up, n=5, 5
DTG 10 mg	0.182	-0.024
DTG 50 mg	0.193	-0.014

[back to top]

Change From Baseline in Hematology Parameter Blood Hematocrit for Part 1

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood hematocrit results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	Proportion of red blood cells in blood (Mean)
	Blood hematocrit, Day 2, n=14, 14	Blood hematocrit, Follow-up, n=5, 5
DTG 10 mg	0.0137	-0.0042
DTG 50 mg	0.0131	-0.0058

[back to top]

Change From Baseline in Hematology Parameter Blood Hematocrit for Part 2

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood hematocrit results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles) (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	Proportion of red blood cells in blood (Mean)
	Blood hematocrit, Day 2, n=24, 24, 24	Blood hematocrit, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	0.0158	0.0103
DTG 5 mg (Test 1)	0.0126	0.0113
DTG 5 mg (Test 2)	0.0172	0.0090

[back to top]

Change From Baseline in Hematology Parameter Blood Hemoglobin for Part 1

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood hemoglobin results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles) (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	g/L (Mean)
	Blood hemoglobin, Day 2, n=14, 14	Blood hemoglobin, Follow-up, n=5, 5
DTG 10 mg	4.9	-0.8
DTG 50 mg	4.0	-3.4

[back to top]

Change From Baseline in Hematology Parameter Blood Hemoglobin for Part 2

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood hemoglobin results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles) (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	g/L (Mean)
	Blood hemoglobin, Day 2, n=24, 24, 24	Blood hemoglobin, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	4.8	3.7
DTG 5 mg (Test 1)	5.0	3.7
DTG 5 mg (Test 2)	6.3	2.0

[back to top]

Change From Baseline in Hematology Parameters Blood Basophils, Blood Eosinophils, Blood Leukocytes, Blood Lymphocytes, Blood Monocytes, Blood Neutrophils, Blood Platelets for Part 1

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 25) in Part 1. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood basophils, blood eosinophils, blood leukocytes, blood lymphocytes, blood monocytes, blood neutrophils, blood platelets results for Part 1. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles) (NCT03095638)
Timeframe: Baseline and up to 25 days in Part 1

Intervention	10^9 cells/Liter (Mean)
	Blood basophils, Day 2, n=14, 14	Blood basophils, Follow-up, n=5, 5	Blood eosinophils, Day 2, n=14, 14	Blood eosinophils, Follow-up, n=5, 5	Blood leukocytes, Day 2, n=14, 14	Blood leukocytes, Follow-up, n=5, 5	Blood lymphocytes, Day 2, n=14, 14	Blood lymphocytes, Follow-up, n=5, 5	Blood monocytes, Day 2, n=14, 14	Blood monocytes, Follow-up, n=5, 5	Blood neutrophils, Day 2, n=14, 14	Blood neutrophils, Follow-up, n=5, 5	Blood platelets, Day 2, n=14, 14	Blood platelets, Follow-up, n=5, 5
DTG 10 mg	-0.004	-0.004	0.003	-0.002	-0.33	-0.06	0.018	0.022	-0.031	-0.036	-0.317	-0.062	14.0	-11.2
DTG 50 mg	-0.013	-0.004	-0.014	-0.072	-0.54	-0.26	0.049	0.130	-0.064	-0.040	-0.486	-0.264	12.6	11.0

[back to top]

Change From Baseline in Hematology Parameters Blood Basophils, Blood Eosinophils,, Blood Leukocytes, Blood Lymphocytes, Blood Monocytes, Blood Neutrophils, Blood Platelets for Part 2

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood basophils, blood eosinophils, blood leukocytes, blood lymphocytes, blood monocytes, blood neutrophils, blood platelets results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles) (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	10^9 cells/Liter (Mean)
	Blood basophils, Day 2, n=24, 24, 24	Blood basophils, Follow-up, n=3, 2, 3	Blood eosinophils, Day 2, n=24, 24, 24	Blood eosinophils, Follow-up, n=3, 2, 3	Blood leukocytes, Day 2, n=24, 24, 24	Blood leukocytes, Follow-up, n=3, 2, 3	Blood lymphocytes, Day 2, n=24, 24, 24	Blood lymphocytes, Follow-up, n=3, 2, 3	Blood monocytes, Day 2, n=24, 24, 24	Blood monocytes, Follow-up, n=3, 2, 3	Blood neutrophils, Day 2, n=24, 24, 24	Blood neutrophils, Follow-up, n=3, 2, 3	Blood platelets, Day 2, n=24, 24, 24	Blood platelets, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	-0.004	0.000	-0.019	-0.020	-0.98	-0.23	-0.196	0.293	-0.104	0.033	-0.477	-0.563	7.8	12.3
DTG 5 mg (Test 1)	-0.004	0.003	-0.028	-0.060	-0.58	-0.63	-0.057	-0.130	-0.085	-0.093	-0.398	-0.350	7.4	18.0
DTG 5 mg (Test 2)	-0.005	0.000	-0.024	0.015	-0.75	-2.05	-0.105	0.245	-0.084	-0.060	-0.520	-2.225	12.9	11.0

[back to top]

Number of Participants With Abnormal Values on Urinalysis by Dipstick Method for Part 1

Urinalysis parameters assessed were urine ketones, urine glucose, urine occult blood and urine protein. In this dipstick test, the level of ketones, glucose, occult blood and protein in urine samples was recorded as negative trace, 1+, 2+, and 3+ (the plus sign increases with a higher level of glucose, ketones, or proteins in the urine: 1+=slightly positive, 2+=positive, 3+=high positive). Urine samples were collected for the measurement of urinalysis parameters by dipstick method up-to follow-up (Day 25) in Part 1. Only categories with significant values have been presented. (NCT03095638)
Timeframe: Up to 25 days in Part 1

Intervention	Participants (Number)
	Urine Ketones, Trace, Day 2 (-24 hours)	Urine Ketones, Trace, Follow-up	Urine Occult Blood,Trace,Day 2 (-24 hours)	Urine Occult Blood, 1+, Day 2 (-24 hours)	Urine Occult Blood, 2+, Day 2 (-24 hours)	Urine Occult Blood, 3+, Day 2 (-24 hours)	Urine Protein, 3+, Day 2 (-24 hours)
DTG 10 mg	2	0	0	1	0	1	1
DTG 50 mg	2	1	1	0	1	0	0

[back to top]

Number of Participants With Abnormal Values on Urinalysis by Dipstick Method for Part 2

Urinalysis parameters assessed were urine ketones, urine glucose, urine occult blood and urine protein. In this dipstick test, the level of ketones, glucose, occult blood and protein in urine samples was recorded as negative trace, 1+, 2+, and 3+ (the plus sign increases with a higher level of glucose, ketones, or proteins in the urine: 1+=slightly positive, 2+=positive, 3+=high positive). Urine samples were collected for the measurement of urinalysis parameters by dipstick method up-to follow-up (Day 36) in Part 2. Only categories with significant values have been presented. (NCT03095638)
Timeframe: Up to 36 days in Part 2

Intervention	Participants (Number)
	Urine Ketones, Trace, Day 2 (-24 hours)	Urine Occult Blood,Trace,Day 2 (-24 hours)	Urine Occult Blood, 3+, Day 2 (-24 hours)	Urine Occult Blood,1+ Follow-up,	Urine Protein, 1+, Day 2 (-24 hours)
DTG 25 mg (Reference)	0	0	0	0	0
DTG 5 mg (Test 1)	1	1	1	1	1
DTG 5 mg (Test 2)	0	1	1	0	0

[back to top]

Number of Participants With Adverse Events (AEs) and Serious Adverse Events (SAEs) for Part 1

AE is any untoward medical occurrence in a participant or clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. An SAE is any untoward medical occurrence that, at any dose results in death, is life-threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, or is a congenital anomaly/birth defect or is medically significant. Data has been presented for AEs and SAEs up-to follow-up (25 days) in Part 1. All Subjects Population was defined as all participants who received at least 1 dose of study medication. (NCT03095638)
Timeframe: Up to 25 days in Part 1

Intervention	Participants (Number)
	Any AE	Any SAE
DTG 10 mg	1	0
DTG 50 mg	2	0

[back to top]

Number of Participants With Adverse Events AEs and Serious Adverse Events SAEs for Part 2

AE is any untoward medical occurrence in a participant or clinical investigation participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. An SAE is any untoward medical occurrence that, at any dose results in death, is life-threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, or is a congenital anomaly/birth defect or is medically significant. Data has been presented for AEs and SAEs up-to follow-up (36 days) in Part 2. (NCT03095638)
Timeframe: Up to 36 days in Part 2

Intervention	Participants (Number)
	Any AE	Any SAE
DTG 25 mg (Reference)	3	0
DTG 5 mg (Test 1)	2	0
DTG 5 mg (Test 2)	2	0

[back to top]

Urine pH Analysis by Dipstick Method for Part 2

Urinary pH measurement is a routine part of urinalysis. Urine pH is an acid-base measurement. pH is measured on a numeric scale ranging from 0 to 14; values on the scale refer to the degree of alkalinity or acidity. A pH of 7 is neutral. A pH less than 7 is acidic, and a pH greater than 7 is basic. Normal urine has a slightly acid pH (5.0 - 6.0). Urine samples were collected for the measurement of urine pH by dipstick method up-to follow-up (Day 36) in Part 2. Only categories with significant values have been presented. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles). (NCT03095638)
Timeframe: Up to 36 days in Part 2

Intervention	Points on a scale (Mean)
	Urine pH, Day 2 (-24 hours), n=24, 24, 24	Urine pH, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	6.31	6.83
DTG 5 mg (Test 1)	6.31	5.33
DTG 5 mg (Test 2)	6.21	5.50

[back to top]

Urine Potential of Hydrogen (pH) Analysis by Dipstick Method for Part 1

Urinary pH measurement is a routine part of urinalysis. Urine pH is an acid-base measurement. pH is measured on a numeric scale ranging from 0 to 14; values on the scale refer to the degree of alkalinity or acidity. A pH of 7 is neutral. A pH less than 7 is acidic, and a pH greater than 7 is basic. Normal urine has a slightly acid pH (5.0 - 6.0). Urine samples were collected for the measurement of urine pH by dipstick method up-to follow-up (Day 25) in Part 1. Only categories with significant values have been presented. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles). (NCT03095638)
Timeframe: Up to 25 days in Part 1

Intervention	Points on a scale (Mean)
	Urine pH, Day 2 (-24 hours), n=14,14	Urine pH, Follow-up, n=5,5
DTG 10 mg	6.43	6.20
DTG 50 mg	6.25	6.00

[back to top]

Urine Specific Gravity Analysis by Dipstick Method for Part 1

Urinary specific gravity measurement is a routine part of urinalysis. Urine specific gravity is a measure of the concentration of solutes in the urine and provides information on the kidney's ability to concentrate urine. The concentration of the excreted molecules determines the urine's specific gravity. Urine samples were collected for the measurement of urine specific gravity by dipstick method up-to follow-up (Day 25) in Part 1. Only categories with significant values have been presented. Only those participants with data available at the specified time were analyzed (represented by n=x,x in the category titles). (NCT03095638)
Timeframe: Up to 25 days in Part 1

Intervention	Ratio (Mean)
	Urine Specific Gravity,Day 2(-24 hours),n=14,14	Urine Specific Gravity,Follow-up,n=5,5
DTG 10 mg	1.0131	1.0180
DTG 50 mg	1.0177	1.0150

[back to top]

Urine Specific Gravity Analysis by Dipstick Method for Part 2

Urinary specific gravity measurement is a routine part of urinalysis. Urine specific gravity is a measure of the concentration of solutes in the urine and provides information on the kidney's ability to concentrate urine. The concentration of the excreted molecules determines the urine's specific gravity. Urine samples were collected for the measurement of urine specific gravity by dipstick method up-to follow-up (Day 36) in Part 2. Only categories with significant values have been presented. Only those participants with data available at the specified time were analyzed (represented by n=x in the category titles). (NCT03095638)
Timeframe: Up to 36 days in Part 2

Intervention	Ratio (Mean)
	Urine Specific Gravity,Day 2(-24 hours),n=24,24,24	Urine Specific Gravity,Follow-up,n=3,2,3
Treatment C	1.0143	1.0207
Treatment D	1.0148	1.0165
Treatment E	1.0141	1.0117

[back to top]

Change From Baseline in Hematology Parameter Blood Erythrocytes for Part 2

Blood samples for the assessment of hematology parameters were collected at Baseline and up-to follow-up (Day 36) in Part 2. Baseline was defined as pre-dose assessments performed on Day -1. Change from Baseline was calculated by subtracting the post-dose-visit value from the Baseline value. Data has been presented for blood erythrocytes results for Part 2. Only those participants with data available at the specified time were analyzed (represented by n=x,x,x in the category titles). (NCT03095638)
Timeframe: Baseline and up to 36 days in Part 2

Intervention	10^12 cells/Liter (Mean)
	Blood erythrocytes, Day 2, n=24, 24, 24	Blood erythrocyte, Follow-up, n=3, 2, 3
DTG 25 mg (Reference)	0.165	0.117
DTG 5 mg (Test 1)	0.145	0.123
DTG 5 mg (Test 2)	0.209	0.120

[back to top]

%AUCex of DTG for Part 2

Blood samples were collected at the indicated time points after administration of study treatment to investigate the PK profile of DTG tablets in fasted state. PK parameters were calculated by standard non-compartmental analysis using Phoenix WinNonlin Version 6.4 or higher based on actual sampling times. (NCT03095638)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose in Part 2

Intervention	Percentage of AUC (Mean)
DTG 5 mg (Test 1)	4.37
DTG 5 mg (Test 2)	4.23
DTG 25 mg (Reference)	4.66

[back to top]

Change From Baseline in CD4+ Cell Count at Week 48

(NCT03110380)
Timeframe: Baseline; Week 48

Intervention	cells/µL (Mean)
B/F/TAF	18
DTG + F/TAF	36

[back to top]

Percentage of Participants With HIV-1 RNA < 50 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm

Intervention	percentage of participants (Number)
B/F/TAF	93.3
DTG + F/TAF	91.1

[back to top]

Percentage of Participants With HIV-1 RNA ≥ 50 Copies/mL at Week 48 as Defined by the US FDA-Defined Snapshot Algorithm

The percentage of participants with HIV-1 RNA ≥ 50 copies/mL at Week 48 was analyzed using the snapshot algorithm, which defines a participant's virologic response status using only the viral load at the predefined time point within an allowed window of time, along with study drug discontinuation status. (NCT03110380)
Timeframe: Week 48

Intervention	percentage of participants (Number)
B/F/TAF	0.4
DTG + F/TAF	1.1

[back to top]

Analysis of Creatinine Clearance at Time Points 24, 36 and 48 Weeks.

(NCT03198884)
Timeframe: 48 weeks

Intervention	mg/dL (Mean)
Analysis of Serum Creatinine at Week 24	75.8
Analysis of Serum Creatinine at Week 36	69.1
Analyis of Serum Creatinine at Week 48	77.7

[back to top]

Number of Grade 1 Adverse Events Reported

"10 study subjects reported adverse events. All adverse events reported (insomnia, diarrhea, headache) were of Grade 1 severity.~There were no adverse events that led to discontinuation of the study regimen." (NCT03198884)
Timeframe: 48 weeks

Intervention	Adverse Events (Number)
	Insomnia	Diarrhea	Headache
Adverse Events	6	4	3

[back to top]

Incidence of Adverse Events.

10 study subjects reported an adverse event. (NCT03198884)
Timeframe: 48 weeks

Intervention	Participants (Count of Participants)
	Insomnia	Diarrhea	Headache
Retrospective Chart Review	6	4	3

[back to top]

The Change in Serum Creatinine From Baseline to 48 Weeks.

A second primary endpoint was evaluating the change in serum creatinine from baseline to 48 weeks for all subjects. (NCT03198884)
Timeframe: 48 weeks

Intervention	mg/dL (Mean)
Retrospective Chart Review	73.4

[back to top]

Number of Participants With RNA <50 Copies/mL at 48 Weeks

Our first primary endpoint evaluated the percent of study subjects with an RNA <50 copies/mL at 48 weeks after initiation of the once daily two-drug regimen. (NCT03198884)
Timeframe: 48 weeks

Intervention	Participants (Count of Participants)
Retrospective Chart Review	19

[back to top]

Number of Participants With RNA <50 Copies/mL at 24, 36, and 48 Weeks

"This secondary outcome measure analyzed the percentage of subjects with < 50 copies/mL RNA at time points 24, 36 and 48 weeks.~The percent of subjects with an RNA < 50 copies/mL at each time point was analyzed using McNemar's test following the guidelines of the Snapshot algorithm. Missing RNA data was considered a treatment failure." (NCT03198884)
Timeframe: 48 weeks

Intervention	Participants (Count of Participants)
Analysis of HIV RNA at Week 24	19
Analysis of HIV RNA at Week 36	14
Analysis of HIV RNA at Week 48	19

[back to top]

Change in Mean CD4+ Cell Count From Baseline.

A secondary endpoint included changes from baseline in CD4+ cell counts. (NCT03198884)
Timeframe: 48 weeks

Intervention	cells/μL (Mean)
Week 24	454
Week 36	428
Week 48	456

[back to top]

Peripheral Blood Mononuclear Cells (PBMC) Antiretroviral Concentrations

Concentrations of emtricitabine-triphosphate, tenofovir-diphosphate will be measured in peripheral blood mononuclear cells in the Truvada arm only. Truvada is a combination pill, so results for both FTC and TFV are reported in separate columns. (NCT03218592)
Timeframe: Up to 28 days post-dose

Intervention	fmol/10^6 cells (Median)
	Phase 1 Single Dose	Phase 2: 7 Doses per Week	Phase 3: 3 Doses Per Week	Phase 3: 1 Dose Per Week	Phase 3: Zero Doses per week
Emtricitabine (Truvada)	27.09	4460	2388.69	267.82	27.48
Tenfovir (Truvada)	2.1	127.1	60	15.7	10.4

[back to top]

Hair Antiretroviral Imaging

Signal Strength concentrations will be measured in hair for all study drugs, inclusive of FTC (emtricitabine), tenofovir (TFV), maraviroc (MRV), and dolutegravir (DTG) using Matrix-assisted Laser Desorption Electrospray Ionization (IR-MALDESI) to be reported by signal abundance (au). Signal abundance is the industry standard unit, and higher values represent greater signal with capability to relate to comparative concentrations. (NCT03218592)
Timeframe: Up to 28 days post dose

Intervention	Signal Abundance (au) (Median)
	Phase 3: Zero Doses Per Week	Phase 3: 1 Dose Per week	Phase 3: 3 Doses Per Week	Phase 2: Daily Dosing	Phase 1: Single Dose
Dolutegravir	1092.130868	2377.868226	5504.883169	14251.46653	NA
Maraviroc	156.4826656	3942.692396	27814.98823	46013.29104	NA
Truvada	0.501209	156.1127125	466.7986895	824.721385	NA

[back to top]

Whole Blood Antiretroviral Concentrations

Concentrations will be measured in dried blood spots of all study drugs, inclusive of FTC (emtricitabine), TFV (tenofovir), MRV (Maraviroc), and DTG (dolutegravir). Truvada is a combination pill, so results for both FTC and TFV are reported in separate columns. (NCT03218592)
Timeframe: Up to 28 days post-dose

,,,

Intervention	fmol / 3mm punch (Median)
	Phase 1: Single Dose	Phase 2: 7 Doses per Week	Phase 3: 3 Doses Per Week	Phase 3: 1 Dose Per Week	Phase 3: 0 Doses per week
Dolutegravir	10	718.5	60.95	10	10
Emtricitabine	50	280	150.5	50	50
Maraviroc	3	9.185	3	3	3
Tenofovir	50	809.5	811	644.5	621

[back to top]

Plasma Antiretroviral Concentrations

Concentrations will be measured in hair of all study drugs, inclusive of FTC (emtricitabine), TFV (tenofovir), MRV (Maraviroc), and DTG (dolutegravir) (NCT03218592)
Timeframe: Up to 28 days post-dose

,,,

Intervention	ng/mL (Median)
	Phase 1: Single dose	Phase2: 7 Doses per Week	Phase 3: 3 Doses Per Week	Phase 3: 1 Dose Per Week	Phase 3: 0 Doses per week
Dolutegravir	1	1240	69.3	3.095	1
Emtricitabine	0.5	72.3	17.2	1.2	0.5
Maraviroc	1	9.715	1.71	1	1
Tenofovir	0.5	61.9	9.4	0.5	0.5

[back to top]

Number of Patients Who Receive Rapid HIV Treatment Initiation

Number of patients who do start Anti-retroviral Therapy (ART) the same day it is offered. (NCT03512964)
Timeframe: 12 months

Intervention	Participants (Count of Participants)
Rapid HIV Treatment Initiation	32

[back to top]

Number of Patients Who Accepted Rapid HIV Treatment Initiation

(NCT03512964)
Timeframe: 12 months

Intervention	Participants (Count of Participants)
Rapid HIV Treatment Initiation	32

[back to top]

Number of Patients Offered Rapid HIV Treatment Initiation

(NCT03512964)
Timeframe: 12 months

Intervention	Participants (Count of Participants)
Rapid HIV Treatment Initiation	32

[back to top]

Rapid HIV Treatment Initiation Acceptability as Assessed by the Number of Patients Who Respond Yes to Starting ART Same Day

Number of patients who respond yes to starting ART same day versus those who respond no in the survey. (NCT03512964)
Timeframe: 12 months

Intervention	Participants (Count of Participants)
Rapid HIV Treatment Initiation	32

[back to top]

Geometric Mean Area Under the Plasma Concentration-time Curve Over 24 Hours (AUC0-24h) for ABC, DTG, and 3TC

Based on analysis of intensive pharmacokinetic (PK) samples. The geometric mean AUC0-24h for each Weight Band was compared to the lower and upper reference values (in ug*h/mL) for DTG (35.1, 134), ABC (6.3, 50.4), and 3TC (6.3, 26.5). Steady state was measured at Week 1, but was re-collected later for two participants due to a specimen handling error for the Week 1 specimens. (NCT03760458)
Timeframe: Week 1; Blood samples were drawn at pre-dose and 1, 2, 3, 4, 6, 8, and 24 hours post dosing.

,,,,

Intervention	h*ug/mL (Geometric Mean)
	Abacavir (ABC)	Dolutegravir (DTG)	Lamivudine (3TC)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	17.7	75.9	10.7
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	19.8	91.0	14.2
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	15.1	71.4	13.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	17.4	84.4	14.5
Weight Band #5 (25 kg or Greater at Study Entry)	25.7	71.8	21.7

[back to top]

Antiretroviral (ARV) Resistance Mutations

ARV resistance mutations at time of virologic failure and at entry for children with virologic failure. (NCT03760458)
Timeframe: Entry and confirmation of virologic failure

Intervention	Participants (Count of Participants)
	Entry Visit: Integrase K14R	Entry Visit: Integrase A21T	Entry Visit: Integrase V31I	Entry Visit: Integrase V72I	Entry Visit: Integrase L74I	Entry Visit: Integrase T112V	Entry Visit: Integrase V113I	Entry Visit: Integrase T125A	Entry Visit: Integrase V126L	Entry Visit: Integrase G134N	Entry Visit: Integrase I135V	Entry Visit: Integrase K136R	Entry Visit: Integrase V165I	Entry Visit: Integrase A196P	Entry Visit: Integrase V236I	Entry Visit: Integrase V281M	Entry Visit: Integrase S283G	Entry Visit: Protease L10V	Entry Visit: Protease I13V	Entry Visit: Protease G16E	Entry Visit: Protease E35D	Entry Visit: Protease M36I	Entry Visit: Protease R41K	Entry Visit: Protease K43R	Entry Visit: Protease H69K	Entry Visit: Protease I72V	Entry Visit: Protease L89M	Entry Visit: Reverse Transcriptase E6D	Entry Visit: Reverse Transcriptase K11T	Entry Visit: Reverse Transcriptase K20R	Entry Visit: Reverse Transcriptase V35T	Entry Visit: Reverse Transcriptase T39K	Entry Visit: Reverse Transcriptase K43E	Entry Visit: Reverse Transcriptase Q102K	Entry Visit: Reverse Transcriptase K122E	Entry Visit: Reverse Transcriptase D123S	Entry Visit: Reverse Transcriptase C162S	Entry Visit: Reverse Transcriptase T165I	Entry Visit: Reverse Transcriptase K173A	Entry Visit: Reverse Transcriptase Q174K	Entry Visit: Reverse Transcriptase D177E	Entry Visit: Reverse Transcriptase T200A	Entry Visit: Reverse Transcriptase I202V	Entry Visit: Reverse Transcriptase Q207A	Entry Visit: Reverse Transcriptase L210M	Entry Visit: Reverse Transcriptase R211S	Entry Visit: Reverse Transcriptase V245E	Entry Visit: Reverse Transcriptase A272P	Entry Visit: Reverse Transcriptase R277K	Entry Visit: Reverse Transcriptase T286A	Entry Visit: Reverse Transcriptase L295L/I	Entry Visit: Reverse Transcriptase E312N	Entry Visit: Reverse Transcriptase I326V	Entry Visit: Reverse Transcriptase I329V	Entry Visit: Reverse Transcriptase G335D	Entry Visit: Reverse Transcriptase M357K	Entry Visit: Reverse Transcriptase K358R	Entry Visit: Reverse Transcriptase G359S	Entry Visit: Reverse Transcriptase K366R	Entry Visit: Reverse Transcriptase A371V	Entry Visit: Reverse Transcriptase T377S	Entry Visit: Reverse Transcriptase K390R	Entry Visit: Reverse Transcriptase K395R	Entry Visit: Reverse Transcriptase A400T
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1

[back to top]

Percentage of Participants With at Least One Adverse Event Through Week 48

AE grading was based on DAIDS AE Grading Table, Corrected Version 2.1, dated July 2017. AEs of any grade were reported. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 48

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	100.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	90.9
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	100.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	100.0
Weight Band #5 (25 kg or Greater at Study Entry)	90.0

[back to top]

Percentage of Participants Who Had at Least One Serious Adverse Event Assessed as Related to Study Drug Through Week 60

AE grading was based on DAIDS AE Grading Table, Corrected Version 2.1, dated July 2017. AEs of any grade were reported. The relationship to study drug was assessed by the site investigator. Seriousness was defined according to Version 2.0 of the DAIDS EAE Manual. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 60

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Serious Adverse Event Assessed as Related to Study Drug Through Week 48

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Serious Adverse Event Assessed as Related to Study Drug Through Week 24

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Life-threatening Adverse Event Assessed as Related to Study Drug Through Week 60

AE grading was based on DAIDS AE Grading Table, Corrected Version 2.1, dated July 2017. AEs of any grade were reported. The relationship to study drug was assessed by the site investigator. Life-threatening was defined according to Version 2.0 of the DAIDS EAE Manual. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 60

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Life-threatening Adverse Event Assessed as Related to Study Drug Through Week 48

AE grading was based on DAIDS AE Grading Table, Corrected Version 2.1, dated July 2017. AEs of any grade were reported. The relationship to study drug was assessed by the site investigator. Life-threatening was defined according to Version 2.0 of the DAIDS EAE Manual. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 48

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Grade 3 or Grade 4 Adverse Event Assessed as Related to Study Drug Through Week 60

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	20.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Grade 3 or Grade 4 Adverse Event Assessed as Related to Study Drug Through Week 48

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	20.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Grade 3 or Grade 4 Adverse Event Assessed as Related to Study Drug Through Week 24

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Adverse Event Through Week 60

AE grading was based on DAIDS AE Grading Table, Corrected Version 2.1, dated July 2017. AEs of any grade were reported. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 60

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	100.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	90.9
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	100.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	100.0
Weight Band #5 (25 kg or Greater at Study Entry)	90.0

[back to top]

Percentage of Participants With HIV-1 RNA Less Than 200 Copies/mL

Viral loads less than the lower limit of quantification were imputed as one less than the lower limit. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	percentage of participants (Number)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	75.0	87.5	100.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	100.0	100.0	100.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	100.0	100.0	100.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	100.0	100.0	100.0
Weight Band #5 (25 kg or Greater at Study Entry)	100.0	100.0	100.0

[back to top]

Percentage of Participants Who Had at Least One Adverse Event Through Week 24

Adverse event (AE) grading was based on the Division of AIDS Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table), Corrected Version 2.1, dated July 2017. AEs of any grade were reported. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 24

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	100.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	90.9
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	100.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	80.0
Weight Band #5 (25 kg or Greater at Study Entry)	80.0

[back to top]

Percentage of Participants Who Had at Least One Adverse Event Assessed as Related to Study Drug That Led to Permanent Discontinuation of Study Drug Through Week 60

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Adverse Event Assessed as Related to Study Drug That Led to Permanent Discontinuation of Study Drug Through Week 48

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had at Least One Adverse Event Assessed as Related to Study Drug That Led to Permanent Discontinuation of Study Drug Through Week 24

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had a Grade 5 Adverse Event Assessed as Related to Study Drug Through Week 60

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had a Grade 5 Adverse Event Assessed as Related to Study Drug Through Week 48

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Had a Grade 5 Adverse Event Assessed as Related to Study Drug Through Week 24

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Population PK: Geometric Mean Apparent Oral Clearance (CL/F) for ABC, DTG, and 3TC

Population PK: Geometric Mean Area Under the Plasma Concentration-time Curve for ABC, DTG, and 3TC derived from population PK model. Population apparent oral clearance and apparent volume of distribution were determined with non-linear mixed effects modeling. DTG and 3TC were fit to a 1-compartment model and ABC was fit to 2-compartment model. Weight was a covariate on clearance and volume for all drugs and enzyme maturation as a covariate on apparent oral clearance for DTG. The posthoc parameter of AUC0-24 was estimated using non-compartmental analysis of simulated steady-state concentration-time profiles and stratified by weight band. (NCT03760458)
Timeframe: Measured from Week 1 through Week 48 over 24 hours post-dose

,,,,

Intervention	L/hour (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	10.40	0.18	9.03
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	12.70	0.23	8.04
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	17.40	0.35	11.00
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	18.40	0.37	13.80
Weight Band #5 (25 kg or Greater at Study Entry)	23.00	0.69	14.80

[back to top]

Population PK: Geometric Mean Concentration at 24 Hours Post-dose (C24h) for ABC, DTG, and 3TC

,,,,

Intervention	ug/mL (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.01	1.08	0.01
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.02	1.35	0.02
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.01	0.71	0.01
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.01	1.09	0.02
Weight Band #5 (25 kg or Greater at Study Entry)	0.02	1.01	0.03

[back to top]

Population PK: Geometric Mean Concentration at Time 0 (Pre-dose) (C0h) for ABC, DTG, and 3TC

,,,,

Intervention	ug/mL (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.01	1.08	0.01
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.02	1.35	0.03
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.01	0.71	0.02
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.01	1.09	0.01
Weight Band #5 (25 kg or Greater at Study Entry)	0.02	1.01	0.02

[back to top]

Population PK: Geometric Mean Half-life (t1/2) for ABC, DTG, and 3TC

,,,,

Intervention	hours (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	3.21	8.34	3.38
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	3.43	9.42	3.23
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	3.72	6.75	2.97
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	3.32	8.34	3.46
Weight Band #5 (25 kg or Greater at Study Entry)	3.30	8.14	3.51

[back to top]

Population PK: Geometric Mean Maximum Plasma Concentration (Cmax) for ABC, DTG, and 3TC

,,,,

Intervention	ug/mL (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	6.04	6.79	2.29
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	7.42	6.63	2.64
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	7.07	6.36	2.98
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	8.04	6.59	2.65
Weight Band #5 (25 kg or Greater at Study Entry)	9.60	5.43	3.59

[back to top]

Population PK: Geometric Mean Time to Maximum Concentration (Tmax) for ABC, DTG, and 3TC

,,,,

Intervention	hours (Median)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1.00	2.00	2.00
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1.00	2.00	2.00
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1.00	2.00	2.00
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1.00	2.50	2.00
Weight Band #5 (25 kg or Greater at Study Entry)	1.00	3.00	2.00

[back to top]

Parent/Guardian-reported Ease of Giving Study Drug

Parent/guardian-reported ease of giving study drug according to palatability questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 12, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570431				Week 472570427	Week 472570428	Week 472570429	Week 472570430	Week 1272570427	Week 1272570428	Week 1272570429	Week 1272570430	Week 1272570431	Week 2472570427	Week 2472570428	Week 2472570429	Week 2472570430	Week 2472570431	Week 4872570429	Week 4872570427	Week 4872570428	Week 4872570430	Week 4872570431
	The child takes by themselves easily	The child takes easily with help	The child takes with help but you need to threaten	You need to hold and force the child
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	2
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	11
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	9
Weight Band #5 (25 kg or Greater at Study Entry)	9
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	6
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	8
Weight Band #5 (25 kg or Greater at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	2
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	10
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	5
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	3
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	12
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	8
Weight Band #5 (25 kg or Greater at Study Entry)	8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	6
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	3
Weight Band #5 (25 kg or Greater at Study Entry)	3
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	4
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	6
Weight Band #5 (25 kg or Greater at Study Entry)	10
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	5
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	4
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #5 (25 kg or Greater at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #5 (25 kg or Greater at Study Entry)	0

[back to top]

Parent/Guardian-reported Reason for Missed Doses of Study Drug

Parent/guardian-reported reason for missed doses of study drug in the 30 days prior to the study visit according to adherence questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570429								Week 472570430	Week 472570431	Week 472570427	Week 472570428	Week 2472570428	Week 2472570430	Week 2472570427	Week 2472570429	Week 2472570431	Week 4872570429	Week 4872570431	Week 4872570428	Week 4872570430	Week 4872570427
	Tried to spit it out because of taste (away from c	No missed doses	Both parents were admitted in the hospital	Caregiver too sick	Caregiver was too busy to give the medication	Change in daily routine	Forgot to administer medication	Mom was in a hurry and forgot to give child medica
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0
Weight Band #5 (25 kg or Greater at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	10
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	14
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10
Weight Band #5 (25 kg or Greater at Study Entry)	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	7
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	8
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	13
Weight Band #5 (25 kg or Greater at Study Entry)	10
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	5
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	9
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	9

[back to top]

Parent/Guardian-reported Response of Child's Face When Taking Favorite Food

Parent/guardian-reported response of child's face when taking favorite food according to palatability questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 12, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570427					Week 472570431	Week 472570430	Week 472570428	Week 472570429	Week 1272570427	Week 1272570428	Week 1272570430	Week 1272570431	Week 1272570429	Week 2472570427	Week 2472570428	Week 2472570430	Week 2472570431	Week 2472570429	Week 4872570427	Week 4872570428	Week 4872570429	Week 4872570430	Week 4872570431
	Average	Very good	Good	Bad	Very bad
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	3
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	7
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	4
Weight Band #5 (25 kg or Greater at Study Entry)	8
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	9
Weight Band #5 (25 kg or Greater at Study Entry)	2
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	4
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	6
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	7
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	6
Weight Band #5 (25 kg or Greater at Study Entry)	10
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	2
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	4
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	3
Weight Band #5 (25 kg or Greater at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	3
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	3
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #5 (25 kg or Greater at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	6
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	4
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	5
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	8
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	7
Weight Band #5 (25 kg or Greater at Study Entry)	11
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	6

[back to top]

Parent/Guardian-reported Number of Missed Doses of Study Drug

Parent/guardian-reported number of missed doses of study drug in the 30 days prior to the study visit according to adherence questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	missed doses (Median)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0	0	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0	0	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0	0	0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0	0	0
Weight Band #5 (25 kg or Greater at Study Entry)	0	0	0

[back to top]

Parent/Guardian-reported Response of Child's Face When Taking Study Drug

Parent/guardian-reported response of child's face when taking study drug according to palatability questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 12, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570427					Week 472570428	Week 472570429	Week 472570430	Week 472570431	Week 1272570427	Week 1272570428	Week 1272570429	Week 1272570431	Week 1272570430	Week 2472570427	Week 2472570428	Week 2472570429	Week 2472570430	Week 2472570431	Week 4872570428	Week 4872570429	Week 4872570430	Week 4872570431	Week 4872570427
	Very bad	Very good	Good	Average	Bad
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0
Weight Band #5 (25 kg or Greater at Study Entry)	5
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	10
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	2
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	3
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	4
Weight Band #5 (25 kg or Greater at Study Entry)	6
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	5
Weight Band #5 (25 kg or Greater at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	4
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	4
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	3
Weight Band #5 (25 kg or Greater at Study Entry)	3
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	2
Weight Band #5 (25 kg or Greater at Study Entry)	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	5
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	3
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	3
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #5 (25 kg or Greater at Study Entry)	4
Weight Band #5 (25 kg or Greater at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	6
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0

[back to top]

Parent/Guardian-reported Response of How Often the Child Received the Study Drug in the Way They Were Supposed to

Parent/guardian-reported response of how often the child received the study drug in the way they were supposed to in the 30 days prior to the study visit according to adherence questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570431					Week 472570428	Week 472570430	Week 472570427	Week 472570429	Week 2472570431	Week 2472570427	Week 2472570428	Week 2472570429	Week 2472570430	Week 4872570430	Week 4872570431	Week 4872570427	Week 4872570428	Week 4872570429
	Always	Almost always	Usually	Sometimes	Never
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	9
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	14
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10
Weight Band #5 (25 kg or Greater at Study Entry)	10
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #5 (25 kg or Greater at Study Entry)	1
Weight Band #5 (25 kg or Greater at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	12
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	6
Weight Band #5 (25 kg or Greater at Study Entry)	9
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	2
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	3
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #5 (25 kg or Greater at Study Entry)	2
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	6
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	13
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	9
Weight Band #5 (25 kg or Greater at Study Entry)	11
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	3
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0

[back to top]

Parent/Guardian-reported Response of How Well the Person Usually Responsible Administered the Study Drug in the Way They Were Supposed to

Parent/guardian-reported response of how well the person usually responsible administered the study drug in the way they were supposed to in the 30 days prior to the study visit according to adherence questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570427					Week 472570428	Week 472570429	Week 472570430	Week 472570431	Week 2472570427	Week 2472570428	Week 2472570429	Week 2472570430	Week 2472570431	Week 4872570427	Week 4872570428	Week 4872570430	Week 4872570431	Week 4872570429
	Excellent	Very good	Good	Fair	Poor
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	4
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	12
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	7
Weight Band #5 (25 kg or Greater at Study Entry)	9
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	3
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	4
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	2
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	2
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	10
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	5
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	5
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	3
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	4
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #5 (25 kg or Greater at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	3
Weight Band #5 (25 kg or Greater at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #5 (25 kg or Greater at Study Entry)	11
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0

[back to top]

Parent/Guardian-reported Satisfaction With the Number of Study Drug Tablets to Dissolve

Parent/guardian-reported satisfaction with the number of study drug tablets to dissolve according to acceptability questionnaire responses (NCT03760458)
Timeframe: Weeks 4, 12, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570429			Week 472570427	Week 472570428	Week 472570430	Week 1272570427	Week 1272570428	Week 1272570429	Week 1272570430	Week 2472570429	Week 2472570430	Week 2472570427	Week 2472570428	Week 4872570429	Week 4872570427	Week 4872570430	Week 4872570428
	It is too few	It is acceptable	It is too many
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	10
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	8
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	8
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	9
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	14
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	10
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	7
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	11
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	15
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	4
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0

[back to top]

Parent/Guardian-reported Time for Study Drug Tablets to Dissolve

Parent/guardian-reported time for study drug tablets to dissolve according to acceptability questionnaire responses (NCT03760458)
Timeframe: Weeks 4, 12, 24, and 48

Intervention	Participants (Count of Participants)
	Week 472570429			Week 472570428	Week 472570427	Week 472570430	Week 1272570429	Week 1272570427	Week 1272570428	Week 1272570430	Week 2472570427	Week 2472570428	Week 2472570429	Week 2472570430	Week 4872570427	Week 4872570428	Week 4872570429	Week 4872570430
	Less than 1 minute	1 to less than 3 minutes	3 to 5 minutes
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	5
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	4
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	5
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	8
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	6
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	2
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	3
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	3
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	10
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	5
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	1
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	1
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	3
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	4
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	6
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	11
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	2
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	2
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	2
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0

[back to top]

Population PK: Geometric Mean AUC0-24h for ABC, DTG, and 3TC

,,,,

Intervention	ug*h/mL (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	17.30	82.20	9.97
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	18.90	86.90	14.90
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	17.20	71.50	13.60
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	19.50	81.60	13.10
Weight Band #5 (25 kg or Greater at Study Entry)	26.10	72.60	20.30

[back to top]

Percentage of Participants With Virologic Success of HIV-1 RNA Less Than 50 Copies/mL Using FDA Snapshot Algorithm

Percentage of participants with virologic success of HIV-1 RNA less than 50 copies/mL using FDA snapshot algorithm at Weeks 4, 24, and 48. Viral loads less than the lower limit of quantification were imputed as one less than the lower limit. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	percentage of participants (Number)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	44.4	77.8	77.8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	91.7	83.3	66.7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	86.7	93.3	86.7
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	80.0	100.0	70.0
Weight Band #5 (25 kg or Greater at Study Entry)	100.0	100.0	90.9

[back to top]

Percentage of Participants With Virologic Success of HIV-1 RNA Less Than 200 Copies/mL Using FDA Snapshot Algorithm

Percentage of participants with virologic success of HIV-1 RNA less than 200 copies/mL using FDA snapshot algorithm at Weeks 4, 24, and 48. Viral loads less than the lower limit of quantification were imputed as one less than the lower limit. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	percentage of participants (Number)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	66.7	77.8	88.9
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	100.0	91.7	91.7
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	100.0	100.0	100.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	100.0	100.0	90.0
Weight Band #5 (25 kg or Greater at Study Entry)	100.0	100.0	100.0

[back to top]

Percentage of Participants Who Had at Least One Life-threatening Adverse Event Assessed as Related to Study Drug Through Week 24

AE grading was based on DAIDS AE Grading Table, Corrected Version 2.1, dated July 2017. AEs of any grade were reported. The relationship to study drug was assessed by the site investigator. Life-threatening was defined according to Version 2.0 of the Manual for Expedited Reporting of Adverse Events to DAIDS (DAIDS EAE Manual). (NCT03760458)
Timeframe: Measured from treatment initiation through Week 24

Intervention	percentage of participants (Number)
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0

[back to top]

Percentage of Participants Who Experienced Virologic Failure Through Week 60

Percentage of participants who experienced virologic failure based on the following definition: ART-experienced participants who had two subsequent viral loads greater or equal to 200 copies/mL at any time, or for ART-naive participants, two subsequent viral loads greater to or equal to 200 copies/mL at 24 weeks or after. The results are presented by ART experienced, ART naïve, and overall. (NCT03760458)
Timeframe: Measured from treatment initiation through Week 60

Intervention	percentage of participants (Number)
	Overall	ART-experienced	ART-naive
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	12.5	0.0	33.3

[back to top]

Percentage of Participants Who Experienced Virologic Failure Through Week 60

,,,

Intervention	percentage of participants (Number)
	Overall	ART-experienced
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0	0.0

[back to top]

Percentage of Participants Who Experienced Virologic Failure Through Week 48

Intervention	percentage of participants (Number)
	Overall	ART-experienced	ART-naive
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	12.5	0.0	33.3

[back to top]

Percentage of Participants Who Experienced Virologic Failure Through Week 48

,,,

Intervention	percentage of participants (Number)
	Overall	ART-experienced
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.0	0.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.0	0.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.0	0.0
Weight Band #5 (25 kg or Greater at Study Entry)	0.0	0.0

[back to top]

Parent/Guardian-reported Percent Adherence to Study Drug

Parent/guardian-reported percent adherence to study drug in the 30 days prior to the study visit according to adherence questionnaire responses. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	percentage of study drug taken (Median)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	100.0	100.0	100.0
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	100.0	100.0	100.0
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	100.0	100.0	100.0
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	100.0	100.0	100.0
Weight Band #5 (25 kg or Greater at Study Entry)	100.0	100.0	100.0

[back to top]

Median (Q1,Q3) Change From Baseline in Triglycerides

Baseline is defined as the latest pre-dose assessment with a non-missing value. Where time was not collected, assessments on the day of treatment initiation are assumed to be taken prior to first dose. Missing results for participants who discontinued study treatment prior to the specified timepoint due to safety or virologic failure were imputed using the baseline value. Per protocol, there was no expectation of evaluating lipids in a fasting state for this study. A relative few participants were identified as having been in a fasted state at a given study visit, but the majority did not fast for this evaluation. (NCT03760458)
Timeframe: Baseline, Weeks 24 and 48

,,,,

Intervention	mmol/L (Median)
	Baseline to Week 24	Baseline to Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	-0.51	-0.43
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	-0.51	-0.32
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	-0.17	-0.21
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	-0.20	0.00
Weight Band #5 (25 kg or Greater at Study Entry)	-0.24	-0.27

[back to top]

Median (Q1,Q3) Change From Baseline in Total Cholesterol

,,,,

Intervention	mmol/L (Median)
	Baseline to Week 24	Baseline to Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	-0.31	0.00
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	-0.70	-0.50
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	-0.67	-0.68
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	-0.32	-0.25
Weight Band #5 (25 kg or Greater at Study Entry)	-0.18	-0.09

[back to top]

Median (Q1,Q3) Change From Baseline in LDL

,,,,

Intervention	mmol/L (Median)
	Baseline to Week 24	Baseline to Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.18	0.05
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	-0.20	-0.13
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	-0.26	-0.30
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	-0.22	0.00
Weight Band #5 (25 kg or Greater at Study Entry)	-0.21	0.03

[back to top]

Median (Q1,Q3) Change From Baseline in HDL

,,,,

Intervention	mmol/L (Median)
	Baseline to Week 24	Baseline to Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	-0.01	-0.10
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	-0.06	-0.20
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	-0.19	-0.24
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	-0.15	-0.19
Weight Band #5 (25 kg or Greater at Study Entry)	-0.06	0.05

[back to top]

Median (Q1, Q3) CD4+ Percentage

Per protocol, CD4+ cell count percentages were not required at Week 60. CD4 results were therefore analyzed through Week 48. For participants who discontinued study drug prior to the other timepoints due to safety or virologic failure, results imputed using the baseline value. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	percentage of CD4+ in total lymphocytes (Median)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	41.6	36.6	34.8
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	33.9	35.2	34.1
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	32.4	33.5	30.5
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	34.4	37.7	33.5
Weight Band #5 (25 kg or Greater at Study Entry)	39.5	38.6	37.6

[back to top]

Median (Q1, Q3) CD4+ Cell Count

Per protocol, CD4 + cell counts were not required at Week 60. CD4 results were therefore analyzed through Week 48. For participants who discontinued study drug prior to the other timepoints due to safety or virologic failure, results imputed using the baseline value. (NCT03760458)
Timeframe: Weeks 4, 24, and 48

,,,,

Intervention	cells/mm^3 (Median)
	Week 4	Week 24	Week 48
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	3528	2208	1853
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	1385	1184	1235
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	812	894	930
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	992	944	942
Weight Band #5 (25 kg or Greater at Study Entry)	841	920	777

[back to top]

Geometric Mean Maximum Plasma Concentration (Cmax) for ABC, DTG, and 3TC

Based on analysis of intensive PK samples. Steady state was measured at Week 1, but was re-collected later for two participants due to a specimen handling error for the Week 1 specimens. (NCT03760458)
Timeframe: Week 1; Blood samples were drawn at pre-dose and 1, 2, 3, 4, 6, 8, and 24 hours post dosing.

,,,,

Intervention	ug/mL (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	7.30	7.40	2.29
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	8.36	8.85	3.55
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	6.26	7.04	2.92
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	6.65	7.29	2.99
Weight Band #5 (25 kg or Greater at Study Entry)	9.04	6.25	4.15

[back to top]

Geometric Mean Concentration at 24 Hours Post-dose (C24h) for ABC, DTG, and 3TC

Based on analysis of intensive PK samples. The geometric mean C24h for each Weight Band was compared to the lower and upper reference values (in ug/mL) for DTG (0.67, 2.97). Steady state was measured at Week 1, but was re-collected later for two participants due to a specimen handling error for the Week 1 specimens. (NCT03760458)
Timeframe: Week 1; Blood samples were drawn at pre-dose and 1, 2, 3, 4, 6, 8, and 24 hours post dosing.

,,,,

Intervention	ug/mL (Geometric Mean)
	ABC	DTG	3TC
Weight Band #1 (6 to Less Than 10 kg at Study Entry)	0.003	0.91	0.055
Weight Band #2 (10 to Less Than 14 kg at Study Entry)	0.005	1.22	0.046
Weight Band #3 (14 to Less Than 20 kg at Study Entry)	0.003	0.79	0.058
Weight Band #4 (20 to Less Than 25 kg at Study Entry)	0.004	1.35	0.060
Weight Band #5 (25 kg or Greater at Study Entry)	0.011	0.98	0.084

[back to top]

Virological Suppression at 24 Weeks (Per Protocol)

Proportion with HIV viral load <50 copies/mL at 24 weeks analyzed per protocol. (NCT03851588)
Timeframe: 24 weeks

Intervention	Participants (Count of Participants)
Supplementary Dose	43
Placebo Dose	44

[back to top]

Virological Suppression at 24 Weeks

Proportion with HIV viral load <50 copies/mL at 24 weeks analysed by modified intention to treat (ITT), which includes all participants who received at least one dose of dolutegravir, and according to the FDA snapshot algorithm. (NCT03851588)
Timeframe: 24 weeks

Intervention	Participants (Count of Participants)
Supplementary Dose	43
Placebo Dose	44

[back to top]

Virological Suppression at 12 Weeks (Modified ITT)

Proportion with HIV viral load <50 copies/mL at 12 weeks analyzed modified ITT. (NCT03851588)
Timeframe: 12 weeks

Intervention	Participants (Count of Participants)
Supplementary Dose	42
Placebo Dose	46

[back to top]

Number of Participants With Non-serious Adverse Events (AEs) and Serious Adverse Events (SAEs)

An AE is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a study intervention, whether or not considered related to the study intervention. A SAE is defined as any untoward medical occurrence that, at any dose results in death,is life-threatening, requires inpatient hospitalization or prolongation of existing hospitalization, results in persistent disability/incapacity, is a congenital anomaly/birth defect, any other situation according to medical or scientific judgement. (NCT03921723)
Timeframe: Up to Week 11

Intervention	Participants (Count of Participants)
	Non-serious AEs	SAEs
DTG Reference	4	0
Prototype A	3	0
Prototype B	3	0

[back to top]

Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP)

SBP and DBP was measured in a supine position after at least 5 minutes of rest for the participant in a quiet setting without any distractions using a completely automated device. Day -1 was considered as Baseline. Change from Baseline was calculated by subtracting Baseline value from the specific time point value. (NCT03921723)
Timeframe: Baseline (Day -1) and Day 4

Intervention	Millimeters of mercury (Mean)
	SBP, Day 4	DBP, Day 4
DTG Reference	7.3	7.8
Prototype A	0.3	-0.7
Prototype B	4.9	1.8

[back to top]

Time of Maximum Observed Concentration (Tmax) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Hours (Median)
Prototype A	1.50
Prototype B	0.50
DTG Reference	0.75

[back to top]

Time of Last Quantifiable Concentration (Tlast) Following Administration of DTG

Intervention	Hours (Median)
Prototype A	48.0000
Prototype B	48.0333
DTG Reference	48.0000

[back to top]

Percentage of AUC(0-inf) Extrapolated (%AUCex) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Percentage of AUCex (Geometric Mean)
Prototype A	6.1049
Prototype B	5.8582
DTG Reference	6.3086

[back to top]

Number of Participants With Clinically Significant Urine Parameters

Urine samples were collected to analyze the following urinalysis parameters: specific gravity, potential of hydrogen (pH). Clinically significant abnormal laboratory findings are those which are not associated with the underlying disease, unless judged by the investigator to be more severe than expected for the participant's condition. (NCT03921723)
Timeframe: Baseline (Day -1)

Intervention	Participants (Count of Participants)
Prototype A	0
Prototype B	0
DTG Reference	0

[back to top]

Number of Participants With Clinically Significant Hematology Parameters

Blood samples were collected to analyze the following hematology parameters: Basophils, Eosinophils, Lymphocytes, Monocytes, Neutrophils, Platelets, hemoglobin, hematocrit, mean corpuscular hemoglobin (MCH), mean corpuscular volume (MCV), percentage reticulocytes and red blood cell count. Data for clinically significant abnormal hematology parameters have been presented. Clinically significant abnormal laboratory findings are those which are not associated with the underlying disease, unless judged by the investigator to be more severe than expected for the participant's condition. (NCT03921723)
Timeframe: Baseline (Day -1)

Intervention	Participants (Count of Participants)
Prototype A	0
Prototype B	0
DTG Reference	0

[back to top]

Number of Participants With Clinically Significant Chemistry Parameters

Blood samples were collected to analyze the following clinical chemistry parameters: Potassium, calcium, sodium, creatinine, glucose, alkaline phosphatase, Aspartate Aminotransferase (AST), Alanine Aminotransferase (ALT), Blood urea nitrogen (BUN), total and direct bilirubin, total protein and creatine kinase. Data for clinically significant abnormal clinical chemistry parameters have been presented. Clinically significant abnormal laboratory findings are those which are not associated with the underlying disease, unless judged by the investigator to be more severe than expected for the participant's condition. (NCT03921723)
Timeframe: Baseline (Day -1)

Intervention	Participants (Count of Participants)
Prototype A	0
Prototype B	0
DTG Reference	0

[back to top]

Maximum Observed Concentration (Cmax) for DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
Prototype A	0.9200
Prototype B	0.9993
DTG Reference	0.8200

[back to top]

Last Quantifiable Concentration (Ct) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose and 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Micrograms per milliliter (Geometric Mean)
Prototype A	0.0398
Prototype B	0.0412
DTG Reference	0.0421

[back to top]

Elimination Half-life (t½) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Hours (Geometric Mean)
Prototype A	13.6389
Prototype B	14.5997
DTG Reference	13.5807

[back to top]

Concentration at 24hours Post-dose (C24) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: 24 hours

Intervention	Micrograms per milliliter (Geometric Mean)
Prototype A	0.1763
Prototype B	0.2167
DTG Reference	0.1917

[back to top]

AUC From Time Zero to Infinity (AUC[0-inf]) for DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
Prototype A	12.8297
Prototype B	14.8099
DTG Reference	13.0715

[back to top]

AUC From Time Zero to 72 Hours (AUC[0-72]) Following Administration of DTG

Intervention	Hours*micrograms per milliliter (Geometric Mean)
Prototype A	12.2645
Prototype B	14.1062
DTG Reference	12.5289

[back to top]

AUC From Time Zero to 24 Hours (AUC[0-24]) Following Administration of DTG

Intervention	Hours*micrograms per milliliter (Geometric Mean)
Prototype A	9.2541
Prototype B	10.2918
DTG Reference	9.2356

[back to top]

Absorption Lag Time (Tlag) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Hours (Median)
Prototype A	0.0
Prototype B	0.0
DTG Reference	0.0

[back to top]

Area Under the Plasma Concentration Time Curve From Time Zero to the Last Quantifiable Time Point (AUC[0-t]) for DTG

Blood samples were collected at indicated time points and pharmacokinetic (PK) analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
Prototype A	11.9968
Prototype B	13.7921
DTG Reference	12.1944

[back to top]

Apparent Oral Volume of Distribution (Vz/F) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters (Geometric Mean)
Prototype A	15.3369
Prototype B	14.2222
DTG Reference	14.9889

[back to top]

Apparent Oral Clearance (CL/F) Following Administration of DTG

Blood samples were collected at indicated time points and PK analysis was performed. PK parameters were determined by non-compartmental methods. (NCT03921723)
Timeframe: Pre-dose, 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,3.5, 4, 5, 6, 8, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Liters per hour (Geometric Mean)
Prototype A	0.7794
Prototype B	0.6752
DTG Reference	0.7650

[back to top]

Apparent Elimination Rate Constant (Lambda z) Following Administration of DTG

Intervention	Per hour (Geometric Mean)
Prototype A	0.0508
Prototype B	0.0475
DTG Reference	0.0510

[back to top]

Change From Baseline in Pulse Rate

Pulse rate was measured in a supine position after at least 5 minutes of rest for the participant in a quiet setting without any distractions using a completely automated device. Day -1 was considered as Baseline. Change from Baseline was calculated by subtracting Baseline value from the specific time point value. (NCT03921723)
Timeframe: Baseline (Day -1) and Day 4

Intervention	Beats per minute (Mean)
Prototype A	6.1
Prototype B	6.8
DTG Reference	4.1

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Chemistry Toxicities Under Treatment With DTG + 3TC FDC

Blood samples were collected up to Week 48 for the analysis of clinical chemistry parameters: alanine aminotransferase (ALT), albumin, aspartate aminotransferase (AST), Alkaline Phosphatase (ALP), bilirubin, carbon dioxide (CO2), creatinine kinase (CK), creatinine, glomerular filtration rate (GFR) from creatinine adjusted for body surface area (BSA), glucose, hypercalcemia, hyperkalemia, hypernatremia, hypocalcemia, hypokalemia, hyponatremia and phosphate. Any abnormality was graded according to DAIDS toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). Higher grade indicates more severity. Only those participants with maximum post-Baseline emergent chemistry toxicities in any of the chemistry parameters have been presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	ALT, Grade 1	ALT, Grade 2	ALT, Grade 3	ALT, Grade 4	Albumin, Grade 1	Albumin, Grade 2	Albumin, Grade 3	Albumin, Grade 4	AST, Grade 1	AST, Grade 2	AST, Grade 3	AST, Grade 4	Bilirubin, Grade 1	Bilirubin, Grade 2	Bilirubin, Grade 3	Bilirubin, Grade 4	CO2, Grade 1	CO2, Grade 2	CO2, Grade 3	CO2, Grade 4	CK, Grade 1	CK, Grade 2	CK, Grade 3	CK, Grade 4	Creatinine, Grade 1	Creatinine, Grade 2	Creatinine, Grade 3	Creatinine, Grade 4	GFR from creatinine adjusted for BSA,Grade 1	GFR from creatinine adjusted for BSA,Grade 2	GFR from creatinine adjusted for BSA,Grade 3	GFR from creatinine adjusted for BSA,Grade 4	Glucose, Grade 1	Glucose, Grade 2	Glucose, Grade 3	Glucose, Grade 4	Hypercalcaemia, Grade 1	Hypercalcaemia, Grade 2	Hypercalcaemia, Grade 3	Hypercalcaemia, Grade 4	Hyperkalemia, Grade 1	Hyperkalemia, Grade 2	Hyperkalemia, Grade 3	Hyperkalemia, Grade 4	Hypernatremia, Grade 1	Hypernatremia, Grade 2	Hypernatremia, Grade 3	Hypernatremia, Grade 4	Hypokalemia, Grade 1	Hypokalemia, Grade 2	Hypokalemia, Grade 3	Hypokalemia, Grade 4	Hyponatremia, Grade 1	Hyponatremia, Grade 2	Hyponatremia, Grade 3	Hyponatremia, Grade 4	Phosphate, Grade 1	Phosphate, Grade 2	Phosphate, Grade 3	Phosphate, Grade 4	Hypocalcaemia, Grade 1	Hypocalcaemia, Grade 2	Hypocalcaemia, Grade 3	Hypocalcaemia, Grade 4	ALP, Grade 1	ALP, Grade 2	ALP, Grade 3	ALP, Grade 4
DTG Plus 3TC	7	2	0	1	0	1	0	0	6	1	1	1	5	0	1	0	20	0	0	0	0	1	0	0	9	1	2	0	0	38	8	1	27	14	2	0	5	0	0	0	0	1	0	0	2	0	0	0	1	0	0	0	9	0	0	0	8	0	0	0	5	1	0	0	1	0	0	0

[back to top]

Number of Participants With Any Serious Adverse Events (SAEs) and Any Common (>=2%) Non-serious Adverse Events (Non-SAEs) Under Treatment With DTG + 3TC FDC

An adverse event is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. An SAE is defined as any untoward medical occurrence that; results in death, is life-threatening, requires hospitalization or prolongation of existing hospitalization, results in disability/incapacity, is a congenital anomaly/birth defect, other situations as judged by physician. Number of participants with any SAE and common (>=2%) non-SAEs are presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Any non-SAE	Any SAE
DTG Plus 3TC	85	2

[back to top]

Number of Participants Who Completed 24 and 48 Weeks on Study

Number of participants who completed 24 and 48 weeks on study are presented. (NCT03945981)
Timeframe: Week 24 and Week 48

Intervention	Participants (Count of Participants)
	Week 24	Week 48
DTG Plus 3TC	115	112

[back to top]

Number of Participants Who Changed First Line Regimen of DTG + 3TC FDC Due to Baseline Laboratory Results or HIV-1 Resistance Mutation Results

Number of participants who switched from first line regimen of DTG + 3TC FDC due to abnormal Baseline laboratory values or Baseline HIV-1 resistance mutation results are presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Switched due to abnormal Baseline laboratory results (HBV Infection)	Switched due to HIV-1 resistance mutation results
DTG Plus 3TC	5	1

[back to top]

Change From Baseline in Cluster of Differentiation (CD4+) Cell Counts for Participants Under Treatment With DTG + 3TC FDC

CD4+ cells are type of white blood cells that fight infection and as HIV infection progresses, the number of these cells decline. Blood samples were collected at specified time points to assess CD4+. It was evaluated by flow cytometry. Baseline value is defined as the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03945981)
Timeframe: Baseline (Day 1) and Week 24 and Week 48

Intervention	Cells per cubic millimeter (Mean)
	Week 24, n=106	Week 48, n=103
DTG Plus 3TC	185.9	273.4

[back to top]

Change From Baseline in CD4+/CD8+ Cell Count Ratio for Participants Under Treatment With DTG + 3TC FDC

Blood samples were collected at specified time points to assess CD4+/CD8+ cell count ratio. It was assessed by flow cyclometry to evaluate the immunologic activity of DTG plus 3TC. Baseline value is defined as the latest pre-dose assessment (Day 1). Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03945981)
Timeframe: Baseline (Day 1) and Week 24 and Week 48

Intervention	Ratio (Mean)
	Week 24, n= 106	Week 48, n=102
DTG Plus 3TC	0.30	0.39

[back to top]

Time to Viral Suppression (HIV-1 RNA<50 c/mL) for Participants Who Had HIV-1 RNA >= 50 c/mL at Baseline

Time of viral suppression for participants who had HIV-1 RNA >= 50 c/mL at Baseline is defined as the time to first viral load value < 50 c/mL, irrespective of the ART regimen a participant was on when that occurred. Non parametric Kaplan-Meier method was used. Participants who withdrew for any reason without being suppressed were censored at date of withdrawal. Participants who have not been withdrawn and have not had viral suppression at time of the analysis were censored at last viral load date. Median time (i.e. time when 50% of participants have reached HIV-1 RNA < 50 c/mL) along with 95% CI is presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Days (Median)
DTG Plus 3TC	35

[back to top]

Percentage of Participants With Plasma Human Immunodeficiency Virus Type 1 (HIV-1) Ribonucleic Acid (RNA) <50 Copies/Milliliter (c/mL) Regardless of Antiretroviral Therapy (ART) Regimen at Week 24 by ITT-E Missing = Failure Analysis

"Participants were classified as HIV-1 RNA <50 c/mL using an ITT-E missing = Failure analysis. Participants were classified as 'HIV-1 RNA < 50 c/mL' if the last viral load within the Week 24 visit window was <50/c/mL, regardless of the ART regimen they were on at the time of viral load assessment (in other words switch from DTG plus 3TC fixed-dose combination [FDC] to another ART was not penalized) and as HIV-1 RNA >= 50 c/mL in all other cases (i.e. last viral load within Week 24 visit window >= 50 c/mL, on study but having missing viral load data at Week 24, discontinued early from study due to lost to follow-up (LFU), withdrew consent or any other reason). Confidence intervals (CI) were calculated based on the Exact Clopper-Pearson method. Percentage of participants with plasma HIV-1 RNA < 50 c/mL based on ITT-E missing = Failure analysis at Week 24 are presented." (NCT03945981)
Timeframe: At Week 24

Intervention	Percentage of Participants (Number)
DTG Plus 3TC	78

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL Regardless of ART Regimen at Week 48 by ITT-E Missing = Failure Analysis

"Participants were classified as HIV-1 RNA <50 c/mL using an ITT-E Missing = Failure analysis. Participants were classified as 'HIV-1 RNA < 50 c/mL' if the last viral load within the Week 48 visit window was <50/c/mL, regardless of the ART regimen they were on at the time of viral load assessment (in other words switch from DTG plus 3TC FDC to another ART was not penalized) and as HIV-1 RNA >= 50 c/mL in all other cases (i.e. last viral load within Week 48 visit window >= 50 c/mL, on study but having missing viral load data at Week 48, discontinued early from study due to LFU, withdrew consent or any other reason). CI were calculated based on the Exact Clopper-Pearson method. Percentage of participants with plasma HIV-1 RNA < 50 c/mL based on ITT-E missing = Failure analysis at Week 48 are presented." (NCT03945981)
Timeframe: At Week 48

Intervention	Percentage of Participants (Number)
DTG Plus 3TC	82

[back to top]

Number of Participants With Treatment-emergent Phenotypic Resistance

Blood samples were collected for drug resistance testing post-Baseline when Confirmed Virologic Failure criteria were met or in other occasion as needed (e.g. at time of study withdrawal when HIV-1 RNA >= 400 c/mL). Assessment of antiviral activity of ART using phenotypic test results was interpreted through a proprietary algorithm (from Monogram Biosciences) and provides the overall susceptibility of the drug. Number of participants with phenotypic resistance to DTG and/or 3TC or any other ART (if treatment is modified) taken during the study in participants with post-Baseline phenotypic resistance data up to Week 48 have been presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
DTG Plus 3TC	0

[back to top]

Number of Participants With HIV-1 Disease Progression to Stage 3 HIV-associated Conditions, Acquired Immunodeficiency Syndrome (AIDS) or Death (for Participants Under Treatment With DTG + 3TC FDC)

HIV-associated conditions were recorded during the study and was assessed according to the 2014 Centers for Disease Control and Prevention (CDC) Classification System for HIV Infection in Adults. CDC classification for HIV were stage 1, 2 and 3. Higher stage indicates more severity. Disease progression summarize participants who had HIV infection stage 3 associated conditions, AIDS and/or death. Number of participants with HIV-1 disease progression to stage 3 HIV-associated conditions, AIDS or death are presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
DTG Plus 3TC	1

[back to top]

Number of Participants With Treatment-emergent Genotypic Resistance

Blood samples were collected for genotypic resistance testing post-Baseline when Confirmed Virologic Failure criteria were met or in other occasion as needed (e.g. at time of study withdrawal when HIV-1 RNA >= 400 c/mL). New mutations were tabulated by drug class: integrase strand transfer inhibitor (INSTI), non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor (NRTI) and protease inhibitor (PI). Number of participants with treatment-emergent resistance associated mutations to any class (INSTI, NNRTI, NRTI, PI) from post-Baseline genotypic resistance data up to Week 48 have been presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	NNRTI	INSTI	NRTI	PI
DTG Plus 3TC	0	0	0	0

[back to top]

Number of Participants Retained in Care for 24 and 48 Weeks on Study and Have HIV-1 RNA <200 c/mL

Number of participants retained in care for 24 and 48 weeks on study and have HIV-1 RNA <200 c/mL have been presented. (NCT03945981)
Timeframe: Week 24 and Week 48

Intervention	Participants (Count of Participants)
	Week 24	Week 48
DTG Plus 3TC	110	109

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL Using Food and Drug Administration (FDA) Snapshot Algorithm

Percentage of participants with HIV-1 RNA<50 c/mL was obtained using FDA Snapshot algorithm. The Snapshot algorithm treated all participants without HIV-1 RNA data at the visit of interest (either due to missing plasma HIV-1 RNA assessment but on study, or due to permanent discontinuation of study treatment prior to visit window) as virologic non-success, as well as participants who switched from first line regimen of DTG + 3TC FDC for any reason prior to the visit of interest. Confidence intervals were calculated based on the Exact Clopper-Pearson method. Percentage of participants with plasma HIV-1 RNA <50 c/mL obtained using FDA Snapshot algorithm are presented. (NCT03945981)
Timeframe: At Week 24 and Week 48

Intervention	Percentage of Participants (Number)
	Week 24	Week 48
DTG Plus 3TC	74	76

[back to top]

Percentage of Participants With HIV-1 RNA < 50 c/mL at Weeks 24 and 48 Among Participants With Available HIV-1 RNA Assessment Regardless of ART

Participants with at least one viral load assessment within Week 24 and 48 visit window have been considered. Participants who discontinued from study prior to Week 24 and Week 48 or who were still on study at Week 24 and Week 48 but with missing viral load assessment have been excluded. Viral load assessments performed under DTG + 3TC FDC treatment or under any Modified ART treatment at Week 24 and Week 48 have been considered. Percentage of participants with HIV-1 RNA < 50 c/mL at Weeks 24 and 48 among participants with available HIV-1 RNA assessment regardless of ART have been presented. (NCT03945981)
Timeframe: At Week 24 and Week 48

Intervention	Percentage of Participants (Number)
	Week 24, n=111	Week 48, n=110
DTG Plus 3TC	92	97

[back to top]

Number of Participants With Maximum Post-Baseline Emergent Hematology Toxicities Under Treatment With DTG + 3TC FDC

Blood samples were collected up to Week 48 visit for the analysis of hematology parameters-platelet count, neutrophils, hemoglobin and leukocytes Any abnormality was graded according to Division of Acquired Immunodeficiency Syndrome (DAIDS) toxicity scales from Grade 1 to 4 (1=Mild, 2=Moderate, 3=Severe, 4=Potentially life threatening). Higher grade indicates more severity. Only those participants with maximum post-Baseline emergent hematology toxicities in any of the hematology parameters have been presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
	Hemoglobin, Grade 1	Hemoglobin, Grade 2	Hemoglobin, Grade 3	Hemoglobin, Grade 4	Leukocytes, Grade 1	Leukocytes, Grade 2	Leukocytes, Grade 3	Leukocytes, Grade 4	Neutrophils, Grade 1	Neutrophils, Grade 2	Neutrophils, Grade 3	Neutrophils, Grade 4	Platelets, Grade 1	Platelets, Grade 2	Platelets, Grade 3	Platelets, Grade 4
DTG Plus 3TC	5	1	0	0	5	2	1	0	4	4	2	1	1	1	0	0

[back to top]

Number of Participants Who Discontinued the Study Treatment (DTG+3TC FDC) Due to AEs

An adverse event is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Number of participants who discontinued the study treatment (DTG plus 3TC) due to AEs are presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
DTG Plus 3TC	1

[back to top]

Number of Participants Who Discontinued the Study Treatment (DTG+3TC FDC) Due to Drug-related AEs

An adverse event is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product. Number of participants who discontinued the study treatment (DTG+3TC FDC) due to drug-related AEs are presented. (NCT03945981)
Timeframe: Up to Week 48

Intervention	Participants (Count of Participants)
DTG Plus 3TC	1

[back to top]

Apparent Elimination Rate Constant (Lambda z) of DTG

Blood samples were collected at indicated time-points for analysis of lambda z of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Per hour (Mean)
DTG/RPV 50mg/25mg FDC	0.0405

[back to top]

Apparent Oral Clearance (CL/F) of DTG

Blood samples were collected at indicated time-points for analysis of CL/F of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Liters per hour (Geometric Mean)
DTG/RPV 50mg/25mg FDC	0.5498

[back to top]

Apparent Oral Volume of Distribution (Vz/F) of DTG

Blood samples were collected at indicated time-points for analysis of Vz/F of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Liters (Mean)
DTG/RPV 50mg/25mg FDC	14.0079

[back to top]

Area Under the Concentration (AUC) Time Curve From Time Zero Extrapolated to Infinite Time (AUC [0-infinity]) of DTG

Blood samples were collected at indicated time-points for analysis of AUC (0-infinity) of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	90.9402

[back to top]

Area Under the Concentration Time Curve From Time Zero to Last Time of Quantifiable Concentration (AUC [0-t]) of DTG

Blood samples were collected at indicated time-points for analysis of AUC (0-t) of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	89.1993

[back to top]

Area Under the Plasma Concentration Time Curve From Time Zero to 24 Hours (AUC[0-24]) of DTG

Blood samples were collected at indicated time-points for analysis of AUC(0-24) of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, and 24 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	54.9466

[back to top]

Area Under the Plasma Concentration Time Curve From Time Zero to 72 Hours (AUC[0-72]) of DTG

Blood samples were collected at indicated time-points for analysis of AUC(0-72) of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, and 72 hours post-dose

Intervention	Hours*micrograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	85.3534

[back to top]

AUC (0-24) of RPV

Blood samples were collected at indicated time-points for analysis of AUC (0-24) of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, and 24 hours post-dose

Intervention	Hours*nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	1420.2525

[back to top]

AUC (0-72) of RPV

Blood samples were collected at indicated time-points for analysis of AUC (0-72) of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48 and 72 hours post-dose

Intervention	Hours*nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	2886.6035

[back to top]

AUC (0-infinity) of RPV

Blood samples were collected at indicated time-points for analysis of AUC (0-infinity) of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Hours*nanogram per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	4027.9415

[back to top]

AUC (0-t) of RPV

Blood samples were collected at indicated time-points for analysis of AUC (0-t) of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Hours*nanogram per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	3920.9404

[back to top]

C24 of RPV

Blood samples were collected at indicated time-points for analysis of C24 of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: At 24 hours post-dose

Intervention	Nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	43.35

[back to top]

Change From Baseline in Body Temperature

Body temperature were assessed at indicated time-points. Day 1 (Pre-dose) was defined as Baseline. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day 1, Pre-dose) and at Day 12

Intervention	Degree Celsius (Mean)
DTG/RPV 50mg/25mg FDC	0.06

[back to top]

Change From Baseline in Erythrocytes

Blood samples were collected at indicated timepoints for analysis of hematology parameter like erythrocytes. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Trillion cells per liter (Mean)
DTG/RPV 50mg/25mg FDC	0.358

[back to top]

Change From Baseline in Hematocrit Level

Blood samples were collected at indicated timepoints for analysis of hematology parameter like hematocrit. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Proportion of red blood cells in blood (Mean)
DTG/RPV 50mg/25mg FDC	0.0308

[back to top]

Change From Baseline in Hemoglobin Level

Blood samples were collected at indicated timepoints for analysis of hematology parameter like hemoglobin. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Grams per liter (Mean)
DTG/RPV 50mg/25mg FDC	10.1

[back to top]

Change From Baseline in Mean Corpuscular Hemoglobin (MCH)

Blood samples were collected at indicated timepoints for analysis of hematology parameter like MCH. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Picograms (Mean)
DTG/RPV 50mg/25mg FDC	-0.10

[back to top]

Change From Baseline in Mean Corpuscular Volume (MCV)

Blood samples were collected at indicated timepoints for analysis of hematology parameter like MCV. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Femtoliters (Mean)
DTG/RPV 50mg/25mg FDC	-0.43

[back to top]

Change From Baseline in Pulse Rate

Pulse rate was assessed in the supine position with a completely automated device. Day 1 (Pre-dose) was defined as Baseline. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day 1, Pre-dose) and at Day 12

Intervention	Beats per minute (Mean)
DTG/RPV 50mg/25mg FDC	8.7

[back to top]

Change From Baseline in Reticulocytes

Blood samples were collected at indicated timepoints for analysis of hematology parameter like reticulocytes. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Percentage of reticulocytes (Mean)
DTG/RPV 50mg/25mg FDC	0.13

[back to top]

CL/F of RPV

Blood samples were collected at indicated time-points for analysis of CL/F of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, 264 hours post-dose

Intervention	Liters per hour (Geometric Mean)
DTG/RPV 50mg/25mg FDC	6.2066

[back to top]

Cmax of RPV

Blood samples were collected at indicated time-points for analysis of Cmax of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Nanogram per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	136.10

[back to top]

Concentration at 24-hour Post-dose (C24) of DTG

Blood samples were collected at indicated time-points for analysis of C24 of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: At 24 hours post-dose

Intervention	Nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	1453.6

[back to top]

Elimination Half-life (t1/2) of DTG

Blood samples were collected at indicated time-points for analysis of t1/2 of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Hours (Geometric Mean)
DTG/RPV 50mg/25mg FDC	17.3135

[back to top]

Lambda z of RPV

Blood samples were collected at indicated time-points for analysis of lambda z of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Per hour (Mean)
DTG/RPV 50mg/25mg FDC	0.0196

[back to top]

Last Quantifiable Concentration (Ct) of DTG

Blood samples were collected at indicated time-points for analysis of Ct of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	54.59

[back to top]

Maximum Observed Plasma Concentration (Cmax) of DTG

Blood samples were collected at indicated time-points for analysis of Cmax of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	4108.5

[back to top]

Percentage AUCex of RPV

Blood samples were collected at indicated time-points for analysis of percentage AUCex of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Percentage of AUCex (Mean)
DTG/RPV 50mg/25mg FDC	2.6501

[back to top]

Percentage of AUC(0-infinity) That Was Extrapolated (%AUCex) of DTG

Blood samples were collected at indicated time-points for analysis of percentage AUCex of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Percentage of AUCex (Mean)
DTG/RPV 50mg/25mg FDC	1.9065

[back to top]

T1/2 of RPV

Blood samples were collected at indicated time-points for analysis of t1/2 of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Hours (Geometric Mean)
DTG/RPV 50mg/25mg FDC	37.2571

[back to top]

Time of Last Quantifiable Concentration (Tlast) of DTG

Blood samples were collected at indicated time-points for analysis of tlast of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Hours (Median)
DTG/RPV 50mg/25mg FDC	120.0854

[back to top]

Time to Reach Maximum Observed Concentration (Tmax) of DTG

Blood samples were collected at indicated time-points for analysis of tmax of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Hours (Median)
DTG/RPV 50mg/25mg FDC	3.0085

[back to top]

Tlag of RPV

Blood samples were collected at indicated time-points for analysis of tlag of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Hours (Median)
DTG/RPV 50mg/25mg FDC	0.5

[back to top]

Tlast of RPV

Blood samples were collected at indicated time-points for analysis of tlast of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Hours (Median)
DTG/RPV 50mg/25mg FDC	214.5819

[back to top]

Tmax of RPV

Blood samples were collected at indicated time-points for analysis of tmax of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Hours (Median)
DTG/RPV 50mg/25mg FDC	4.4976

[back to top]

Vz/F of RPV

Blood samples were collected at indicated time-points for analysis of Vz/F of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Liters (Mean)
DTG/RPV 50mg/25mg FDC	347.3276

[back to top]

Absolute Values of AST, ALT and ALP Levels

Blood samples were collected at indicated time-points for analysis of clinical chemistry parameters like AST, ALT and ALP levels. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	International units per Liter (Mean)
	ALT, Baseline (Day -1)	ALT, Day 3	AST, Baseline (Day -1)	AST, Day 3	ALP, Baseline (Day -1)	ALP, Day 3
DTG/RPV 50mg/25mg FDC	19.4	22.6	17.9	18.5	52.3	53.1

[back to top]

Absolute Values of Body Temperature

Body temperature were assessed at indicated time-points. Day 1 (Pre-dose) was defined as Baseline. (NCT03984838)
Timeframe: Baseline (Day 1, Pre-dose) and at Day 12

Intervention	Degree Celsius (Mean)
	Day 1, Pre-dose	Day 12
DTG/RPV 50mg/25mg FDC	36.16	36.21

[back to top]

Absolute Values of BUN, Glucose, Calcium, Sodium, and Potassium Levels

Blood samples were collected at indicated time-points for analysis of clinical chemistry parameters like (BUN), glucose, sodium, calcium, and potassium levels. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Millimoles per Liter (Mean)
	Calcium, Baseline (Day -1)	Calcium, Day 3	Glucose, Baseline (Day -1)	Glucose, Day 3	Potassium, Baseline (Day -1)	Potassium, Day 3	Sodium, Baseline (Day -1)	Sodium, Day 3	BUN, Baseline (Day -1)	BUN, Day 3
DTG/RPV 50mg/25mg FDC	2.3079	2.3562	5.5163	5.3255	4.18	4.19	137.1	139.8	4.1948	4.4848

[back to top]

Absolute Values of Erythrocytes

Blood samples were collected at indicated timepoints for analysis of hematology parameter like erythrocytes. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Trillion cells per liter (Mean)
	Baseline (Day -1)	Day 3
DTG/RPV 50mg/25mg FDC	4.688	5.046

[back to top]

Absolute Values of Hematocrit Level

Blood samples were collected at indicated timepoints for analysis of hematology parameter like hematocrit. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Proportion of red blood cells in blood (Mean)
	Baseline (Day -1)	Day 3
DTG/RPV 50mg/25mg FDC	0.4248	0.4556

[back to top]

Absolute Values of Hemoglobin Level

Blood samples were collected at indicated timepoints for analysis of hematology parameter like hemoglobin. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Grams per liter (Mean)
	Baseline (Day -1)	Day 3
DTG/RPV 50mg/25mg FDC	140.9	151.0

[back to top]

Absolute Values of MCH

Blood samples were collected at indicated timepoints for analysis of hematology parameter like MCH. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Picograms (Mean)
	Baseline (Day -1)	Day 3
DTG/RPV 50mg/25mg FDC	30.04	29.94

[back to top]

Absolute Values of MCV

Blood samples were collected at indicated timepoints for analysis of hematology parameter like MCV. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Femtoliters (Mean)
	Baseline (Day -1)	Day 3
DTG/RPV 50mg/25mg FDC	90.87	90.44

[back to top]

Absolute Values of Neutrophil, Lymphocyte, Leukocyte, Monocyte, Eosinophil, Basophil and Platelet Count

Blood samples were collected at indicated time-points for analysis of hematology parameters like platelet count, neutrophils, lymphocytes, monocytes, leukocyte, eosinophils and basophils. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Giga cells per liter (Mean)
	Basophils, Baseline (Day -1)	Basophils, Day 3	Eosinophils, Baseline (Day -1)	Eosinophils, Day 3	Leukocytes, Baseline (Day -1)	Leukocytes, Day 3	Lymphocytes, Baseline (Day -1)	Lymphocytes, Day 3	Monocytes, Baseline (Day -1)	Monocytes, Day 3	Platelets, Baseline (Day -1)	Platelets, Day 3	Neutrophils, Baseline (Day -1)	Neutrophils, Day 3
DTG/RPV 50mg/25mg FDC	0.04	0.01	0.20	0.16	5.76	5.59	1.84	1.82	0.45	0.41	233.3	238.6	3.21	3.16

[back to top]

Absolute Values of Pulse Rate

Pulse rate was assessed in the supine position with a completely automated device. Day 1 (Pre-dose) was defined as Baseline. (NCT03984838)
Timeframe: Baseline (Day 1, Pre-dose) and at Day 12

Intervention	Beats per minute (Mean)
	Day 1, Pre-dose	Day 12
DTG/RPV 50mg/25mg FDC	58.0	66.7

[back to top]

Absolute Values of Reticulocytes

Blood samples were collected at indicated timepoints for analysis of hematology parameter like reticulocytes. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Percentage of reticulocytes (Mean)
	Baseline (Day -1)	Day 3
DTG/RPV 50mg/25mg FDC	1.47	1.59

[back to top]

Absolute Values of SBP and DBP

SBP and DBP were assessed in the supine position with a completely automated device. Day 1 (Pre-dose) was defined as Baseline. (NCT03984838)
Timeframe: Baseline (Day 1, Pre-dose) and at Day 12

Intervention	Millimeters of mercury (Mean)
	SBP, Day 1, Pre-dose	SBP, Day 12	DBP, Day 1, Pre-dose	DBP, Day 12
DTG/RPV 50mg/25mg FDC	107.0	113.2	70.1	71.7

[back to top]

Absolute Values of Total and Direct Bilirubin, Creatinine and Protein Levels

Blood samples were collected at indicated time-points for analysis of clinical chemistry parameters like total and direct bilirubin, creatinine and protein levels. Baseline was defined as Day -1. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Micromoles per liter (Mean)
	Total bilirubin, Baseline (Day -1)	Total bilirubin, Day 3	Direct bilirubin, Baseline (Day -1)	Direct bilirubin, Day 3	Creatinine, Baseline (Day -1)	Creatinine, Day 3	Protein, Baseline (Day -1)	Protein, Day 3
DTG/RPV 50mg/25mg FDC	11.008	14.963	2.565	2.993	80.3335	83.0408	66.6	70.8

[back to top]

Change From Baseline in Aspartate Aminotransferase (AST), Alanine Aminotransferase (ALT) and Alkaline Phosphatase (ALP) Levels

Blood samples were collected at indicated time-points for analysis of clinical chemistry parameters like AST, ALT and ALP levels. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	International units per Liter (Mean)
	ALT	AST	ALP
DTG/RPV 50mg/25mg FDC	3.2	0.6	0.9

[back to top]

Change From Baseline in Blood Urea Nitrogen (BUN), Glucose, Calcium, Sodium, and Potassium Levels

Blood samples were collected at indicated time-points for analysis of clinical chemistry parameters like (BUN), glucose, sodium, calcium, and potassium levels. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Millimoles per Liter (Mean)
	Calcium	Glucose	Potassium	Sodium	BUN
DTG/RPV 50mg/25mg FDC	0.0483	-0.1908	0.02	2.8	0.2901

[back to top]

Change From Baseline in Neutrophil, Lymphocyte, Leukocyte, Monocyte, Eosinophil, Basophil and Platelet Count

Blood samples were collected at indicated time-points for analysis of hematology parameters like platelet count, neutrophils, lymphocytes, leukocyte, monocytes, eosinophils and basophils. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Giga cells per liter (Mean)
	Basophils	Eosinophils	Leukocytes	Lymphocytes	Monocytes	Platelets	Neutrophils
DTG/RPV 50mg/25mg FDC	-0.03	-0.04	-0.16	-0.03	-0.04	5.4	-0.06

[back to top]

Change From Baseline in Systolic Blood Pressure (SBP) and Diastolic Blood Pressure (DBP)

SBP and DBP were assessed in the supine position with a completely automated device. Day 1 (Pre-dose) was defined as Baseline. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day 1, Pre-dose) and at Day 12

Intervention	Millimeters of mercury (Mean)
	SBP	DBP
DTG/RPV 50mg/25mg FDC	6.2	1.6

[back to top]

Change From Baseline in Total and Direct Bilirubin, Creatinine and Protein Levels

Blood samples were collected at indicated time-points for analysis of clinical chemistry parameters like total and direct bilirubin, creatinine and protein levels. Baseline was defined as Day -1. Change from Baseline was defined as post-dose visit value minus Baseline value. (NCT03984838)
Timeframe: Baseline (Day -1) and Day 3

Intervention	Micromoles per liter (Mean)
	Total bilirubin	Direct bilirubin	Creatinine	Protein
DTG/RPV 50mg/25mg FDC	3.954	0.428	2.7072	4.2

[back to top]

Number of Participants With Adverse Events (AE) and Serious Adverse Events (SAE)

An AE is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a study intervention, whether or not considered related to the study intervention. A SAE is defined as any untoward medical occurrence that, at any dose: results in death and is life-threatening; which requires in-patient hospitalization or prolongation of existing hospitalization, results in persistent disability or incapacity and birth defect or congenital anomaly, or any other situation that require medical or scientific judgment. (NCT03984838)
Timeframe: Up to Day 18

Intervention	Participants (Count of Participants)
	AE	SAE
DTG/RPV 50mg/25mg FDC	2	0

[back to top]

Ct of RPV

Blood samples were collected at indicated time-points for analysis of Ct of RPV. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, 120, 168, 216, and 264 hours post-dose

Intervention	Nanograms per milliliter (Geometric Mean)
DTG/RPV 50mg/25mg FDC	1.836

[back to top]

Absorption Lag Time (Tlag) of DTG

Blood samples were collected at indicated time-points for analysis of tlag of DTG. PK parameters were calculated by standard non-compartmental analysis. (NCT03984838)
Timeframe: Pre-dose, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, 12, 16, 24, 48, 72, and 120 hours post-dose

Intervention	Hours (Median)
DTG/RPV 50mg/25mg FDC	0.0

[back to top]

Part 2: Maximum Plasma Concentration (Cmax) of S-648414 Following Single and Multiple-dose Administration

(NCT04147715)
Timeframe: Day 1 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose; Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72, and 96 hours postdose.

Intervention	ng/mL (Geometric Mean)
	Day 1	Day 14
Part 2: 30 mg S-648414 + Midazolam	411	719
Part 2: 50 mg S-648414 + Midazolam	623	1320

[back to top]

Part 2: Area Under the Concentration-time Curve From Time Zero to the Last Quantifiable Concentration After Dosing (AUC0-last) for Midazolam

"The effect of S-648414 on the PK of midazolam (a cytochrome P450 3A [CYP3A] substrate) was assessed in Part 2 following 5 mg midazolam administration alone (Day -2) and co-administration with S-648414 30 or 50 mg (Day 14).~Area under the concentration-time curve from time zero to the time of the last quantifiable concentration after dosing, calculated by linear up/log down trapezoidal method." (NCT04147715)
Timeframe: Day -2 and Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
Part 2: Midazolam (30 mg S-648414 Group)	70.17
Part 2: 30 mg S-648414 + Midazolam	59.83
Part 2: Midazolam (50 mg S-648414 Group)	73.28
Part 2: 50 mg S-648414 + Midazolam	64.53

[back to top]

Part 2: Terminal Elimination Rate Constant (λz) of S-648414 Following Multiple-dose Administration

Terminal elimination rate constant, where λz is the magnitude of the slope of the linear regression of the log concentration versus time profile during the terminal phase on Day 14. (NCT04147715)
Timeframe: Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72, and 96 hours postdose.

Intervention	1/hours (Geometric Mean)
Part 2: 30 mg S-648414 + Midazolam	0.0321
Part 2: 50 mg S-648414 + Midazolam	0.0292

[back to top]

Part 2: Terminal Elimination Half-life for Midazolam

The effect of S-648414 on the PK of midazolam (a cytochrome P450 3A [CYP3A] substrate) was assessed in Part 2 following 5 mg midazolam administration alone (Day -2) and co-administration with S-648414 30 or 50 mg (Day 14). (NCT04147715)
Timeframe: Day -2 and Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	hours (Geometric Mean)
Part 2: Midazolam (30 mg S-648414 Group)	5.07
Part 2: 30 mg S-648414 + Midazolam	4.64
Part 2: Midazolam (50 mg S-648414 Group)	4.41
Part 2: 50 mg S-648414 + Midazolam	4.54

[back to top]

Part 2: Terminal Elimination Half-life (t1/2,z) of S-648414 Following Multiple-dose Administration

Terminal elimination half-life, where t1/2,z = (ln2)/λz on Day 14. (NCT04147715)
Timeframe: Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72, and 96 hours postdose.

Intervention	hours (Geometric Mean)
Part 2: 30 mg S-648414 + Midazolam	21.6
Part 2: 50 mg S-648414 + Midazolam	23.7

[back to top]

Part 2: Renal Clearance (CLR) of S-648414 Following Multiple-dose Administration

Renal clearance on Day 14, calculated as CLR = Aeu0-τ/AUC0-τ, where Aeu0-τ is the amount of drug excreted in urine over the dosing interval τ (24 hours) (NCT04147715)
Timeframe: Day 14 0-24 hours postdose

Intervention	L/hr (Geometric Mean)
Part 2: 30 mg S-648414 + Midazolam	0.948
Part 2: 50 mg S-648414 + Midazolam	0.952

[back to top]

Part 2: Mean Residence Time for Midazolam

"The effect of S-648414 on the PK of midazolam (a cytochrome P450 3A [CYP3A] substrate) was assessed in Part 2 following 5 mg midazolam administration alone (Day -2) and co-administration with S-648414 30 or 50 mg (Day 14).~Mean residence time was calculated as MRT = AUMC0-inf/AUC0-inf where AUMC0-inf is the area under the first moment curve extrapolated to infinity." (NCT04147715)
Timeframe: Day -2 and Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	hours (Geometric Mean)
Part 2: Midazolam (30 mg S-648414 Group)	5.30
Part 2: 30 mg S-648414 + Midazolam	4.44
Part 2: Midazolam (50 mg S-648414 Group)	4.93
Part 2: 50 mg S-648414 + Midazolam	4.40

[back to top]

Part 2: Maximum Plasma Concentration (Cmax) of Midazolam

Intervention	ng/mL (Geometric Mean)
Part 2: Midazolam (30 mg S-648414 Group)	18.0
Part 2: 30 mg S-648414 + Midazolam	16.8
Part 2: Midazolam (50 mg S-648414 Group)	19.5
Part 2: 50 mg S-648414 + Midazolam	19.3

[back to top]

Part 2: Fraction of S-648414 Dose Excreted in Urine Over the Dosing Interval (Feu0- τ) Following Multiple-dose Administration

Fraction of dose excreted in urine over the dosing interval τ (24 hours) on Day 14 calculated as Aeu0-τ/Dose × 100, where Aeu0-τ is the amount of drug excreted in urine over the dosing interval τ (24 hours). (NCT04147715)
Timeframe: Day 14 0-24 hours postdose

Intervention	percent excreted (Geometric Mean)
Part 2: 30 mg S-648414 + Midazolam	33.3
Part 2: 50 mg S-648414 + Midazolam	35.0

[back to top]

Part 2: Area Under the Concentration-time Curve From Time Zero to Infinity (AUC0-inf) of Midazolam

"The effect of S-648414 on the PK of midazolam (a cytochrome P450 3A [CYP3A] substrate) was assessed in Part 2 following 5 mg midazolam administration alone (Day -2) and co-administration with S-648414 30 or 50 mg (Day 14).~Area under the concentration-time curve extrapolated from time zero to infinity defined as AUC0-last + (Clast/λz), where Clast is the last measurable plasma concentration and λz is the plasma terminal elimination rate constant." (NCT04147715)
Timeframe: Day -2 and Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
Part 2: Midazolam (30 mg S-648414 Group)	72.81
Part 2: 30 mg S-648414 + Midazolam	61.68
Part 2: Midazolam (50 mg S-648414 Group)	76.03
Part 2: 50 mg S-648414 + Midazolam	67.02

[back to top]

Part 2: Terminal Elimination Rate Constant for Midazolam

Intervention	1/hour (Geometric Mean)
Part 2: Midazolam (30 mg S-648414 Group)	0.1366
Part 2: 30 mg S-648414 + Midazolam	0.1494
Part 2: Midazolam (50 mg S-648414 Group)	0.1570
Part 2: 50 mg S-648414 + Midazolam	0.1528

[back to top]

Part 2: Apparent Volume of Distribution in the Terminal Elimination Phase (Vz/F) of S-648414 Following Multiple-dose Administration

Apparent volume of distribution in the terminal elimination phase on Day 14, estimated according to: Vz /F = Dose/AUC0-τ/λz (NCT04147715)
Timeframe: Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72, and 96 hours postdose.

Intervention	liters (Geometric Mean)
Part 2: 30 mg S-648414 + Midazolam	88.7
Part 2: 50 mg S-648414 + Midazolam	93.0

[back to top]

Part 2: Apparent Total Clearance (CL/F) of S-648414 Following Multiple-dose Administration

Apparent total clearance estimated according to: CL/F = Dose/AUC0-τ on Day 14 (NCT04147715)
Timeframe: Day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	L/hr (Geometric Mean)
Part 2: 30 mg S-648414 + Midazolam	2.85
Part 2: 50 mg S-648414 + Midazolam	2.72

[back to top]

Part 1: Time to Maximum Plasma Concentration (Tmax) of S-648414

(NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	hours (Median)
Part 1: 10 mg S-648414	1.00
Part 1: 30 mg S-648414	1.00
Part 1: 100 mg S-648414 Fasted	1.25
Part 1: 100 mg S-648414 Fed	3.00
Part 1: 250 mg S-648414	1.50
Part 1: 500 mg S-648414	1.50
Part 1: 1000 mg S-648414	1.75

[back to top]

Part 1: Terminal Elimination Rate Constant (λz) of S-648414

(NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	1/hour (Geometric Mean)
Part 1: 10 mg S-648414	0.0301
Part 1: 30 mg S-648414	0.0336
Part 1: 100 mg S-648414 Fasted	0.0313
Part 1: 100 mg S-648414 Fed	0.0305
Part 1: 250 mg S-648414	0.0288
Part 1: 500 mg S-648414	0.0312
Part 1: 1000 mg S-648414	0.0293

[back to top]

Part 1: Terminal Elimination Half-life (t1/2,z) of S-648414

Terminal elimination half-life calculated as t1/2,z = (ln2)/λz, where λz is the terminal elimination rate constant. (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	hours (Geometric Mean)
Part 1: 10 mg S-648414	23.0
Part 1: 30 mg S-648414	20.7
Part 1: 100 mg S-648414 Fasted	22.2
Part 1: 100 mg S-648414 Fed	22.8
Part 1: 250 mg S-648414	24.1
Part 1: 500 mg S-648414	22.2
Part 1: 1000 mg S-648414	23.7

[back to top]

Parts 1: Change From Baseline in Heart Rate (HR)

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median HR in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~Baseline was defined as the average of the measured ECG values from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline in HR (ΔHR) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline HR as covariate." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,,

Intervention	beats per minute (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	-0.2	-2.7	-3.0	-3.2	-1.2	-3.0	-1.2	4.6	1.7	1.1	-1.7
Part 1: 100 mg S-648414	-1.1	-2.1	-3.0	-2.5	-2.2	-2.1	-2.8	4.2	-0.2	1.1	-1.4
Part 1: 1000 mg S-648414	-1.6	-0.8	-0.4	-0.3	-0.7	-0.6	3.3	7.5	3.5	3.4	3.3
Part 1: 250 mg S-648414	-0.1	0.4	-0.5	-1.7	-0.7	-1.8	0.8	3.7	1.8	2.4	0.8
Part 1: 30 mg S-648414	-1.4	-1.9	-0.3	-2.4	-3.0	-1.6	0.7	2.4	0.7	1.9	-0.4
Part 1: 500 mg S-648414	-0.7	-1.0	0.2	0.4	2.7	2.0	2.1	7.3	4.6	9.1	0.3
Part 1: Placebo	0.9	1.5	-0.4	-0.5	0.8	-0.9	0.2	5.2	1.5	2.7	0.4

[back to top]

Part 1: Renal Clearance (CLR) of S-648414

Renal clearance was estimated according to: CLR = cumulative amount of S-648414 excreted in urine from time zero to 96 hours postdose (Aeu0-96) / area under the concentration-time curve from time zero to the time of the last quantifiable concentration after dosing (AUC0-last). (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose (-12 to 0 hours), 0 to 24 hours, 24 to 48 hours, 48 to 72 hours, and 72 to 96 hours postdose

Intervention	L/hr (Geometric Mean)
Part 1: 10 mg S-648414	0.884
Part 1: 30 mg S-648414	0.721
Part 1: 100 mg S-648414 Fasted	0.695
Part 1: 100 mg S-648414 Fed	0.720
Part 1: 250 mg S-648414	0.804
Part 1: 500 mg S-648414	0.732
Part 1: 1000 mg S-648414	0.720

[back to top]

Part 2: Time to Maximum Plasma Concentration (Tmax) of S-648414 Following Single and Multiple-dose Administration

Intervention	hours (Median)
	Day 1	Day 14
Part 2: 30 mg S-648414 + Midazolam	3.02	2.03
Part 2: 50 mg S-648414 + Midazolam	4.50	1.25

[back to top]

Part 2: Number of Participants With Treatment-emergent Adverse Events

"A TEAE is any event not present before exposure to study drug or any event already present that worsens after exposure to study drug.~A serious adverse event is any untoward medical occurrence that resulted in death, was life-threatening, required or prolonged inpatient hospitalization, resulted in persistent disability/incapacity, was a congenital anomaly/birth defect, or other event that may have jeopardized the participant or required intervention to prevent one of the outcomes above.~The investigator assessed the intensity of each AE according to the following:~Grade 1 (Mild): No or minimal interference with usual activities.~Grade 2 (Moderate): More than minimal interference with usual activities, intervention indicated.~Grade 3 (Severe): Inability to perform usual activities, intervention or hospitalization indicated.~Grade 4 (Potentially life-threatening): Inability to perform self-care, intervention indicated to prevent permanent impairment, disability, or death." (NCT04147715)
Timeframe: From the first dose up to 10 days after end of dosing (25 days); A TEAE was summarized to a given treatment if the event onset/worsening occurred any time after the dose of that treatment and before the dose of the next treatment.

,,,,,,

Intervention	Participants (Count of Participants)
	Any TEAE	Any treatment-related TEAE	Any TEAE with severity Grade 2 to 4	Any TEAE with severity Grade 3 to 4	Any gastrointestinal AEs	Any ocular AEs	Any serious adverse events	Any treatment-related SAEs	Any TEAE leading to study discontinuation	Any TEAE leading to study drug discontinuation	Deaths
Part 2: 30 mg S-648414 (Days 1-13)	3	2	1	0	0	2	0	0	0	0	0
Part 2: 30 mg S-648414 + Midazolam (Day 14)	1	0	0	0	0	0	0	0	0	0	0
Part 2: 50 mg S-648414 (Days 1-13)	2	2	2	0	0	0	0	0	1	1	0
Part 2: 50 mg S-648414 + Midazolam (Day 14)	1	1	0	0	0	0	0	0	0	0	0
Part 2: Midazolam (Day -2)	0	0	0	0	0	0	0	0	0	0	0
Part 2: Placebo (Days 1-13)	2	2	2	0	0	1	0	0	2	2	0
Part 2: Placebo + Midazolam (Day 14)	0	0	0	0	0	0	0	0	0	0	0

[back to top]

Part 1: Mean Residence Time (MRT) of S-648414

Mean residence time, calculated as MRT = AUMC0-inf / AUC0-inf, where AUMC0-inf is the area under the first moment curve extrapolated to infinity. (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	hours (Geometric Mean)
Part 1: 10 mg S-648414	32.5
Part 1: 30 mg S-648414	29.2
Part 1: 100 mg S-648414 Fasted	31.5
Part 1: 100 mg S-648414 Fed	33.8
Part 1: 250 mg S-648414	34.2
Part 1: 500 mg S-648414	32.6
Part 1: 1000 mg S-648414	34.5

[back to top]

Part 2: Area Under the Concentration-time Curve Over the Dosing Interval τ (AUC0-τ) of S-648414 Following Single and Multiple-dose Administration

Area under the concentration-time curve over the dosing interval (24 hours) on Day 1 and Day 14, calculated by the linear up/log down trapezoidal method. (NCT04147715)
Timeframe: Day 1 and day 14 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
	Day 1	Day 14
Part 2: 30 mg S-648414 + Midazolam	5519	10540
Part 2: 50 mg S-648414 + Midazolam	8983	18400

[back to top]

Part 1: Placebo-corrected Change From Baseline in QRS Duration

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median QRS duration in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~Baseline was defined as the average of the measured ECG intervals from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline in QRS duration (ΔQRS) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline QRS as covariate.~Placebo-corrected ΔQRS (ΔΔQRS) was calculated as the adjusted mean ΔQRS in the S-648414 group minus adjusted mean ΔQRS in the placebo group at each time point." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,

Intervention	ms (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	0.2	0.3	-0.7	0.5	0.1	0.2	-0.3	-0.3	0.2	1.4	0.8
Part 1: 100 mg S-648414	0.5	0.6	-0.1	1.1	-0.1	0.3	0.3	-0.2	0.5	1.1	1.1
Part 1: 1000 mg S-648414	0.2	0.8	0.0	1.1	0.4	0.3	0.8	1.3	0.3	1.9	0.0
Part 1: 250 mg S-648414	0.2	0.7	-0.1	0.5	0.3	0.5	0.1	-0.8	0.5	1.1	0.6
Part 1: 30 mg S-648414	-0.1	0.5	-0.6	0.4	0.3	0.4	0.0	0.0	0.7	1.4	0.8
Part 1: 500 mg S-648414	0.4	0.6	-0.3	0.7	0.1	0.5	0.8	1.1	1.1	1.9	0.7

[back to top]

Part 1: Placebo-corrected Change From Baseline in PR Interval

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median PR interval in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~Baseline was defined as the average of the measured ECG intervals from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline (ΔPR) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline PR as covariate.~Placebo-corrected ΔPR (ΔΔPR) was calculated as the adjusted mean ΔPR in the S-648414 group minus adjusted mean ΔPR in the placebo group at each time point." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,

Intervention	ms (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	0.6	0.2	3.0	2.0	0.4	3.8	2.5	1.2	1.4	1.3	1.6
Part 1: 100 mg S-648414	-0.5	0.5	0.5	-3.1	-0.8	1.8	-1.5	0.5	-1.3	-0.4	2.0
Part 1: 1000 mg S-648414	-0.4	0.2	0.5	-0.6	-1.6	-0.5	-2.2	-0.1	1.4	0.4	-1.6
Part 1: 250 mg S-648414	0.9	1.0	1.8	-2.2	-0.2	-1.4	-0.5	1.9	-2.6	-0.1	-2.7
Part 1: 30 mg S-648414	1.8	3.2	0.6	2.6	3.8	3.8	2.7	3.5	6.8	4.5	2.2
Part 1: 500 mg S-648414	-4.3	-7.2	0.4	-2.9	-5.9	-5.2	-7.4	-4.1	-2.6	-6.9	-0.7

[back to top]

Part 1: Placebo-corrected Change From Baseline in Heart Rate

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median HR in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~Baseline was defined as the average of the measured values from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline (ΔHR) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline HR as covariate.~Placebo-corrected ΔHR (ΔΔHR) was calculated as the adjusted mean ΔHR in the S-648414 group minus adjusted mean ΔHR in the placebo group at each time point." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,

Intervention	beats per minute (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	-1.1	-4.2	-2.6	-2.7	-2.0	-2.1	-1.4	-0.6	0.1	-1.6	-2.2
Part 1: 100 mg S-648414	-2.0	-3.5	-2.6	-2.1	-3.0	-1.2	-3.1	-1.0	-1.7	-1.5	-1.9
Part 1: 1000 mg S-648414	-2.5	-2.2	0.0	0.1	-1.5	0.4	3.1	2.3	2.0	0.7	2.9
Part 1: 250 mg S-648414	-1.0	-1.1	0.0	-1.3	-1.5	-0.8	0.6	-1.5	0.3	-0.3	0.4
Part 1: 30 mg S-648414	-2.3	-3.4	0.1	-2.0	-3.8	-0.7	0.4	-2.8	-0.9	-0.7	-0.9
Part 1: 500 mg S-648414	-1.6	-2.5	0.6	0.9	2.0	2.9	1.9	2.0	3.1	6.4	-0.1

[back to top]

Part 1: Placebo-corrected Change From Baseline in Fridericia's Corrected QT Interval

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median QT in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~QT interval was corrected for heart rate using Fridericia's correction (QTcF). Baseline was defined as the average of the measured ECG intervals from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline (ΔQTcF) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline QTcF as covariate.~Placebo-corrected ΔQTcF (ΔΔQTcF) was calculated as the adjusted mean ΔQTcF in the S-648414 group minus adjusted mean ΔQTcF in the placebo group at each time point." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,

Intervention	ms (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	0.0	1.7	-0.1	-2.0	0.8	4.1	2.1	-6.7	-2.7	-1.0	-3.6
Part 1: 100 mg S-648414	-1.6	-1.0	0.0	-1.8	1.4	1.2	2.4	4.0	0.9	1.8	-0.7
Part 1: 1000 mg S-648414	5.2	7.0	6.0	6.4	10.4	12.0	14.3	8.1	9.1	9.6	8.8
Part 1: 250 mg S-648414	-0.9	1.2	3.0	-1.1	2.8	4.5	2.5	0.7	-1.8	-0.5	0.5
Part 1: 30 mg S-648414	-2.4	-0.2	-1.5	-0.9	1.0	0.5	1.7	3.0	3.7	1.8	0.2
Part 1: 500 mg S-648414	-2.4	1.1	4.2	2.5	5.0	1.4	5.9	0.6	0.7	-2.1	-0.4

[back to top]

Part 1: Maximum Plasma Concentration (Cmax) of S-648414

(NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	ng/mL (Geometric Mean)
Part 1: 10 mg S-648414	151
Part 1: 30 mg S-648414	498
Part 1: 100 mg S-648414 Fasted	1620
Part 1: 100 mg S-648414 Fed	1430
Part 1: 250 mg S-648414	3820
Part 1: 500 mg S-648414	9260
Part 1: 1000 mg S-648414	12700

[back to top]

Part 1: Fraction of S-648414 Dose Excreted in Urine From 0 to 96 Hours Postdose (Feu0-96)

"The fraction of S-648414 dose excreted in urine from 0 to 96 hours postdose was calculated as:~Cumulative amount of S-648414 excreted in urine from time zero to 96 hours postdose (Aeu0-96) / Dose × 100" (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose (-12 to 0 hours), 0 to 24 hours, 24 to 48 hours, 48 to 72 hours, and 72 to 96 hours postdose

Intervention	percent excreted (Geometric Mean)
Part 1: 10 mg S-648414	30.3
Part 1: 30 mg S-648414	25.5
Part 1: 100 mg S-648414 Fasted	25.3
Part 1: 100 mg S-648414 Fed	25.1
Part 1: 250 mg S-648414	28.7
Part 1: 500 mg S-648414	31.5
Part 1: 1000 mg S-648414	25.9

[back to top]

Part 1: Area Under the Concentration-time Curve From Time Zero to the Last Quantifiable Concentration After Dosing (AUC0-last) of S-648414

Area under the concentration-time curve from time zero to the time of the last quantifiable concentration after dosing, calculated by the linear trapezoidal method when concentrations are increasing and by the logarithmic trapezoidal method when concentrations are decreasing (linear up/log down trapezoidal method). (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
Part 1: 10 mg S-648414	3431
Part 1: 30 mg S-648414	10610
Part 1: 100 mg S-648414 Fasted	36370
Part 1: 100 mg S-648414 Fed	34910
Part 1: 250 mg S-648414	89330
Part 1: 500 mg S-648414	215300
Part 1: 1000 mg S-648414	359300

[back to top]

Part 1: Apparent Volume of Distribution in the Terminal Elimination Phase (Vz/F) of S-648414

Apparent volume of distribution in the terminal elimination phase was estimated according to: Vz /F = Dose / AUC0-inf / λz. (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	liters (Geometric Mean)
Part 1: 10 mg S-648414	91.7
Part 1: 30 mg S-648414	81.0
Part 1: 100 mg S-648414 Fasted	83.5
Part 1: 100 mg S-648414 Fed	88.9
Part 1: 250 mg S-648414	91.0
Part 1: 500 mg S-648414	70.8
Part 1: 1000 mg S-648414	89.3

[back to top]

Part 3: Time to Maximum Plasma Concentration (Tmax) of Dolutegravir

The effect of S-648414 on the PK of dolutegravir was assessed after administration of multiple oral doses of dolutegravir alone and after administration of multiple oral doses of S-648414 co-administered with dolutegravir. (NCT04147715)
Timeframe: Day 7 and Day 28 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12 and 24 hours postdose.

Intervention	hours (Median)
Part 3: Dolutegravir (100 mg S-648414 Group)	3.50
Part 3: 100 mg S-648414 + Dolutegravir	2.75
Part 3: Dolutegravir (200 mg S-648414 Group)	3.50
Part 3: 200 mg S-648414 + Dolutegravir	4.00

[back to top]

Part 1: Apparent Total Clearance (CL/F) of S-648414

Apparent total clearance estimated according to: CL/F = Dose / AUC0-inf. (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	L/hr (Geometric Mean)
Part 1: 10 mg S-648414	2.76
Part 1: 30 mg S-648414	2.72
Part 1: 100 mg S-648414 Fasted	2.61
Part 1: 100 mg S-648414 Fed	2.71
Part 1: 250 mg S-648414	2.62
Part 1: 500 mg S-648414	2.21
Part 1: 1000 mg S-648414	2.62

[back to top]

Part 3: Apparent Total Clearance (CL/F) of Dolutegravir

"The effect of S-648414 on the PK of dolutegravir was assessed after administration of multiple oral doses of dolutegravir alone and after administration of multiple oral doses of S-648414 co-administered with dolutegravir.~Apparent total clearance calculated as CL/F =Dose/AUC0-τ" (NCT04147715)
Timeframe: Day 7 and Day 28 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12 and 24 hours postdose.

Intervention	L/hr (Geometric Mean)
Part 3: Dolutegravir (100 mg S-648414 Group)	0.669
Part 3: 100 mg S-648414 + Dolutegravir	0.560
Part 3: Dolutegravir (200 mg S-648414 Group)	0.716
Part 3: 200 mg S-648414 + Dolutegravir	0.683

[back to top]

Part 1: Number of Participants With Treatment-emergent Changes for T-wave Morphology and U-wave Presence

"T-wave abnormalities were categorized as follows:~Normal T wave: Any positive T wave not meeting any criterion below~Flat T wave: T amplitude < 1 mm (either positive or negative) including flat isoelectric line~Notched T wave (+): Presence of notch(es) of at least 0.05 mV amplitude on ascending or descending arm of the positive T wave~Biphasic: T wave that contains a second component with an opposite phase that is at least 0.1 mV deep (both positive/negative and negative/positive and polyphasic T waves included)~Normal T wave (-): T amplitude that is negative, without biphasic T wave or notches~Notched T wave (-): Presence of notch(es) of at least 0.05 mV amplitude on descending or ascending arm of the negative T wave~U waves: Presence of abnormal U waves" (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,,

Intervention	Participants (Count of Participants)
	Flat	Notched (+)	Biphasic	Normal (-)	Notched (-)	U-Wave presence
Part 1: 10 mg S-648414	1	1	0	0	1	0
Part 1: 100 mg S-648414	0	0	0	0	0	0
Part 1: 1000 mg S-648414	0	0	0	0	0	0
Part 1: 250 mg S-648414	0	0	0	0	0	0
Part 1: 30 mg S-648414	0	0	0	0	0	0
Part 1: 500 mg S-648414	0	0	0	0	0	0
Part 1: Placebo	0	0	0	0	0	0

[back to top]

Part 1: Number of Participants With Treatment-emergent Adverse Events (TEAEs)

,,,,,,,,

Intervention	Participants (Count of Participants)
	Any treatment-emergent adverse event (TEAE)	Any treatment-related TEAE	Any TEAE with severity Grade 2 to 4	Any TEAE with severity Grade 3 to 4	Any gastrointestinal AEs	Any ocular AEs	Serious adverse events (SAEs)	Any treatment-related SAE	Any TEAE leading to study discontinuation	Any TEAE leading to study drug discontinuation	Deaths
Part 1: 10 mg S-648414	0	0	0	0	0	0	0	0	0	0	0
Part 1: 100 mg S-648414 Fasted	2	1	1	0	1	0	0	0	0	0	0
Part 1: 100 mg S-648414 Fed	2	1	1	0	1	0	0	0	0	0	0
Part 1: 1000 mg S-648414	2	2	0	0	2	0	0	0	0	0	0
Part 1: 250 mg S-648414	1	0	0	0	0	0	0	0	0	0	0
Part 1: 30 mg S-648414	1	0	0	0	0	0	0	0	0	0	0
Part 1: 500 mg S-648414	1	0	0	0	0	0	0	0	0	0	0
Part 1: Placebo - Fasted	2	1	0	0	1	0	0	0	0	0	0
Part 1: Placebo - Fed	0	0	0	0	0	0	0	0	0	0	0

[back to top]

Part 1: Number of Participants With Recorded Outlier Values for QTcF, HR, PR, and QRS

"A participant was determined as an outlier if the following criteria (assessed separately) were met for the ECG intervals at any time point:~QTcF:~Treatment-emergent value of > 450 and ≤ 480 ms when not present at Baseline (new onset)~Treatment-emergent value of > 480 and ≤ 500 ms when not present at Baseline (new onset)~Treatment-emergent value of > 500 ms when not present at Baseline (new onset)~Increase of QTcF (ΔQTcF) from Baseline of > 30 and ≤ 60 ms~Increase of QTcF from Baseline > 60 ms~HR:~Decrease of HR from Baseline > 25% resulting in HR < 50 bpm~Increase of HR from Baseline > 25% resulting in HR > 100 bpm~PR:~Increase of PR from Baseline > 25% resulting in PR > 200 ms~QRS:~Increase of QRS from Baseline > 25% resulting in QRS > 120 ms" (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,,

Intervention	Participants (Count of Participants)
	QTcF > 450 and ≤ 480 ms	QTcF > 480 and ≤ 500 ms	QTcF > 500 ms	ΔQTcF > 30 and ≤ 60 ms	ΔQTcF > 60 ms	HR < 50 (bpm) with a decrease in ΔHR > 25%	HR > 100 (bpm) with an increase in ΔHR > 25%	PR > 200 (ms) with an increase in ΔPR > 25%	QRS > 120 (ms) with an increase in ΔQRS > 25%
Part 1: 10 mg S-648414	0	0	0	0	0	1	0	0	0
Part 1: 100 mg S-648414	0	0	0	0	0	0	0	0	0
Part 1: 1000 mg S-648414	0	0	0	0	0	0	0	0	0
Part 1: 250 mg S-648414	0	0	0	0	0	0	0	0	0
Part 1: 30 mg S-648414	0	0	0	0	0	0	0	0	0
Part 1: 500 mg S-648414	0	0	0	0	0	0	0	0	0
Part 1: Placebo	0	0	0	0	0	0	0	0	0

[back to top]

Part 1: Change From Baseline in QRS Interval

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. The QRS complex is a combination of the Q wave, R wave and S wave on an ECG tracing, and represents ventricular depolarization. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median QRS in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~Baseline was defined as the average of the measured ECG intervals from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline in QRS interval (ΔQRS) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline QRS as covariate." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,,

Intervention	ms (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	0.0	-0.1	-0.2	0.2	0.0	0.0	-0.1	-0.8	-0.6	0.0	0.1
Part 1: 100 mg S-648414	0.2	0.2	0.4	0.7	-0.2	0.1	0.5	-0.7	-0.3	-0.3	0.4
Part 1: 1000 mg S-648414	-.1	0.4	0.6	0.8	0.3	0.2	1.0	0.8	-0.5	0.5	-0.7
Part 1: 250 mg S-648414	-0.1	0.3	0.5	0.1	0.2	0.4	0.3	-1.3	-0.3	-0.3	-0.1
Part 1: 30 mg S-648414	-0.4	0.1	0.0	0.1	0.2	0.2	0.2	-0.5	-0.2	0.0	0.1
Part 1: 500 mg S-648414	0.1	0.2	0.3	0.4	0.0	0.4	0.9	0.6	0.2	0.5	0.0
Part 1: Placebo	-0.3	-0.4	0.5	-0.3	-0.1	-0.2	0.2	-0.5	-0.8	-1.4	-0.7

[back to top]

Part 1: Change From Baseline in PR Interval

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. The PR interval is the time from the onset of the P-wave to the start of the next QRS complex. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median PR in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~Baseline was defined as the average of the measured ECG intervals from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline in PR interval (ΔPR) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline PR as covariate." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,,

Intervention	ms (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	1.0	1.0	3.4	2.8	1.1	3.6	3.0	-1.6	-1.8	0.4	0.1
Part 1: 100 mg S-648414	-0.1	1.3	0.9	-2.3	-0.1	1.7	-1.0	-2.3	-4.5	-1.3	0.5
Part 1: 1000 mg S-648414	0.0	1.0	0.9	0.2	-0.9	-0.7	-1.7	-3.0	-1.8	-0.5	-3.1
Part 1: 250 mg S-648414	1.3	1.9	2.2	-1.4	0.5	-1.5	-0.1	-0.9	-5.8	-1.0	-4.2
Part 1: 30 mg S-648414	2.2	4.0	1.0	3.4	4.5	3.7	3.1	0.7	3.6	3.5	0.8
Part 1: 500 mg S-648414	-3.9	-6.4	0.8	-2.1	-5.2	-5.3	-6.9	-7.0	-5.8	-7.8	-2.2
Part 1: Placebo	0.4	0.9	0.4	0.8	0.7	-0.1	0.5	-2.8	-3.2	-0.9	-1.5

[back to top]

Part 1: Change From Baseline in Fridericia's Corrected QT Interval (QTcF)

"Continuous 12-lead digital electrocardiogram (ECG) recording was performed on Day 1. The QT interval is a measure between Q and T wave in heart's electrical cycle. ECGs were analyzed at a blinded, central ECG laboratory. At each specified time point, ten 14-second 12-lead ECG tracings were extracted from the continuous recordings. The median QT in each replicate was calculated; the mean of available medians was used as the participant's reportable value at that time point.~QT interval was corrected for heart rate using Fridericia's correction (QTcF). Baseline was defined as the average of the measured ECG intervals from the 3 pre-dose time points (45, 30, and 15 minutes before dosing) on Day 1.~Change from Baseline (ΔQTcF) was calculated based on a linear mixed-effects model with time (categorical), treatment, and time-by-treatment interaction as fixed effects and Baseline QTcF as covariate." (NCT04147715)
Timeframe: Day 1: Predose at 3 time points (-45, -30 and -15 minutes), and 0.5, 1, 1.5, 2, 2.5, 3, 4, 6, 8, 12, and 24 hours postdose.

,,,,,,

Intervention	ms (Least Squares Mean)
	0.5 hours postdose	1 hour postdose	1.5 hours postdose	2 hours postdose	2.5 hours postdose	3 hours postdose	4 hours postdose	6 hours postdose	8 hours postdose	12 hours postdose	24 hours postdose
Part 1: 10 mg S-648414	-3.2	-0.4	-1.2	-2.1	-1.7	2.3	-0.2	-12.0	-6.7	-1.8	-4.9
Part 1: 100 mg S-648414	-4.8	-3.2	-1.1	-1.9	-1.1	-0.6	0.1	-1.2	-3.2	1.0	-2.1
Part 1: 1000 mg S-648414	2.0	4.9	4.9	6.3	8.0	10.1	12.0	2.9	5.0	8.8	7.5
Part 1: 250 mg S-648414	-4.1	-0.9	1.8	-1.2	0.4	2.6	0.2	-4.6	-5.9	-1.3	-0.8
Part 1: 30 mg S-648414	-5.6	-2.4	-2.6	-1.0	-1.5	-1.3	-0.6	-2.3	-0.3	0.9	-1.2
Part 1: 500 mg S-648414	-5.6	-1.0	3.1	2.4	2.5	-0.4	3.6	-4.6	-3.4	-3.0	-1.8
Part 1: Placebo	-3.2	-2.2	-1.1	-0.1	-2.5	-1.9	-2.3	-5.3	-4.1	-0.9	-1.4

[back to top]

Part 3: Time to Maximum Plasma Concentration (Tmax) of S-648414

The effect of dolutegravir on the pharmacokinetics (PK) of S-648414 was assessed after administration of multiple oral doses of S-648414 alone (Day 21) and after administration of multiple oral doses of S-648414 co-administered with dolutegravir (Day 28). (NCT04147715)
Timeframe: Day 21 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8 and 12 hours postdose. Day 28 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	hours (Median)
Part 3: 100 mg S-648414	2.00
Part 3: 100 mg S-648414 + Dolutegravir	2.25
Part 3: 200 mg S-648414	2.50
Part 3: 200 mg S-648414 + Dolutegravir	2.25

[back to top]

Part 1: Area Under the Concentration-time Curve From Time Zero to Infinity (AUC0-inf) of S-648414

Area under the concentration-time curve extrapolated from time zero to infinity defined as AUC0-last + (Clast/λz), where Clast is the last measurable plasma concentration and λz is the plasma terminal elimination rate constant. (NCT04147715)
Timeframe: Day 1 and Day 14 (for participants in the 100 mg dose group only) predose, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, 24, 48, 72 and 96 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
Part 1: 10 mg S-648414	3620
Part 1: 30 mg S-648414	11040
Part 1: 100 mg S-648414 Fasted	38300
Part 1: 100 mg S-648414 Fed	36940
Part 1: 250 mg S-648414	95510
Part 1: 500 mg S-648414	226600
Part 1: 1000 mg S-648414	382000

[back to top]

Part 3: Plasma Concentration of S-648414 at the End of the Dosing Interval τ (Cτ)

The effect of dolutegravir on the pharmacokinetics (PK) of S-648414 was assessed after administration of multiple oral doses of S-648414 alone (Day 21) and after administration of multiple oral doses of S-648414 co-administered with dolutegravir (Day 28). (NCT04147715)
Timeframe: Day 22 and Day 29 (24 hours post-dosing on Days 21 and 28)

Intervention	ng/mL (Geometric Mean)
Part 3: 100 mg S-648414	1210
Part 3: 100 mg S-648414 + Dolutegravir	1250
Part 3: 200 mg S-648414	2590
Part 3: 200 mg S-648414 + Dolutegravir	2360

[back to top]

Part 3: Plasma Concentration of Dolutegravir at the End of the Dosing Interval τ (Cτ)

The effect of S-648414 on the PK of dolutegravir was assessed after administration of multiple oral doses of dolutegravir alone and after administration of multiple oral doses of S-648414 co-administered with dolutegravir. (NCT04147715)
Timeframe: Day 8 and Day 29 (24 hours post-dosing on Day 7 and Day 28).

Intervention	ng/mL (Geometric Mean)
Part 3: Dolutegravir (100 mg S-648414 Group)	1980
Part 3: 100 mg S-648414 + Dolutegravir	2660
Part 3: Dolutegravir (200 mg S-648414 Group)	1850
Part 3: 200 mg S-648414 + Dolutegravir	2000

[back to top]

Part 3: Maximum Plasma Concentration (Cmax) of S-648414

Intervention	ng/mL (Geometric Mean)
Part 3: 100 mg S-648414	2740
Part 3: 100 mg S-648414 + Dolutegravir	2720
Part 3: 200 mg S-648414	5150
Part 3: 200 mg S-648414 + Dolutegravir	5020

[back to top]

Part 3: Maximum Plasma Concentration (Cmax) of Dolutegravir

Intervention	ng/mL (Geometric Mean)
Part 3: Dolutegravir (100 mg S-648414 Group)	4910
Part 3: 100 mg S-648414 + Dolutegravir	5800
Part 3: Dolutegravir (200 mg S-648414 Group)	4720
Part 3: 200 mg S-648414 + Dolutegravir	4950

[back to top]

Part 3: Area Under the Concentration-time Curve Over the Dosing Interval τ (AUC0-τ) for S-648414

"The effect of dolutegravir on the pharmacokinetics (PK) of S-648414 was assessed after administration of multiple oral doses of S-648414 alone (Day 21) and after administration of multiple oral doses of S-648414 co-administered with dolutegravir (Day 28).~Area under the concentration-time curve over the dosing interval τ (24 hours) was calculated by the linear up/log down trapezoidal method." (NCT04147715)
Timeframe: Day 21 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8 and 12 hours postdose. Day 28 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
Part 3: 100 mg S-648414	40800
Part 3: 100 mg S-648414 + Dolutegravir	41080
Part 3: 200 mg S-648414	81010
Part 3: 200 mg S-648414 + Dolutegravir	79820

[back to top]

Part 3: Area Under the Concentration-time Curve Over the Dosing Interval τ (AUC0-τ) for Dolutegravir

"The effect of S-648414 on the PK of dolutegravir was assessed after administration of multiple oral doses of dolutegravir alone and after administration of multiple oral doses of S-648414 co-administered with dolutegravir.~Area under the concentration-time curve over the dosing interval τ (24 hours) was calculated by the linear up/log down trapezoidal method." (NCT04147715)
Timeframe: Day 7 and Day 28 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12 and 24 hours postdose.

Intervention	ng*hr/mL (Geometric Mean)
Part 3: Dolutegravir (100 mg S-648414 Group)	74790
Part 3: 100 mg S-648414 + Dolutegravir	89290
Part 3: Dolutegravir (200 mg S-648414 Group)	69850
Part 3: 200 mg S-648414 + Dolutegravir	73210

[back to top]

Part 3: Apparent Total Clearance (CL/F) of S-648414

"The effect of dolutegravir on the pharmacokinetics (PK) of S-648414 was assessed after administration of multiple oral doses of S-648414 alone (Day 21) and after administration of multiple oral doses of S-648414 co-administered with dolutegravir (Day 28).~Apparent total clearance was calculated as CL/F = Dose/AUC0-τ" (NCT04147715)
Timeframe: Day 21 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8 and 12 hours postdose. Day 28 predose (0 hours), 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 8, 12, and 24 hours postdose.

Intervention	L/hr (Geometric Mean)
Part 3: 100 mg S-648414	2.45
Part 3: 100 mg S-648414 + Dolutegravir	2.43
Part 3: 200 mg S-648414	2.47
Part 3: 200 mg S-648414 + Dolutegravir	2.51

[back to top]

Part 3: Number of Participants With Treatment-emergent Adverse Events

"A TEAE is any event not present before exposure to study drug or any event already present that worsens after exposure to study drug.~A serious adverse event is any untoward medical occurrence that resulted in death, was life-threatening, required or prolonged inpatient hospitalization, resulted in persistent disability/incapacity, was a congenital anomaly/birth defect, or other event that may have jeopardized the participant or required intervention to prevent one of the outcomes above.~The investigator assessed the intensity of each AE according to the following:~Grade 1 (Mild): No or minimal interference with usual activities.~Grade 2 (Moderate): More than minimal interference with usual activities, intervention indicated.~Grade 3 (Severe): Inability to perform usual activities, intervention or hospitalization indicated.~Grade 4 (Potentially life-threatening): Inability to perform self-care, intervention indicated to prevent permanent impairment, disability, or death." (NCT04147715)
Timeframe: From the first dose up to Day 36; A TEAE was summarized to a given treatment if the event onset/worsening occurred any time after the dose of that treatment and before the dose of the next treatment.

,,,,,

Intervention	Participants (Count of Participants)
	Any TEAE	Any treatment-related TEAE	Any TEAE with severity Grade 2 to 4	Any TEAE with severity Grade 3 to 4	Any gastrointestinal AEs	Any ocular AEs	Any serious adverse events	Any treatment-related SAE	Any TEAE leading to study discontinuation	Any TEAE leading to study drug discontinuation	Deaths
Part 3: 100 mg S-648414	3	0	2	0	0	0	0	0	0	0	0
Part 3: 100 mg S-648414 + Dolutegravir	4	0	2	0	0	0	0	0	0	0	0
Part 3: 200 mg S-648414	5	2	3	0	0	2	0	0	0	0	0
Part 3: 200 mg S-648414 + Dolutegravir	2	1	1	0	1	0	0	0	0	0	0
Part 3: Dolutegravir (100 mg S-648414 Group)	3	0	2	0	0	0	0	0	0	0	0
Part 3: Dolutegravir (200 mg S-648414 Group)	2	0	2	0	0	0	0	0	0	0	0

[back to top]

Part 2: Time to Maximum Plasma Concentration of Midazolam

Intervention	hours (Median)
Part 2: Midazolam (30 mg S-648414 Group)	0.76
Part 2: 30 mg S-648414 + Midazolam	1.00
Part 2: Midazolam (50 mg S-648414 Group)	0.50
Part 2: 50 mg S-648414 + Midazolam	0.50

[back to top]

Number of Participants With Adverse Events (AEs) Leading to Treatment Discontinuation Through Weeks 24 and 48

An AE is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a study intervention, whether or not considered related to the study intervention. Number of participants who discontinued study treatment due to AEs are presented. (NCT04493216)
Timeframe: Up to Weeks 24 and 48

,,,

Intervention	Participants (Count of Participants)
	Week 24	Week 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	2	2
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	2	2
GSK3640254 150 mg + ABC/3TC or FTC/TAF	3	4
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	4	5

[back to top]

Change From Baseline in Plasma HIV-1 RNA at Weeks 24 and 48

Plasma samples were collected for quantitative analysis of HIV-1 RNA. log10 values for plasma HIV-1 RNA have been presented. Baseline was defined as the latest pre-dose assessment with a non-missing value, including those from unscheduled visits. Change from Baseline is defined as post-dose visit value minus Baseline value. (NCT04493216)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

,,,

Intervention	Log 10 copies per milliliter (Mean)
	Baseline (Day 1)	Change from Baseline to Week 24	Change from Baseline to Week 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	4.247	-2.629	-2.717
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	4.351	-2.718	-2.675
GSK3640254 150 mg + ABC/3TC or FTC/TAF	4.353	-2.784	-2.762
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	4.165	-2.565	-2.580

[back to top]

Change From Baseline in CD4+ Cell Counts at Weeks 24 and 48

Blood samples were collected and CD4+ cell count was assessed using flow cytometry. Baseline was defined as the latest pre-dose assessment with a non-missing value, including those from unscheduled visits. Change from Baseline is defined as post-dose visit value minus Baseline value. (NCT04493216)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

,,,

Intervention	Cells per cubic millimeter (Mean)
	Baseline (Day 1)	Change from Baseline to Week 24	Change from Baseline to Week 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	514.1	198.5	190.6
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	480.3	241.3	292.4
GSK3640254 150 mg + ABC/3TC or FTC/TAF	509.7	129.3	189.2
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	478.7	202.3	243.0

[back to top]

Absolute Values of HIV-1 RNA at Weeks 24 and 48

Plasma samples were collected for quantitative analysis of HIV-1 RNA. Logarithm to base 10 (log10) values for plasma HIV-1 RNA have been presented. Baseline was defined as the latest pre-dose assessment with a non-missing value, including those from unscheduled visits. (NCT04493216)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

,,,

Intervention	Log 10 copies per milliliter (Mean)
	Baseline (Day 1)	Week 24	Week 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	4.247	1.592	1.590
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	4.351	1.619	1.602
GSK3640254 150 mg + ABC/3TC or FTC/TAF	4.353	1.607	1.605
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	4.165	1.610	1.594

[back to top]

Number of Participants With AEs Based on Maximum Severity Grades at Weeks 24 and 48

An AE is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a study intervention, whether or not considered related to the study intervention. The severity of AEs was defined as per the Division of AIDS Table for Grading the Severity of Adult and Pediatric Adverse Events (DAIDS AE Grading Table) Version 2.1 and was categorized into grades as following: Grade 1 - mild, Grade 2 - moderate, Grade 3 - severe, Grade 4 - Potentially life threatening and Grade 5 - Fatal. Higher grade indicates more severe condition. Number of participants with adverse events by maximum grade have been presented. (NCT04493216)
Timeframe: At Weeks 24 and 48

,,,

Intervention	Participants (Count of Participants)
	Weeks 24, Grade 1	Weeks 48, Grade 1	Weeks 24, Grade 2	Weeks 48, Grade 2	Weeks 24, Grade 3	Weeks 48, Grade 3	Weeks 24, Grade 4	Weeks 48, Grade 4	Weeks 24, Grade 5	Weeks 48, Grade 5
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	15	15	10	10	3	3	0	0	0	0
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	14	12	16	20	4	4	1	1	0	0
GSK3640254 150 mg + ABC/3TC or FTC/TAF	18	14	16	17	3	5	1	2	0	0
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	16	17	18	17	2	3	1	1	0	0

[back to top]

Absolute Values of Cluster of Differentiation 4 Plus (CD4+) Cell Counts at Weeks 24 and 48

Blood samples were collected and CD4+ cell count was assessed using flow cytometry. Baseline was defined as the latest pre-dose assessment with a non-missing value, including those from unscheduled visits. (NCT04493216)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

,,,

Intervention	Cells per cubic millimeter (Mean)
	Baseline (Day 1)	Week 24	Week 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	514.1	724.8	705.2
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	480.3	717.5	749.9
GSK3640254 150 mg + ABC/3TC or FTC/TAF	509.7	643.5	702.6
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	478.7	689.8	747.3

[back to top]

Time to Cmax (Tmax) of GSK3640254 at Steady State

Blood samples were collected at indicated time points for PK analysis of GSK3640254. Tmax was determined directly from the concentration-time data. (NCT04493216)
Timeframe: Pre-dose, 1, 2, 3, 3.5, 4, 4.5, 5, 6, 10, and 24 hours post-dose at Week 2

Intervention	Hour (Median)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	3.0000
GSK3640254 150 mg + ABC/3TC or FTC/TAF	3.4167
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	3.4583

[back to top]

Steady State Oral Clearance (CLt/F) of GSK3640254

Blood samples were collected at indicated time points for PK analysis of GSK3640254. (NCT04493216)
Timeframe: Pre-dose, 1, 2, 3, 3.5, 4, 4.5, 5, 6, 10, and 24 hours post-dose at Week 2

Intervention	Liter/ hour (Geometric Mean)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	6.6686
GSK3640254 150 mg + ABC/3TC or FTC/TAF	7.0714
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	6.5129

[back to top]

Percentage of Participants With Plasma HIV-1 RNA <50 c/mL at Week 48

Percentage of participants with plasma HIV-1 RNA <50 c/mL at week 48 was assessed using the FDA snapshot algorithm to demonstrate the antiviral activity of GSK3640254 given in combination with either ABC/3TC or FTC/TAF compared to the reference treatment of DTG given in combination with either ABC/3TC or FTC/TAF. (NCT04493216)
Timeframe: At Week 48

Intervention	Percentage of participants (Number)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	85.0
GSK3640254 150 mg + ABC/3TC or FTC/TAF	83.7
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	76.2
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	77.8

[back to top]

Observed Pre-dose Plasma Concentration (C0) of GSK3640254 at Steady State

Blood samples were collected at indicated time points for PK analysis of GSK3640254. Observed pre-dose plasma concentration was determined directly from the concentration-time data. (NCT04493216)
Timeframe: Pre-dose, 1, 2, 3, 3.5, 4, 4.5, 5, 6, 10, and 24 hours post-dose at Week 2

Intervention	ng/mL (Geometric Mean)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	435.9
GSK3640254 150 mg + ABC/3TC or FTC/TAF	603.2
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	865.2

[back to top]

Observed Plasma Concentration at the End of the Dosing Interval (Ctau) of GSK3640254 at Steady State - Week 2

Blood samples were collected at indicated time points for pharmacokinetic (PK) analysis of GSK3640254. Observed plasma concentration at the end of the dosing interval was determined directly from the concentration-time data. (NCT04493216)
Timeframe: Pre-dose, 1, 2, 3, 3.5, 4, 4.5, 5, 6, 10, and 24 hours post-dose at Week 2

Intervention	Nanogram/ milliliter (ng/mL) (Geometric Mean)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	430.5361
GSK3640254 150 mg + ABC/3TC or FTC/TAF	604.8387
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	805.2209

[back to top]

Number of Participants With Genotypic Resistance

Plasma samples were collected for resistance testing. Genotypic testing was conducted in participants meeting protocol-defined virologic failure (PDVF) criteria. Baseline was defined as the latest pre-dose assessment with a non-missing value, including those from unscheduled visits. Only those participants with data available at specified time points have been analyzed. (NCT04493216)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

,,,

Intervention	Participants (Count of Participants)
	Baseline (Day 1)	Weeks 24	Weeks 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	0	0	0
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	0	0	0
GSK3640254 150 mg + ABC/3TC or FTC/TAF	0	0	0
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	0	0	0

[back to top]

Maximum Observed Concentration (Cmax) of GSK3640254 at Steady State

Blood samples were collected at indicated time points for PK analysis of GSK3640254. (NCT04493216)
Timeframe: Pre-dose, 1, 2, 3, 3.5, 4, 4.5, 5, 6, 10, and 24 hours post-dose at Week 2

Intervention	ng/mL (Geometric Mean)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	929.8
GSK3640254 150 mg + ABC/3TC or FTC/TAF	1337.3
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	2094.5

[back to top]

Area Under the Plasma Drug Concentration-time Curve From Pre-dose to the End of the Dosing Interval (AUC [0-tau]) of GSK3640254 at Steady State

Blood samples were collected at indicated time points for PK analysis of GSK3640254. (NCT04493216)
Timeframe: Pre-dose, 1, 2, 3, 3.5, 4, 4.5, 5, 6, 10, and 24 hours post-dose at Week 2

Intervention	Hournanogram/ milliliter (hng/mL) (Geometric Mean)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	14995.7576
GSK3640254 150 mg + ABC/3TC or FTC/TAF	21212.2480
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	30708.2546

[back to top]

Number of Participants With AEs of Special Interest (AESI) (Gastrointestinal (GI), Nervous System, and Psychiatric AEs) Through Weeks 24 and 48

An AE is any untoward medical occurrence in a clinical study participant, temporally associated with the use of a study intervention, whether or not considered related to the study intervention. Number of participants with AESI (gastrointestinal (GI), nervous system, and psychiatric AEs) are presented. (NCT04493216)
Timeframe: At Weeks 24 and 48

,,,

Intervention	Participants (Count of Participants)
	Week 24, AESI (Gastrointestinal)	Week 48, AESI (Gastrointestinal)	Week 24, AESI (Nervous system)	Week 48, AESI (Nervous system)	Week 24, AESI (Psychiatric)	Week 48, AESI (Psychiatric)
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	11	14	3	3	2	4
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	13	14	5	7	1	4
GSK3640254 150 mg + ABC/3TC or FTC/TAF	18	18	4	5	3	3
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	12	14	7	8	2	4

[back to top]

Observed Plasma Concentration at the End of the Dosing Interval (Ctau) of GSK3640254 at Steady State - Weeks 24 and 48

Intervention	Nanogram/ milliliter (ng/mL) (Geometric Mean)
	Week 24	Week 48
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	396.5117	310.9877
GSK3640254 150 mg + ABC/3TC or FTC/TAF	519.6041	568.0656
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	922.9638	812.4745

[back to top]

Number of Participants With Serious Adverse Events (SAEs) and Deaths Through Weeks 24 and 48

An SAE is defined as any serious adverse event that, at any dose results in death, is life threatening, requires inpatient hospitalization or prolongation of existing hospitalization, results in persistent or significant disability/incapacity, is a congenital anomaly/birth defect, or any other situation according to medical or scientific judgment. (NCT04493216)
Timeframe: Up to Weeks 24 and 48

,,,

Intervention	Participants (Count of Participants)
	Week 24, SAEs	Week 48, SAEs	Week 24, Deaths	Week 48, Deaths
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	2	2	0	0
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	2	2	0	0
GSK3640254 150 mg + ABC/3TC or FTC/TAF	4	7	0	0
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	2	2	0	0

[back to top]

Number of Participants With Phenotypic Resistance

Plasma samples were collected for resistance testing. Phenotypic testing was conducted in participants meeting PDVF criteria. Baseline was defined as the latest pre-dose assessment with a non-missing value, including those from unscheduled visits. (NCT04493216)
Timeframe: Baseline (Day 1) and at Weeks 24 and 48

,,,

Intervention	Participants (Count of Participants)
	Baseline (Day 1)	Weeks 24	Weeks 48
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	0	0	0
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	0	0	0
GSK3640254 150 mg + ABC/3TC or FTC/TAF	0	0	0
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	0	0	0

[back to top]

Percentage of Participants With Plasma HIV-1 Ribonucleic Acid (RNA) Less Than (<)50 Copies Per Milliliter (c/mL) at Week 24

Percentage of participants with plasma HIV-1 RNA <50 c/mL at week 24 was assessed using the Food and Drug Administration (FDA) snapshot algorithm to demonstrate the antiviral activity of GSK3640254 given in combination with either ABC/3TC or FTC/TAF compared to the reference treatment of DTG given in combination with either ABC/3TC or FTC/TAF. (NCT04493216)
Timeframe: At Week 24

Intervention	Percentage of participants (Number)
GSK3640254 100 Milligram(mg)+ Placebo+ ABC/3TC or FTC/TAF	82.5
GSK3640254 150 mg + ABC/3TC or FTC/TAF	90.7
GSK3640254 200 mg+ Placebo+ ABC/3TC or FTC/TAF	76.2
Dolutegravir (DTG) 50 mg + ABC/3TC or FTC/TAF	91.7

[back to top]

Trough Concentration (Ctrough) of GSK3640254 at Weeks 2, 4, 8, 12 and 24

Trough concentration (Ctrough) is the concentration reached by a drug immediately before the next dose is administered. This was determined to assess the steady-state exposure of GSK3640254 when given in combination with DTG. (NCT04900038)
Timeframe: At Weeks 2, 4, 8, 12 (PRE DOSE), 12 (2-6HR POST DOSE), 24 (PRE DOSE), 24 (2-6HR POST DOSE)

Intervention	nanogram per milliliter (ng/mL) (Geometric Mean)
	Week 2	Week 4	Week 8	Week 12 ( PRE DOSE)	Week 12 (2-6HR POST DOSE)	Week 24 ( PRE DOSE)	Week 24 (2-6HR POST DOSE)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	340.2	417.8	386.2	481.3	767.8	396.0	759.0
GSK3640254 150 mg + DTG 50 mg	549.9	632.7	646.6	611.4	1081.2	570.1	1107.0
GSK3640254 200 mg + DTG 50 mg	724.2	799.6	821.1	877.2	1658.1	848.8	1584.1

[back to top]

Number of Participants With Serious Adverse Events (SAEs) and Deaths, up to End of Continued Access to Treatment Post-study Termination (Day 478)

"An SAE is defined as any serious adverse event that, at any dose results in death, is life-threatening, requires inpatient hospitalization or prolongation of existing hospitalization, results in persistent or significant disability/incapacity and is a congenital anomaly/birth defect.~The study was terminated by the sponsor after primary analysis (at week 24). Adverse event data were collected up to end of continued access to treatment post-study termination (Day 478)." (NCT04900038)
Timeframe: From Day 1 up to end of continued access to treatment post-study termination (Day 478)

,,,

Intervention	Participants (Count of Participants)
	SAEs	Death
DTG 50 mg + Lamivudine (3TC) 300 mg	1	0
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	2	0
GSK3640254 150 mg + DTG 50 mg	0	0
GSK3640254 200 mg + DTG 50 mg	0	0

[back to top]

Number of Participants With Adverse Events of Special Interest (AESIs), up to End of Continued Access to Treatment Post-study Termination (Day 478)

"AEs of special interest (AESIs) included AEs related to QT prolongation, gastrointestinal (GI) intolerability/toxicity, psychiatric events, nervous system disorders, skin and subcutaneous tissue disorders and cardiac disorders.~The study was terminated by the sponsor after primary analysis (at week 24). Adverse event data were collected up to end of continued access to treatment post-study termination (Day 478)." (NCT04900038)
Timeframe: From Day 1 up to end of continued access to treatment post-study termination (Day 478)

,,,

Intervention	Participants (Count of Participants)
	AEs related to QT prolongation	AEs related to GI intolerability/toxicity	AEs related to psychiatric events	AEs related to nervous system disorders	AEs related to skin and subcutaneous tissue disorder	AEs related to cardiac disorders
DTG 50 mg + Lamivudine (3TC) 300 mg	0	5	4	2	0	0
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	0	5	0	2	4	1
GSK3640254 150 mg + DTG 50 mg	0	7	3	4	0	0
GSK3640254 200 mg + DTG 50 mg	0	8	0	5	4	0

[back to top]

Absolute Values of HIV-1 RNA Through Week 24

Plasma samples were collected for quantitative analysis of HIV-1 RNA. Logarithm to base 10 (log 10) values for plasma HIV-1 RNA has been presented. Baseline is defined as the latest non-missing value prior to first dose of treatment according to date and time including unscheduled visits. (NCT04900038)
Timeframe: At Baseline (Day 1) and Week 24

,,,

Intervention	log10 copies per milliliter(log10 c/mL) (Mean)
	Baseline (Day 1)	Week 24
DTG 50 mg + Lamivudine (3TC) 300 mg	4.179	1.379
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	4.614	1.315
GSK3640254 150 mg + DTG 50 mg	4.446	1.532
GSK3640254 200 mg + DTG 50 mg	4.535	1.349

[back to top]

Percentage of Participants With Plasma HIV-1 Ribonucleic Acid (RNA) Less Than (<)50 Copies Per Milliliter (c/mL) at Week 24

Percentage of participants with plasma HIV-1 RNA <50 c/mL at Week 24 using the Food and Drug Administration (FDA) snapshot algorithm was assessed to evaluate the antiviral activity in HIV-1 infected ART (anti-retroviral therapy)-naïve participants. (NCT04900038)
Timeframe: At Week 24

Intervention	Percentage of participants (Number)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	95
GSK3640254 150 mg + DTG 50 mg	85
GSK3640254 200 mg + DTG 50 mg	77
DTG 50 mg + Lamivudine (3TC) 300 mg	86

[back to top]

Number of Participants With Adverse Events (AEs) Leading to Discontinuation, up to End of Continued Access to Treatment Post-study Termination (Day 478)

Number of participants who discontinued treatment due to AEs are presented. The study was terminated by the sponsor after primary analysis (at week 24). Adverse event data were collected up to end of continued access to treatment post-study termination (Day 478). (NCT04900038)
Timeframe: From Day 1 up to end of continued access to treatment post-study termination (Day 478)

Intervention	Participants (Count of Participants)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	1
GSK3640254 150 mg + DTG 50 mg	0
GSK3640254 200 mg + DTG 50 mg	1
DTG 50 mg + Lamivudine (3TC) 300 mg	0

[back to top]

Number of Participants Who Develop Phenotypic Resistance up to Week 24

Blood samples were collected for drug resistance testing to assess the development of viral resistance to GSK3640254 and other on-study Anti-Retroviral Therapy (ART) in participants experiencing virologic failure through Week 24. Only plasma HIV-1 RNA values determined by the central laboratory were used to assess virologic failure. PDVF was defined as having virologic non-response (HIV-1 RNA <1.0 log10 c/mL reduction from baseline and <200 copies/mL by Week 12, confirmed levels >=200 c/mL at or after Week 24 and plasma HIV-1 RNA <= 50 c/mL from testing on Week 24, virologic rebound (confirmed HIV-1 RNA >=200 copies/mL after confirmed consecutive HIV-1 RNA <50 copies/mL). (NCT04900038)
Timeframe: From Day 1 up to Week 24

Intervention	Participants (Count of Participants)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	0
GSK3640254 150 mg + DTG 50 mg	0
GSK3640254 200 mg + DTG 50 mg	0
DTG 50 mg + Lamivudine (3TC) 300 mg	0

[back to top]

Number of Participants Who Develop Genotypic Resistance up to Week 24

"Blood samples were collected for drug resistance testing to assess the development of viral resistance to GSK3640254 through Week 24. New mutations were tabulated by drug class: integrase strand transfer inhibitor (INSTI), non-nucleoside reverse transcriptase inhibitor (NNRTI), nucleoside reverse transcriptase inhibitor (NRTI) and protease inhibitor (PI).~Protocol-Defined Virologic Failure (PDVF) was defined as having virologic non-response (HIV-1 RNA <1.0 log10 c/mL reduction from baseline and <200 copies/mL by Week 12, confirmed levels >=200 c/mL at or after Week 24 and plasma HIV-1 RNA <= 50 c/mL from testing on Week 24, virologic rebound (confirmed HIV-1 RNA >=200 copies/mL after confirmed consecutive HIV-1 RNA <50 copies/mL)." (NCT04900038)
Timeframe: From Day 1 up to Week 24

Intervention	Participants (Count of Participants)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	0
GSK3640254 150 mg + DTG 50 mg	0
GSK3640254 200 mg + DTG 50 mg	0
DTG 50 mg + Lamivudine (3TC) 300 mg	0

[back to top]

Change From Baseline in CD4+ T-cell Counts Through Week 24

Blood samples were collected and CD4+ cell count assessment was carried out to evaluate the immunologic activity. Change from Baseline is defined as post-dose visit value minus Baseline value. (NCT04900038)
Timeframe: At Week 24 compared to baseline (Day 1)

Intervention	cells/mm^3 (Mean)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	317.7
GSK3640254 150 mg + DTG 50 mg	200.6
GSK3640254 200 mg + DTG 50 mg	241.2
DTG 50 mg + Lamivudine (3TC) 300 mg	139.5

[back to top]

Absolute Values of Cluster of Differentiation 4+ (CD4+) T-cell Counts Through Week 24

Blood samples were collected and CD4+ cell count assessment by flow cytometry was carried out to evaluate the immunologic activity. Baseline is defined as the latest non-missing value prior to first dose of treatment according to date and time including unscheduled visits. (NCT04900038)
Timeframe: At Baseline (Day 1) and Week 24

,,,

Intervention	cells per cubic millimeter (cells/mm^3) (Mean)
	Baseline (Day 1)	Week 24
DTG 50 mg + Lamivudine (3TC) 300 mg	506.9	627.5
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	436.7	753.4
GSK3640254 150 mg + DTG 50 mg	451.4	661.0
GSK3640254 200 mg + DTG 50 mg	534.8	756.1

[back to top]

Change From Baseline in HIV-1 RNA Through Week 24

Plasma samples were collected for quantitative analysis of HIV-1 RNA. Logarithm to base 10 (log 10) values for plasma HIV-1 RNA has been presented. Change from Baseline is defined as post-dose visit value minus Baseline value. (NCT04900038)
Timeframe: At Week 24 compared to baseline (Day 1)

Intervention	log10 c/mL (Mean)
GSK3640254 100 mg + Dolutegravir (DTG) 50 mg	-3.306
GSK3640254 150 mg + DTG 50 mg	-2.874
GSK3640254 200 mg + DTG 50 mg	-3.186
DTG 50 mg + Lamivudine (3TC) 300 mg	-2.767

[back to top]

dolutegravir

Cross-References

Synonyms (77)

Research Excerpts

Overview

Effects

Actions

Treatment

Toxicity

Pharmacokinetics

Compound-Compound Interactions

Bioavailability

Dosage Studied

Roles (1)

Drug Classes (4)

Protein Targets (28)

Potency Measurements

Inhibition Measurements

Activation Measurements

Other Measurements

Biological Processes (132)

Molecular Functions (84)

Ceullar Components (28)

Bioassays (235)

Research

Studies (1,108)

Market Indicators

Research Demand Index: 84.30

Study Types

Clinical Trials (206)

Trial Overview

Trial Outcomes

PK Parameter: Cord/Maternal Blood Concentration Ratio With Median (IQR) for ARVs and TB Drugs

Number of Women Who Met PK Target of Area Under the Curve (AUC) for ARVs

Number of Women Who Met PK Target of Area Under the Curve (AUC) for ARVs

Area Under the Curve From 0 to 24 Hours (AUC24) of ARVs for Contraceptive Arms

Area Under the Curve From 0 to 12 Hours (AUC12) of ARVs for Contraceptive Arms

Plasma Concentration for Contraceptives

PK Parameter: Cord/Maternal Blood Concentration Ratio With Median (Range) for ARVs and TB Drugs

Pharmacokinetic (PK) Parameter: Infant Plasma Washout Half-life (T1/2) of ARVs and TB Drugs

PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (Range) for ARVs and TB Drugs

PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (IQR) for ARVs and TB Drugs

PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Median (Range) for ARVs and TB Drugs

PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Median (IQR) for ARVs and TB Drugs

PK Parameter: Area Under the Curve From 0 to 12 Hours (AUC12) With Geometric Mean (95% CI) for ARVs and TB Drugs

Pharmacokinetic (PK) Parameter: Infant Plasma Washout Concentration of ARVs and TB Drugs

PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (Range) for ARVs and TB Drugs

PK Parameter: Area Under the Curve From 0 to 24 Hours (AUC24) With Median (Range) for ARVs and TB Drugs

PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (IQR) for ARVs and TB Drugs

PK Parameter: Maximum Concentration (Cmax) in mg/L With Median (IQR) for ARVs and TB Drugs

PK Parameter: Maximum Concentration (Cmax) in ng/mL With Median (95% CI) for ARVs and TB Drugs

PK Parameter: Maximum Concentration (Cmax) in ng/mL With Median (IQR) for ARVs and TB Drugs

PK Parameter: Trough Concentration (C12) With Geometric Mean (95% CI) for ARVs and TB Drugs

PK Parameter: Trough Concentration (C12) With Median (IQR) for ARVs and TB Drugs

PK Parameter: Trough Concentration (C12) With Median (Range) for ARVs and TB Drugs

PK Parameter: Trough Concentration (C24) With Median (IQR) for ARVs and TB Drugs

PK Parameter: Trough Concentration (C24) With Median (Range) for ARVs and TB Drugs

PK Parameter: Trough Concentration (C24) With Median (Range) for ARVs and TB Drugs

Area Under the Plasma Concentration-time Curve From Time Zero (Pre-dose) Extrapolated to Infinite Time (AUC[0-inf]) and Over 24 Hours (AUC[0-24]) of GSK1349572 Following Dose Administration on Day 1

Change From Baseline in Mean Blood Pressure at Days 1, 4, 7, and 10

Change From Baseline in Mean Heart Rate at Days 1, 4, 7, and 10

Maximum Observed Plasma Concentration (Cmax) and Concentration at 24 Hours Post Dose (C24) of GSK1349572 Following Dose Administration on Day 1

Number of Participants Who Received the Indicated Concomitant Medications During the Study Period

Number of Participants With Abnormal Electrocardiogram (ECG) Findings

Number of Participants With Any Non-serious Adverse Event (AE) or Serious Adverse Event (SAE)

Number of Participants With HIV-1 RNA <400 Copies/mL and <50 Copies/mL

Number of Participants With the Indicated Grade 3 and Grade 4 Laboratory Abnormalities

Pre-dose Concentration (C0), Concentration at the End of the Dosing Interval (Ctau), Minimum Observed Concentration During One Dosing Interval (Cmin), and Maximum Obsevered Plasma Concentration (Cmax) of GSK1349572 Following the Last Repeat Administration

Time to Maximum Observed Concentration (Tmax) and Absorption Lag Time (Tlag) of GSK1349572 Following Dose Administration on Day 1

Median Change From Baseline in Plasma HIV-1 RNA to Nadir (Maximum Change) at Day 11

Number of Participants With the Emergence of Drug Resistance Mutations

Median Change From Baseline in Cluster of Differentiation 4+ (CD4+) Cell Count at Day 11

Mean Change From Baseline in Plasma HIV-1 RNA to Nadir (Maximum Change) at Day 11

Mean Change From Baseline in Plasma HIV-1 RNA Levels During the Follow-up Period (Days 11 to 21)

Change From Baseline in Plasma Human Immunodeficiency Virus-1 (HIV-1) Ribonucleic Acid (RNA) at Day 11

Area Under the Concentration-time Curve Over the Dosing Interval (AUC[0-tau]) of GSK1349572 Following the Last Repeat Administration on Day 10

Apparent Clearance (CL/F) of GSK1349572 Following Dose Administration on Day 10

Apparent Clearance (CL/F) of GSK1349572 Following Dose Administration on Day 1

Plasma HIV-1 RNA Rate of Decline Over 10 Days

Median Change From Baseline in Plasma HIV-1 RNA Levels During the Follow-up Period (Days 11 to 21)