dolutegravir profile

ID Source	ID
PubMed CID	54726191
CHEMBL ID	1229211
SCHEMBL ID	82071
CHEBI ID	76010
MeSH ID	M0562621

Synonym
HY-13238
dolutegravir ,
chebi:76010 ,
s-349572
bdbm50062551
gsk1349572
gsk-1349572
s/gsk-1349572
1051375-16-6
dolutegravir (usan)
D10066
BCP9000620
S/GSK1349572 ,
dolutegravir [usan:inn]
s-gsk1349572
hsdb 8152
dko1w9h7m1 ,
2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide, n-((2,4-difluorophenyl)methyl)-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-, (4r,12as)-
gsk 1349572
unii-dko1w9h7m1
CHEMBL1229211
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-pyrido[1',2':4,5]pyrazino[2,1-b][1,3]oxazine-9-carboxamide
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.0^{3,8}]tetradeca-10,13-diene-13-carboxamide
s/gsk1349572,gsk1349572
NCGC00346629-01
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-7-hydroxy-4-methyl-6,8-dioxo-3,4,12,12a-tetrahydro-2h-pyrido[[?]:[?]]pyrazino[[?]][1,3]oxazine-9-carboxamide
CS-0454
dolutegravir [mi]
dolutegravir [inn]
dolutegravir [vandf]
(4r,12.alpha.s)-n-((2,4-difluorophenyl)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12.alpha.-hexahydro-2h-pyrido(1',2':4,5)pyrazino(2,1-.beta.)(1,3)oxazine-9-carboxamide
dolutegravir [usan]
dolutegravir [who-dd]
S2667
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2h-pyrido[1',2':4,5]pyrazino[2,1-b][1,3]oxazine-9-carboxamide
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-7-hydroxy-4-methyl-6,8-dioxo-3,4,12,12a-tetrahydro-2h-pyrido[5,6]pyrazino[2,6-b][1,3]oxazine-9-carboxamide
gtpl7365
DB08930
SCHEMBL82071
smr004702915
MLS006011137
3S3M
3S3N
3S3O
(4r,12as)-n-[(2,4-difluorophenyl)methyl]-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2h-pyrido[1',2':4,5]pyrazino[2,1-b][1 ,3]oxazine-9-carboxamide
J-501471
dolutegravir (gsk1349572)
AC-28371
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-[1,3]oxazino[3,2-a]pyrido[1,2-d]pyrazine-9-carboxamide
AKOS025396657
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.03,8]tetradeca-10,13-diene-13-carboxamide
mfcd20488027
RHWKPHLQXYSBKR-BMIGLBTASA-N
1051375-16-6 (free)
EX-A1695
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide
soltegravir
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.0(3),?]tetradeca-10,13-diene-13-carboxamide
AS-75277
Q937224
CCG-268876
NCGC00346629-02
DTXSID90909356
A854801
dolutegravir dtg
(4r,12as)-n-((2,4-difluorophenyl)methyl)-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide
dolutegravirum
(4r,12as)-n-
(4r,9as)-5-hydroxy-4-methyl-6,10-dioxo-3,4,6,9,9a,10-hexahydro-2h-1-oxa-4a,8a-diazaanthracene-7-carboxylic acid 2,4-difluorobenzylamide
(4r,9as)-5-hydroxy-4-methyl-6,10-dioxo-3,4,6,9,9a,10-hexahydro-2h-1-oxa-4a,8a-diaza-anthracene-7-carboxylic acid-2,4 difluorobenzylamide
(4r,12as)-n-(2,4-difluorobenzyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide
j05ax12
(4r,12alphas)-n-((2,4-difluorophenyl)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12alpha-hexahydro-2h-pyrido(1',2':4,5)pyrazino(2,1-beta)(1,3)oxazine-9-carboxamide
2h-pyrido(1',2':4,5)pyrazino(2,1-b)(1,3)oxazine-9-carboxamide, n-((2,4-difluorophenyl)methyl)-3,4,6,8,12,12a-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-, (4r,12as)
Z2235801952
EN300-7409916
(3s,7r)-n-[(2,4-difluorophenyl)methyl]-11-hydroxy-7-methyl-9,12-dioxo-4-oxa-1,8-diazatricyclo[8.4.0.0,3,8]tetradeca-10,13-diene-13-carboxamide

Role	Description
HIV-1 integrase inhibitor	An inhibitor of HIV-1 integrase, an enzyme required for the integration of the genetic material of the retrovirus into the DNA of the infected cells.

Class	Description
monocarboxylic acid amide	A carboxamide derived from a monocarboxylic acid.
organic heterotricyclic compound	An organic tricyclic compound in which at least one of the rings of the tricyclic skeleton contains one or more heteroatoms.
secondary carboxamide	A carboxamide resulting from the formal condensation of a carboxylic acid with a primary amine; formula RC(=O)NHR(1).
difluorobenzene	Any member of the class of fluorobenzenes containing a mono- or poly-substituted benzene ring carrying two fluorine atoms.

Protein	Taxonomy	Measurement	Average (mM)	Bioassay(s)
Fumarate hydratase	Homo sapiens (human)	Potency	37.2212	AID1347053
EWS/FLI fusion protein	Homo sapiens (human)	Potency	19.0694	AID1259252; AID1259253; AID1259255; AID1259256
polyprotein	Zika virus	Potency	37.2212	AID1347053
Spike glycoprotein	Severe acute respiratory syndrome-related coronavirus	Potency	0.0096	AID1479148

Protein	Taxonomy	Measurement	Average (mM)	Bioassay(s)
Chain A, PFV integrase	Human spumaretrovirus	IC50	0.0517	AID977608
Chain A, PFV integrase	Human spumaretrovirus	IC50	0.0517	AID977608
Chain A, PFV integrase	Human spumaretrovirus	IC50	0.0517	AID977608
Solute carrier family 22 member 2	Homo sapiens (human)	IC50	1.9000	AID1211974
Cytochrome P450 1A2	Homo sapiens (human)	IC50	90.0000	AID1212007
ATP-dependent translocase ABCB1	Homo sapiens (human)	IC50	95.0000	AID1211968; AID1212007
Cytochrome P450 3A4	Homo sapiens (human)	IC50	67.0000	AID1212009
Cytochrome P450 2C8	Homo sapiens (human)	IC50	90.0000	AID1212007
Cytochrome P450 2D6	Homo sapiens (human)	IC50	90.0000	AID1212007; AID1212008
Cytochrome P450 2A6	Homo sapiens (human)	IC50	100.0000	AID1211999
Cytochrome P450 2C9	Homo sapiens (human)	IC50	90.0000	AID1212008
UDP-glucuronosyltransferase 1A1	Homo sapiens (human)	IC50	100.0000	AID1211999
Cytochrome P450 2C19	Homo sapiens (human)	IC50	67.0000	AID1212009
Sigma intracellular receptor 2	Homo sapiens (human)	Ki	0.0180	AID1655661
Sigma intracellular receptor 2	Rattus norvegicus (Norway rat)	Ki	0.0238	AID1824523; AID1877931
Sigma non-opioid intracellular receptor 1	Cavia porcellus (domestic guinea pig)	Ki	0.0975	AID1191388; AID1877932
Vesicular acetylcholine transporter	Rattus norvegicus (Norway rat)	Ki	4.5230	AID1506088
Reverse transcriptase/RNaseH	Human immunodeficiency virus 1	IC50	10.0000	AID1406290; AID1602241; AID1635810
Integrase	Human immunodeficiency virus 1	IC50	0.0414	AID1406292; AID1588917; AID1602243; AID1635801; AID759973
Canalicular multispecific organic anion transporter 1	Homo sapiens (human)	IC50	95.0000	AID1211970; AID1212008
Solute carrier organic anion transporter family member 1B3	Homo sapiens (human)	IC50	100.0000	AID1211972
Broad substrate specificity ATP-binding cassette transporter ABCG2	Homo sapiens (human)	IC50	48.5000	AID1211969; AID1212009
Solute carrier organic anion transporter family member 1B1	Homo sapiens (human)	IC50	100.0000	AID1211971

Protein	Taxonomy	Measurement	Average (mM)	Bioassay(s)
Integrase	Human immunodeficiency virus 2	EC50	0.0023	AID1603996
Integrase	Human immunodeficiency virus 1	EC50	0.0034	AID1604009; AID1604010; AID1604011; AID1604012

Protein	Taxonomy	Measurement	Average (mM)	Bioassay(s)
UDP-glucuronosyltransferase 1A1	Homo sapiens (human)	Km	21.0000	AID1211925

Assay ID	Title	Year	Journal	Article
AID1211972	Inhibition of human OATP1B3 expressed in BacMam baculovirus virus infected HEK MSR2 cells using [3H]estradiol 17beta-D-glucuronide as substrate by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604000	Inhibition of HIV-2 ROD9 integrase Y143C mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1073335	Antiviral activity against HIV-1 harboring integrase T97A mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1073332	Antiviral activity against HIV-1 harboring integrase G140S mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1073324	Antiviral activity against HIV-1 harboring integrase T66I/R263K double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211953	Activity at human BCRP expressed in MDCK2 cells assessed as apical efflux ratio by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604008	Inhibition of HIV-2 ROD9 integrase T97A/N155H double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1300996	Selectivity ratio of EC50 for raltegravir resistant HIV1 harboring integrase Q148H mutant infected in human MT4 cells to EC50 for wild type HIV1 3B infected in human MT4 cells	2016	European journal of medicinal chemistry, Jul-19, Volume: 117ISSN: 1768-3254	2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs) as human immunodeficiency virus type 1 integrase inhibitors: Influence of the alkylcarboxamide substitution of position 4.
AID1635806	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 1556-1 expressing integrase Y143C mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1211951	Activity at human MDR1 expressed in MDCK2 cells assessed as apical efflux ratio at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212014	Inhibition of CYP3A4 in human liver microsomes using atorvastatin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211950	Activity at human MDR1 expressed in MDCK2 cells assessed as apical efflux ratio at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073318	Antiviral activity against HIV-1 harboring integrase T97A/Y143C double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1191388	Displacement of (+)-[3H]pentazocine from guinea pig brain cortex sigma1 receptor by scintillation analyzer	2015	European journal of medicinal chemistry, Jan-27, Volume: 90ISSN: 1768-3254	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1073337	Antiviral activity against HIV-1 harboring integrase T66R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211964	In vitro passive membrane permeability across dog MDCK2 cells at 3 uM using fasted state-simulated intestinal fluid buffer at pH 7.4 on donor side and 1% human serum albumin at pH 7.4 on receiver side by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635807	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 4736-2 expressing integrase N155H mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1211946	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A4-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211936	Drug metabolism in supersomes expressing human recombinant CYP2B6 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211981	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human OCT2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212006	Drug excretion in human feces at 20 mg, po	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211949	Drug metabolism assessed as UDPGA-fortified human recombinant UGT2B7-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073334	Antiviral activity against HIV-1 harboring integrase G118R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211916	Drug metabolism assessed as UDPGA-fortified human recombinant UGT2B15-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211956	Activity at human BCRP expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211944	Inhibition of CYP2C8 in human liver microsomes using rosiglitazone as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212010	Protein binding in plasma (unknown origin)	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483418	Cytotoxicity against human P4R5 cells by MTS assay	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12 ISSN: 1520-4804	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1211983	Ratio of drug level in human 250 ml gastrointestinal volume at 50 mg administered as daily dose to IC50 for human BCRP	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073331	Antiviral activity against HIV-1 harboring integrase Y143C mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1406292	Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by HTS assay	2018	European journal of medicinal chemistry, Aug-05, Volume: 156ISSN: 1768-3254	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1212025	Metabolism-dependent inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073317	Antiviral activity against HIV-1 harboring integrase T97A/Y143R double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211978	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human OATP1B1	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155173	Antiviral activity against HIV-1 harboring wild type integrase infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID759973	Inhibition of HIV-1 integrase strand transfer activity using [3H]-DNA as substrate preincubated for 60 mins prior to substrate addition measured after 25 to 45 mins	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1212021	Metabolism-dependent inhibition of CYP1A2 in human liver microsomes using phenacetin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211992	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211922	Drug metabolism in UDPGA-fortified human liver microsomes assessed as UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1191391	Displacement of [3H]MK801 from pig brain cortex NMDA receptor PCP binding site at 1 uM by scintillation analyzer	2015	European journal of medicinal chemistry, Jan-27, Volume: 90ISSN: 1768-3254	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1212013	Inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211995	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1270893	Inhibition of HIV integrase-mediated strand transfer activity using precleaved 19T duplex oligonucleotide after 2 hrs	2015	European journal of medicinal chemistry, Dec-01, Volume: 106ISSN: 1768-3254	Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
AID1211966	Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine at 30 uM after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212000	Inhibition of human recombinant UGT2B7 expressed in supersomes assessed as 7-HFC glucuronidation up to 100 uM by fluoresence analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211937	Drug metabolism in supersomes expressing human recombinant CYP2C8 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211938	Drug metabolism in supersomes expressing human recombinant CYP2C9 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211968	Inhibition of MDR1 (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [3H]digoxin after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1603997	Inhibition of HIV-2 ROD9 integrase E92Q mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211987	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A3-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211930	Drug metabolism in NADPH-fortified human liver microsomes assessed as metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide) formati	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1603998	Inhibition of HIV-2 ROD9 integrase T97A mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID759977	Antiviral activity against Human immunodeficiency virus harboring integrase Q148K mutant infected in human HeLa cells expressing CD4 after 2 days by beta galactosidase assay relative to wild type HIV	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID759971	Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells after 4 to 5 days by bioluminescence assay	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1212027	Metabolism-dependent inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1603996	Inhibition of wild type HIV-2 ROD9 integrase	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211982	Ratio of drug level in human 250 ml gastrointestinal volume at 50 mg administered as daily dose to IC50 for human P-gp	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073328	Antiviral activity against HIV-1 harboring integrase Q148K mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1406291	Inhibition of HIV1 reverse transcriptase polymerase activity using 18 nucleotide DNA primer and 100 nucleotide DNA template after 30 mins	2018	European journal of medicinal chemistry, Aug-05, Volume: 156ISSN: 1768-3254	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1212017	Inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212022	Metabolism-dependent inhibition of CYP2A6 in human liver microsomes using coumarin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483415	Inhibition of HIV integrase strand transfer activity expressed in Escherichia coli BL21 (DE3) using 5' biotin ATGTGGAAAATCTCTAGCA primer annealed with ACTGCTAGAGATTTTCCACAT 3' Cy5 template preincubated for 10 mins followed by primer/template addition meas	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12 ISSN: 1520-4804	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1212019	Inhibition of CYP2D6 in human liver microsomes using bufuralol as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211997	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID759972	Antiviral activity against Human immunodeficiency virus 1 Ba-L infected human PBMC after 7 days by [methyl-3H]dTTP incorporation assay	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1211923	Drug metabolism in UDPGA-fortified human liver microsomes assessed as UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1655661	Displacement of [3H]-di-o-tolylguanidine from sigma2 receptor (unknown origin) incubated for 1 hr in presence of (+)SKF10047 by liquid scintillation counting method	2020	ACS medicinal chemistry letters, May-14, Volume: 11, Issue:5 ISSN: 1948-5875
AID1689343	Antiviral activity against HIV1 3B	2020	European journal of medicinal chemistry, Mar-01, Volume: 189ISSN: 1768-3254	Synthesis, biological evaluation and in silico modeling of novel integrase strand transfer inhibitors (INSTIs).
AID1602241	Inhibition of HIV1 reverse transcriptase RNase H expressed in Escherichia coli JM109 using RNA/DNA duplex substrate HTS-1	2019	European journal of medicinal chemistry, Mar-15, Volume: 166ISSN: 1768-3254	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID1602243	Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins	2019	European journal of medicinal chemistry, Mar-15, Volume: 166ISSN: 1768-3254	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID1604004	Inhibition of HIV-2 ROD9 integrase E92Q/Y143C double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1155176	Antiviral activity against raltegravir-resistant HIV-1 harboring integrase G140S/Q148H double mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1604005	Inhibition of HIV-2 ROD9 integrase T97A/Y143C double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211925	Drug metabolism assessed as human recombinant UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)-3,4,5-trihydrox	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073325	Antiviral activity against HIV-1 harboring integrase R263K mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1506086	Displacement of (+)-[3H]pentazocine from sigma1 receptor in rat brain membranes after 60 mins by liquid scintillation counting method	2018	Journal of medicinal chemistry, Aug-09, Volume: 61, Issue:15 ISSN: 1520-4804	Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
AID1073323	Antiviral activity against HIV-1 harboring integrase E92Q/N155H double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211991	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211958	Activity at human MDR1 expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211961	Activity at human BCRP expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211954	Activity at human MDR1 expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID759978	Antiviral activity against pseudo Human immunodeficiency virus infected in HEK293T cells after 2 days in presence of human serum albumin	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1211943	Inhibition of CYP2B6 in human liver microsomes using bupropion as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211998	Inhibition of human recombinant UGT1A1 expressed in supersomes assessed as scopoletin glucuronidation at 100 uM by fluorescence analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211963	In vitro passive membrane permeability across dog MDCK2 cells at 3 uM using fasted state-simulated intestinal fluid buffer at pH 5.5 on donor side and 1% human serum albumin at pH 7.4 on receiver side by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212020	Inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212018	Inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073336	Antiviral activity against HIV-1 harboring integrase E92Q mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1406290	Inhibition of HIV1 reverse transcriptase RNaseH activity using 3'-fluorescein/5'-Dabcyl labeled HTS-1 substrate	2018	European journal of medicinal chemistry, Aug-05, Volume: 156ISSN: 1768-3254	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1211984	Ratio of drug level in human 250 ml gastrointestinal volume at 50 mg administered as daily dose to IC50 for human MRP2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073322	Antiviral activity against HIV-1 harboring integrase E138K/Q148H double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1212008	Inhibition of human MRP2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483417	Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 cells assessed as inhibition of viral replication preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene ass	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12 ISSN: 1520-4804	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1635805	Antiviral activity against HIV1 infected in human P4R5 cells assessed as reduction of virus replication preincubated with cells for 24 hrs followed by viral infection for 48 hrs by 4-methylumbelliferylgalactoside-based MAGI assay	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1483413	Inhibition of recombinant full length HIV1 reverse transcriptase RNase H domain using RNA/DNA duplex substrate HTS1 assessed as reduction in internal cleavage of RNA strand by fluoresence assay	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12 ISSN: 1520-4804	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1824523	Displacement of [3H]DTG from sigma 2 receptor in Wistar Han rat liver membranes measured after 120 mins by scintillation counting method	2022	European journal of medicinal chemistry, Jan-15, Volume: 228ISSN: 1768-3254	Development of novel phenoxyalkylpiperidines as high-affinity Sigma-1 (σ
AID1602244	Antiviral activity against HIV-1 infected in human P4R5 cells assessed as reduction in viral replication preincubated for 24 hrs followed by viral infection and measured after 48 hrs by MAGI assay	2019	European journal of medicinal chemistry, Mar-15, Volume: 166ISSN: 1768-3254	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID1603999	Inhibition of HIV-2 ROD9 integrase G140S mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1073321	Antiviral activity against HIV-1 harboring integrase E138K/Q148K double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1212026	Metabolism-dependent inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604010	Inhibition of HIV-1 NL4-3 integrase T97A/Y143C double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1212009	Inhibition of human BCRP	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211917	Drug metabolism in human hepatocytes assessed as DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)-3,4,5-trihydroxytetr	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211980	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human MRP2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1300997	Selectivity ratio of EC50 for raltegravir resistant HIV1 harboring integrase N155H mutant infected in human MT4 cells to EC50 for wild type HIV1 3B infected in human MT4 cells	2016	European journal of medicinal chemistry, Jul-19, Volume: 117ISSN: 1768-3254	2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs) as human immunodeficiency virus type 1 integrase inhibitors: Influence of the alkylcarboxamide substitution of position 4.
AID1155175	Antiviral activity against raltegravir-resistant HIV-1 harboring integrase N155H mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1211999	Inhibition of human recombinant UGT1A1 expressed in supersomes assessed as scopoletin glucuronidation by fluorescence analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211967	Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine at 100 uM after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212024	Metabolism-dependent inhibition of CYP2C8 in human liver microsomes using rosiglitazone as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211952	Activity at human BCRP expressed in MDCK2 cells assessed as apical efflux ratio at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1380353	Lipophilicity, log D of the compound at pH 7.4 by chromatographic method	2018	Journal of medicinal chemistry, 08-09, Volume: 61, Issue:15 ISSN: 1520-4804	Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
AID1211965	Inhibition of MDR1 (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [3H]digoxin at 100 uM after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073333	Antiviral activity against HIV-1 harboring integrase E138K mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1604003	Inhibition of HIV-2 ROD9 integrase N155H mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211969	Inhibition of BCRP (unknown origin) expressed in MDCK2 cells assessed as basolateral to apical transport of [14C]cimetidine after 90 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212016	Inhibition of CYP2B6 in human liver microsomes using bupropion as substrate at 100 uM preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635808	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 8070-1 expressing integrase G140S/Y143H/Q148H mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1212002	Induction of CYP2B6 mRNA expression in human hepatocytes at 1 to 40 uM after 48 hrs by real time PCR analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635810	Inhibition of RNase H activity of full length HIV1 reverse transcriptase using RNA-DNA duplex HTS-1 substrate	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1191390	Selectivity ratio of Ki for rat liver sigma2 receptor to Ki for guinea pig brain cortex sigma1 receptor	2015	European journal of medicinal chemistry, Jan-27, Volume: 90ISSN: 1768-3254	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1211929	Drug metabolism in supersomes expressing human recombinant CYP3A4 assessed as NADPH-fortified enzyme-mediated metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyri	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1877931	Displacement of [3H]-DTG from Sprague-Dawley rat liver Sigma 2 receptor incubated for 120 mins in presence of [3H]-(+)-pentazocine by liquid scintillation counting analysis	2022	European journal of medicinal chemistry, Feb-15, Volume: 230ISSN: 1768-3254	Dual Sigma-1 receptor antagonists and hydrogen sulfide-releasing compounds for pain treatment: Design, synthesis, and pharmacological evaluation.
AID1211933	Drug metabolism in supersomes expressing human recombinant CYP3A4 assessed as for NADPH-fortified enzyme-mediated metabolite M1 ((4R,12aS)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide) for	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155174	Antiviral activity against raltegravir-resistant HIV-1 harboring integrase Y143R mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1212029	Metabolism-dependent inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211927	Drug metabolism assessed as intrinsic clearance for human recombinant UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604011	Inhibition of HIV-1 NL4-3 integrase G140S/Q148R double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1211957	Activity at human BCRP expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211962	In vitro passive membrane permeability from basolateral to apical side of dog MDCK2 cells at 3 uM using Dulbecco's modified Eagle's medium as transport buffer at pH 7.4 on both donor and receiver side by liquid scintillation counting analysis in presence	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155179	Ratio of EC50 for raltegravir-resistant HIV-1 harboring integrase G140S/Q148H double mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1212004	Drug excretion in human urine at 20 mg, po	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635809	Fold resistance, ratio of EC50 for raltegravir-resistant HIV1 8070-2 expressing integrase G140S/Q148H mutant to EC50 for HIV1 expressing wild-type integrase	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1211971	Inhibition of human OATP1B1 expressed in CHO cells using [3H]estradiol 17beta-D-glucuronide as substrate by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID759979	Antiviral activity against pseudo Human immunodeficiency virus infected in HEK293T cells after 2 days	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1211942	Inhibition of CYP2A6 in human liver microsomes using coumarin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211975	Inhibition of human OCT2 expressed in MDCK2 cells using [14C]metformin as substrate at 25 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211970	Inhibition of human MRP2 expressed in baculovirus-infected Sf9 cell membrane vesicle using [3H]estradiol 17beta-D-glucuronide as substrate preincubated with vesicles for 5 mins prior to substrate addition by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211928	Drug metabolism in supersomes expressing human recombinant CYP3A4 assessed as intrinsic clearance for NADPH-fortified enzyme-mediated metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483414	Inhibition of recombinant full length HIV1 reverse transcriptase polymerase domain assessed as decrease in extension of 18 nucleotide DNA primer annealed to 100 nucleotide DNA template after 30 mins	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12 ISSN: 1520-4804	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1211921	Drug metabolism in UDPGA-fortified human liver microsomes assessed as DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211974	Inhibition of human OCT2 expressed in MDCK2 cells using [14C]metformin as substrate by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211994	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073319	Antiviral activity against HIV-1 harboring integrase G140S/Q148K double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211948	Drug metabolism assessed as UDPGA-fortified human recombinant UGT2B4-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211939	Drug metabolism in supersomes expressing human recombinant CYP2C19 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211926	Drug metabolism assessed as human recombinant UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)-3,4,5-trihydrox	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211979	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human OTAP1B3	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211976	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human P-gp	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604007	Inhibition of HIV-2 ROD9 integrase E92Q/N155H double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1155180	Antiviral activity against INSTI-resistant HIV-1 harboring integrase R263K mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1212023	Metabolism-dependent inhibition of CYP2B6 in human liver microsomes using bupropion as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212011	Inhibition of CYP2C9 in human liver microsomes using diclofenac as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1270894	Inhibition of HIV integrase-mediated strand transfer activity using 5'-[gamma-32P]-labeled full length 21T DNA at 50 nM after 2 hrs	2015	European journal of medicinal chemistry, Dec-01, Volume: 106ISSN: 1768-3254	Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
AID1073327	Antiviral activity against HIV-1 harboring integrase Q148R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211941	Inhibition of CYP1A2 in human liver microsomes using phenacetin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155183	Ratio of EC50 for INSTI-resistant HIV-1 harboring integrase G118R mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1211947	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A6-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211955	Activity at human MDR1 expressed in MDCK2 cells assessed as apical to basolateral mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155177	Ratio of EC50 for raltegravir-resistant HIV-1 harboring integrase Y143R mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1211919	Drug metabolism in UDPGA-fortified human liver microsomes assessed as DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-7-yloxy)	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211959	Activity at human MDR1 expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211935	Drug metabolism in supersomes expressing human recombinant CYP1A2 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212015	Inhibition of CYP3A4 in human liver microsomes using nifedipine as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1655660	Displacement of [3H]-(+)-pentazocine from sigma1 receptor in guinea pig brain membranes incubated for 1 hr by liquid scintillation counting method	2020	ACS medicinal chemistry letters, May-14, Volume: 11, Issue:5 ISSN: 1948-5875
AID1211924	Drug metabolism in UDPGA-fortified human liver microsomes assessed as intrinsic clearance for UGT1A1-mediated DTG glucuronide M2 ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1506087	Displacement of [3H]DTG from sigma2 receptor in rat liver membranes after 60 mins by liquid scintillation counting method	2018	Journal of medicinal chemistry, Aug-09, Volume: 61, Issue:15 ISSN: 1520-4804	Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
AID1604002	Inhibition of HIV-2 ROD9 integrase Q148R mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1212003	Induction of CYP3A4 mRNA expression in human hepatocytes at 1 to 40 uM after 48 hrs by real time PCR analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155181	Antiviral activity against INSTI-resistant HIV-1 harboring integrase G118R mutant infected in human HOS cells pretreated with compound for 3 hrs by single-round HIV-1 infectivity assay	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1270892	Inhibition of HIV integrase-mediated 3'-processing activity using 5'-[gamma-32P]-labeled full length 21T DNA after 2 hrs	2015	European journal of medicinal chemistry, Dec-01, Volume: 106ISSN: 1768-3254	Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
AID1211940	Drug metabolism in supersomes expressing human recombinant CYP2D6 assessed as NADPH-fortified enzyme-mediated metabolite formation at 5 uM after 120 mins by radio HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211932	Drug metabolism in NADPH-fortified human liver microsomes assessed as metabolite M3 ((4R,12aS)-N-((3,5-difluorophenyl)(hydroxy)methyl)-7-hydroxy-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazine-9-carboxamide) formati	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073330	Antiviral activity against HIV-1 harboring integrase Y143R mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1212007	Inhibition of human MDR1	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1406293	Selectivity index, ratio of IC50 for HIV integrase strand transfer activity to IC50 for HIV1 reverse transcriptase RNaseH activity	2018	European journal of medicinal chemistry, Aug-05, Volume: 156ISSN: 1768-3254	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1073329	Antiviral activity against HIV-1 harboring integrase Q148H mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1212028	Metabolism-dependent inhibition of CYP3A4 in human liver microsomes using atorvastatin as substrate preincubated for 20 mins with NADPH prior to initiation of reaction with probe substrate by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211989	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A9-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1212012	Inhibition of CYP2C19 in human liver microsomes using S-mephenytoin as substrate preincubated for 20 mins with substrate prior to initiation of reaction with NADPH by HPLC analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1073326	Antiviral activity against HIV-1 harboring integrase N155H mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211977	Ratio of peak plasma concentration in human at 50 mg administered as daily dose to IC50 for human BCRP	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211973	Inhibition of human OCT1 expressed in HEK293 cells using [14C]metformin as substrate at 10 uM after 10 mins by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604006	Inhibition of HIV-2 ROD9 integrase G140S/Q148R double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1191389	Displacement of [3H]DTG from rat liver sigma2 receptor by scintillation analyzer	2015	European journal of medicinal chemistry, Jan-27, Volume: 90ISSN: 1768-3254	Improving selectivity preserving affinity: new piperidine-4-carboxamide derivatives as effective sigma-1-ligands.
AID1073320	Antiviral activity against HIV-1 harboring integrase G140S/Q148H double mutant relative to wild type HIV1	2014	Journal of medicinal chemistry, Feb-13, Volume: 57, Issue:3 ISSN: 1520-4804	Inhibiting the HIV integration process: past, present, and the future.
AID1211985	Drug metabolism assessed as UDPGA-fortified human recombinant UGT1A1-mediated DTG glucuronide metabolite ((2S,3S,4S,5R,6S)-6-((4R,12aS)-9-(2,4-difluorobenzylcarbamoyl)-4-methyl-6,8-dioxo-3,4,6,8,12,12a-hexahydro-2H-[1,3]oxazino[3,2-d]pyrido[1,2-a]pyrazin-	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1155182	Ratio of EC50 for INSTI-resistant HIV-1 harboring integrase R263K mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1155178	Ratio of EC50 for raltegravir-resistant HIV-1 harboring integrase N155H mutant infected in human HOS cells to EC50 for HIV-1 harboring integrase wild type integrase infected in human HOS cells	2014	Journal of medicinal chemistry, Jun-26, Volume: 57, Issue:12 ISSN: 1520-4804	4-amino-1-hydroxy-2-oxo-1,8-naphthyridine-containing compounds having high potency against raltegravir-resistant integrase mutants of HIV-1.
AID1604009	Inhibition of wild type HIV-1 NL4-3 integrase	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1588917	Inhibition of HIV integrase strand transfer activity	2019	Bioorganic & medicinal chemistry, 09-01, Volume: 27, Issue:17 ISSN: 1464-3391	Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
AID1211990	Activity at human MDR1 expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1604001	Inhibition of HIV-2 ROD9 integrase Q148H mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1877932	Displacement of [3H]-(+)-pentazocine from Dunkin-Hartley guinea pig brain cortex Sigma 1 receptor incubated for 150 mins by liquid scintillation counting analysis	2022	European journal of medicinal chemistry, Feb-15, Volume: 230ISSN: 1768-3254	Dual Sigma-1 receptor antagonists and hydrogen sulfide-releasing compounds for pain treatment: Design, synthesis, and pharmacological evaluation.
AID1604012	Inhibition of HIV-1 NL4-3 integrase E92Q/N155H double mutant	2019	European journal of medicinal chemistry, Nov-01, Volume: 181ISSN: 1768-3254	Synthetic routes and structure-activity relationships (SAR) of anti-HIV agents: A key review.
AID1212001	Induction of CYP1A2 mRNA expression in human hepatocytes at 1 to 40 uM after 48 hrs by real time PCR analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1635801	Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay	2016	Journal of medicinal chemistry, 07-14, Volume: 59, Issue:13 ISSN: 1520-4804	3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
AID1506088	Displacement of (-)-[3H]vesamicol from rat VAChT expressed in rat PC12 cell membranes after 60 mins by liquid scintillation counting method	2018	Journal of medicinal chemistry, Aug-09, Volume: 61, Issue:15 ISSN: 1520-4804	Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
AID1300998	Selectivity ratio of EC50 for raltegravir resistant HIV1 harboring integrase G140S/Q148H double mutant infected in human MT4 cells to EC50 for wild type HIV1 3B infected in human MT4 cells	2016	European journal of medicinal chemistry, Jul-19, Volume: 117ISSN: 1768-3254	2-hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs) as human immunodeficiency virus type 1 integrase inhibitors: Influence of the alkylcarboxamide substitution of position 4.
AID1211996	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from basolateral to apical side at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211960	Activity at human BCRP expressed in MDCK2 cells assessed as basolateral to apical mass balance at 3 uM by liquid scintillation counting analysis	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1211993	Activity at human BCRP expressed in MDCK2 cells assessed as rate of passive membrane permeability from apical to basolateral side at 3 uM by liquid scintillation counting analysis in presence of 3 uM P-gp and BCRP inhibitor GF120918	2013	Drug metabolism and disposition: the biological fate of chemicals, Feb, Volume: 41, Issue:2 ISSN: 1521-009X	In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor.
AID1483416	Selectivity index, ratio of IC50 for HIV integrase strand transfer activity to IC50 for recombinant full length HIV1 reverse transcriptase RNase H domain	2017	Journal of medicinal chemistry, 06-22, Volume: 60, Issue:12 ISSN: 1520-4804	Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
AID1602242	Inhibition of HIV1 reverse transcriptase polymerase using deoxynucleotide triphosphates and 18 nucleotide DNA primer annealed to 100 nucleotide DNA template after 30 mins	2019	European journal of medicinal chemistry, Mar-15, Volume: 166ISSN: 1768-3254	Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker.
AID759970	Antiviral activity against Human immunodeficiency virus 1 3B infected in human MT4 cells after 4 to 5 days by bioluminescence assay in presence of human serum relative to control	2013	Journal of medicinal chemistry, Jul-25, Volume: 56, Issue:14 ISSN: 1520-4804	Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
AID1406294	Antiviral activity against HIV1 infected in CD4/CXCR4/CCR5 expressing human P4R5 MAGI cells preincubated with cells for 24 hrs followed by viral infection measured after 48 hrs by beta-galactosidase reporter gene assay	2018	European journal of medicinal chemistry, Aug-05, Volume: 156ISSN: 1768-3254	6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity.
AID1347097	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Saos-2 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347104	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for RD cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347103	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for OHS-50 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347093	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for SK-N-MC cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347091	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for SJ-GBM2 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1296008	Cytotoxic Profiling of Annotated Libraries Using Quantitative High-Throughput Screening	2020	SLAS discovery : advancing life sciences R & D, 01, Volume: 25, Issue:1 ISSN: 2472-5560	Cytotoxic Profiling of Annotated and Diverse Chemical Libraries Using Quantitative High-Throughput Screening.
AID1347154	Primary screen GU AMC qHTS for Zika virus inhibitors	2020	Proceedings of the National Academy of Sciences of the United States of America, 12-08, Volume: 117, Issue:49 ISSN: 1091-6490	Therapeutic candidates for the Zika virus identified by a high-throughput screen for Zika protease inhibitors.
AID1347089	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for TC32 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347099	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for NB1643 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347090	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for DAOY cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1346987	P-glycoprotein substrates identified in KB-8-5-11 adenocarcinoma cell line, qHTS therapeutic library screen	2019	Molecular pharmacology, 11, Volume: 96, Issue:5 ISSN: 1521-0111	A High-Throughput Screen of a Library of Therapeutics Identifies Cytotoxic Substrates of P-glycoprotein.
AID1347106	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for control Hh wild type fibroblast cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347108	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Rh41 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347082	qHTS for Inhibitors of the Functional Ribonucleoprotein Complex (vRNP) of Lassa (LASV) Arenavirus: LASV Primary Screen - GLuc reporter signal	2020	Antiviral research, 01, Volume: 173ISSN: 1872-9096	A cell-based, infectious-free, platform to identify inhibitors of lassa virus ribonucleoprotein (vRNP) activity.
AID1347086	qHTS for Inhibitors of the Functional Ribonucleoprotein Complex (vRNP) of Lymphocytic Choriomeningitis Arenaviruses (LCMV): LCMV Primary Screen - GLuc reporter signal	2020	Antiviral research, 01, Volume: 173ISSN: 1872-9096	A cell-based, infectious-free, platform to identify inhibitors of lassa virus ribonucleoprotein (vRNP) activity.
AID1347101	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for BT-12 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347107	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Rh30 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347102	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for Rh18 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347096	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for U-2 OS cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347094	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for BT-37 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347095	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for NB-EBc1 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1508630	Primary qHTS for small molecule stabilizers of the endoplasmic reticulum resident proteome: Secreted ER Calcium Modulated Protein (SERCaMP) assay	2021	Cell reports, 04-27, Volume: 35, Issue:4 ISSN: 2211-1247	A target-agnostic screen identifies approved drugs to stabilize the endoplasmic reticulum-resident proteome.
AID1347092	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for A673 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1745845	Primary qHTS for Inhibitors of ATXN expression	2022	The Journal of biological chemistry, 08, Volume: 298, Issue:8 ISSN: 1083-351X
AID1347083	qHTS for Inhibitors of the Functional Ribonucleoprotein Complex (vRNP) of Lassa (LASV) Arenavirus: Viability assay - alamar blue signal for LASV Primary Screen	2020	Antiviral research, 01, Volume: 173ISSN: 1872-9096	A cell-based, infectious-free, platform to identify inhibitors of lassa virus ribonucleoprotein (vRNP) activity.
AID1347098	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for SK-N-SH cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347105	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for MG 63 (6-TG R) cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1347100	qHTS of pediatric cancer cell lines to identify multiple opportunities for drug repurposing: Primary screen for LAN-5 cells	2018	Oncotarget, Jan-12, Volume: 9, Issue:4 ISSN: 1949-2553	Quantitative high-throughput phenotypic screening of pediatric cancer cell lines identifies multiple opportunities for drug repurposing.
AID1346986	P-glycoprotein substrates identified in KB-3-1 adenocarcinoma cell line, qHTS therapeutic library screen	2019	Molecular pharmacology, 11, Volume: 96, Issue:5 ISSN: 1521-0111	A High-Throughput Screen of a Library of Therapeutics Identifies Cytotoxic Substrates of P-glycoprotein.
AID977608	Experimentally measured binding affinity data (IC50) for protein-ligand complexes derived from PDB	2011	Molecular pharmacology, Oct, Volume: 80, Issue:4 ISSN: 1521-0111	Structural and functional analyses of the second-generation integrase strand transfer inhibitor dolutegravir (S/GSK1349572).

Timeframe	Studies, This Drug (%)	All Drugs %
pre-1990	0 (0.00)	18.7374
1990's	0 (0.00)	18.2507
2000's	0 (0.00)	29.6817
2010's	614 (55.42)	24.3611
2020's	494 (44.58)	2.80

Publication Type	This drug (%)	All Drugs (%)
Trials	179 (15.87%)	5.53%
Reviews	119 (10.55%)	6.00%
Case Studies	95 (8.42%)	4.05%
Observational	58 (5.14%)	0.25%
Other	677 (60.02%)	84.16%

Substance	Classes	Roles	Relationship Strength
acetamide	acetamides; carboximidic acid; monocarboxylic acid amide; N-acylammonia		low
indoleacetamide	indoles; monocarboxylic acid amide; N-acylammonia	bacterial metabolite; fungal metabolite; plant metabolite	low
dihydrolipoamide	dithiol; monocarboxylic acid amide	cofactor; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	low
formamide	carboximidic acid; formamides; monocarboxylic acid amide; one-carbon compound	solvent	low
lipoamide	dithiolanes; monocarboxylic acid amide	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	low
pyrazinamide	monocarboxylic acid amide; N-acylammonia; pyrazines	antitubercular agent; prodrug	low
urea	isourea; monocarboxylic acid amide; one-carbon compound	Daphnia magna metabolite; Escherichia coli metabolite; fertilizer; flour treatment agent; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	low
pk 11195	aromatic amide; isoquinolines; monocarboxylic acid amide; monochlorobenzenes	antineoplastic agent	low
5-(n,n-hexamethylene)amiloride	aromatic amine; azepanes; guanidines; monocarboxylic acid amide; organochlorine compound; pyrazines	antineoplastic agent; apoptosis inducer; odorant receptor antagonist; sodium channel blocker	low
ethylisopropylamiloride	aromatic amine; guanidines; monocarboxylic acid amide; organochlorine compound; pyrazines; tertiary amino compound	anti-arrhythmia drug; neuroprotective agent; sodium channel blocker	low
acebutolol	aromatic amide; ethanolamines; ether; monocarboxylic acid amide; propanolamine; secondary amino compound	anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; sympathomimetic agent	low
acetazolamide	monocarboxylic acid amide; sulfonamide; thiadiazoles	anticonvulsant; diuretic; EC 4.2.1.1 (carbonic anhydrase) inhibitor	low
acetochlor	aromatic amide; monocarboxylic acid amide; organochlorine compound	environmental contaminant; herbicide; xenobiotic	low
alachlor	aromatic amide; monocarboxylic acid amide; organochlorine compound	environmental contaminant; herbicide; xenobiotic	low
alfuzosin	monocarboxylic acid amide; quinazolines; tetrahydrofuranol	alpha-adrenergic antagonist; antihypertensive agent; antineoplastic agent	low
ampiroxicam	acetal; aminopyridine; benzothiazine; etabonate ester; monocarboxylic acid amide; sulfonamide	analgesic; antirheumatic drug; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-steroidal anti-inflammatory drug; prodrug	low
atenolol	ethanolamines; monocarboxylic acid amide; propanolamine	anti-arrhythmia drug; antihypertensive agent; beta-adrenergic antagonist; environmental contaminant; sympatholytic agent; xenobiotic	low
benzquinamide	monocarboxylic acid amide	antiemetic; antipsychotic agent; H1-receptor antagonist; muscarinic antagonist; sedative	low
bicalutamide	(trifluoromethyl)benzenes; monocarboxylic acid amide; monofluorobenzenes; nitrile; sulfone; tertiary alcohol		low
carcinine	beta-alanine derivative; imidazoles; monocarboxylic acid amide; organonitrogen compound; organooxygen compound	antioxidant; crustacean metabolite	low
dacarbazine	imidazoles; monocarboxylic acid amide; triazene derivative	alkylating agent; antineoplastic agent; carcinogenic agent; prodrug	low
dibucaine	aromatic ether; monocarboxylic acid amide; tertiary amino compound	topical anaesthetic	low
dimethoate	monocarboxylic acid amide; organic thiophosphate	acaricide; agrochemical; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; environmental contaminant; insecticide; xenobiotic	low
disopyramide	monocarboxylic acid amide; pyridines; tertiary amino compound	anti-arrhythmia drug	low
doxazosin	aromatic amine; benzodioxine; monocarboxylic acid amide; N-acylpiperazine; N-arylpiperazine; quinazolines	alpha-adrenergic antagonist; antihyperplasia drug; antihypertensive agent; antineoplastic agent; vasodilator agent	low
etanidazole	C-nitro compound; imidazoles; monocarboxylic acid amide	alkylating agent; antineoplastic agent; prodrug; radiosensitizing agent	low
fentanyl	anilide; monocarboxylic acid amide; piperidines	adjuvant; anaesthesia adjuvant; anaesthetic; intravenous anaesthetic; mu-opioid receptor agonist; opioid analgesic	low
flecainide	aromatic ether; monocarboxylic acid amide; organofluorine compound; piperidines	anti-arrhythmia drug	low
flutamide	(trifluoromethyl)benzenes; monocarboxylic acid amide	androgen antagonist; antineoplastic agent	low
glipizide	aromatic amide; monocarboxylic acid amide; N-sulfonylurea; pyrazines	EC 2.7.1.33 (pantothenate kinase) inhibitor; hypoglycemic agent; insulin secretagogue	low
lidocaine	benzenes; monocarboxylic acid amide; tertiary amino compound	anti-arrhythmia drug; drug allergen; environmental contaminant; local anaesthetic; xenobiotic	low
leflunomide	(trifluoromethyl)benzenes; isoxazoles; monocarboxylic acid amide	antineoplastic agent; antiparasitic agent; EC 1.3.98.1 [dihydroorotate oxidase (fumarate)] inhibitor; EC 3.1.3.16 (phosphoprotein phosphatase) inhibitor; hepatotoxic agent; immunosuppressive agent; non-steroidal anti-inflammatory drug; prodrug; pyrimidine synthesis inhibitor; tyrosine kinase inhibitor	low
qx-314	monocarboxylic acid amide	local anaesthetic	low
loperamide	monocarboxylic acid amide; monochlorobenzenes; piperidines; tertiary alcohol	anticoronaviral agent; antidiarrhoeal drug; mu-opioid receptor agonist	low
modafinil	monocarboxylic acid amide; sulfoxide		low
deet	benzamides; monocarboxylic acid amide	environmental contaminant; insect repellent; xenobiotic	low
pipamperone	aromatic ketone; bipiperidines; monocarboxylic acid amide; organofluorine compound; tertiary amino compound	dopaminergic antagonist; first generation antipsychotic; serotonergic antagonist	low
prazosin	aromatic ether; furans; monocarboxylic acid amide; piperazines; quinazolines	alpha-adrenergic antagonist; antihypertensive agent; EC 3.4.21.26 (prolyl oligopeptidase) inhibitor	low
prilocaine	amino acid amide; monocarboxylic acid amide	anticonvulsant; local anaesthetic	low
propachlor	anilide; monocarboxylic acid amide; organochlorine compound	environmental contaminant; herbicide; xenobiotic	low
carbamylhydrazine	carbohydrazide; monocarboxylic acid amide; one-carbon compound; ureas		low
temozolomide	imidazotetrazine; monocarboxylic acid amide; triazene derivative	alkylating agent; antineoplastic agent; prodrug	low
lysergic acid diethylamide	ergoline alkaloid; monocarboxylic acid amide; organic heterotetracyclic compound	dopamine agonist; hallucinogen; serotonergic agonist	low
propionamide	monocarboxylic acid amide; primary fatty amide		low
n-methylacetamide	acetamides; monocarboxylic acid amide	metabolite	low
2-phenylacetamide	monocarboxylic acid amide	mouse metabolite	low
6-aminonicotinamide	aminopyridine; monocarboxylic acid amide; primary amino compound	antimetabolite; EC 1.1.1.44 (NADP(+)-dependent decarboxylating phosphogluconate dehydrogenase) inhibitor; teratogenic agent	low
aminoimidazole carboxamide	aminoimidazole; monocarboxylic acid amide	mouse metabolite	low
valeramide	monocarboxylic acid amide		low
devrinol	aromatic ether; monocarboxylic acid amide; naphthalenes		low
thiamphenicol	monocarboxylic acid amide; sulfone	antimicrobial agent; immunosuppressive agent	low
lisuride	monocarboxylic acid amide	antidyskinesia agent; antiparkinson drug; dopamine agonist; serotonergic agonist	low
dimethylacetamide	acetamides; monocarboxylic acid amide	human metabolite	low
benzonidazole	C-nitro compound; imidazoles; monocarboxylic acid amide	antiprotozoal drug	low
n-methyl-n-(trimethylsilyl)trifluoroacetamide	monocarboxylic acid amide; N-silyl compound; trifluoroacetamide	chromatographic reagent	low
ribavirin	1-ribosyltriazole; aromatic amide; monocarboxylic acid amide; primary carboxamide	anticoronaviral agent; antiinfective agent; antimetabolite; antiviral agent; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor	low
tocainide	monocarboxylic acid amide	anti-arrhythmia drug; local anaesthetic; sodium channel blocker	low
bezafibrate	aromatic ether; monocarboxylic acid amide; monocarboxylic acid; monochlorobenzenes	antilipemic drug; environmental contaminant; geroprotector; xenobiotic	low
closantel	aromatic amide; monocarboxylic acid amide; monochlorobenzenes; nitrile; organoiodine compound; phenols		low
alfentanil	monocarboxylic acid amide; piperidines	central nervous system depressant; intravenous anaesthetic; mu-opioid receptor agonist; opioid analgesic; peripheral nervous system drug	low
ranolazine	aromatic amide; monocarboxylic acid amide; monomethoxybenzene; N-alkylpiperazine; secondary alcohol		low
remifentanil	alpha-amino acid ester; anilide; monocarboxylic acid amide; piperidinecarboxylate ester	intravenous anaesthetic; mu-opioid receptor agonist; opioid analgesic; sedative	low
valsartan	biphenylyltetrazole; monocarboxylic acid amide; monocarboxylic acid	angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic	low
3-methylfentanyl	monocarboxylic acid amide; piperidines	mu-opioid receptor agonist; opioid analgesic; sedative	low
4-fluorofentanyl	monocarboxylic acid amide; organofluorine compound; piperidines		low
1,2,4-triazole-3-carboxamide	aromatic amide; monocarboxylic acid amide; primary carboxamide; triazoles	drug metabolite; human urinary metabolite	low
aloxistatin	epoxide; ethyl ester; L-leucine derivative; monocarboxylic acid amide	anticoronaviral agent; cathepsin B inhibitor	low
phenylacetylglycine	monocarboxylic acid amide; monocarboxylic acid; N-acylglycine	human metabolite; mouse metabolite	low
mandelamide	benzyl alcohols; monocarboxylic acid amide; secondary alcohol		low
5-(3-methyl-1-triazeno)imidazole-4-carboxamide	imidazoles; monocarboxylic acid amide; triazene derivative	alkylating agent; antineoplastic agent	low
biocytin	azabicycloalkane; L-alpha-amino acid zwitterion; L-lysine derivative; monocarboxylic acid amide; non-proteinogenic L-alpha-amino acid; thiabicycloalkane; ureas	mouse metabolite	low
biotinamide	biotins; monocarboxylic acid amide	human metabolite	low
lactamide	monocarboxylic acid amide; secondary alcohol		low
ribavirin 5'-diphosphate	1-ribosyltriazole; aromatic amide; monocarboxylic acid amide; primary carboxamide; ribose monophosphate	antiviral agent; drug metabolite; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; human blood serum metabolite	low
difenpiramide	biphenyls; monocarboxylic acid amide; pyridines	antipyretic; non-narcotic analgesic; non-steroidal anti-inflammatory drug	low
u 69593	monocarboxylic acid amide; N-alkylpyrrolidine; organic heterobicyclic compound; oxaspiro compound	anti-inflammatory agent; diuretic; kappa-opioid receptor agonist	low
phenazine-1-carboxamide	aromatic amide; monocarboxylic acid amide; phenazines		low
ribavirin 5'-triphosphate	1-ribosyltriazole; aromatic amide; monocarboxylic acid amide; primary carboxamide; ribose triphosphate	antiviral agent; drug metabolite; EC 2.7.7.48 (RNA-directed RNA polymerase) inhibitor; eukaryotic initiation factor 4F inhibitor; human blood serum metabolite	low
n(6)-(3-iodobenzyl)-5'-n-methylcarboxamidoadenosine	adenosines; monocarboxylic acid amide; organoiodine compound	adenosine A3 receptor agonist	low
4-carbamoylimidazolium 5-olate	hydroxyimidazole; monocarboxylic acid amide	antineoplastic agent	low
ribavirin 5'-diphosphate	1-ribosyltriazole; aromatic amide; monocarboxylic acid amide; primary carboxamide; ribose diphosphate	antiviral agent; drug metabolite	low
methotrexate	dicarboxylic acid; monocarboxylic acid amide; pteridines	abortifacient; antimetabolite; antineoplastic agent; antirheumatic drug; dermatologic drug; DNA synthesis inhibitor; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; immunosuppressive agent	low
dexpanthenol	amino alcohol; monocarboxylic acid amide	cholinergic drug; provitamin	low
cercosporamide	dibenzofurans; methyl ketone; monocarboxylic acid amide; polyphenol	antifungal agent; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; fungal metabolite; phytotoxin	low
cyclazosin	aromatic amide; aromatic ether; furans; monocarboxylic acid amide; quinazolines; quinoxaline derivative	adenosine A2A receptor antagonist	low
nepafenac	monocarboxylic acid amide	cyclooxygenase 1 inhibitor; cyclooxygenase 2 inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug; prodrug	low
rp 73401	aromatic ether; benzamides; chloropyridine; monocarboxylic acid amide	anti-asthmatic drug; anti-inflammatory agent; bronchodilator agent; phosphodiesterase IV inhibitor	low
n-(2,3-dichloro-4-hydroxyphenyl)-1-methylcyclohexanecarboxamide	anilide fungicide; aromatic amide; dichlorobenzene; monocarboxylic acid amide; phenols	antifungal agrochemical; EC 1.14.13.72 (methylsterol monooxygenase) inhibitor; sterol biosynthesis inhibitor	low
norfentanyl	anilide; monocarboxylic acid amide; piperidines	drug metabolite; opioid analgesic	low
rocaglamide	monocarboxylic acid amide; monomethoxybenzene; organic heterotricyclic compound	antileishmanial agent; antineoplastic agent; metabolite	low
taurolithocholic acid	bile acid taurine conjugate; monocarboxylic acid amide	human metabolite	low
ochratoxin a	isochromanes; monocarboxylic acid amide; N-acyl-L-phenylalanine; organochlorine compound; phenylalanine derivative	Aspergillus metabolite; calcium channel blocker; carcinogenic agent; mycotoxin; nephrotoxin; Penicillium metabolite; teratogenic agent	low
ergonovine	ergot alkaloid; monocarboxylic acid amide; organic heterotetracyclic compound; primary alcohol; secondary amino compound; tertiary amino compound	diagnostic agent; fungal metabolite; oxytocic; toxin	low
darifenacin	1-benzofurans; monocarboxylic acid amide; pyrrolidines	antispasmodic drug; muscarinic antagonist	low
adenosine-5'-(n-ethylcarboxamide)	adenosines; monocarboxylic acid amide	adenosine A1 receptor agonist; adenosine A2A receptor agonist; antineoplastic agent; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; vasodilator agent	low
tiazofurin	1,3-thiazoles; C-glycosyl compound; monocarboxylic acid amide	antineoplastic agent; EC 1.1.1.205 (IMP dehydrogenase) inhibitor; prodrug	low
glucuronamide	monocarboxylic acid amide; monosaccharide derivative		low
n-methyl-n-(tert-butyldimethylsilyl)trifluoroacetamide	monocarboxylic acid amide; N-silyl compound; trifluoroacetamide	chromatographic reagent	low
n-(3-chloro-4-methylphenyl)-4-methyl-1,2,3-thiadiazole-5-carboxamide	anilide fungicide; monocarboxylic acid amide; monochlorobenzenes; organosulfur compound; thiadiazoles	antifungal agrochemical	low
lincomycin	carbohydrate-containing antibiotic; L-proline derivative; monocarboxylic acid amide; pyrrolidinecarboxamide; S-glycosyl compound	antimicrobial agent; bacterial metabolite	low
u-50488	dichlorobenzene; monocarboxylic acid amide; N-alkylpyrrolidine	analgesic; antitussive; calcium channel blocker; diuretic; kappa-opioid receptor agonist	low
N-octylhomovanillamide	guaiacols; monocarboxylic acid amide	protective agent	low
adenosine-5'-(N-propyl)carboxamide	adenosines; monocarboxylic acid amide		low
dasatinib	1,3-thiazoles; aminopyrimidine; monocarboxylic acid amide; N-(2-hydroxyethyl)piperazine; N-arylpiperazine; organochlorine compound; secondary amino compound; tertiary amino compound	anticoronaviral agent; antineoplastic agent; tyrosine kinase inhibitor	low
ex 527	carbazoles; monocarboxylic acid amide; organochlorine compound		low
entacapone	2-nitrophenols; catechols; monocarboxylic acid amide; nitrile	antidyskinesia agent; antiparkinson drug; central nervous system drug; EC 2.1.1.6 (catechol O-methyltransferase) inhibitor	low
cerulenin	epoxide; monocarboxylic acid amide	antifungal agent; antiinfective agent; antilipemic drug; antimetabolite; antimicrobial agent; fatty acid synthesis inhibitor	low
fortimicin a	amino cyclitol glycoside; aminoglycoside antibiotic; diol; monocarboxylic acid amide; primary amino compound	antibacterial agent; metabolite	low
fenretinide	monocarboxylic acid amide; retinoid	antineoplastic agent; antioxidant	low
bimatoprost	monocarboxylic acid amide	antiglaucoma drug; antihypertensive agent	low
ag-490	catechols; enamide; monocarboxylic acid amide; nitrile; secondary carboxamide	anti-inflammatory agent; antioxidant; apoptosis inducer; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor; geroprotector; STAT3 inhibitor	low
su 11248	monocarboxylic acid amide; pyrroles	angiogenesis inhibitor; antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; immunomodulator; neuroprotective agent; vascular endothelial growth factor receptor antagonist	low
monocrotophos	alkenyl phosphate; dialkyl phosphate; monocarboxylic acid amide; organophosphate insecticide	acaricide; agrochemical; avicide; EC 1.4.3.4 (monoamine oxidase) inhibitor; EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor	low
l 685458	carbamate ester; monocarboxylic acid amide; peptide; secondary alcohol	EC 3.4.23.46 (memapsin 2) inhibitor; peptidomimetic	low
aliskiren	monocarboxylic acid amide; monomethoxybenzene	antihypertensive agent	low
su 1498	enamide; monocarboxylic acid amide; nitrile; phenols; secondary carboxamide	vascular endothelial growth factor receptor antagonist	low
n(3)-(4-methoxyfumaroyl)-2,3-diaminopropionic acid	enoate ester; methyl ester; monocarboxylic acid amide	metabolite	low
ekb 569	aminoquinoline; monocarboxylic acid amide; monochlorobenzenes; nitrile	protein kinase inhibitor	low
netupitant	aminopyridine; monocarboxylic acid amide; N-alkylpiperazine; N-arylpiperazine; organofluorine compound; toluenes	antiemetic; neurokinin-1 receptor antagonist	low
2-(4-fluoro-3-(trifluoromethyl)phenoxy)-n-(phenylmethyl)butanamide	(trifluoromethyl)benzenes; aromatic ether; monocarboxylic acid amide; monofluorobenzenes		low
1-methyl-d-lysergic acid butanolamide	ergot alkaloid; monocarboxylic acid amide	serotonergic antagonist; sympatholytic agent; vasoconstrictor agent	low
platensimycin	aromatic amide; cyclic ether; cyclic ketone; dihydroxybenzoic acid; monocarboxylic acid amide; polycyclic cage	antibacterial agent; antimicrobial agent; bacterial metabolite; EC 2.3.1.85 (fatty acid synthase) inhibitor	low
vilazodone	1-benzofurans; indoles; monocarboxylic acid amide; N-alkylpiperazine; N-arylpiperazine; nitrile	antidepressant; serotonergic agonist; serotonin uptake inhibitor	low
n-demethylloperamide	monocarboxylic acid amide; monochlorobenzenes; piperidines; tertiary alcohol	drug metabolite	low
lenvatinib	aromatic amide; aromatic ether; cyclopropanes; monocarboxylic acid amide; monochlorobenzenes; phenylureas; quinolines	antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; fibroblast growth factor receptor antagonist; orphan drug; vascular endothelial growth factor receptor antagonist	low
avibactam	azabicycloalkane; hydroxylamine O-sulfonic acid; monocarboxylic acid amide; ureas	antibacterial drug; antimicrobial agent; EC 3.5.2.6 (beta-lactamase) inhibitor	low
mirabegron	1,3-thiazoles; aromatic amide; ethanolamines; monocarboxylic acid amide	beta-adrenergic agonist	low
avanafil	aromatic amide; monocarboxylic acid amide; organochlorine compound; prolinols; pyrimidines	EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; vasodilator agent	low
rivaroxaban	aromatic amide; lactam; monocarboxylic acid amide; morpholines; organochlorine compound; oxazolidinone; thiophenes	anticoagulant; EC 3.4.21.6 (coagulation factor Xa) inhibitor	low
selexipag	aromatic amine; ether; monocarboxylic acid amide; N-sulfonylcarboxamide; pyrazines; tertiary amino compound	orphan drug; platelet aggregation inhibitor; prodrug; prostacyclin receptor agonist; vasodilator agent	low
3-iodo-4-aminobenzyl-5'-N-methylcarboxamidoadenosine	adenosines; monocarboxylic acid amide; organoiodine compound		low
ly-2157299	aromatic amide; methylpyridines; monocarboxylic acid amide; pyrrolopyrazole; quinolines	antineoplastic agent; TGFbeta receptor antagonist	low
SIS3 free base	aromatic ether; enamide; isoquinolines; monocarboxylic acid amide; pyrrolopyridine; tertiary carboxamide	Smad3 inhibitor	low
bl1521	enamide; hydroxamic acid; monocarboxylic acid amide	antineoplastic agent; apoptosis inducer; EC 3.5.1.98 (histone deacetylase) inhibitor	low
tasimelteon	1-benzofurans; cyclopropanes; monocarboxylic acid amide	melatonin receptor agonist	low
edoxaban	chloropyridine; monocarboxylic acid amide; tertiary amino compound; thiazolopyridine	anticoagulant; EC 3.4.21.6 (coagulation factor Xa) inhibitor; platelet aggregation inhibitor	low
fr 901464	acetate ester; cyclic hemiketal; monocarboxylic acid amide; pyrans; spiro-epoxide	antimicrobial agent; antineoplastic agent; bacterial metabolite	low
bms 477118	adamantanes; azabicycloalkane; monocarboxylic acid amide; nitrile; tertiary alcohol	EC 3.4.14.5 (dipeptidyl-peptidase IV) inhibitor; hypoglycemic agent	low
mandipropamid	aromatic ether; monocarboxylic acid amide; monochlorobenzenes; terminal acetylenic compound		low
bay 60-6583	aminopyridine; aromatic ether; aryl sulfide; cyanopyridine; cyclopropanes; monocarboxylic acid amide	adenosine A2B receptor agonist; anti-inflammatory agent; cardioprotective agent	low
vx-770	aromatic amide; monocarboxylic acid amide; phenols; quinolone	CFTR potentiator; orphan drug	low
platencin	aromatic amide; cyclic ketone; dihydroxybenzoic acid; monocarboxylic acid amide; polycyclic cage	antibacterial agent; antimicrobial agent; bacterial metabolite; EC 2.3.1.85 (fatty acid synthase) inhibitor	low
tenovin-6	monocarboxylic acid amide; tertiary amino compound; thioureas	antineoplastic agent; p53 activator; Sir2 inhibitor	low
bacillaene	enamine; monocarboxylic acid amide; polyene antibiotic; polyketide; secondary alcohol	antibacterial agent; antimicrobial agent; bacterial metabolite	low
cobicistat	1,3-thiazoles; carbamate ester; monocarboxylic acid amide; morpholines; ureas	P450 inhibitor	low
fluazaindolizine	aromatic amide; imidazopyridine; monocarboxylic acid amide; monochlorobenzenes; monomethoxybenzene; N-sulfonylcarboxamide; organofluorine pesticide	agrochemical; nematicide	low
crambescidin 800	alkaloid; carboxylic ester; guanidines; monocarboxylic acid amide; organic heteropentacyclic compound; primary amino compound; secondary alcohol; spiro compound	anti-HIV-1 agent; anti-HSV-1 agent; antimalarial; marine metabolite	low
novobiocin	carbamate ester; ether; hexoside; hydroxycoumarin; monocarboxylic acid amide; monosaccharide derivative; phenols	antibacterial agent; antimicrobial agent; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; Escherichia coli metabolite; hepatoprotective agent	low
piroxicam	benzothiazine; monocarboxylic acid amide; pyridines	analgesic; antirheumatic drug; cyclooxygenase 1 inhibitor; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-steroidal anti-inflammatory drug	low
mobic	1,3-thiazoles; benzothiazine; monocarboxylic acid amide	analgesic; antirheumatic drug; cyclooxygenase 2 inhibitor; non-steroidal anti-inflammatory drug	low
mobiflex	heteroaryl hydroxy compound; monocarboxylic acid amide; pyridines; thienothiazine	antipyretic; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug	low
isoxicam	benzothiazine; isoxazoles; monocarboxylic acid amide	antirheumatic drug; non-steroidal anti-inflammatory drug	low
lornoxicam	heteroaryl hydroxy compound; monocarboxylic acid amide; organochlorine compound; pyridines; thienothiazine	antipyretic; non-narcotic analgesic; non-steroidal anti-inflammatory drug	low
streptolydigin	bridged compound; cyclic ketal; enol; monocarboxylic acid amide; N-glycosyl compound; organic heterobicyclic compound; pyrrolidinone; spiro-epoxide	antimicrobial agent; bacterial metabolite; EC 2.7.7.6 (RNA polymerase) inhibitor	low
gsk1265744	difluorobenzene; monocarboxylic acid amide; organic heterotricyclic compound; secondary carboxamide	HIV-1 integrase inhibitor	low
3-(difluoromethyl)-N-methoxy-1-methyl-N-[1-(2,4,6-trichlorophenyl)propan-2-yl]pyrazole-4-carboxamide	aromatic amide; monocarboxylic acid amide; organofluorine compound; pyrazoles; trichlorobenzene		low
HG-10-102-01	aminopyrimidine; aromatic ether; monocarboxylic acid amide; morpholines; organochlorine compound; secondary amino compound	EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor	low
bictegravir	monocarboxylic acid amide; organic heterotetracyclic compound; secondary carboxamide; trifluorobenzene	HIV-1 integrase inhibitor	low
ver 52296	aromatic amide; isoxazoles; monocarboxylic acid amide; morpholines; resorcinols	angiogenesis inhibitor; antineoplastic agent; Hsp90 inhibitor	low
5-methoxypsoralen	5-methoxyfurocoumarin; organic heterotricyclic compound; psoralens	hepatoprotective agent; plant metabolite	low
beta-naphthoflavone	extended flavonoid; naphtho-gamma-pyrone; organic heterotricyclic compound	aryl hydrocarbon receptor agonist	low
etodolac	monocarboxylic acid; organic heterotricyclic compound	antipyretic; cyclooxygenase 2 inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug	low
fluorescite	benzoic acids; cyclic ketone; hydroxy monocarboxylic acid; organic heterotricyclic compound; phenols; xanthene dye	fluorescent dye; radioopaque medium	low
ketotifen	cyclic ketone; olefinic compound; organic heterotricyclic compound; organosulfur heterocyclic compound; piperidines; tertiary amino compound	anti-asthmatic drug; H1-receptor antagonist	low
khellin	furanochromone; organic heterotricyclic compound; oxacycle	anti-asthmatic agent; bronchodilator agent; cardiovascular drug; vasodilator agent	low
oxolinic acid	aromatic carboxylic acid; organic heterotricyclic compound; oxacycle; quinolinemonocarboxylic acid; quinolone antibiotic	antibacterial drug; antifungal agent; antiinfective agent; antimicrobial agent; enzyme inhibitor	low
ro 15-4513	organic heterotricyclic compound; organonitrogen heterocyclic compound		low
skimmianine	alkaloid antibiotic; organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
benzo(b)naphtho(2,1-d)thiophene	organic heterotricyclic compound; organosulfur heterocyclic compound		low
kokusaginine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
cytisine	alkaloid; bridged compound; lactam; organic heterotricyclic compound; secondary amino compound	nicotinic acetylcholine receptor agonist; phytotoxin; plant metabolite	low
alpha-naphthoflavone	extended flavonoid; naphtho-gamma-pyrone; organic heterotricyclic compound	aryl hydrocarbon receptor agonist; aryl hydrocarbon receptor antagonist; EC 1.14.14.14 (aromatase) inhibitor	low
naftalofos	organic heterotricyclic compound	anthelminthic drug	low
helenalin	cyclic ketone; gamma-lactone; organic heterotricyclic compound; secondary alcohol; sesquiterpene lactone	anti-inflammatory agent; antineoplastic agent; metabolite; plant metabolite	low
ancitabine	diol; organic heterotricyclic compound	antimetabolite; antineoplastic agent; prodrug	low
1-(3-chloro-5-benzo[b][1]benzoxepinyl)-4-methylpiperazine	N-alkylpiperazine; organic heterotricyclic compound		low
colforsin	acetate ester; cyclic ketone; labdane diterpenoid; organic heterotricyclic compound; tertiary alpha-hydroxy ketone; triol	adenylate cyclase agonist; anti-HIV agent; antihypertensive agent; plant metabolite; platelet aggregation inhibitor; protein kinase A agonist	low
nedocromil	dicarboxylic acid; organic heterotricyclic compound	anti-allergic agent; anti-asthmatic drug; non-steroidal anti-inflammatory drug	low
naxagolide	organic heterotricyclic compound; phenols; tertiary amino compound	anticonvulsant; antiparkinson drug; dopamine agonist	low
depsidone	depsidones; organic heterotricyclic compound		low
droxicam	organic heterotricyclic compound; pyridines	cyclooxygenase 1 inhibitor; hepatotoxic agent; non-narcotic analgesic; non-steroidal anti-inflammatory drug; platelet aggregation inhibitor; prodrug	low
dictamnine	alkaloid antibiotic; organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
flindersiamine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
flindersine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
maculine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
zaluzanin C	gamma-lactone; guaiane sesquiterpenoid; organic heterotricyclic compound; secondary alcohol; sesquiterpene lactone	EC 1.14.13.39 (nitric oxide synthase) inhibitor; metabolite	low
alpha-lapachone	organic heterotricyclic compound; organooxygen compound		low
dehydrocostus lactone	gamma-lactone; guaiane sesquiterpenoid; organic heterotricyclic compound; sesquiterpene lactone	antimycobacterial drug; antineoplastic agent; apoptosis inducer; cyclooxygenase 2 inhibitor; metabolite; trypanocidal drug	low
Evoxine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
galaxolide	isochromenes; organic heterotricyclic compound	fragrance	low
aurofusarin	organic heterotricyclic compound; organooxygen compound		low
geographutoxin i	organic heterotricyclic compound	marine metabolite	low
gamma-fagarine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
1,9-dideoxyforskolin	acetate ester; labdane diterpenoid; organic heterotricyclic compound	plant metabolite	low
paspaline	organic heterotricyclic compound; organooxygen compound		low
salvinorin a	organic heterotricyclic compound; organooxygen compound	metabolite; oneirogen	low
sch 45752	organic heterotricyclic compound; organooxygen compound		low
pannarin	aldehyde; aromatic ether; depsidones; organic heterotricyclic compound; organochlorine compound; phenols	antimicrobial agent; antineoplastic agent; apoptosis inducer; lichen metabolite	low
mirestrol	organic heterotricyclic compound; organooxygen compound		low
confertin	cyclic ketone; gamma-lactone; organic heterotricyclic compound; pseudoguaianolide	anti-inflammatory agent; metabolite; plant metabolite	low
inuviscolide	gamma-lactone; organic heterotricyclic compound; sesquiterpene lactone; tertiary alcohol	anti-inflammatory agent; plant metabolite	low
ergolide	acetate ester; cyclic ketone; gamma-lactone; organic heterotricyclic compound; sesquiterpene lactone	anti-inflammatory agent; antineoplastic agent; metabolite; NF-kappaB inhibitor; plant metabolite	low
fk 1052	imidazoles; organic heterotricyclic compound	antiemetic; serotonergic antagonist	low
noscapine	aromatic ether; benzylisoquinoline alkaloid; cyclic acetal; isobenzofuranone; organic heterobicyclic compound; organic heterotricyclic compound; tertiary amino compound	antineoplastic agent; antitussive; apoptosis inducer; plant metabolite	low
aromaticin	cyclic ketone; gamma-lactone; organic heterotricyclic compound; sesquiterpene lactone	anti-inflammatory agent; metabolite; plant metabolite	low
aglafoline	methyl ester; organic heterotricyclic compound	metabolite; platelet aggregation inhibitor	low
cimifugin	organic heterotricyclic compound; oxacycle		low
khelloside	organic heterotricyclic compound; oxacycle		low
columbin	organic heterotricyclic compound; organooxygen compound		low
decursinol	cyclic ether; delta-lactone; organic heterotricyclic compound; secondary alcohol	analgesic; antineoplastic agent; EC 3.1.1.7 (acetylcholinesterase) inhibitor; metabolite	low
cleomiscosin a	aromatic ether; delta-lactone; organic heterotricyclic compound; phenols; primary alcohol	anti-inflammatory agent; metabolite	low
Dubinidine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
colforsin daropate	acetate ester; carboxylic ester; cyclic ketone; diol; organic heterotricyclic compound; tertiary amino compound	adenylate cyclase agonist; antihypertensive agent; cardiotonic drug; vasodilator agent	low
thapsigargin	butyrate ester; organic heterotricyclic compound; sesquiterpene lactone	calcium channel blocker; EC 3.6.3.8 (Ca(2+)-transporting ATPase) inhibitor	low
reynosin	organic heterotricyclic compound; sesquiterpene lactone	metabolite	low
5',7'-dimethylspiro[cyclohexane-1,3'-pyrimido[5,4-c][1,2,5]oxadiazine]-6',8'-dione	organic heterotricyclic compound; spiro compound		low
vedelianin	cyclic ether; organic heterotricyclic compound; resorcinols; stilbenoid	antineoplastic agent; plant metabolite	low
haplamine	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
(2R)-1-[(4,8-dimethoxy-7-furo[2,3-b]quinolinyl)oxy]-3-methylbutane-2,3-diol	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
acetic acid (11-oxo-6H-benzo[c][1]benzoxepin-2-yl) ester	organic heterotricyclic compound		low
2-oxo-3-benzo[h][1]benzopyrancarboxylic acid ethyl ester	organic heterotricyclic compound; organooxygen compound		low
huperzine a	organic heterotricyclic compound; primary amino compound; pyridone; sesquiterpene alkaloid	EC 3.1.1.7 (acetylcholinesterase) inhibitor; neuroprotective agent; nootropic agent; plant metabolite	low
CHIC-35	aromatic compound; organic heterotricyclic compound; organochlorine compound; primary carboxamide	EC 3.5.1.98 (histone deacetylase) inhibitor	low
3-imino-2-benzo[f][1]benzopyrancarbothioamide	organic heterotricyclic compound; organooxygen compound		low
2-benzamido-4,5-dihydrobenzo[g][1]benzothiole-3-carboxamide	organic heterotricyclic compound; organosulfur heterocyclic compound		low
3-(3-oxo-2-benzo[f][1]benzopyranyl)-1-phenyl-4-pyrazolecarboxaldehyde	organic heterotricyclic compound; organooxygen compound		low
2-benzo[b][1]benzoxepinamine	organic heterotricyclic compound		low
LSM-33589	organic heterotricyclic compound; organosulfur heterocyclic compound		low
2-(difluoromethyl)-4-benzo[h][1]benzopyranone	organic heterotricyclic compound; organooxygen compound		low
bigelovin	acetate ester; cyclic ketone; gamma-lactone; organic heterotricyclic compound; sesquiterpene lactone	antineoplastic agent; apoptosis inducer; immunomodulator; plant metabolite	low
momilactone b	organic heterotricyclic compound; organooxygen compound		low
quinagolide	organic heterotricyclic compound; organonitrogen heterocyclic compound		low
6,8-difluoro-4-(pyridin-3-yl)-3a,4,5,9b-tetrahydro-3H-cyclopenta[c]quinoline	organic heterotricyclic compound; organofluorine compound; pyridines; secondary amino compound		low
uccf-029	organic heterotricyclic compound; organooxygen compound		low
4-[oxo-(4-oxo-5H-thieno[3,2-c]quinolin-2-yl)methyl]-1-piperazinecarboxylic acid ethyl ester	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
[4-(1,3-benzodioxol-5-ylmethyl)-1-piperazinyl]-(7-methoxy-2-furo[2,3-b]quinolinyl)methanone	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
1-[(6-methoxy-2-furo[2,3-b]quinolinyl)-oxomethyl]-4-piperidinecarboxylic acid ethyl ester	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
N-[2-(dipropylamino)ethyl]-4-methyl-2-furo[3,2-c]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
6-methoxy-N-(thiophen-2-ylmethyl)-2-furo[2,3-b]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
LSM-1924	organic heterotricyclic compound; organooxygen compound		low
LSM-22738	organic heterotricyclic compound; organooxygen compound		low
7-methoxy-N-(3-pyridinylmethyl)-2-furo[2,3-b]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
LSM-26445	organic heterotricyclic compound; organooxygen compound		low
LSM-1925	organic heterotricyclic compound; organooxygen compound		low
acetic acid [1-[(4,8-dimethoxy-7-furo[2,3-b]quinolinyl)oxy]-3-hydroxy-3-methylbutan-2-yl] ester	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
LSM-25964	organic heterotricyclic compound; organooxygen compound		low
N-(3-oxo-2-benzo[f][1]benzopyranyl)acetamide	organic heterotricyclic compound; organooxygen compound		low
chanoclavine	benzoindole; ergot alkaloid; organic heterotricyclic compound; primary alcohol; secondary amino compound		low
riddelliine	macrodiolide; olefinic compound; organic heterotricyclic compound; pyrrolizine alkaloid	carcinogenic agent; genotoxin; mutagen	low
irilone	hydroxyisoflavone; organic heterotricyclic compound; oxacycle	antineoplastic agent; immunomodulator; metabolite	low
heliparvifoline	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
sirolimus	antibiotic antifungal drug; cyclic acetal; cyclic ketone; ether; macrolide lactam; organic heterotricyclic compound; secondary alcohol	antibacterial drug; anticoronaviral agent; antineoplastic agent; bacterial metabolite; geroprotector; immunosuppressive agent; mTOR inhibitor	low
5-ethyl-4-oxo-N-(thiophen-2-ylmethyl)-2-thieno[3,2-c]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
8-methyl-1-[2-(2-methyl-1-piperidinyl)-2-oxoethyl]-4-[1]benzopyrano[4,3-c]pyrazolone	organic heterotricyclic compound		low
cytochalasin b	cytochalasin; lactam; lactone; organic heterotricyclic compound	actin polymerisation inhibitor; metabolite; mycotoxin; platelet aggregation inhibitor	low
(3r)-((2,3-dihydro-5-methyl-3-((4-morpholinyl)methyl)pyrrolo-(1,2,3-de)-1,4-benzoxazin-6-yl)(1-naphthalenyl))methanone	morpholines; naphthyl ketone; organic heterotricyclic compound; synthetic cannabinoid	analgesic; apoptosis inhibitor; neuroprotective agent	low
methyl brevifolincarboxylate	cyclic ketone; delta-lactone; organic heterotricyclic compound; phenols	EC 5.99.1.2 (DNA topoisomerase) inhibitor; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; metabolite; platelet aggregation inhibitor; radical scavenger; vasodilator agent	low
palonosetron	azabicycloalkane; delta-lactam; organic heterotricyclic compound	antiemetic; serotonergic antagonist	low
himbacine	gamma-lactone; organic heterotricyclic compound; piperidine alkaloid	muscarinic antagonist	low
riddelliine n-oxide	diol; macrocyclic lactone; olefinic compound; organic heterotricyclic compound; primary alcohol; pyrrolizine alkaloid; tertiary alcohol; tertiary amine oxide	carcinogenic agent; genotoxin; human xenobiotic metabolite; Jacobaea metabolite; mutagen; rat metabolite	low
chaetoviridin a	azaphilone; beta-hydroxy ketone; enone; gamma-lactone; organic heterotricyclic compound; organochlorine compound; secondary alcohol	antifungal agent; Chaetomium metabolite	low
tremortin a	organic heterotricyclic compound; organooxygen compound		low
4-methyl-N-[(4-methylphenyl)methyl]-2-furo[3,2-c]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
beraprost	enyne; monocarboxylic acid; organic heterotricyclic compound; secondary alcohol; secondary allylic alcohol	anti-inflammatory agent; antihypertensive agent; platelet aggregation inhibitor; prostaglandin receptor agonist; vasodilator agent	low
jwh-133	benzochromene; dibenzopyran; organic heterotricyclic compound	analgesic; anti-inflammatory agent; antineoplastic agent; apoptosis inhibitor; CB2 receptor agonist; opioid analgesic; vasodilator agent	low
nu 7026	organic heterotricyclic compound; organooxygen compound		low
pi103	aromatic amine; morpholines; organic heterotricyclic compound; phenols; tertiary amino compound	antineoplastic agent; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; mTOR inhibitor	low
terpendole e	organic heterotricyclic compound; organooxygen compound		low
epicocconone	organic heterotricyclic compound	fluorochrome	low
pentalenolactone f	alpha,beta-unsaturated monocarboxylic acid; organic heterotricyclic compound; sesquiterpene lactone; spiro-epoxide	bacterial metabolite	low
jnj16259685	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
episilvestrol	dioxanes; ether; methyl ester; organic heterotricyclic compound	antineoplastic agent; metabolite	low
silvestrol	dioxanes; ether; methyl ester; organic heterotricyclic compound	antineoplastic agent; metabolite	low
4-chloro-N-(3,4-dimethoxyphenyl)-2-thieno[3,2-c]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
monascin	alpha,beta-unsaturated ketone; gamma-lactone; organic heterotricyclic compound; polyketide	antilipemic drug; antineoplastic agent; fungal metabolite; PPARgamma agonist	low
batzelladine a	alkaloid; carboxylic ester; guanidines; organic heterotricyclic compound; pyrrolopyrimidine; triazaacenaphthylene	anti-HIV-1 agent; metabolite	low
prim-o-glucosylcimifugin	organic heterotricyclic compound; oxacycle		low
4-chloro-N-[3-(3-methyl-1-piperidinyl)propyl]-2-thieno[3,2-c]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
schweinfurthin g	cyclic ether; organic heterotricyclic compound; resorcinols; stilbenoid	antineoplastic agent; metabolite	low
8-methyl-4-oxo-N-[3-(4-propyl-1-piperazinyl)propyl]-5H-thieno[3,2-c]quinoline-2-carboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
N,8-dimethyl-N-(3-methylphenyl)-4-oxo-5H-thieno[3,2-c]quinoline-2-carboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
N-[2-(dipropylamino)ethyl]-5-ethyl-4-oxo-2-thieno[3,2-c]quinolinecarboxamide	organic heterotricyclic compound; organonitrogen heterocyclic compound; organosulfur heterocyclic compound		low
schweinfurthin f	cyclic ether; organic heterotricyclic compound; resorcinols; stilbenoid	metabolite	low
thallusin	organic heterotricyclic compound; organooxygen compound		low
aflatrem	organic heterotricyclic compound; organooxygen compound		low
dihydroagarofuran	bridged compound; cyclic ether; eudesmane sesquiterpenoid; organic heterotricyclic compound	metabolite	low
4'-epichaetoviridin A	azaphilone; beta-hydroxy ketone; enone; gamma-lactone; organic heterotricyclic compound; organochlorine compound; secondary alcohol	Chaetomium metabolite	low
arenaemycin e	alpha,beta-unsaturated monocarboxylic acid; organic heterotricyclic compound; sesquiterpene lactone; spiro-epoxide	antimicrobial agent; bacterial metabolite; EC 1.2.1.12 [glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)] inhibitor	low
mk 2206	organic heterotricyclic compound	EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor	low
chaetoviridin E	azaphilone; enone; gamma-lactone; organic heterotricyclic compound; organochlorine compound	Chaetomium metabolite	low
LSM-1873	organic heterotricyclic compound; organooxygen compound		low
LSM-1834	organic heterotricyclic compound; organooxygen compound		low
LSM-1287	organic heterotricyclic compound; organooxygen compound		low
LSM-1675	organic heterotricyclic compound; organooxygen compound		low
LSM-1312	organic heterotricyclic compound; organooxygen compound		low
LSM-1315	organic heterotricyclic compound; organooxygen compound		low
debromoaplysiatoxin	aplysiatoxins; cyclic hemiketal; ether; organic heterotricyclic compound; phenols; secondary alcohol; spiroketal	algal metabolite; carcinogenic agent; cyanotoxin; marine metabolite; protein kinase C agonist	low
aplysiatoxin	aplysiatoxins; bromophenol; cyclic hemiketal; ether; organic heterotricyclic compound; secondary alcohol; spiroketal	algal metabolite; carcinogenic agent; cyanotoxin; marine metabolite; protein kinase C agonist	low
gonyautoxin v	organic heterotricyclic compound; paralytic shellfish toxin	marine metabolite	low
4-hydroxy-6-propan-2-ylpyrano[3,2-c]quinoline-2,5-dione	organic heterotricyclic compound; organonitrogen heterocyclic compound; oxacycle		low
pelabresib	monochlorobenzenes; organic heterotricyclic compound; primary carboxamide	antineoplastic agent; bromodomain-containing protein 4 inhibitor	low
gonyautoxin ii	organic heterotricyclic compound; paralytic shellfish toxin	marine metabolite	low
8-epidiosbulbin e acetate	organic heterotricyclic compound; organooxygen compound		low
conocurvone	organic heterotricyclic compound; organooxygen compound		low
scytonemin	enone; organic heterotricyclic compound; organonitrogen heterocyclic compound; polyphenol; ring assembly	bacterial metabolite; biological pigment; ultraviolet filter	low
liproxstatin-1	azaspiro compound; monochlorobenzenes; organic heterotricyclic compound; secondary amino compound	antioxidant; cardioprotective agent; ferroptosis inhibitor; radical scavenger	low
butoctamide succinate	dicarboxylic acid monoester; hemisuccinate; secondary carboxamide		low
cl 387785	bromobenzenes; quinazolines; secondary carboxamide; ynamide	antineoplastic agent; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor; epidermal growth factor receptor antagonist	low
iodipamide	benzoic acids; organoiodine compound; secondary carboxamide	radioopaque medium	low
4-(dimethylamino)-n-(7-(hydroxyamino)-7-oxoheptyl)benzamide	benzamides; hydroxamic acid; secondary carboxamide; tertiary amino compound	antineoplastic agent; apoptosis inducer; EC 3.5.1.98 (histone deacetylase) inhibitor	low
nemonapride	benzamides; monochlorobenzenes; monomethoxybenzene; N-alkylpyrrolidine; secondary amino compound; secondary carboxamide; substituted aniline		low
niclosamide	benzamides; C-nitro compound; monochlorobenzenes; salicylanilides; secondary carboxamide	anthelminthic drug; anticoronaviral agent; antiparasitic agent; apoptosis inducer; molluscicide; piscicide; STAT3 inhibitor	low
pd168393	acrylamides; bromobenzenes; quinazolines; secondary carboxamide; substituted aniline	epidermal growth factor receptor antagonist	low
pilsicainide	organic heterobicyclic compound; secondary carboxamide	anti-arrhythmia drug; sodium channel blocker	low
pj-34	phenanthridines; secondary carboxamide; tertiary amino compound	angiogenesis inhibitor; anti-inflammatory agent; antiatherosclerotic agent; antineoplastic agent; apoptosis inducer; cardioprotective agent; EC 2.4.2.30 (NAD(+) ADP-ribosyltransferase) inhibitor; neuroprotective agent	low
opc 12759	secondary carboxamide		low
suramin	naphthalenesulfonic acid; phenylureas; secondary carboxamide	angiogenesis inhibitor; antinematodal drug; antineoplastic agent; apoptosis inhibitor; EC 2.7.11.13 (protein kinase C) inhibitor; GABA antagonist; GABA-gated chloride channel antagonist; purinergic receptor P2 antagonist; ryanodine receptor agonist; trypanocidal drug	low
2-[[3-(3,4-dimethoxyphenyl)-1-oxoprop-2-enyl]amino]benzoic acid	amidobenzoic acid; cinnamamides; secondary carboxamide		low
acedapsone	acetamides; anilide; secondary carboxamide; sulfone	antimalarial; antimicrobial drug	low
salicylurate	N-acylglycine; secondary carboxamide	human xenobiotic metabolite; uremic toxin	low
monoacetyldapsone	acetamides; anilide; secondary carboxamide; sulfone		low
n-methylolacrylamide	secondary carboxamide		low
win 18446	organochlorine compound; secondary carboxamide	EC 1.2.1.3 [aldehyde dehydrogenase (NAD(+))] inhibitor	low
carboxin	anilide fungicide; anilide; enamide; organosulfur heterocyclic compound; oxacycle; secondary carboxamide	antifungal agrochemical; EC 1.3.5.1 [succinate dehydrogenase (quinone)] inhibitor	low
tromantadine	secondary carboxamide		low
aureothricin	dithiolopyrrolone antibiotic; secondary carboxamide	angiogenesis inhibitor; antibacterial agent; bacterial metabolite; EC 2.7.7.6 (RNA polymerase) inhibitor	low
morphazinamide	morpholines; pyrazines; secondary carboxamide		low
amperozide	diarylmethane; monofluorobenzenes; N-alkylpiperazine; secondary carboxamide; ureas	anxiolytic drug; dopamine uptake inhibitor; geroprotector; second generation antipsychotic; serotonergic antagonist	low
n-acetyltryptophanamide	acetamides; L-tryptophan derivative; primary carboxamide; secondary carboxamide		low
gamma-glutamyltyrosine	dicarboxylic acid; dipeptide; phenols; primary amino compound; secondary carboxamide	human metabolite	low
n-acetyldopamine	acetamides; catechols; N-(fatty acyl)-dopamine; secondary carboxamide	human urinary metabolite; marine metabolite	low
n-acetylcytidine	acetamides; cytidines; secondary carboxamide	metabolite	low
florfenicol	organochlorine compound; organofluorine compound; secondary alcohol; secondary carboxamide; sulfone	antimicrobial agent	low
marimastat	hydroxamic acid; secondary carboxamide	antineoplastic agent; matrix metalloproteinase inhibitor	low
n-(3-oxohexanoyl)-3-aminodihydro-2(3h)-furanone	N-acyl homoserine lactone; secondary carboxamide		low
mosapride	aromatic ether; benzamides; monochlorobenzenes; monofluorobenzenes; morpholines; secondary carboxamide; substituted aniline; tertiary amino compound		low
benzyloxycarbonylphenylalanylphenylalanine diazomethyl ketone	carboxylic ester; diazo compound; L-phenylalanine derivative; secondary carboxamide	cathepsin L (EC 3.4.22.15) inhibitor	low
yh 439	aromatic amide; isopropyl ester; secondary carboxamide		low
cyc 682	nitrile; nucleoside analogue; secondary carboxamide	antimetabolite; antineoplastic agent; DNA synthesis inhibitor; prodrug	low
sceptrin	pyrroles; secondary carboxamide		low
n(beta)-alanyldopamine	catechols; primary amino compound; secondary carboxamide		low
monoacetylcadaverine	acetamides; N-substituted cadaverine; primary amino compound; secondary carboxamide	human metabolite	low
N-(1-phenylethyl)acetamide	acetamides; secondary carboxamide		low
2,2,2-trifluoro-N-[2-(1H-indol-3-yl)ethyl]acetamide	indoles; secondary carboxamide; trifluoroacetamide		low
xv 638	1,3-thiazoles; benzamides; diazepanone; diol; secondary alcohol; secondary carboxamide; ureas	HIV protease inhibitor	low
vibriobactin	1,3-oxazoles; secondary carboxamide	siderophore	low
bms 195614	benzoic acids; quinolines; secondary carboxamide	retinoic acid receptor alpha antagonist	low
tempace	aminoxyls; piperidinecarboxamide; secondary carboxamide	radiation protective agent; radical scavenger	low
dimethyloxalylglycine	glycine derivative; methyl ester; secondary carboxamide	EC 1.14.11.29 (hypoxia-inducible factor-proline dioxygenase) inhibitor; neuroprotective agent	low
s 1033	(trifluoromethyl)benzenes; imidazoles; pyridines; pyrimidines; secondary amino compound; secondary carboxamide	anticoronaviral agent; antineoplastic agent; tyrosine kinase inhibitor	low
3-methyl-2-[[oxo-(4-pentoxyphenyl)methyl]amino]butanoic acid	secondary carboxamide		low
cinromide	cinnamamides; secondary carboxamide		low
4-[[2-furanyl(oxo)methyl]amino]benzoic acid propan-2-yl ester	aromatic amide; furans; isopropyl ester; secondary carboxamide		low
2,2,2-trifluoro-N-(2-methyl-8-quinolinyl)acetamide	quinolines; secondary carboxamide; trifluoroacetamide		low
N-(3-carbamoyl-4,5,6,7-tetrahydro-1-benzothiophen-2-yl)-2-pyrazinecarboxamide	primary carboxamide; pyrazines; secondary carboxamide		low
2-[[oxo(thiophen-2-yl)methyl]amino]-4,5,6,7-tetrahydro-1-benzothiophene-3-carboxylic acid propan-2-yl ester	aromatic amide; isopropyl ester; secondary carboxamide; thiophenes		low
N-[1-[(4-chlorophenyl)methyl]-4-pyrazolyl]-2-pyrazinecarboxamide	pyrazines; secondary carboxamide		low
4-[[(4-bromo-2-ethyl-3-pyrazolyl)-oxomethyl]amino]benzoic acid propan-2-yl ester	aromatic amide; isopropyl ester; secondary carboxamide		low
(2S)-2-[[(2-chlorophenyl)-oxomethyl]amino]-3-methylbutanoic acid (6-nitro-4H-1,3-benzodioxin-8-yl)methyl ester	secondary carboxamide		low
N-[(2S)-1-(1H-benzimidazol-2-ylamino)-3-methyl-1-oxobutan-2-yl]-3,5-dimethoxybenzamide	secondary carboxamide		low
2-(2,4-dioxo-1H-pyrimidin-6-yl)-N-[2-(4-morpholinyl)ethyl]acetamide	morpholines; pyrimidone; secondary carboxamide; tertiary amino compound		low
N-[(4-chlorophenyl)methyl]-2-(2,4-dioxo-1H-pyrimidin-6-yl)acetamide	monochlorobenzenes; pyrimidone; secondary carboxamide		low
N-[(2S)-1-(1H-benzimidazol-2-ylamino)-3-methyl-1-oxobutan-2-yl]-3-methylbenzamide	secondary carboxamide		low
2,2,2-trifluoro-N-(5-oxo-1-phenyl-4H-pyrazol-3-yl)acetamide	pyrazoles; secondary carboxamide; trifluoroacetamide		low
N-(2-anilino-2-oxoethyl)-2-methoxybenzamide	secondary carboxamide		low
N-[5-[(2,6-dichlorophenyl)methylthio]-1,3,4-thiadiazol-2-yl]-5-methyl-2-pyrazinecarboxamide	pyrazines; secondary carboxamide		low
(2S)-3-methyl-2-[[(3-methylphenyl)-oxomethyl]amino]butanoic acid (4-oxo-2-pyrimido[2,1-b][1,3]benzothiazolyl)methyl ester	secondary carboxamide		low
n-(1-oxyl-2,2,6,6-tetramethyl-4-piperidinyl)iodoacetamide	aminoxyls; organoiodine compound; piperidinecarboxamide; secondary carboxamide	radical scavenger; spin label	low
ANA-12	1-benzothiophenes; caprolactams; secondary carboxamide	antidepressant; anxiolytic drug; tropomyosin-related kinase B receptor antagonist	low
N-([biphenyl]-2-yl)-3-cyclopentylpropanamide	biphenyls; cyclopentanes; secondary carboxamide		low
bms 387032	1,3-oxazoles; 1,3-thiazoles; organic sulfide; piperidinecarboxamide; secondary carboxamide	angiogenesis inhibitor; antineoplastic agent; apoptosis inducer; EC 2.7.11.22 (cyclin-dependent kinase) inhibitor	low
sr 144528	bridged compound; monochlorobenzenes; pyrazoles; secondary carboxamide	CB2 receptor antagonist; EC 2.3.1.26 (sterol O-acyltransferase) inhibitor	low
N-(1,3-benzodioxol-5-ylmethyl)-N-[2-(cyclohexylamino)-2-oxo-1-pyridin-4-ylethyl]-2,2,2-trifluoroacetamide	benzodioxoles; pyridines; secondary carboxamide; tertiary carboxamide; trifluoroacetamide		low
N-[2-(cyclohexylamino)-2-oxo-1-thiophen-2-ylethyl]-2,2,2-trifluoro-N-(4-methylphenyl)acetamide	secondary carboxamide; tertiary carboxamide; thiophenes; trifluoroacetamide		low
ML162	monochlorobenzenes; monomethoxybenzene; organochlorine compound; secondary carboxamide; tertiary carboxamide; thiophenes	EC 1.11.1.9 (glutathione peroxidase) inhibitor; ferroptosis inducer	low
N-[3-(N-(2-chloro-1-oxoethyl)-4-nitroanilino)propyl]-2,2,2-trifluoroacetamide	C-nitro compound; secondary carboxamide; tertiary carboxamide; trifluoroacetamide		low
2-[[2-(3,4-dimethoxyanilino)-2-oxoethyl]thio]-3-pyridinecarboxylic acid propan-2-yl ester	dimethoxybenzene; isopropyl ester; secondary carboxamide		low
fagaramide	cinnamamides; secondary carboxamide		low
arachidonyl dopamine	catechols; fatty amide; N-(fatty acyl)-dopamine; secondary carboxamide		low
n-oleoyldopamine	catechols; fatty amide; N-(fatty acyl)-dopamine; secondary carboxamide	TRPV1 agonist	low
tranilast	amidobenzoic acid; cinnamamides; dimethoxybenzene; secondary carboxamide	anti-allergic agent; anti-asthmatic drug; antineoplastic agent; aryl hydrocarbon receptor agonist; calcium channel blocker; hepatoprotective agent; nephroprotective agent	low
arachidonyl-2-chloroethylamide	fatty amide; organochlorine compound; secondary carboxamide; synthetic cannabinoid	CB1 receptor agonist; CB2 receptor agonist; neuroprotective agent	low
l796778	benzenes; C-nitro compound; L-lysine derivative; L-phenylalanine derivative; methyl ester; oligopeptide; secondary carboxamide; ureas	somatostatin receptor agonist	low
l803087	benzenes; fluoroindole; guanidines; L-arginine derivative; methyl ester; phenylindole; secondary carboxamide	somatostatin receptor agonist	low
n-cinnamoyltyramine	cinnamamides; phenols; secondary carboxamide	allelochemical; antimicrobial agent; phytoalexin; platelet aggregation inhibitor	low
4-amylcinnamoylanthranilic acid	amidobenzoic acid; cinnamamides; secondary carboxamide	EC 3.1.1.4 (phospholipase A2) inhibitor; TRP channel blocker	low
batimastat	hydroxamic acid; L-phenylalanine derivative; organic sulfide; secondary carboxamide; thiophenes; triamide	angiogenesis inhibitor; antineoplastic agent; matrix metalloproteinase inhibitor	low
pipercallosidine	alkaloid; benzodioxoles; enamide; secondary carboxamide	apoptosis inducer; metabolite; plant metabolite	low
pederin	cyclic ketal; diol; oxanes; polyketide; secondary alcohol; secondary carboxamide	antimitotic; antineoplastic agent; bacterial metabolite; vesicant	low
streptogramin a	1,3-oxazoles; cyclic ketone; enamide; lactam; macrolide antibiotic; macrolide; pyrroline; secondary alcohol; secondary carboxamide; tertiary carboxamide	antibacterial drug; Mycoplasma genitalium metabolite	low
cinanserin	aryl sulfide; cinnamamides; secondary carboxamide; tertiary amino compound	anticoronaviral agent; antiviral agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor	low
pepstatin	pentapeptide; secondary carboxamide	bacterial metabolite; EC 3.4.23.* (aspartic endopeptidase) inhibitor	low
ximelagatran	amidoxime; azetidines; carboxamide; ethyl ester; hydroxylamines; secondary amino compound; secondary carboxamide; tertiary carboxamide	anticoagulant; EC 3.4.21.5 (thrombin) inhibitor; prodrug; serine protease inhibitor	low
(6R,7R)-7-[[(2R)-2-carboxy-2-(4-hydroxyphenyl)-1-oxoethyl]amino]-7-methoxy-3-[[(1-methyl-5-tetrazolyl)thio]methyl]-8-oxo-5-oxa-1-azabicyclo[4.2.0]oct-2-ene-2-carboxylic acid	dicarboxylic acid; secondary carboxamide		low
salubrinal	aminal; organochlorine compound; quinolines; secondary carboxamide; thioureas		low
DPI2	benzenes; morpholines; secondary carboxamide; tertiary amino compound; thiazolidinone	ferroptosis inducer	low
n-feruloylserotonin	aromatic ether; cinnamamides; hydroxyindoles; phenols; secondary carboxamide	plant metabolite	low
oroidin	pyrroles; secondary carboxamide	metabolite	low
ro 42-5892	cyclopropanes; diol; L-histidine derivative; secondary carboxamide; sulfone	antihypertensive agent; EC 3.4.23.15 (renin) inhibitor; peptidomimetic; vasodilator agent	low
s 1006	1,3-thiazoles; carbamate ester; carboxylic acid; cephalosporin; enamide; secondary carboxamide	antibacterial drug	low
manumycin	enamide; epoxide; organic heterobicyclic compound; polyketide; secondary carboxamide; tertiary alcohol	antiatherosclerotic agent; antimicrobial agent; antineoplastic agent; apoptosis inducer; bacterial metabolite; EC 1.8.1.9 (thioredoxin reductase) inhibitor; EC 2.5.1.58 (protein farnesyltransferase) inhibitor; marine metabolite	low
asukamycin	enamide; epoxide; organic heterobicyclic compound; polyketide; secondary carboxamide; tertiary alcohol	antibacterial agent; antifungal agent; antimicrobial agent; antineoplastic agent; bacterial metabolite	low
kalimantacin a	alpha,beta-unsaturated monocarboxylic acid; carbamate ester; fatty acid derivative; secondary carboxamide	antibacterial agent; antimicrobial agent; bacterial metabolite	low
l 744832	benzenes; ether; isopropyl ester; secondary carboxamide; sulfone; thiol	antineoplastic agent; EC 2.5.1.58 (protein farnesyltransferase) inhibitor; geroprotector	low
mocetinostat	aminopyrimidine; benzamides; pyridines; secondary amino compound; secondary carboxamide; substituted aniline	antineoplastic agent; apoptosis inducer; autophagy inducer; cardioprotective agent; EC 3.5.1.98 (histone deacetylase) inhibitor; hepatotoxic agent	low
l 779976	benzimidazoles; indoles; piperidinecarboxamide; primary amino compound; secondary carboxamide	neuroprotective agent; somatostatin receptor agonist	low
ustiloxin b	aromatic ether; heterodetic cyclic peptide; macrocycle; phenols; secondary alcohol; secondary carboxamide; sulfoxide	Aspergillus metabolite; microtubule-destabilising agent; mycotoxin	low
dysidenin	1,3-thiazoles; organochlorine compound; secondary carboxamide; tertiary carboxamide	animal metabolite; marine metabolite; toxin	low
avenanthramide b	amidobenzoic acid; cinnamamides; monohydroxybenzoic acid; monomethoxybenzene; phenols; secondary carboxamide	antineoplastic agent; apoptosis inducer; phytoalexin	low
azd2858	aromatic amine; N-methylpiperazine; pyrazines; pyridines; secondary carboxamide; sulfonamide	antineoplastic agent; bone density conservation agent; EC 2.7.11.26 (tau-protein kinase) inhibitor; Wnt signalling activator	low
bibw 2992	aromatic ether; enamide; furans; monochlorobenzenes; organofluorine compound; quinazolines; secondary carboxamide; tertiary amino compound	antineoplastic agent; tyrosine kinase inhibitor	low
betrixaban	benzamides; guanidines; monochloropyridine; monomethoxybenzene; secondary carboxamide	anticoagulant; EC 3.4.21.6 (coagulation factor Xa) inhibitor	low
fr 900848	cyclopropanes; nucleoside analogue; olefinic compound; polyketide; secondary carboxamide	antifungal agent; bacterial metabolite	low
pha 665752	dichlorobenzene; enamide; indolones; N-acylpyrrolidine; pyrrolecarboxamide; secondary carboxamide; sulfone; tertiary carboxamide	antineoplastic agent; c-Met tyrosine kinase inhibitor	low
n-benzylhexadecanamide	macamide; secondary carboxamide	EC 3.5.1.99 (fatty acid amide hydrolase) inhibitor; neuroprotective agent; plant metabolite	low
chlorantranilipole	monochlorobenzenes; organobromine compound; pyrazole insecticide; pyrazoles; pyridines; secondary carboxamide	ryanodine receptor agonist	low
cenicriviroc	aromatic ether; benzazocine; diether; imidazoles; secondary carboxamide; sulfoxide	anti-HIV agent; anti-inflammatory agent; antirheumatic drug; chemokine receptor 2 antagonist; chemokine receptor 5 antagonist	low
at 7519	dichlorobenzene; piperidines; pyrazoles; secondary carboxamide	antineoplastic agent; EC 2.7.11.22 (cyclin-dependent kinase) inhibitor	low
azd 1152	anilide; monoalkyl phosphate; monofluorobenzenes; pyrazoles; quinazolines; secondary amino compound; secondary carboxamide; tertiary amino compound	antineoplastic agent; Aurora kinase inhibitor; prodrug	low
pf 00299804	enamide; monochlorobenzenes; monofluorobenzenes; piperidines; quinazolines; secondary amino compound; secondary carboxamide; tertiary amino compound	antineoplastic agent; epidermal growth factor receptor antagonist	low
MI-63	azaspiro compound; monochlorobenzenes; monofluorobenzenes; morpholines; oxindoles; pyrrolidines; secondary carboxamide	apoptosis inducer	low
PF-00835231	aromatic ether; indolecarboxamide; L-leucine derivative; primary alcohol; pyrrolidin-2-ones; secondary carboxamide	anticoronaviral agent; drug metabolite; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor	low
cyantraniliprole	nitrile; organobromine compound; organochlorine compound; pyrazole insecticide; pyridines; secondary carboxamide	ryanodine receptor agonist	low
VPC 23019	aromatic amide; D-serine derivative; organic phosphate; phosphoric ester; secondary carboxamide	sphingosine-1-phosphate receptor 1 antagonist; sphingosine-1-phosphate receptor 3 antagonist	low
pd 0348292	monochlorobenzenes; monofluorobenzenes; pyridone; pyrrolidines; secondary carboxamide; ureas	anticoagulant; EC 3.4.21.6 (coagulation factor Xa) inhibitor; serine protease inhibitor	low
narlaprevir	azabicyclohexane; cyclopropanes; pyrrolidinecarboxamide; secondary carboxamide; sulfone; tertiary carboxamide; ureas	anticoronaviral agent; antiviral drug; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor; hepatitis C protease inhibitor	low
tosedostat	carboxylic ester; hydroxamic acid; secondary carboxamide		low
4-chloro-N-[1-[[5-(ethylthio)-1,3,4-thiadiazol-2-yl]amino]-3-methyl-1-oxobutan-2-yl]benzamide	secondary carboxamide		low
azd 1152-hqpa	anilide; monofluorobenzenes; primary alcohol; pyrazoles; quinazolines; secondary amino compound; secondary carboxamide; tertiary amino compound	antineoplastic agent; Aurora kinase inhibitor	low
CDN1163	aromatic ether; quinolines; secondary carboxamide	SERCA activator	low
(2S)-2-[[[5-[[5-[[(2-methylpropan-2-yl)oxy-oxomethyl]amino]pentylamino]-oxomethyl]-1H-imidazol-4-yl]-oxomethyl]amino]propanoic acid tert-butyl ester	secondary carboxamide; tert-butyl ester		low
(2S)-2-[[[5-[[methyl-(phenylmethyl)amino]-oxomethyl]-1H-imidazol-4-yl]-oxomethyl]amino]-6-[[(2-methylpropan-2-yl)oxy-oxomethyl]amino]hexanoic acid tert-butyl ester	secondary carboxamide; tert-butyl ester; tertiary carboxamide		low
(2S,3S,4R)-4-cyclopropyl-2-ethoxy-3-(3-hydroxypropyl)-N-prop-2-ynyl-3,4-dihydro-2H-pyran-6-carboxamide	secondary carboxamide		low
sid 26681509	carbohydrazide; L-tryptophan derivative; secondary carboxamide; tert-butyl ester; thioester	antiplasmodial drug; cathepsin L (EC 3.4.22.15) inhibitor	low
azd 7545	benzamides; monochlorobenzenes; organofluorine compound; secondary carboxamide; sulfone; tertiary alcohol; tertiary carboxamide	EC 2.7.11.2 - [pyruvate dehydrogenase (acetyl-transferring)] kinase inhibitor; hypoglycemic agent	low
sm 164	benzenes; organic heterobicyclic compound; secondary carboxamide; triazoles	antineoplastic agent; apoptosis inducer; radiosensitizing agent	low
sch772984	biaryl; indazoles; N-acylpiperazine; N-alkylpyrrolidine; N-arylpiperazine; pyridines; pyrimidines; pyrrolidinecarboxamide; secondary carboxamide; tertiary amino compound; tertiary carboxamide	analgesic; antineoplastic agent; apoptosis inducer; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	low
GRL-0617	benzamides; naphthalenes; secondary carboxamide; substituted aniline	anticoronaviral agent; protease inhibitor	low
entrectinib	benzamides; difluorobenzene; indazoles; N-methylpiperazine; oxanes; secondary amino compound; secondary carboxamide	antibacterial agent; antineoplastic agent; apoptosis inducer; EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor	low
TAK-580	1,3-thiazolecarboxamide; aminopyrimidine; chloropyridine; organofluorine compound; pyrimidinecarboxamide; secondary carboxamide	antineoplastic agent; apoptosis inducer; B-Raf inhibitor	low
cx 5461	diazepine; naphthyridine derivative; organic heterotetracyclic compound; pyrazines; secondary carboxamide	antineoplastic agent; apoptosis inducer; EC 2.7.7.6 (RNA polymerase) inhibitor	low
KOM70144	acetamides; benzamides; naphthalenes; secondary carboxamide	anticoronaviral agent; protease inhibitor	low
monepantel	(trifluoromethyl)benzenes; aromatic ether; aryl sulfide; nitrile; secondary carboxamide	anthelminthic drug; nematicide	low
ulixacaltamide	benzamides; monochlorobenzenes; monofluorobenzenes; piperidines; secondary carboxamide	non-narcotic analgesic; T-type calcium channel blocker	low
EG00229	benzothiadiazole; dicarboxylic acid monoamide; L-arginine derivative; secondary carboxamide; sulfonamide; thiophenes	angiogenesis inhibitor; antineoplastic agent; neuropilin receptor antagonist	low
tak-632	(trifluoromethyl)benzenes; aromatic ether; benzothiazoles; cyclopropylcarboxamide; monofluorobenzenes; nitrile; secondary carboxamide	antineoplastic agent; apoptosis inducer; B-Raf inhibitor; EC 2.7.11.26 (tau-protein kinase) inhibitor; necroptosis inhibitor	low
lgk974	bipyridines; pyrazines; pyridines; secondary carboxamide	Wnt signalling inhibitor	low
gsk-5498a	(trifluoromethyl)benzenes; difluorobenzene; pyrazoles; secondary carboxamide	calcium channel blocker	low
2-methoxy-N-[3-[4-[3-methyl-4-[(6-methyl-3-pyridinyl)oxy]anilino]-6-quinazolinyl]prop-2-enyl]acetamide	aromatic ether; methylpyridines; olefinic compound; quinazolines; secondary amino compound; secondary carboxamide; toluenes		low
raltegravir	1,2,4-oxadiazole; dicarboxylic acid amide; hydroxypyrimidine; monofluorobenzenes; pyrimidone; secondary carboxamide	antiviral drug; HIV-1 integrase inhibitor	low
lfm a13	aromatic amide; dibromobenzene; enamide; enol; nitrile; secondary carboxamide	antineoplastic agent; apoptosis inducer; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor; EC 2.7.11.21 (polo kinase) inhibitor; geroprotector; platelet aggregation inhibitor	low
teriflunomide	(trifluoromethyl)benzenes; aromatic amide; enamide; enol; nitrile; secondary carboxamide	drug metabolite; EC 1.3.98.1 [dihydroorotate oxidase (fumarate)] inhibitor; hepatotoxic agent; non-steroidal anti-inflammatory drug; tyrosine kinase inhibitor	low
LimKi 3	1,3-thiazoles; dichlorobenzene; organofluorine compound; pyrazoles; secondary carboxamide	LIM kinase inhibitor	low
MK-8353	aromatic ether; dihydropyridine; indazoles; methyl sulfide; N-alkylpyrrolidine; pyridines; pyrrolidinecarboxamide; secondary carboxamide; tertiary carboxamide; triazoles	antineoplastic agent; apoptosis inducer; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	low
acp-196	aromatic amine; benzamides; imidazopyrazine; pyridines; pyrrolidinecarboxamide; secondary carboxamide; tertiary carboxamide; ynone	antineoplastic agent; apoptosis inducer; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor	low
gsk343	aminopyridine; indazoles; N-alkylpiperazine; N-arylpiperazine; pyridone; secondary carboxamide	antineoplastic agent; apoptosis inducer; EC 2.1.1.43 (enhancer of zeste homolog 2) inhibitor	low
osimertinib	acrylamides; aminopyrimidine; biaryl; indoles; monomethoxybenzene; secondary amino compound; secondary carboxamide; substituted aniline; tertiary amino compound	antineoplastic agent; epidermal growth factor receptor antagonist	low
ivosidenib	cyanopyridine; monochlorobenzenes; organofluorine compound; pyrrolidin-2-ones; secondary carboxamide; tertiary carboxamide	antineoplastic agent; EC 1.1.1.42 (isocitrate dehydrogenase) inhibitor	low
atogepant	azaspiro compound; organic heterotetracyclic compound; piperidones; secondary carboxamide; trifluorobenzene	calcitonin gene-related peptide receptor antagonist	low
DDR1-IN-1	(trifluoromethyl)benzenes; aromatic ether; benzamides; N-alkylpiperazine; oxindoles; secondary carboxamide	EC 2.7.10.1 (receptor protein-tyrosine kinase) inhibitor	low
THZ531	aminopyrimidine; enamide; indoles; N-acylpiperidine; organochlorine compound; secondary amino compound; secondary carboxamide	antineoplastic agent; apoptosis inducer; EC 2.7.11.22 (cyclin-dependent kinase) inhibitor	low
AZ3451	benzimidazoles; benzodioxoles; nitrile; organobromine compound; secondary carboxamide	anti-inflammatory agent; autophagy inducer; PAR2 negative allosteric modulator	low
MMP-9-IN-1	aromatic compound; organic sulfide; organofluorine compound; pyrimidone; secondary carboxamide	antineoplastic agent; EC 3.4.24.35 (gelatinase B) inhibitor	low
althiomycin	1,3-thiazoles; aldoxime; ether; gamma-lactam; pentapeptide; peptide antibiotic; primary alcohol; pyrroline; secondary carboxamide; tertiary carboxamide	antibacterial agent; bacterial metabolite; protein synthesis inhibitor	low
colibactin	1,3-thiazoles; azaspiro compound; polyketide; pyrroline; secondary carboxamide	alkylating agent; carcinogenic agent; Escherichia coli metabolite; genotoxin	low
N-[(2S)-3-cyclohexyl-1-oxo-1-({(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl}amino)propan-2-yl]-1H-indole-2-carboxamide	aldehyde; indolecarboxamide; oligopeptide; pyrrolidin-2-ones; secondary carboxamide	anticoronaviral agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor	low
3-fluoro-Nalpha-(1H-indol-2-ylcarbonyl)-N-{(2S)-1-oxo-3-[(3S)-2-oxopyrrolidin-3-yl]propan-2-yl}-L-phenylalaninamide	aldehyde; indolecarboxamide; monofluorobenzenes; oligopeptide; pyrrolidin-2-ones; secondary carboxamide	anticoronaviral agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor	low
PF-07304814	aromatic ether; indolecarboxamide; L-leucine derivative; phosphate monoester; pyrrolidin-2-ones; secondary carboxamide	anticoronaviral agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor; prodrug	low
nirmatrelvir	azabicyclohexane; nitrile; organofluorine compound; pyrrolidin-2-ones; pyrrolidinecarboxamide; secondary carboxamide; tertiary carboxamide	anticoronaviral agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor	low
fleroxacin	difluorobenzene; fluoroquinolone antibiotic; monocarboxylic acid; N-alkylpiperazine; quinolines	antibacterial drug; EC 5.99.1.3 [DNA topoisomerase (ATP-hydrolysing)] inhibitor; topoisomerase IV inhibitor	low
fluconazole	conazole antifungal drug; difluorobenzene; tertiary alcohol; triazole antifungal drug	environmental contaminant; P450 inhibitor; xenobiotic	low
1,2-difluorobenzene	difluorobenzene	anaesthetic	low
voriconazole	conazole antifungal drug; difluorobenzene; pyrimidines; tertiary alcohol; triazole antifungal drug	P450 inhibitor	low
teflubenzuron	dichlorobenzene; difluorobenzene; N-acylurea	environmental contaminant; insecticide; xenobiotic	low
flufenoxuron	(trifluoromethyl)benzenes; benzoylurea insecticide; difluorobenzene; monochlorobenzenes; monofluorobenzenes	mite growth regulator	low
vx-745	aryl sulfide; dichlorobenzene; difluorobenzene; pyrimidopyridazine	anti-inflammatory drug; apoptosis inducer; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	low
n-(n-(3,5-difluorophenacetyl)alanyl)phenylglycine tert-butyl ester	carboxylic ester; difluorobenzene; dipeptide; tert-butyl ester	EC 3.4.23.46 (memapsin 2) inhibitor	low
isavuconazole	1,3-thiazoles; conazole antifungal drug; difluorobenzene; nitrile; tertiary alcohol; triazole antifungal drug	EC 1.14.13.70 (sterol 14alpha-demethylase) inhibitor; ergosterol biosynthesis inhibitor; orphan drug	low
pd 0325901	difluorobenzene; hydroxamic acid ester; monofluorobenzenes; organoiodine compound; propane-1,2-diols; secondary amino compound	antineoplastic agent; EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor	low
ly 411575	dibenzoazepine; difluorobenzene; lactam; secondary alcohol	EC 3.4.23.46 (memapsin 2) inhibitor	low
dafadine C	aromatic amide; aromatic ether; difluorobenzene; isoxazoles; N-acylpiperidine; pyridines	P450 inhibitor	low
pamapimod	aromatic amine; aromatic ether; difluorobenzene; diol; primary alcohol; pyridopyrimidine; secondary amino compound	antirheumatic drug; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	low
gdc-0973	aromatic amine; difluorobenzene; N-acylazetidine; organoiodine compound; piperidines; secondary amino compound; tertiary alcohol	antineoplastic agent; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	low
plx 4720	aromatic ketone; difluorobenzene; organochlorine compound; pyrrolopyridine; sulfonamide	antineoplastic agent; B-Raf inhibitor	low
gsk 2126458	aromatic ether; difluorobenzene; pyridazines; pyridines; quinolines; sulfonamide	anticoronaviral agent; antineoplastic agent; autophagy inducer; EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor; mTOR inhibitor; radiosensitizing agent	low
plx4032	aromatic ketone; difluorobenzene; monochlorobenzenes; pyrrolopyridine; sulfonamide	antineoplastic agent; B-Raf inhibitor	low

Substance	Classes	Roles	Relationship Strength
laurolitsine	aporphine alkaloid; aromatic ether; phenols	HIV-1 integrase inhibitor; metabolite	low
australifungin	carbobicyclic compound; enol; enone; secondary alcohol	antifungal agent; EC 2.3.1.24 (sphingosine N-acyltransferase) inhibitor; HIV-1 integrase inhibitor; metabolite	low
jtk-303	aromatic ether; monochlorobenzenes; organofluorine compound; quinolinemonocarboxylic acid; quinolone	HIV-1 integrase inhibitor	low
chicoric acid	organooxygen compound	geroprotector; HIV-1 integrase inhibitor	low
complestatin	cyclic ether; heterodetic cyclic peptide; indoles; organic heterobicyclic compound; organochlorine compound; peptide antibiotic; polyphenol	anti-HIV-1 agent; antimicrobial agent; HIV-1 integrase inhibitor; metabolite	low
neuroprotectin a	cyclic ether; heterodetic cyclic peptide; indoles; organochlorine compound; polyphenol	HIV-1 integrase inhibitor; metabolite	low
integric acid	carboxylic ester; cyclic ketone; dioxo monocarboxylic acid; enal; enone; eremophilane sesquiterpenoid	HIV-1 integrase inhibitor; metabolite	low
raltegravir	1,2,4-oxadiazole; dicarboxylic acid amide; hydroxypyrimidine; monofluorobenzenes; pyrimidone; secondary carboxamide	antiviral drug; HIV-1 integrase inhibitor	low
equisetin	enol; octahydronaphthalenes; primary alcohol; tetramic acids	antibacterial agent; fungal metabolite; HIV-1 integrase inhibitor; quorum sensing inhibitor	low
gsk1265744	difluorobenzene; monocarboxylic acid amide; organic heterotricyclic compound; secondary carboxamide	HIV-1 integrase inhibitor	low
bictegravir	monocarboxylic acid amide; organic heterotetracyclic compound; secondary carboxamide; trifluorobenzene	HIV-1 integrase inhibitor	low

Substance	Classes	Roles	Relationship Strength
raltegravir	1,2,4-oxadiazole; dicarboxylic acid amide; hydroxypyrimidine; monofluorobenzenes; pyrimidone; secondary carboxamide	antiviral drug; HIV-1 integrase inhibitor	low
gsk1265744	difluorobenzene; monocarboxylic acid amide; organic heterotricyclic compound; secondary carboxamide	HIV-1 integrase inhibitor	low
bictegravir	monocarboxylic acid amide; organic heterotetracyclic compound; secondary carboxamide; trifluorobenzene	HIV-1 integrase inhibitor	low

Substance	Studies	Classes	Roles	First Year	Last Year	Average Age	Relationship Strength	2010's	post-2020
verapamil	1	aromatic ether; nitrile; polyether; tertiary amino compound		2016	2016	8.0	low	1	0
donepezil	1	aromatic ether; indanones; piperidines; racemate	EC 3.1.1.7 (acetylcholinesterase) inhibitor; EC 3.1.1.8 (cholinesterase) inhibitor; nootropic agent	2018	2018	6.0	low	1	0
e 4031	1	sulfonamide		2016	2016	8.0	low	1	0
furafylline	1	oxopurine		2016	2016	8.0	low	1	0
haloperidol	3	aromatic ketone; hydroxypiperidine; monochlorobenzenes; organofluorine compound; tertiary alcohol	antidyskinesia agent; antiemetic; dopaminergic antagonist; first generation antipsychotic; serotonergic antagonist	2015	2022	5.7	low	2	1
ketoconazole	1	dichlorobenzene; dioxolane; ether; imidazoles; N-acylpiperazine; N-arylpiperazine		2016	2016	8.0	low	1	0
metoprolol	1	aromatic ether; propanolamine; secondary alcohol; secondary amino compound	antihypertensive agent; beta-adrenergic antagonist; environmental contaminant; geroprotector; xenobiotic	2019	2019	5.0	low	1	0
nadolol	1	tetralins		2019	2019	5.0	low	1	0
sulfaphenazole	1	primary amino compound; pyrazoles; substituted aniline; sulfonamide antibiotic; sulfonamide	antibacterial drug; EC 1.14.13.181 (13-deoxydaunorubicin hydroxylase) inhibitor; EC 1.14.13.67 (quinine 3-monooxygenase) inhibitor; P450 inhibitor	2016	2016	8.0	low	1	0
vesamicol	1	piperidines		2018	2018	6.0	low	1	0
zidovudine	3	azide; pyrimidine 2',3'-dideoxyribonucleoside	antimetabolite; antiviral drug; HIV-1 reverse transcriptase inhibitor	2016	2019	7.0	low	3	0
carbidopa	1	catechols; hydrate; hydrazines; monocarboxylic acid	antidyskinesia agent; antiparkinson drug; dopaminergic agent; EC 4.1.1.28 (aromatic-L-amino-acid decarboxylase) inhibitor	2014	2014	10.0	low	1	0
atorvastatin	1	aromatic amide; dihydroxy monocarboxylic acid; monofluorobenzenes; pyrroles; statin (synthetic)	environmental contaminant; xenobiotic	2014	2014	10.0	low	1	0
beta-thujaplicinol	1			2019	2019	5.0	low	1	0
beta-carboline-3-carboxylic acid ethyl ester	1	beta-carbolines		2018	2018	6.0	low	1	0
tadalafil	1	benzodioxoles; pyrazinopyridoindole	EC 3.1.4.35 (3',5'-cyclic-GMP phosphodiesterase) inhibitor; vasodilator agent	2018	2018	6.0	low	1	0
4-(4-(4-chlorophenyl)-4-hydroxy-1-piperidinyl)-1-(4-fluorophenyl)-1-butanol	1	piperidines		2022	2022	2.0	low	0	1
birb 796	1	aromatic ether; morpholines; naphthalenes; pyrazoles; ureas	EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor; immunomodulator	2018	2018	6.0	low	1	0
dizocilpine	1	secondary amino compound; tetracyclic antidepressant	anaesthetic; anticonvulsant; neuroprotective agent; nicotinic antagonist; NMDA receptor antagonist	2015	2015	9.0	low	1	0
ritonavir	1	1,3-thiazoles; carbamate ester; carboxamide; L-valine derivative; ureas	antiviral drug; environmental contaminant; HIV protease inhibitor; xenobiotic	2016	2016	8.0	low	1	0
quinidine	1	cinchona alkaloid	alpha-adrenergic antagonist; anti-arrhythmia drug; antimalarial; drug allergen; EC 1.14.13.181 (13-deoxydaunorubicin hydroxylase) inhibitor; EC 3.6.3.44 (xenobiotic-transporting ATPase) inhibitor; muscarinic antagonist; P450 inhibitor; potassium channel blocker; sodium channel blocker	2016	2016	8.0	low	1	0
pentazocine	2	benzazocine		2022	2022	2.0	low	0	2
cerivastatin	1	dihydroxy monocarboxylic acid; pyridines; statin (synthetic)		2016	2016	8.0	low	1	0
1-(3-tert-butyl-1-methylpyrazol-5-yl)-3-(4-chlorophenyl)urea	1	monochlorobenzenes; phenylureas; pyrazoles	EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	2018	2018	6.0	low	1	0
bd 1063	1	primary amine		2022	2022	2.0	medium	0	1
telaprevir	1	cyclopentapyrrole; cyclopropanes; oligopeptide; pyrazines	antiviral drug; hepatitis C protease inhibitor; peptidomimetic	2018	2018	6.0	low	1	0
u-50488	1	dichlorobenzene; monocarboxylic acid amide; N-alkylpyrrolidine	analgesic; antitussive; calcium channel blocker; diuretic; kappa-opioid receptor agonist	2022	2022	2.0	low	0	1
jtk-303	3	aromatic ether; monochlorobenzenes; organofluorine compound; quinolinemonocarboxylic acid; quinolone	HIV-1 integrase inhibitor	2014	2019	7.0	low	3	0
eprosartan	1	dicarboxylic acid; imidazoles; thiophenes	angiotensin receptor antagonist; antihypertensive agent; environmental contaminant; xenobiotic	2014	2014	10.0	low	1	0
enkephalin, ala(2)-mephe(4)-gly(5)-	1	peptide		2022	2022	2.0	low	0	1
pradimicin a	1	aromatic ether; carboxylic acid; disaccharide derivative; L-alanine derivative; p-quinones; polyphenol; pradimicin; secondary alcohol		2015	2015	9.0	low	1	0
naltrindole	1	isoquinolines		2022	2022	2.0	low	0	1
scio-469	1	aromatic amide; aromatic ketone; chloroindole; dicarboxylic acid diamide; indolecarboxamide; monofluorobenzenes; N-acylpiperazine; N-alkylpiperazine	antineoplastic agent; apoptosis inducer; EC 2.7.11.24 (mitogen-activated protein kinase) inhibitor	2018	2018	6.0	low	1	0
sa 4503	1			2018	2018	6.0	low	1	0
raltegravir potassium	1			2013	2013	11.0	low	1	0
bms-790052	1	biphenyls; carbamate ester; carboxamide; imidazoles; valine derivative	antiviral drug; nonstructural protein 5A inhibitor	2018	2018	6.0	low	1	0
azd3839	1			2018	2018	6.0	medium	1	0
abt-199	1	aromatic ether; C-nitro compound; monochlorobenzenes; N-alkylpiperazine; N-arylpiperazine; N-sulfonylcarboxamide; oxanes; pyrrolopyridine	antineoplastic agent; apoptosis inducer; B-cell lymphoma 2 inhibitor	2018	2018	6.0	low	1	0
ass234	1			2018	2018	6.0	medium	1	0
raltegravir	8	1,2,4-oxadiazole; dicarboxylic acid amide; hydroxypyrimidine; monofluorobenzenes; pyrimidone; secondary carboxamide	antiviral drug; HIV-1 integrase inhibitor	2014	2019	6.9	low	8	0
a 769662	1	biphenyls		2018	2018	6.0	low	1	0
gsk1265744	2	difluorobenzene; monocarboxylic acid amide; organic heterotricyclic compound; secondary carboxamide	HIV-1 integrase inhibitor	2013	2020	7.5	low	2	0
bictegravir	2	monocarboxylic acid amide; organic heterotetracyclic compound; secondary carboxamide; trifluorobenzene	HIV-1 integrase inhibitor	2019	2020	4.5	low	2	0
sildenafil	1	piperazines; pyrazolopyrimidine; sulfonamide	EC 3.1.4.35 (3',5'-cyclic-GMP phosphodiesterase) inhibitor; vasodilator agent	2018	2018	6.0	low	1	0
zaprinast	1	triazolopyrimidines		2018	2018	6.0	low	1	0
vardenafil	1	imidazotriazine; N-alkylpiperazine; N-sulfonylpiperazine	EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; vasodilator agent	2018	2018	6.0	low	1	0

Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Journal of medicinal chemistry, , Aug-09, Volume: 61, Issue:15, 2018

Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Bioorganic & medicinal chemistry, , 09-01, Volume: 27, Issue:17, 2019

Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Journal of medicinal chemistry, , Aug-09, Volume: 61, Issue:15, 2018

3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Journal of medicinal chemistry, , 07-14, Volume: 59, Issue:13, 2016

Inhibiting the HIV integration process: past, present, and the future.
Journal of medicinal chemistry, , Feb-13, Volume: 57, Issue:3, 2014

Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Bioorganic & medicinal chemistry, , 09-01, Volume: 27, Issue:17, 2019

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Bioorganic & medicinal chemistry, , 09-01, Volume: 27, Issue:17, 2019

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Inhibiting the HIV integration process: past, present, and the future.
Journal of medicinal chemistry, , Feb-13, Volume: 57, Issue:3, 2014

Inhibiting the HIV integration process: past, present, and the future.
Journal of medicinal chemistry, , Feb-13, Volume: 57, Issue:3, 2014

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Journal of medicinal chemistry, , Aug-09, Volume: 61, Issue:15, 2018

Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Journal of medicinal chemistry, , Jul-25, Volume: 56, Issue:14, 2013

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Journal of medicinal chemistry, , Aug-09, Volume: 61, Issue:15, 2018

Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Bioorganic & medicinal chemistry, , 09-01, Volume: 27, Issue:17, 2019

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity.
Journal of medicinal chemistry, , 06-22, Volume: 60, Issue:12, 2017

3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H.
Journal of medicinal chemistry, , 07-14, Volume: 59, Issue:13, 2016

Inhibiting the HIV integration process: past, present, and the future.
Journal of medicinal chemistry, , Feb-13, Volume: 57, Issue:3, 2014

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744).
Journal of medicinal chemistry, , Jul-25, Volume: 56, Issue:14, 2013

Design, synthesis and biological evaluation of 3-hydroxyquinazoline-2,4(1H,3H)-diones as dual inhibitors of HIV-1 reverse transcriptase-associated RNase H and integrase.
Bioorganic & medicinal chemistry, , 09-01, Volume: 27, Issue:17, 2019

Mapping the Efficiency and Physicochemical Trajectories of Successful Optimizations.
Journal of medicinal chemistry, , 08-09, Volume: 61, Issue:15, 2018

Substance	Studies	Classes	Roles	First Year	Last Year	Average Age	Relationship Strength	Trials	2010's	post-2020
adenine	36	6-aminopurines; purine nucleobase	Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	2012	2023	4.8	low	16	25	11
bromide	1	halide anion; monoatomic bromine		2021	2021	3.0	low	0	0	1
carbamates	5	amino-acid anion		2014	2019	7.2	low	4	5	0
cytosine	1	aminopyrimidine; pyrimidine nucleobase; pyrimidone	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	2019	2019	5.0	low	1	1	0
glycine	1	alpha-amino acid; amino acid zwitterion; proteinogenic amino acid; serine family amino acid	EC 2.1.2.1 (glycine hydroxymethyltransferase) inhibitor; fundamental metabolite; hepatoprotective agent; micronutrient; neurotransmitter; NMDA receptor agonist; nutraceutical	2020	2020	4.0	low	0	1	0
kynurenine	1	aromatic ketone; non-proteinogenic alpha-amino acid; substituted aniline	human metabolite	2019	2019	5.0	low	0	1	0
uracil	2	pyrimidine nucleobase; pyrimidone	allergen; Daphnia magna metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; prodrug; Saccharomyces cerevisiae metabolite	2016	2019	6.5	low	2	2	0
p-aminohippuric acid	1	N-acylglycine	Daphnia magna metabolite	2013	2013	11.0	low	1	1	0
amlodipine	1	dihydropyridine; ethyl ester; methyl ester; monochlorobenzenes; primary amino compound	antihypertensive agent; calcium channel blocker; vasodilator agent	2020	2020	4.0	low	0	1	0
amodiaquine	4	aminoquinoline; organochlorine compound; phenols; secondary amino compound; tertiary amino compound	anticoronaviral agent; antimalarial; drug allergen; EC 2.1.1.8 (histamine N-methyltransferase) inhibitor; non-steroidal anti-inflammatory drug; prodrug	2019	2021	4.5	low	0	3	1
antipyrine	1	pyrazolone	antipyretic; cyclooxygenase 3 inhibitor; environmental contaminant; non-narcotic analgesic; non-steroidal anti-inflammatory drug; xenobiotic	2019	2019	5.0	low	0	1	0
aztreonam	1			2016	2016	8.0	low	0	1	0
carbamazepine	2	dibenzoazepine; ureas	analgesic; anticonvulsant; antimanic drug; drug allergen; EC 3.5.1.98 (histone deacetylase) inhibitor; environmental contaminant; glutamate transporter activator; mitogen; non-narcotic analgesic; sodium channel blocker; xenobiotic	2016	2020	6.0	low	1	2	0
dichlorodiphenyl dichloroethylene	1	chlorophenylethylene; monochlorobenzenes	human xenobiotic metabolite; persistent organic pollutant	2019	2019	5.0	low	0	1	0
valproic acid	3	branched-chain fatty acid; branched-chain saturated fatty acid	anticonvulsant; antimanic drug; EC 3.5.1.98 (histone deacetylase) inhibitor; GABA agent; neuroprotective agent; psychotropic drug; teratogenic agent	2018	2021	4.7	low	1	2	1
foscarnet	2	carboxylic acid; one-carbon compound; phosphonic acids	antiviral drug; geroprotector; HIV-1 reverse transcriptase inhibitor; sodium-dependent Pi-transporter inhibitor	2014	2016	9.0	low	0	2	0
hydroxychloroquine	1	aminoquinoline; organochlorine compound; primary alcohol; secondary amino compound; tertiary amino compound	anticoronaviral agent; antimalarial; antirheumatic drug; dermatologic drug	2021	2021	3.0	low	1	0	1
iohexol	1	benzenedicarboxamide; organoiodine compound	environmental contaminant; radioopaque medium; xenobiotic	2013	2013	11.0	low	1	1	0
isoniazid	6	carbohydrazide	antitubercular agent; drug allergen	2018	2023	2.8	low	3	3	3
metformin	5	guanidines	environmental contaminant; geroprotector; hypoglycemic agent; xenobiotic	2016	2018	7.0	low	1	5	0
methadone	1	benzenes; diarylmethane; ketone; tertiary amino compound		2013	2013	11.0	low	1	1	0
nevirapine	3	cyclopropanes; dipyridodiazepine	antiviral drug; HIV-1 reverse transcriptase inhibitor	2015	2023	5.0	low	1	2	1
oxolinic acid	1	aromatic carboxylic acid; organic heterotricyclic compound; oxacycle; quinolinemonocarboxylic acid; quinolone antibiotic	antibacterial drug; antifungal agent; antiinfective agent; antimicrobial agent; enzyme inhibitor	2016	2016	8.0	low	0	1	0
phenobarbital	1	barbiturates	anticonvulsant; drug allergen; excitatory amino acid antagonist; sedative	2018	2018	6.0	low	0	1	0
sulfisoxazole	1	isoxazoles; sulfonamide antibiotic; sulfonamide	antibacterial drug; drug allergen	2018	2018	6.0	low	0	1	0
tazarotene	1	acetylenic compound; ethyl ester; pyridines; retinoid; thiochromane	keratolytic drug; prodrug; teratogenic agent	2019	2019	5.0	low	0	1	0
thyroxine	1	2-halophenol; iodophenol; L-phenylalanine derivative; non-proteinogenic L-alpha-amino acid; thyroxine zwitterion; thyroxine	antithyroid drug; human metabolite; mouse metabolite; thyroid hormone	2017	2017	7.0	low	0	1	0
prednisone	1	11-oxo steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 21-hydroxy steroid; 3-oxo-Delta(1),Delta(4)-steroid; C21-steroid; glucocorticoid; primary alpha-hydroxy ketone; tertiary alpha-hydroxy ketone	adrenergic agent; anti-inflammatory drug; antineoplastic agent; immunosuppressive agent; prodrug	2013	2013	11.0	low	1	1	0
penicillin g	1	penicillin allergen; penicillin	antibacterial drug; drug allergen; epitope	2020	2020	4.0	low	0	1	0
alanine	28	alanine zwitterion; alanine; L-alpha-amino acid; proteinogenic amino acid; pyruvate family amino acid	EC 4.3.1.15 (diaminopropionate ammonia-lyase) inhibitor; fundamental metabolite	2017	2023	4.2	low	11	17	11
serine	1	L-alpha-amino acid; proteinogenic amino acid; serine family amino acid; serine zwitterion; serine	algal metabolite; Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	2020	2020	4.0	low	0	1	0
glutamine	1	amino acid zwitterion; glutamine family amino acid; glutamine; L-alpha-amino acid; polar amino acid zwitterion; proteinogenic amino acid	EC 1.14.13.39 (nitric oxide synthase) inhibitor; Escherichia coli metabolite; human metabolite; metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite	2020	2020	4.0	low	0	1	0
ethinyl estradiol	1	17-hydroxy steroid; 3-hydroxy steroid; terminal acetylenic compound	xenoestrogen	2015	2015	9.0	low	1	1	0
uridine monophosphate	1	pyrimidine ribonucleoside 5'-monophosphate; uridine 5'-phosphate	Escherichia coli metabolite; human metabolite; mouse metabolite	2014	2014	10.0	low	0	1	0
carbostyril	91	monohydroxyquinoline; quinolone	bacterial xenobiotic metabolite	2011	2022	7.4	low	3	85	6
phenylalanine	1	amino acid zwitterion; erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid; phenylalanine; proteinogenic amino acid	algal metabolite; EC 3.1.3.1 (alkaline phosphatase) inhibitor; Escherichia coli metabolite; human xenobiotic metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite	2019	2019	5.0	low	0	1	0
histidine	1	amino acid zwitterion; histidine; L-alpha-amino acid; polar amino acid zwitterion; proteinogenic amino acid	algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite	2020	2020	4.0	low	0	1	0
valine	2	L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid; pyruvate family amino acid; valine	algal metabolite; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite	2016	2016	8.0	low	2	2	0
tryptophan	1	erythrose 4-phosphate/phosphoenolpyruvate family amino acid; L-alpha-amino acid zwitterion; L-alpha-amino acid; proteinogenic amino acid; tryptophan zwitterion; tryptophan	antidepressant; Escherichia coli metabolite; human metabolite; micronutrient; mouse metabolite; nutraceutical; plant metabolite; Saccharomyces cerevisiae metabolite	2019	2019	5.0	low	0	1	0
quinoxalines	1	mancude organic heterobicyclic parent; naphthyridine; ortho-fused heteroarene		2019	2019	5.0	low	1	1	0
2-naphthylamine	1	naphthylamine	carcinogenic agent	2016	2016	8.0	low	1	1	0
xanthenes	1	xanthene		2021	2021	3.0	low	0	0	1
pyrroles	1	pyrrole; secondary amine		2017	2017	7.0	low	0	1	0
limestone	1	calcium salt; carbonate salt; inorganic calcium salt; one-carbon compound	antacid; fertilizer; food colouring; food firming agent	2015	2015	9.0	low	1	1	0
myristic acid	1	long-chain fatty acid; straight-chain saturated fatty acid	algal metabolite; Daphnia magna metabolite; EC 3.1.1.1 (carboxylesterase) inhibitor; human metabolite	2022	2022	2.0	low	0	0	1
resazurin	1	phenoxazine		2021	2021	3.0	low	0	0	1
2,6-dichloro-4-nitrophenol	1			2023	2023	1.0	low	0	0	1
deoxycytidine	4	pyrimidine 2'-deoxyribonucleoside	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite	2014	2017	8.5	low	0	4	0
ethambutol	1	ethanolamines; ethylenediamine derivative	antitubercular agent; environmental contaminant; xenobiotic	2019	2019	5.0	low	0	1	0
fluorescein-5-isothiocyanate	1	fluorescein isothiocyanate		2019	2019	5.0	low	0	1	0
dithiothreitol	1	1,4-dimercaptobutane-2,3-diol; butanediols; dithiol; glycol; thiol	chelator; human metabolite; reducing agent	2014	2014	10.0	low	0	1	0
silver	1	copper group element atom; elemental silver	Escherichia coli metabolite	2023	2023	1.0	low	0	0	1
europium	1	f-block element atom; lanthanoid atom		2018	2018	6.0	low	0	1	0
pregnanolone	1	3-hydroxy-5beta-pregnan-20-one; 3alpha-hydroxy steroid	human metabolite; intravenous anaesthetic; sedative	2019	2019	5.0	low	0	1	0
oxcarbazepine	2	cyclic ketone; dibenzoazepine	anticonvulsant; drug allergen	2018	2020	5.0	low	0	2	0
zidovudine	6	azide; pyrimidine 2',3'-dideoxyribonucleoside	antimetabolite; antiviral drug; HIV-1 reverse transcriptase inhibitor	2016	2022	4.8	low	2	3	3
miloxacin	1	quinolines		2016	2016	8.0	low	0	1	0
desogestrel	1	17beta-hydroxy steroid; terminal acetylenic compound	contraceptive drug; progestin; synthetic oral contraceptive	2020	2020	4.0	low	0	1	0
pefloxacin	1	fluoroquinolone antibiotic; monocarboxylic acid; N-alkylpiperazine; N-arylpiperazine; quinolone antibiotic; quinolone	antibacterial drug; antiinfective agent; DNA synthesis inhibitor	2016	2016	8.0	low	0	1	0
gemcitabine	1	organofluorine compound; pyrimidine 2'-deoxyribonucleoside	antimetabolite; antineoplastic agent; antiviral drug; DNA synthesis inhibitor; EC 1.17.4.1 (ribonucleoside-diphosphate reductase) inhibitor; environmental contaminant; immunosuppressive agent; photosensitizing agent; prodrug; radiosensitizing agent; xenobiotic	2017	2017	7.0	low	0	1	0
atorvastatin	1	aromatic amide; dihydroxy monocarboxylic acid; monofluorobenzenes; pyrroles; statin (synthetic)	environmental contaminant; xenobiotic	2020	2020	4.0	low	0	1	0
lamivudine	228	monothioacetal; nucleoside analogue; oxacycle; primary alcohol	allergen; anti-HBV agent; antiviral drug; EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor; HIV-1 reverse transcriptase inhibitor; prodrug	2013	2023	4.1	medium	55	129	99
irinotecan	1	carbamate ester; delta-lactone; N-acylpiperidine; pyranoindolizinoquinoline; ring assembly; tertiary alcohol; tertiary amino compound	antineoplastic agent; apoptosis inducer; EC 5.99.1.2 (DNA topoisomerase) inhibitor; prodrug	2021	2021	3.0	low	0	0	1
emtricitabine	78	monothioacetal; nucleoside analogue; organofluorine compound; pyrimidone	antiviral drug; HIV-1 reverse transcriptase inhibitor	2014	2023	3.8	low	29	41	37
trovafloxacin	1			2016	2016	8.0	low	0	1	0
efavirenz	77	acetylenic compound; benzoxazine; cyclopropanes; organochlorine compound; organofluorine compound	antiviral drug; HIV-1 reverse transcriptase inhibitor	2012	2023	4.0	low	18	40	37
nelfinavir	1	aryl sulfide; benzamides; organic heterobicyclic compound; phenols; secondary alcohol; tertiary amino compound	antineoplastic agent; HIV protease inhibitor	2017	2017	7.0	low	0	1	0
emivirine	1	pyrimidone	antiviral drug; HIV-1 reverse transcriptase inhibitor	2019	2019	5.0	low	1	1	0
amprenavir	1	carbamate ester; sulfonamide; tetrahydrofuryl ester	antiviral drug; HIV protease inhibitor	2014	2014	10.0	low	1	1	0
cephalosporin c	1	cephalosporin	fungal metabolite	2016	2016	8.0	low	0	1	0
triazoles	8	1,2,3-triazole		2012	2021	7.8	low	3	7	1
sertraline	1	dichlorobenzene; secondary amino compound; tetralins	antidepressant; serotonin uptake inhibitor	2020	2020	4.0	low	0	1	0
artemether	4	artemisinin derivative; cyclic acetal; organic peroxide; semisynthetic derivative; sesquiterpenoid	antimalarial	2019	2021	4.5	low	0	3	1
uk 68798	2	aromatic ether; sulfonamide; tertiary amino compound	anti-arrhythmia drug; potassium channel blocker	2014	2014	10.0	low	0	2	0
alafosfalin	1			2020	2020	4.0	low	0	1	0
doripenem	1	carbapenems		2016	2016	8.0	low	0	1	0
lopinavir	9	amphetamines; dicarboxylic acid diamide	anticoronaviral agent; antiviral drug; HIV protease inhibitor	2014	2023	5.2	low	2	6	3
brexanolone	1	3-hydroxy-5alpha-pregnan-20-one	antidepressant; GABA modulator; human metabolite; intravenous anaesthetic; sedative	2019	2019	5.0	low	0	1	0
imipenem, anhydrous	1	beta-lactam antibiotic allergen; carbapenems; zwitterion	antibacterial drug	2016	2016	8.0	low	0	1	0
artesunic acid	4			2019	2021	4.5	low	0	3	1
piperaquine	2	aminoquinoline; N-arylpiperazine; organochlorine compound	antimalarial	2022	2022	2.0	low	2	0	2
fosamprenavir	1	sulfonamide	prodrug	2014	2014	10.0	low	1	1	0
carbapenems	1			2016	2016	8.0	low	0	1	0
proline	2	amino acid zwitterion; glutamine family amino acid; L-alpha-amino acid; proline; proteinogenic amino acid	algal metabolite; compatible osmolytes; Escherichia coli metabolite; micronutrient; mouse metabolite; nutraceutical; Saccharomyces cerevisiae metabolite	2014	2016	9.0	low	2	2	0
docetaxel anhydrous	1	secondary alpha-hydroxy ketone; tetracyclic diterpenoid	antimalarial; antineoplastic agent; photosensitizing agent	2017	2017	7.0	low	0	1	0
moxifloxacin	1	aromatic ether; cyclopropanes; fluoroquinolone antibiotic; pyrrolidinopiperidine; quinolinemonocarboxylic acid; quinolone antibiotic; quinolone	antibacterial drug	2012	2012	12.0	low	1	1	0
atazanavir sulfate	19	organic sulfate salt		2011	2023	5.4	low	3	15	4
organophosphonates	4	divalent inorganic anion; phosphite ion		2012	2015	10.5	low	2	4	0
etravirine	6	aminopyrimidine; aromatic ether; dinitrile; organobromine compound	antiviral agent; HIV-1 reverse transcriptase inhibitor	2012	2021	6.7	low	1	5	1
darunavir	49	carbamate ester; furofuran; sulfonamide	antiviral drug; HIV protease inhibitor	2013	2023	4.8	low	12	33	16
benzofurans	1			2019	2019	5.0	low	1	1	0
trimethoprim, sulfamethoxazole drug combination	1			2016	2016	8.0	low	0	1	0
ritonavir	46	1,3-thiazoles; carbamate ester; carboxamide; L-valine derivative; ureas	antiviral drug; environmental contaminant; HIV protease inhibitor; xenobiotic	2011	2023	6.2	low	17	37	9
abacavir	53	2,6-diaminopurines	antiviral drug; drug allergen; HIV-1 reverse transcriptase inhibitor	2013	2023	5.5	low	14	43	10
linezolid	1	acetamides; morpholines; organofluorine compound; oxazolidinone	antibacterial drug; protein synthesis inhibitor	2016	2016	8.0	low	0	1	0
betadex	1	cyclodextrin		2019	2019	5.0	low	0	1	0
zithromax	1	macrolide antibiotic	antibacterial drug; environmental contaminant; xenobiotic	2019	2019	5.0	low	0	1	0
tenofovir	121	nucleoside analogue; phosphonic acids	antiviral drug; drug metabolite; HIV-1 reverse transcriptase inhibitor	2012	2023	4.0	medium	38	63	58
maraviroc	7	tropane alkaloid		2012	2020	8.1	low	3	7	0
telaprevir	1	cyclopentapyrrole; cyclopropanes; oligopeptide; pyrazines	antiviral drug; hepatitis C protease inhibitor; peptidomimetic	2014	2014	10.0	low	1	1	0
abacavir, lamivudine drug combination	33			2013	2022	6.7	high	8	30	3
jtk-303	91	aromatic ether; monochlorobenzenes; organofluorine compound; quinolinemonocarboxylic acid; quinolone	HIV-1 integrase inhibitor	2011	2023	7.4	high	3	85	6
bilirubin	2	biladienes; dicarboxylic acid	antioxidant; human metabolite; mouse metabolite	2018	2022	4.0	low	0	1	1
amphotericin b	1	antibiotic antifungal drug; macrolide antibiotic; polyene antibiotic	antiamoebic agent; antiprotozoal drug; bacterial metabolite	2019	2019	5.0	low	0	1	0
morphine	2	morphinane alkaloid; organic heteropentacyclic compound; tertiary amino compound	anaesthetic; drug allergen; environmental contaminant; geroprotector; mu-opioid receptor agonist; opioid analgesic; plant metabolite; vasodilator agent; xenobiotic	2019	2019	5.0	low	0	2	0
clobetasol	1	11beta-hydroxy steroid; 17alpha-hydroxy steroid; 20-oxo steroid; 3-oxo-Delta(1),Delta(4)-steroid; chlorinated steroid; fluorinated steroid; glucocorticoid; tertiary alpha-hydroxy ketone	anti-inflammatory drug; SMO receptor agonist	2019	2019	5.0	low	0	1	0
halobetasol	1	corticosteroid hormone		2019	2019	5.0	low	0	1	0
indinavir sulfate	1	dicarboxylic acid diamide; N-(2-hydroxyethyl)piperazine; piperazinecarboxamide	HIV protease inhibitor	2020	2020	4.0	low	0	1	0
fumarates	3	butenedioate; C4-dicarboxylate	human metabolite; metabolite; Saccharomyces cerevisiae metabolite	2023	2023	1.0	low	1	0	3
cefepime	1	cephalosporin; oxime O-ether	antibacterial drug	2020	2020	4.0	low	0	1	0
ferrous fumarate	1	dicarboxylic acid		2015	2015	9.0	low	1	1	0
lumefantrine	1	fluorenes; monochlorobenzenes; secondary alcohol; tertiary amine	antimalarial	2019	2019	5.0	low	0	1	0
cgp-56697	3			2019	2021	4.3	low	0	2	1
rilpivirine	61	aminopyrimidine; nitrile	EC 2.7.7.49 (RNA-directed DNA polymerase) inhibitor; HIV-1 reverse transcriptase inhibitor	2013	2023	5.2	medium	7	45	16
epoxyfarnesyl diazoacetate	2			2019	2021	4.0	low	1	1	1
carumonam	1	monobactam	antibacterial drug	2016	2016	8.0	low	0	1	0
etonogestrel	1	17beta-hydroxy steroid; 3-oxo-Delta(4) steroid; terminal acetylenic compound	contraceptive drug; female contraceptive drug; progestin	2020	2020	4.0	low	0	1	0
tri-cyclen	1			2015	2015	9.0	low	1	1	0
gs-7340	27	6-aminopurines; ether; isopropyl ester; L-alanine derivative; phosphoramidate ester	antiviral drug; HIV-1 reverse transcriptase inhibitor; prodrug	2017	2023	3.9	low	11	14	13
efavirenz, emtricitabine, tenofovir disoproxil fumarate drug combination	1			2016	2016	8.0	low	0	1	0
pasireotide	1	homodetic cyclic peptide; peptide hormone	antineoplastic agent	2014	2014	10.0	low	0	1	0
artenimol	2			2022	2022	2.0	low	2	0	2
aclidinium bromide	1	organic bromide salt; quaternary ammonium salt	bronchodilator agent; muscarinic antagonist	2019	2019	5.0	low	0	1	0
emtricitabine, tenofovir disoproxil fumarate drug combination	1			2017	2017	7.0	low	0	1	0
norelgestromin	1			2015	2015	9.0	low	1	1	0
mdv 3100	1	(trifluoromethyl)benzenes; benzamides; imidazolidinone; monofluorobenzenes; nitrile; thiocarbonyl compound	androgen antagonist; antineoplastic agent	2022	2022	2.0	low	0	0	1
alx-0600	1	polypeptide	antioxidant; glucagon-like peptide-2 receptor agonist; metabolite; protective agent	2014	2014	10.0	low	0	1	0
chitosan	2			2021	2022	2.5	low	0	0	2
raltegravir potassium	140			2011	2022	7.4	high	9	126	14
cardiovascular agents	1			2020	2020	4.0	low	0	1	0
cobicistat	20	1,3-thiazoles; carbamate ester; monocarboxylic acid amide; morpholines; ureas	P450 inhibitor	2016	2023	5.2	low	3	15	5
bms-790052	1	biphenyls; carbamate ester; carboxamide; imidazoles; valine derivative	antiviral drug; nonstructural protein 5A inhibitor	2016	2016	8.0	low	1	1	0
quad pill	3			2016	2021	6.0	low	0	2	1
siponimod	1			2019	2019	5.0	low	0	1	0
grazoprevir	1	aromatic ether; azamacrocycle; carbamate ester; cyclopropanes; lactam; N-sulfonylcarboxamide; quinoxaline derivative	antiviral drug; hepatitis C protease inhibitor; hepatoprotective agent	2019	2019	5.0	low	1	1	0
abt-450	1			2016	2016	8.0	low	1	1	0
sofosbuvir	4	isopropyl ester; L-alanyl ester; nucleotide conjugate; organofluorine compound; phosphoramidate ester	antiviral drug; hepatitis C protease inhibitor; prodrug	2014	2023	6.5	low	1	3	1
warfarin	1	benzenes; hydroxycoumarin; methyl ketone		2017	2017	7.0	low	0	1	0
tipranavir	2	sulfonamide	antiviral drug; HIV protease inhibitor	2014	2020	7.0	low	1	2	0
gsk1265744	13	difluorobenzene; monocarboxylic acid amide; organic heterotricyclic compound; secondary carboxamide	HIV-1 integrase inhibitor	2013	2023	5.7	low	1	10	3
urmc-099	1			2017	2017	7.0	low	0	1	0
abt-267	1	aromatic amide; carbamate ester; dipeptide; pyrrolidines	antiviral drug; hepatitis C virus nonstructural protein 5A inhibitor	2016	2016	8.0	low	1	1	0
abt-333	1	aromatic ether; naphthalenes; pyrimidone; sulfonamide	antiviral drug; nonnucleoside hepatitis C virus polymerase inhibitor	2016	2016	8.0	low	1	1	0
doravirine	7			2017	2023	3.4	low	1	3	4
gs-5816	1	carbamate ester; ether; imidazoles; L-valine derivative; N-acylpyrrolidine; organic heteropentacyclic compound; ring assembly	antiviral drug; hepatitis C virus nonstructural protein 5A inhibitor	2023	2023	1.0	low	0	0	1
mk-8742	1	carbamate ester; imidazoles; L-valine derivative; N-acylpyrrolidine; organic heterotetracyclic compound; ring assembly	antiviral drug; hepatitis C virus nonstructural protein 5A inhibitor; hepatoprotective agent	2019	2019	5.0	low	1	1	0
bictegravir	37	monocarboxylic acid amide; organic heterotetracyclic compound; secondary carboxamide; trifluorobenzene	HIV-1 integrase inhibitor	2016	2023	4.0	high	8	23	14
vitamin b 12	1			2023	2023	1.0	low	1	0	1
norgestrel	1			2015	2015	9.0	low	1	1	0
albuvirtide	1			2023	2023	1.0	medium	0	0	1
levoleucovorin	1	5-formyltetrahydrofolic acid	antineoplastic agent; metabolite	2017	2017	7.0	low	0	1	0
folic acid	9	folic acids; N-acyl-amino acid	human metabolite; mouse metabolite; nutrient	2018	2023	3.9	low	2	6	3
rifampin	16	cyclic ketal; hydrazone; N-iminopiperazine; N-methylpiperazine; rifamycins; semisynthetic derivative; zwitterion	angiogenesis inhibitor; antiamoebic agent; antineoplastic agent; antitubercular agent; DNA synthesis inhibitor; EC 2.7.7.6 (RNA polymerase) inhibitor; Escherichia coli metabolite; geroprotector; leprostatic drug; neuroprotective agent; pregnane X receptor agonist; protein synthesis inhibitor	2013	2023	4.1	low	6	10	6
rifapentine	6	N-alkylpiperazine; N-iminopiperazine; rifamycins	antitubercular agent; leprostatic drug	2016	2023	4.0	low	2	4	2
pemetrexed	1	N-acyl-L-glutamic acid; pyrrolopyrimidine	antimetabolite; antineoplastic agent; EC 1.5.1.3 (dihydrofolate reductase) inhibitor; EC 2.1.1.45 (thymidylate synthase) inhibitor; EC 2.1.2.2 (phosphoribosylglycinamide formyltransferase) inhibitor	2016	2016	8.0	low	0	1	0
leptin	2			2019	2022	3.5	low	0	1	1
pyrimidinones	1			2016	2016	8.0	low	0	1	0

Condition	Indicated	Studies	First Year	Last Year	Average Age	Relationship Strength	Trials	2000's	2010's	post-2020
2019 Novel Coronavirus Disease	0	9	2020	2023	2.6	low	2	0	2	7
Abnormalities, Congenital	0	5	2018	2021	4.8	low	0	0	4	1
Abnormalities, Drug-Induced	0	3	2018	2020	5.0	low	0	0	3	0
Abortion, Spontaneous	0	2	2019	2021	4.0	low	0	0	1	1
Abortion, Tubal	0	2	2019	2021	4.0	low	0	0	1	1
Absence Seizure	0	2	2019	2020	4.5	low	0	0	2	0
Ache	0	1	2022	2022	2.0	low	0	0	0	1
Acquired Immune Deficiency Syndrome	0	12	2017	2023	3.2	low	1	0	6	6
Acquired Immunodeficiency Syndrome	1	12	2017	2023	3.2	low	1	0	6	6
Acquired-Immune Deficiency Syndrome Dementia Complex	0	2	2017	2020	5.5	low	0	0	2	0
Acrania	0	23	2018	2023	4.5	low	0	0	17	6
Acute Confusional Senile Dementia	0	1	2018	2018	6.0	low	0	0	1	0
Acute Disease	0	1	2019	2019	5.0	low	1	0	1	0
Acute Hepatic Failure	0	1	2018	2018	6.0	low	0	0	1	0
Acute Ischemic Stroke	0	1	2020	2020	4.0	low	0	0	1	0
Acute Liver Injury, Drug-Induced	0	3	2013	2019	7.3	low	0	0	3	0
Acute Necrotizing Pancreatitis	0	1	2015	2015	9.0	low	0	0	1	0
Addiction, Opioid	0	1	2013	2013	11.0	low	1	0	1	0
Adenocarcinoma	0	1	2019	2019	5.0	low	0	0	1	0
Adenocarcinoma, Basal Cell	0	1	2019	2019	5.0	low	0	0	1	0
Adverse Drug Event	0	27	2012	2023	4.9	low	5	0	19	8
Affective Disorders	0	2	2015	2020	6.5	low	0	0	2	0
African Sleeping Sickness	0	1	2017	2017	7.0	low	0	0	1	0
Age-Related Osteoporosis	0	1	2018	2018	6.0	low	1	0	1	0
Aging	0	4	2020	2021	3.8	low	0	0	3	1
AIDS Dementia Complex	0	2	2017	2020	5.5	low	0	0	2	0
AIDS Seroconversion	0	30	2016	2023	3.5	low	6	0	13	17
AIDS-Related Opportunistic Infections	0	6	2014	2020	5.8	low	0	0	6	0
AIDS, Simian	0	1	2016	2016	8.0	low	0	0	1	0
Allergic Cutaneous Angiitis	0	1	2019	2019	5.0	low	0	0	1	0
Allergy, Drug	0	3	2015	2017	8.0	low	0	0	3	0
ALS - Amyotrophic Lateral Sclerosis	0	1	2019	2019	5.0	low	0	0	1	0
Alzheimer Disease	0	1	2018	2018	6.0	low	0	0	1	0
Amnesia	0	1	2022	2022	2.0	low	0	0	0	1
Amnesia-Memory Loss	0	1	2022	2022	2.0	low	0	0	0	1
Amyotrophic Lateral Sclerosis	1	1	2019	2019	5.0	low	0	0	1	0
Anoxemia	0	1	2022	2022	2.0	low	0	0	0	1
Anxiety	0	3	2017	2019	6.3	low	0	0	3	0
Aortic Stenosis	0	1	2017	2017	7.0	low	0	0	1	0
Aortic Valve Stenosis	0	1	2017	2017	7.0	low	0	0	1	0
Apoplexy	0	1	2017	2017	7.0	low	0	0	1	0
Arthralgia	0	1	2020	2020	4.0	low	0	0	1	0
Asymptomatic Conditions	0	1	2020	2020	4.0	low	0	0	1	0
Atherogenesis	0	3	2022	2023	1.7	low	2	0	0	3
Atherosclerosis	0	3	2022	2023	1.7	low	2	0	0	3
Atypical Mycobacterial Infection, Disseminated	0	1	2019	2019	5.0	low	0	0	1	0
B Virus Infection	0	1	2019	2019	5.0	low	0	0	1	0
Bacteremia	0	2	2019	2020	4.5	low	0	0	2	0
Bacterial Eye Infections	0	1	2020	2020	4.0	low	0	0	1	0
Basal Ganglia Diseases	0	1	2019	2019	5.0	low	0	0	1	0
Behavior Disorders	0	8	2015	2020	6.1	low	0	0	8	0
Benign Neoplasms	0	1	2017	2017	7.0	low	0	0	1	0
Bilateral Headache	0	3	2010	2016	10.3	low	1	1	2	0
Bile Duct Obstruction	0	1	2018	2018	6.0	low	0	0	1	0
Body Weight	0	6	2020	2023	2.5	low	3	0	1	5
Bone Diseases, Metabolic	0	1	2021	2021	3.0	low	0	0	0	1
Cancer of Lung	0	2	2016	2017	7.5	low	0	0	2	0
Cancer of Prostate	0	2	2022	2023	1.5	low	0	0	0	2
Cancer of Skin	0	2	2020	2020	4.0	low	0	0	2	0
Cancer of Stomach	0	1	2019	2019	5.0	low	0	0	1	0
Carcinoma, Non-Small Cell Lung	0	2	2016	2017	7.5	low	0	0	2	0
Carcinoma, Non-Small-Cell Lung	0	2	2016	2017	7.5	low	0	0	2	0
Cardiometabolic Syndrome	0	1	2021	2021	3.0	low	1	0	0	1
Cardiovascular Diseases	0	9	2017	2023	3.7	low	6	0	5	4
Cardiovascular Stroke	0	1	2020	2020	4.0	low	0	0	1	0
Carditis	0	2	2016	2019	6.5	low	0	0	2	0
Central Nervous System Disease	0	1	2019	2019	5.0	low	0	0	1	0
Central Nervous System Diseases	0	1	2019	2019	5.0	low	0	0	1	0
Central Nervous System Infection	0	1	2019	2019	5.0	low	0	0	1	0
Central Nervous System Syphilis	0	1	2020	2020	4.0	low	0	0	1	0
Central Nervous System Toxoplasmosis	0	1	2017	2017	7.0	low	0	0	1	0
Cerebellar Diseases	0	1	2016	2016	8.0	low	0	0	1	0
Chemical and Drug Induced Liver Injury	0	3	2013	2019	7.3	low	0	0	3	0
Chemical Dependence	0	1	2021	2021	3.0	low	0	0	0	1
Child Development Deviations	0	1	2019	2019	5.0	low	0	0	1	0
Child Mental Disorders	0	1	2021	2021	3.0	low	0	0	0	1
Cholera Infantum	0	1	2015	2015	9.0	low	0	0	1	0
Cholestasis	0	1	2018	2018	6.0	low	0	0	1	0
Chronic Esophagitis, Eosinophilic	0	1	2020	2020	4.0	low	0	0	1	0
Chronic Hepatitis C	0	4	2016	2023	5.5	low	1	0	3	1
Chronic Insomnia	0	6	2015	2018	7.2	low	0	0	6	0
Chronic Kidney Diseases	0	3	2016	2022	5.7	low	0	0	2	1
Chronic Kidney Failure	0	5	2016	2019	6.2	low	1	0	5	0
Cirrhosis	0	1	2022	2022	2.0	low	0	0	0	1
Cirrhosis, Liver	0	1	2017	2017	7.0	low	0	0	1	0
Clerambault Syndrome	0	2	2016	2019	6.5	low	0	0	2	0
Co-infection	0	22	2012	2023	4.9	low	5	0	16	6
Cognition Disorders	0	1	2019	2019	5.0	low	0	0	1	0
Cognitive Decline	0	3	2020	2020	4.0	low	0	0	3	0
Cognitive Dysfunction	0	3	2020	2020	4.0	low	0	0	3	0
Colitis	0	2	2016	2020	6.0	low	0	0	2	0
Colitis, Lymphocytic	0	1	2019	2019	5.0	low	0	0	1	0
Colorectal Cancer	0	1	2021	2021	3.0	low	0	0	0	1
Colorectal Neoplasms	0	1	2021	2021	3.0	low	0	0	0	1
Complication, Postoperative	0	1	2020	2020	4.0	low	0	0	1	0
Complications, Infectious Pregnancy	0	28	2015	2023	5.2	low	3	0	24	4
Complications, Parasitic Pregnancy	0	1	2022	2022	2.0	low	1	0	0	1
Complications, Pregnancy	0	3	2019	2020	4.3	low	0	0	3	0
Congenital Familial Lymphedema	0	1	2020	2020	4.0	low	0	0	1	0
Congenital Zika Syndrome	0	1	2020	2020	4.0	low	0	0	1	0
Coronavirus Infections	0	2	2020	2020	4.0	low	0	0	2	0
Critical Illness	0	1	2022	2022	2.0	low	0	0	0	1
Cytomegaloviral Retinitis	0	1	2020	2020	4.0	low	0	0	1	0
Cytomegalovirus Retinitis	0	1	2020	2020	4.0	low	0	0	1	0
Deficiency, Folic Acid	0	2	2019	2023	3.0	low	0	0	1	1
Deglutition Disorders	0	1	2020	2020	4.0	low	0	0	1	0
Delayed Effects, Prenatal Exposure	0	5	2016	2019	5.6	low	0	0	5	0
Depression	0	5	2017	2021	5.0	low	0	0	4	1
Dermatitis, Contact, Photoallergic	0	1	2018	2018	6.0	low	0	0	1	0
Developmental Disabilities	0	1	2019	2019	5.0	low	0	0	1	0
Diabetes Mellitus	0	1	2022	2022	2.0	low	0	0	0	1
Diabetes Mellitus, Adult-Onset	0	4	2017	2023	4.0	low	0	0	2	2
Diabetes Mellitus, Gestational	0	1	2021	2021	3.0	low	0	0	0	1
Diabetes Mellitus, Type 2	0	4	2017	2023	4.0	low	0	0	2	2
Diabetes, Gestational	0	1	2021	2021	3.0	low	0	0	0	1
Diathesis	0	1	2021	2021	3.0	low	0	0	0	1
Disease Exacerbation	0	2	2017	2019	6.0	low	0	0	2	0
Disease Models, Animal	0	6	2017	2023	4.2	low	0	0	4	2
Dizziness	0	1	2017	2017	7.0	low	0	0	1	0
Dizzyness	0	1	2017	2017	7.0	low	0	0	1	0
DRESS Syndrome	0	1	2018	2018	6.0	low	0	0	1	0
Drug Abuse, Intravenous	0	1	2013	2013	11.0	low	1	0	1	0
Drug Hypersensitivity	0	3	2015	2017	8.0	low	0	0	3	0
Drug Withdrawal Symptoms	0	1	2013	2013	11.0	low	1	0	1	0
Drug-Related Side Effects and Adverse Reactions	0	27	2012	2023	4.9	low	5	0	19	8
Dysesthesia	0	1	2017	2017	7.0	low	0	0	1	0
Dysphagia	0	1	2020	2020	4.0	low	0	0	1	0
Electrocardiogram QT Prolonged	0	1	2012	2012	12.0	low	1	0	1	0
Encephalopathy, Toxic	0	1	2021	2021	3.0	low	0	0	0	1
Eosinophilia	0	1	2018	2018	6.0	low	0	0	1	0
Eosinophilia, Tropical	0	1	2018	2018	6.0	low	0	0	1	0
Eosinophilic Esophagitis	0	1	2020	2020	4.0	low	0	0	1	0
Erectile Dysfunction	0	1	2020	2020	4.0	low	0	0	1	0
Exanthem	0	1	2018	2018	6.0	low	0	0	1	0
Exanthema	0	1	2018	2018	6.0	low	0	0	1	0
Experimental Lung Inflammation	0	1	2019	2019	5.0	low	0	0	1	0
Extravascular Hemolysis	0	1	2016	2016	8.0	low	0	0	1	0
Fatty Liver	0	1	2023	2023	1.0	low	0	0	0	1
Fibrosis	0	1	2022	2022	2.0	low	0	0	0	1
Folic Acid Deficiency	0	2	2019	2023	3.0	low	0	0	1	1
Fungemia	0	1	2019	2019	5.0	low	0	0	1	0
Gastric Outlet Obstruction	0	1	2019	2019	5.0	low	0	0	1	0
Genetic Predisposition	0	1	2017	2017	7.0	low	0	0	1	0
Great Pox	0	2	2020	2020	4.0	low	0	0	2	0
Headache	0	3	2010	2016	10.3	low	1	1	2	0
Hemolysis	0	1	2016	2016	8.0	low	0	0	1	0
Hepatic Failure	0	1	2017	2017	7.0	low	0	0	1	0
Hepatitis B	0	1	2020	2020	4.0	low	0	0	1	0
Hepatitis B Virus Infection	0	1	2020	2020	4.0	low	0	0	1	0
Hepatitis C	0	6	2012	2023	6.2	low	2	0	5	1
Hepatitis C, Chronic	0	4	2016	2023	5.5	low	1	0	3	1
Hepatitis, Viral, Human	0	1	2015	2015	9.0	low	0	0	1	0
Hepatitis, Viral, Non-A, Non-B, Parenterally-Transmitted	0	6	2012	2023	6.2	low	2	0	5	1
Histoplasma capsulatum Infection	0	1	2019	2019	5.0	low	0	0	1	0
Histoplasmosis	0	1	2019	2019	5.0	low	0	0	1	0
HIV	0	41	2013	2023	5.0	low	7	0	28	13
HIV Coinfection	0	910	2011	2023	4.8	high	148	0	589	321
HIV Infections	1	910	2011	2023	4.8	high	148	0	589	321
HIV Lipodystrophy Syndrome	0	1	2018	2018	6.0	low	0	0	1	0
HIV-Associated Lipodystrophy Syndrome	0	1	2018	2018	6.0	low	0	0	1	0
Hyperglycemia	0	6	2018	2023	2.8	low	0	0	2	4
Hyperglycemia, Postprandial	0	6	2018	2023	2.8	low	0	0	2	4
Hyperlactatemia	0	2	2017	2018	6.5	low	0	0	2	0
Hyperthyroid	0	1	2017	2017	7.0	low	0	0	1	0
Hyperthyroidism	0	1	2017	2017	7.0	low	0	0	1	0
Hypertrophy	0	1	2022	2022	2.0	low	0	0	0	1
Hypocalcemia	0	1	2019	2019	5.0	low	0	0	1	0
Hypoxia	0	1	2022	2022	2.0	low	0	0	0	1
Immune Reconstitution Disease	0	4	2015	2021	5.8	low	0	0	3	1
Impotence	0	1	2020	2020	4.0	low	0	0	1	0
Infection, Mycobacterium avium-intracellulare	0	2	2020	2022	3.0	low	0	0	1	1
Infections, Coronavirus	0	2	2020	2020	4.0	low	0	0	2	0
Infections, Plasmodium	0	2	2022	2022	2.0	low	2	0	0	2
Inflammation	0	8	2018	2023	2.8	low	1	0	3	5
Innate Inflammatory Response	0	8	2018	2023	2.8	low	1	0	3	5
Insulin Resistance	0	9	2019	2023	2.7	low	2	0	3	6
Insulin Sensitivity	0	9	2019	2023	2.7	low	2	0	3	6
Ischemic Stroke	0	1	2020	2020	4.0	low	0	0	1	0
Joint Pain	0	1	2020	2020	4.0	low	0	0	1	0
Kaposi Sarcoma	0	3	2020	2020	4.0	low	0	0	3	0
Kidney Diseases	0	1	2017	2017	7.0	low	0	0	1	0
Kidney Failure	0	2	2014	2017	8.5	low	1	0	2	0
Kidney Failure, Chronic	0	5	2016	2019	6.2	low	1	0	5	0
Koch's Disease	0	20	2018	2023	3.3	low	5	0	11	9
Latent Tuberculosis	0	3	2018	2023	2.7	low	1	0	1	2
Leanness	0	2	2022	2023	1.5	low	1	0	0	2
Liver Cirrhosis	0	1	2017	2017	7.0	low	0	0	1	0
Liver Failure	0	1	2017	2017	7.0	low	0	0	1	0
Liver Failure, Acute	0	1	2018	2018	6.0	low	0	0	1	0
Liver Steatosis	0	1	2023	2023	1.0	low	0	0	0	1
Long QT Syndrome	0	1	2012	2012	12.0	low	1	0	1	0
Long Sleeper Syndrome	0	2	2018	2019	5.5	low	0	0	2	0
Low Bone Density	0	1	2021	2021	3.0	low	0	0	0	1
Lung Neoplasms	0	2	2016	2017	7.5	low	0	0	2	0
Lymphedema	0	1	2020	2020	4.0	low	0	0	1	0
Lymphocytic Colitis	0	1	2019	2019	5.0	low	0	0	1	0
Lymphoma, Primary Effusion	0	1	2019	2019	5.0	low	0	0	1	0
Malaria	1	2	2022	2022	2.0	low	2	0	0	2
Malaria, Falciparum	0	1	2021	2021	3.0	low	0	0	0	1
Menopause	0	1	2021	2021	3.0	low	0	0	0	1
Mental Disorders	0	8	2015	2020	6.1	low	0	0	8	0
Metabolic Syndrome	0	1	2021	2021	3.0	low	1	0	0	1
Mitral Incompetence	0	1	2017	2017	7.0	low	0	0	1	0
Mitral Valve Insufficiency	0	1	2017	2017	7.0	low	0	0	1	0
Mood Disorders	0	2	2015	2020	6.5	low	0	0	2	0
Morbid Obesity	0	1	2020	2020	4.0	low	0	0	1	0
Mycobacterium avium-intracellulare Infection	0	2	2020	2022	3.0	low	0	0	1	1
Myelopathy	0	1	2020	2020	4.0	low	0	0	1	0
Myocardial Infarction	0	1	2020	2020	4.0	low	0	0	1	0
Myocarditis	0	2	2016	2019	6.5	low	0	0	2	0
Nausea	0	1	2020	2020	4.0	low	0	0	1	0
Neoplasms	0	1	2017	2017	7.0	low	0	0	1	0
Nervous System Diseases	0	2	2018	2019	5.5	low	0	0	2	0
Nervous System Disorders	0	2	2018	2019	5.5	low	0	0	2	0
Neural Tube Defects	0	23	2018	2023	4.5	low	0	0	17	6
Neurodevelopmental Disorders	0	1	2021	2021	3.0	low	0	0	0	1
Obesity	0	2	2019	2021	4.0	low	1	0	1	1
Obesity, Morbid	0	1	2020	2020	4.0	low	0	0	1	0
Opioid-Related Disorders	0	1	2013	2013	11.0	low	1	0	1	0
Osteoporosis	0	1	2018	2018	6.0	low	1	0	1	0
P carinii Pneumonia	0	1	2016	2016	8.0	low	0	0	1	0
Pain	0	1	2022	2022	2.0	low	0	0	0	1
Plasmodium falciparum Malaria	0	1	2021	2021	3.0	low	0	0	0	1
Pneumonia	0	1	2019	2019	5.0	low	0	0	1	0
Pneumonia, Pneumocystis	0	1	2016	2016	8.0	low	0	0	1	0
Pneumonia, Viral	0	2	2020	2020	4.0	low	0	0	2	0
Postoperative Complications	0	1	2020	2020	4.0	low	0	0	1	0
Pregnancy	0	88	2015	2023	4.3	low	12	0	57	31
Premature Birth	0	2	2019	2022	3.5	low	0	0	1	1
Preterm Birth	0	2	2019	2022	3.5	low	0	0	1	1
Prostatic Neoplasms	0	2	2022	2023	1.5	low	0	0	0	2
Proteinuria	0	1	2017	2017	7.0	low	0	0	1	0
Psychoses, Drug	0	2	2017	2018	6.5	low	0	0	2	0
Recrudescence	0	1	2016	2016	8.0	low	0	0	1	0
Renal Insufficiency	0	2	2014	2017	8.5	low	1	0	2	0
Renal Insufficiency, Chronic	0	3	2016	2022	5.7	low	0	0	2	1
Respiration Disorders	0	1	2015	2015	9.0	low	0	0	1	0
Sarcoma, Kaposi	0	3	2020	2020	4.0	low	0	0	3	0
Seizures	0	2	2019	2020	4.5	low	0	0	2	0
Sensitivity and Specificity	0	2	2014	2018	8.0	low	0	0	2	0
Skin Neoplasms	0	2	2020	2020	4.0	low	0	0	2	0
Sleep Initiation and Maintenance Disorders	0	6	2015	2018	7.2	low	0	0	6	0
Sleep Wake Disorders	0	2	2018	2019	5.5	low	0	0	2	0
Spinal Cord Diseases	0	1	2020	2020	4.0	low	0	0	1	0
Stillbirth	0	2	2019	2021	4.0	low	0	0	1	1
Stomach Neoplasms	0	1	2019	2019	5.0	low	0	0	1	0
Stroke	0	1	2017	2017	7.0	low	0	0	1	0
Substance Withdrawal Syndrome	0	1	2013	2013	11.0	low	1	0	1	0
Substance-Related Disorders	0	1	2021	2021	3.0	low	0	0	0	1
Suicidal Ideation	0	2	2017	2020	5.5	low	0	0	2	0
Syphilis	0	2	2020	2020	4.0	low	0	0	2	0
Teratogenesis	0	1	2018	2018	6.0	low	0	0	1	0
Thrombocytopenia	0	1	2017	2017	7.0	low	0	0	1	0
Thrombopenia	0	1	2017	2017	7.0	low	0	0	1	0
Toxoplasmosis, Cerebral	0	1	2017	2017	7.0	low	0	0	1	0
Trypanosomiasis, African	0	1	2017	2017	7.0	low	0	0	1	0
Tuberculosis	0	20	2018	2023	3.3	low	5	0	11	9
Tuberculosis, Drug-Resistant	0	1	2021	2021	3.0	low	0	0	0	1
Tuberculosis, Multidrug-Resistant	0	1	2021	2021	3.0	low	0	0	0	1
Uveitis	0	1	2020	2020	4.0	low	0	0	1	0
Vaccine Preventable Diseases	0	2	2019	2019	5.0	low	0	0	2	0
Viral Hepatitis, Human	0	1	2015	2015	9.0	low	0	0	1	0
Viremia	0	13	2015	2023	3.5	low	3	0	5	8
Weight Gain	0	36	2012	2023	3.3	low	4	0	15	21
Zika Virus Infection	0	1	2020	2020	4.0	low	0	0	1	0

Dolutegravir and pregnancy outcomes in women on antiretroviral therapy in Brazil: a retrospective national cohort study.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Therapeutic candidates for the Zika virus identified by a high-throughput screen for Zika protease inhibitors.
Proceedings of the National Academy of Sciences of the United States of America, , 12-08, Volume: 117, Issue:49, 2020

Brief Report: Integrase Strand Transfer Inhibitors Are Associated With Lower Risk of Incident Cardiovascular Disease in People Living With HIV.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 84, Issue:4, 2020

Efficacy and Durability of Dolutegravir- or Darunavir-Based Regimens in ART-Naïve AIDS- or Late-Presenting HIV-Infected Patients.
Viruses, , 05-08, Volume: 15, Issue:5, 2023

The DoDo experience: an alternative antiretroviral 2-drug regimen of doravirine and dolutegravir.
Infection, , Volume: 51, Issue:6, 2023

Tolerability and effectiveness of albuvirtide combined with dolutegravir for hospitalized people living with HIV/AIDS.
Medicine, , Nov-10, Volume: 102, Issue:45, 2023

Efficacy and safety of dolutegravir/rilpivirine in real-world clinical practice. GeSIDA study 1119.
HIV medicine, , Volume: 24, Issue:8, 2023

Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children.
The Pediatric infectious disease journal, , 03-01, Volume: 41, Issue:3, 2022

Dolutegravir plus rilpivirine: benefits beyond viral suppression: DORIPEX retrospective study.
Medicine, , Jun-17, Volume: 101, Issue:24, 2022

Highlights of the 17th European AIDS Conference.
The lancet. HIV, , Volume: 7, Issue:1, 2020

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Highlights of AIDS 2020.
The lancet. HIV, , Volume: 7, Issue:8, 2020

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Extensive brain masses and cavitary lung lesions associated with toxoplasmosis and acquired immunodeficiency syndrome.
International journal of STD & AIDS, , Volume: 28, Issue:11, 2017

Autophagy facilitates macrophage depots of sustained-release nanoformulated antiretroviral drugs.
The Journal of clinical investigation, , Mar-01, Volume: 127, Issue:3, 2017

Virologic Response Following a Switch to Dolutegravir-based Regimen in People Living with HIV/AIDS at a Tertiary Care Center in Nepal.
Kathmandu University medical journal (KUMJ), , Volume: 20, Issue:80

High rates of transmitted NNRTI resistance among persons with acute HIV infection in Malawi: implications for first-line dolutegravir scale-up.
AIDS research and therapy, , 02-22, Volume: 16, Issue:1, 2019

Crushed dolutegravir/abacavir/lamivudine given via nasogastric tube in gastric outlet obstruction caused by cancer resulted in rapid viral load suppression.
International journal of STD & AIDS, , Volume: 30, Issue:1, 2019

Weight gain and aging in people with HIV.
AIDS (London, England), , 05-01, Volume: 35, Issue:6, 2021

Aging does not impact drug--drug interaction magnitudes with antiretrovirals.
AIDS (London, England), , 05-01, Volume: 34, Issue:6, 2020

Pharmacokinetic profiles of boosted darunavir, dolutegravir and lamivudine in aging people living with HIV.
AIDS (London, England), , 01-01, Volume: 34, Issue:1, 2020

Highlights of the 17th European AIDS Conference.
The lancet. HIV, , Volume: 7, Issue:1, 2020

Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Journal of medicinal chemistry, , Aug-09, Volume: 61, Issue:15, 2018

Development of novel phenoxyalkylpiperidines as high-affinity Sigma-1 (σ
European journal of medicinal chemistry, , Jan-15, Volume: 228, 2022

Safety and tolerability of Triumeq in amyotrophic lateral sclerosis: the Lighthouse trial.
Amyotrophic lateral sclerosis & frontotemporal degeneration, , Volume: 20, Issue:7-8, 2019

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

Health-related quality of life among HIV-infected patients initiating treatment in Brazil in the single-tablet regimen era.
AIDS care, , Volume: 31, Issue:5, 2019

Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1.
BMC infectious diseases, , 09-16, Volume: 17, Issue:1, 2017

Psychiatric Symptoms in Patients Receiving Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , Apr-01, Volume: 74, Issue:4, 2017

[Toxicity for warfarine switching from lopinavir/ritonavir to dolutegravir].
Farmacia hospitalaria : organo oficial de expresion cientifica de la Sociedad Espanola de Farmacia Hospitalaria, , 03-01, Volume: 41, Issue:2, 2017

Neuropsychiatric outcomes before and after switching to dolutegravir-based therapy in an acute HIV cohort.
AIDS research and therapy, , 01-07, Volume: 17, Issue:1, 2020

Lifetime antiretroviral exposure and neurocognitive impairment in HIV.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

Integrase strand transfer inhibitors and neuropsychiatric adverse events in a large prospective cohort.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

SLC22A2 variants and dolutegravir levels correlate with psychiatric symptoms in persons with HIV.
The Journal of antimicrobial chemotherapy, , 04-01, Volume: 74, Issue:4, 2019

Adverse events of raltegravir and dolutegravir.
AIDS (London, England), , 08-24, Volume: 31, Issue:13, 2017

Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients.
HIV medicine, , Volume: 18, Issue:1, 2017

Single-tablet antiretroviral treatment (once daily).
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , Sep-20, Volume: 188, Issue:13, 2016

Psychiatric disorders after starting dolutegravir: report of four cases.
AIDS (London, England), , Aug-24, Volume: 29, Issue:13, 2015

Unveiling the basis of antiretroviral therapy-induced osteopenia: the effects of Dolutegravir, Darunavir and Atazanavir on osteogenesis.
AIDS (London, England), , 02-02, Volume: 35, Issue:2, 2021

Nivolumab in HIV-related non-small-cell lung cancer.
Annals of oncology : official journal of the European Society for Medical Oncology, , 11-01, Volume: 28, Issue:11, 2017

Loss of Virologic Control and Severe Pneumocystis pneumonia in an HIV-Infected Patient Receiving Chemotherapy for Non-Small Cell Lung Cancer.
AIDS research and human retroviruses, , Volume: 32, Issue:1, 2016

Changes in weight, body composition and metabolic parameters after switch to dolutegravir/lamivudine compared with continued treatment with dolutegravir/abacavir/lamivudine for virologically suppressed HIV infection (The AVERTAS trial): a randomised, open
BMJ open, , 08-21, Volume: 13, Issue:8, 2023

Long-term effects on subclinical cardiovascular disease of switching from boosted protease inhibitors to dolutegravir.
The Journal of antimicrobial chemotherapy, , 09-05, Volume: 78, Issue:9, 2023

Limited Weight Impact After Switching From Boosted Protease Inhibitors to Dolutegravir in Persons With Human Immunodeficiency Virus With High Cardiovascular Risk: A Post Hoc Analysis of the 96-Week NEAT-022 Randomized Trial.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 03-04, Volume: 76, Issue:5, 2023

Switching from boosted PIs to dolutegravir decreases soluble CD14 and adiponectin in high cardiovascular risk people living with HIV.
The Journal of antimicrobial chemotherapy, , 08-12, Volume: 76, Issue:9, 2021

Switching from boosted PIs to dolutegravir in HIV-infected patients with high cardiovascular risk: 48 week effects on subclinical cardiovascular disease.
The Journal of antimicrobial chemotherapy, , 11-01, Volume: 75, Issue:11, 2020

Aging does not impact drug--drug interaction magnitudes with antiretrovirals.
AIDS (London, England), , 05-01, Volume: 34, Issue:6, 2020

Immediate Versus Deferred Switching From a Boosted Protease Inhibitor-based Regimen to a Dolutegravir-based Regimen in Virologically Suppressed Patients With High Cardiovascular Risk or Age ≥50 Years: Final 96-Week Results of the NEAT022 Study.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-01, Volume: 68, Issue:4, 2019

Switching from a ritonavir-boosted protease inhibitor to a dolutegravir-based regimen for maintenance of HIV viral suppression in patients with high cardiovascular risk.
AIDS (London, England), , 11-28, Volume: 31, Issue:18, 2017

Limiting cardiovascular events associated with HIV and antiretroviral therapy.
AIDS (London, England), , Nov-28, Volume: 31, Issue:18, 2017

Neuropsychiatric Adverse Events with Dolutegravir and Other Integrase Strand Transfer Inhibitors
AIDS reviews, , Volume: 21, Issue:1, 2019

Risks and benefits of dolutegravir-based antiretroviral drug regimens in sub-Saharan Africa: a modelling study.
The lancet. HIV, , Volume: 6, Issue:2, 2019

Severe cholestatic hepatitis related to abacavir/lamivudine/dolutegravir antiretroviral treatment in a HIV-1 infected subject.
AIDS (London, England), , 07-31, Volume: 32, Issue:12, 2018

Apoptotic colitis owing to dolutegravir.
Gastroenterologia y hepatologia, , Volume: 43, Issue:10, 2020

Dolutegravir-induced colitis in an HIV-infected patient.
The Journal of antimicrobial chemotherapy, , Volume: 71, Issue:1, 2016

Sustained virologic suppression with abacavir, emtricitabine, and crushed dolutegravir and tenofovir alafenamide in a patient with HIV and eosinophilic esophagitis.
International journal of STD & AIDS, , Volume: 31, Issue:3, 2020

Neurotoxicities in the treatment of HIV between dolutegravir, rilpivirine and dolutegravir/rilpivirine: a meta-analysis.
Sexually transmitted infections, , Volume: 97, Issue:4, 2021

Lifetime antiretroviral exposure and neurocognitive impairment in HIV.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

Health-related quality of life among HIV-infected patients initiating treatment in Brazil in the single-tablet regimen era.
AIDS care, , Volume: 31, Issue:5, 2019

Severe depression as a neuropsychiatric side effect induced by dolutegravir.
HIV medicine, , Volume: 19, Issue:4, 2018

Psychiatric Symptoms in Patients Receiving Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , Apr-01, Volume: 74, Issue:4, 2017

The risk of hyperglycemia associated with use of dolutegravir among adults living with HIV in Kampala, Uganda: A case-control study.
International journal of STD & AIDS, , Volume: 33, Issue:14, 2022

Blood glucose trajectories and incidence of diabetes mellitus in Ugandan people living with HIV initiated on dolutegravir.
AIDS research and therapy, , 03-13, Volume: 20, Issue:1, 2023

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

How Relevant is the Interaction Between Dolutegravir and Metformin in Real Life?
Journal of acquired immune deficiency syndromes (1999), , 05-01, Volume: 75, Issue:1, 2017

Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1.
BMC infectious diseases, , 09-16, Volume: 17, Issue:1, 2017

A severe hypersensitivity reaction to abacavir following re-challenge.
International journal of STD & AIDS, , Volume: 28, Issue:3, 2017

Single-tablet antiretroviral treatment (once daily).
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , Sep-20, Volume: 188, Issue:13, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Dolutegravir as a trigger for DRESS syndrome?
International journal of STD & AIDS, , Volume: 29, Issue:10, 2018

Decreased Hepatic Steatosis in South African Adolescents With Perinatal HIV Switching to Dolutegravir-containing Regimens.
The Pediatric infectious disease journal, , Jul-01, Volume: 42, Issue:7, 2023

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

Folate deficiency increases the incidence of dolutegravir-associated foetal defects in a mouse pregnancy model.
EBioMedicine, , Volume: 95, 2023

Clinical Extrapolation of the Effects of Dolutegravir and Other HIV Integrase Inhibitors on Folate Transport Pathways.
Drug metabolism and disposition: the biological fate of chemicals, , Volume: 47, Issue:8, 2019

Switch to Dolutegravir plus Rilpivirine Dual Therapy in cART-Experienced Subjects: An Observational Cohort.
PloS one, , Volume: 11, Issue:10, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers.
Antimicrobial agents and chemotherapy, , Volume: 54, Issue:1, 2010

Enhanced Eryptosis Following Exposure to Dolutegravir.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, , Volume: 39, Issue:2, 2016

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy.
Journal of viral hepatitis, , Volume: 30, Issue:9, 2023

Switch to dolutegravir is well tolerated in Thais with HIV infection.
Journal of the International AIDS Society, , Volume: 22, Issue:7, 2019

Assessment of drug interaction potential between the HCV direct-acting antiviral agents elbasvir/grazoprevir and the HIV integrase inhibitors raltegravir and dolutegravir.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Small increase in dolutegravir trough, but equivalent total dolutegravir exposure with simeprevir in HIV/HCV seronegative volunteers.
The Journal of antimicrobial chemotherapy, , Jan-01, Volume: 73, Issue:1, 2018

Clinical experience with dolutegravir/abacavir/lamivudine in HIV-HCV co-infected patients treated with a sofosbuvir-based regimen-safety and efficacy.
HIV clinical trials, , Volume: 17, Issue:6, 2016

The use of HIV-1 integrase inhibitors in antiretroviral naive patients.
Current opinion in HIV and AIDS, , Volume: 7, Issue:5, 2012

New drugs: simeprevir, sofosbuvir, and dolutegravir sodium.
Journal of the American Pharmacists Association : JAPhA, , Volume: 54, Issue:2

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

An evaluation of postmarketing reports of hyperglycaemia associated with dolutegravir for treatment of HIV in Eswatini.
AIDS research and therapy, , 11-24, Volume: 19, Issue:1, 2022

Dolutegravir-associated hyperglycaemia in patients with HIV.
The lancet. HIV, , Volume: 7, Issue:7, 2020

Dolutegravir-induced hyperglycaemia in a patient living with HIV.
The Journal of antimicrobial chemotherapy, , 01-01, Volume: 73, Issue:1, 2018

Early neuropsychological adverse events after switching from PI/r to dolutegravir could be related to hyperthyroidism in patients under levothyroxine.
Antiviral therapy, , Volume: 22, Issue:3, 2017

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

Tenofovir disoproxil fumarate/emtricitabine is associated with a higher risk of hypocalcemia compared to abacavir/lamivudine - results from a German cohort study.
International journal of STD & AIDS, , Volume: 30, Issue:5, 2019

Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study.
PloS one, , Volume: 15, Issue:12, 2020

Long-term effects on subclinical cardiovascular disease of switching from boosted protease inhibitors to dolutegravir.
The Journal of antimicrobial chemotherapy, , 09-05, Volume: 78, Issue:9, 2023

Inflammation and intracellular exposure of dolutegravir, darunavir, tenofovir and emtricitabine in people living with HIV.
British journal of clinical pharmacology, , Volume: 89, Issue:3, 2023

Differential effects of dolutegravir, bictegravir and raltegravir in adipokines and inflammation markers on human adipocytes.
Life sciences, , Nov-01, Volume: 308, 2022

Pro-Inflammatory Interactions of Dolutegravir with Human Neutrophils in an In Vitro Study.
Molecules (Basel, Switzerland), , Dec-19, Volume: 27, Issue:24, 2022

Brief Report: Evaluation of Inflammation and Atherogenesis Biomarkers Through 148 Weeks Postswitch to Dolutegravir and Rilpivirine in SWORD-1/SWORD-2.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

The impact of integrase inhibitor-based regimens on markers of inflammation among HIV naïve patients.
Cytokine, , Volume: 126, 2020

Immune activation, inflammation and HIV DNA after 96 weeks of ATV/r monotherapy: a MODAt substudy.
Antiviral therapy, , Volume: 23, Issue:7, 2018

Reply to Letter 'Morning dosing for dolutegravir-related insomnia and sleep disorders' by Capetti et al.
HIV medicine, , Volume: 19, Issue:5, 2018

Morning dosing for dolutegravir-related insomnia and sleep disorders.
HIV medicine, , Volume: 19, Issue:5, 2018

Psychiatric Symptoms in Patients Receiving Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , Apr-01, Volume: 74, Issue:4, 2017

Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1.
BMC infectious diseases, , 09-16, Volume: 17, Issue:1, 2017

Switch to Dolutegravir plus Rilpivirine Dual Therapy in cART-Experienced Subjects: An Observational Cohort.
PloS one, , Volume: 11, Issue:10, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Long-term effects on subclinical cardiovascular disease of switching from boosted protease inhibitors to dolutegravir.
The Journal of antimicrobial chemotherapy, , 09-05, Volume: 78, Issue:9, 2023

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

Dolutegravir use over 48 weeks is not associated with worsening insulin resistance and pancreatic beta cell function in a cohort of HIV-infected Ugandan adults.
AIDS research and therapy, , 09-09, Volume: 20, Issue:1, 2023

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

Brief Report: Improvement in Metabolic Health Parameters at Week 48 After Switching From a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen to the 2-Drug Regimen of Dolutegravir/Lamivudine: The TANGO Study.
Journal of acquired immune deficiency syndromes (1999), , 06-01, Volume: 87, Issue:2, 2021

Bone mineral density, kidney function, weight gain and insulin resistance in women who switch from TDF/FTC/NNRTI to ABC/3TC/DTG.
HIV medicine, , Volume: 22, Issue:2, 2021

The Integrase Inhibitors Dolutegravir and Raltegravir Exert Proadipogenic and Profibrotic Effects and Induce Insulin Resistance in Human/Simian Adipose Tissue and Human Adipocytes.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 12-17, Volume: 71, Issue:10, 2020

HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells.
PloS one, , Volume: 15, Issue:1, 2020

Improvement in insulin sensitivity and serum leptin concentration after the switch from a ritonavir-boosted PI to raltegravir or dolutegravir in non-diabetic HIV-infected patients.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Lamivudine-based two-drug regimens with dolutegravir or protease inhibitor: Virological suppression in spite of previous therapy failure or renal dysfunction.
The Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases, , Volume: 27, Issue:3

Safety and efficacy of dolutegravir in hemodialysis.
International journal of STD & AIDS, , Volume: 30, Issue:6, 2019

Abacavir/lamivudine/dolutegravir single tablet regimen in patients with human immunodeficiency virus and end-stage renal disease on hemodialysis.
International journal of STD & AIDS, , Volume: 30, Issue:2, 2019

Drug interaction after ritonavir discontinuation: considerations for antiretroviral therapy changes in renal transplant recipients.
International journal of STD & AIDS, , Volume: 30, Issue:7, 2019

Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease.
Antimicrobial agents and chemotherapy, , Volume: 60, Issue:4, 2016

Serum creatinine elevation after switch to dolutegravir in a human immunodeficiency virus-positive kidney transplant recipient.
Transplant infectious disease : an official journal of the Transplantation Society, , Volume: 18, Issue:4, 2016

Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 72, Issue:3, 2017

Effect of a single supratherapeutic dose of dolutegravir on cardiac repolarization.
Pharmacotherapy, , Volume: 32, Issue:4, 2012

Nivolumab in HIV-related non-small-cell lung cancer.
Annals of oncology : official journal of the European Society for Medical Oncology, , 11-01, Volume: 28, Issue:11, 2017

Loss of Virologic Control and Severe Pneumocystis pneumonia in an HIV-Infected Patient Receiving Chemotherapy for Non-Small Cell Lung Cancer.
AIDS research and human retroviruses, , Volume: 32, Issue:1, 2016

Kaposi's Sarcoma Occurring in HIV Infection Controlled on HAART.
The American journal of medicine, , Volume: 133, Issue:6, 2020

Impact of Dolutegravir-Based Antiretroviral Therapy on Piperaquine Exposure following Dihydroartemisinin-Piperaquine Intermittent Preventive Treatment of Malaria in Pregnant Women Living with HIV.
Antimicrobial agents and chemotherapy, , 12-20, Volume: 66, Issue:12, 2022

Effect of dihydroartemisinin/piperaquine for malaria intermittent preventive treatment on dolutegravir exposure in pregnant women living with HIV.
The Journal of antimicrobial chemotherapy, , 05-29, Volume: 77, Issue:6, 2022

Effect of menopause on weight gain, insulin and waist circumference in women with HIV who switch antiretroviral therapy to abacavir/lamivudine/dolutegravir.
AIDS (London, England), , 02-02, Volume: 35, Issue:2, 2021

[Toxicity for warfarine switching from lopinavir/ritonavir to dolutegravir].
Farmacia hospitalaria : organo oficial de expresion cientifica de la Sociedad Espanola de Farmacia Hospitalaria, , 03-01, Volume: 41, Issue:2, 2017

Brief Report: Integrase Strand Transfer Inhibitors Are Associated With Lower Risk of Incident Cardiovascular Disease in People Living With HIV.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 84, Issue:4, 2020

Acute myocarditis after switch to dolutegravir: a reminder of potential toxicity of integrase inhibitor-including HAART.
AIDS (London, England), , 11-01, Volume: 33, Issue:13, 2019

Two case reports of severe myocarditis associated with the initiation of dolutegravir treatment in HIV patients.
Medicine, , Volume: 95, Issue:47, 2016

Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects.
Drug and alcohol dependence, , Dec-01, Volume: 133, Issue:2, 2013

Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study.
PloS one, , Volume: 15, Issue:12, 2020

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Integrase strand transfer inhibitors and neuropsychiatric adverse events in a large prospective cohort.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring.
Current drug safety, , Volume: 13, Issue:1, 2018

Folate deficiency increases the incidence of dolutegravir-associated foetal defects in a mouse pregnancy model.
EBioMedicine, , Volume: 95, 2023

No developmental toxicity observed with dolutegravir in rat whole embryo culture.
Birth defects research, , 10-01, Volume: 113, Issue:16, 2021

Dolutegravir Inhibition of Matrix Metalloproteinases Affects Mouse Neurodevelopment.
Molecular neurobiology, , Volume: 58, Issue:11, 2021

Lessons from dolutegravir and neural tube defects.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Dolutegravir and pregnancy outcomes in women on antiretroviral therapy in Brazil: a retrospective national cohort study.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels.
EBioMedicine, , Volume: 63, 2021

Dolutegravir for pregnant women living with HIV.
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , 03-02, Volume: 192, Issue:9, 2020

Dolutegravir and neural tube defects: a new insight.
The Lancet. Infectious diseases, , Volume: 20, Issue:4, 2020

Periconception dolutegravir use in women living with HIV and missed opportunities in maternal and child health.
The Lancet. Child & adolescent health, , Volume: 3, Issue:10, 2019

Risks and Benefits of Dolutegravir- and Efavirenz-Based Strategies for South African Women With HIV of Child-Bearing Potential: A Modeling Study.
Annals of internal medicine, , 05-07, Volume: 170, Issue:9, 2019

Dolutegravir becomes first choice for HIV.
The Lancet. Infectious diseases, , Volume: 19, Issue:9, 2019

Clinical Extrapolation of the Effects of Dolutegravir and Other HIV Integrase Inhibitors on Folate Transport Pathways.
Drug metabolism and disposition: the biological fate of chemicals, , Volume: 47, Issue:8, 2019

HIV Drug May Increase Risk of Neural Tube Birth Defects.
The American journal of nursing, , Volume: 119, Issue:1, 2019

Health Care Autonomy of Women Living with HIV.
The New England journal of medicine, , Aug-29, Volume: 381, Issue:9, 2019

Is There a Safety Signal for Dolutegravir and Integrase Inhibitors During Pregnancy?
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

What will it take to refute the possible safety signal for dolutegravir and neural tube defects?
BJOG : an international journal of obstetrics and gynaecology, , Volume: 126, Issue:11, 2019

Neural-Tube Defects and Antiretroviral Treatment Regimens in Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Dolutegravir Use at Conception - Additional Surveillance Data from Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Optimizing responses to drug safety signals in pregnancy: the example of dolutegravir and neural tube defects.
Journal of the International AIDS Society, , Volume: 22, Issue:7, 2019

Neural-Tube Defects with Dolutegravir Treatment from the Time of Conception.
The New England journal of medicine, , 09-06, Volume: 379, Issue:10, 2018

Protecting Mothers and Babies - A Delicate Balancing Act.
The New England journal of medicine, , Sep-06, Volume: 379, Issue:10, 2018

Changes to dolutegravir policy in several African countries.
Lancet (London, England), , 07-21, Volume: 392, Issue:10143, 2018

Assessing the risk of dolutegravir for women of childbearing potential.
The Lancet. Global health, , Volume: 6, Issue:9, 2018

Two cases of neural tube defects with dolutegravir use at conception in south Brazil.
The Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases, , Volume: 25, Issue:2

The predicted risk of adverse pregnancy outcomes as a result of treatment-associated obesity in a hypothetical population receiving tenofovir alafenamide/emtricitabine/dolutegravir, tenofovir disoproxil fumarate/emtricitabine/dolutegravir or tenofovir dis
AIDS (London, England), , 12-15, Volume: 35, Issue:Suppl 2, 2021

Dolutegravir-Based or Low-Dose Efavirenz-Based Regimen for the Treatment of HIV-1.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Case Report of Increased Exposure to Antiretrovirals following Sleeve Gastrectomy.
Antimicrobial agents and chemotherapy, , 03-24, Volume: 64, Issue:4, 2020

Switch from tenofovir disoproxil fumarate combination to dolutegravir with rilpivirine improves parameters of bone health.
AIDS (London, England), , 02-20, Volume: 32, Issue:4, 2018

Dual Sigma-1 receptor antagonists and hydrogen sulfide-releasing compounds for pain treatment: Design, synthesis, and pharmacological evaluation.
European journal of medicinal chemistry, , Feb-15, Volume: 230, 2022

Lamivudine-Associated Pancreatitis: Strongest Evidence to Date.
American journal of therapeutics, , Volume: 24, Issue:5

Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study.
Antiviral research, , Volume: 169, 2019

Loss of Virologic Control and Severe Pneumocystis pneumonia in an HIV-Infected Patient Receiving Chemotherapy for Non-Small Cell Lung Cancer.
AIDS research and human retroviruses, , Volume: 32, Issue:1, 2016

Highlights of AIDS 2020.
The lancet. HIV, , Volume: 7, Issue:8, 2020

Cases of coronavirus disease-2019 in HIV-infected transgender women.
AIDS (London, England), , 07-15, Volume: 34, Issue:9, 2020

Pharmacokinetic profile of dolutegravir after transjugular intrahepatic portosystemic shunt placement.
The Journal of antimicrobial chemotherapy, , 05-01, Volume: 75, Issue:5, 2020

Discovery of dolutegravir-1,2,3-triazole derivatives against prostate cancer via inducing DNA damage.
Bioorganic chemistry, , Volume: 141, 2023

Effects of the androgen receptor inhibitor enzalutamide on the pharmacokinetics of dolutegravir and tenofovir: a case report.
AIDS (London, England), , 09-01, Volume: 36, Issue:11, 2022

Renal effects of novel antiretroviral drugs.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, , 03-01, Volume: 32, Issue:3, 2017

Kaposi's sarcoma in a HIV-positive patient: an exuberant and widespread case report in the Amazon.
Revista do Instituto de Medicina Tropical de Sao Paulo, , Volume: 62, 2020

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Kaposi's Sarcoma Occurring in HIV Infection Controlled on HAART.
The American journal of medicine, , Volume: 133, Issue:6, 2020

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Drug interactions are not always predictable: the curious case of valproic acid and dolutegravir and a possible explanation.
AIDS (London, England), , 08-01, Volume: 33, Issue:10, 2019

High-performance liquid chromatography-tandem mass spectrometry for simultaneous determination of raltegravir, dolutegravir and elvitegravir concentrations in human plasma and cerebrospinal fluid samples.
Biomedical chromatography : BMC, , Volume: 32, Issue:2, 2018

A liquid chromatography-tandem mass spectrometry assay for quantification of rilpivirine and dolutegravir in human plasma.
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, , Nov-15, Volume: 971, 2014

Kaposi's Sarcoma Occurring in HIV Infection Controlled on HAART.
The American journal of medicine, , Volume: 133, Issue:6, 2020

Kaposi's sarcoma in a HIV-positive patient: an exuberant and widespread case report in the Amazon.
Revista do Instituto de Medicina Tropical de Sao Paulo, , Volume: 62, 2020

Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-01, Volume: 68, Issue:1, 2019

Reply to Letter 'Morning dosing for dolutegravir-related insomnia and sleep disorders' by Capetti et al.
HIV medicine, , Volume: 19, Issue:5, 2018

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Crushed dolutegravir/abacavir/lamivudine given via nasogastric tube in gastric outlet obstruction caused by cancer resulted in rapid viral load suppression.
International journal of STD & AIDS, , Volume: 30, Issue:1, 2019

Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects.
Drug and alcohol dependence, , Dec-01, Volume: 133, Issue:2, 2013

Recurrent ocular syphilis in a patient living with HIV.
International journal of STD & AIDS, , Volume: 31, Issue:11, 2020

Multidrug-resistant HIV viral rebound during early syphilis: a case report.
BMC infectious diseases, , Apr-07, Volume: 20, Issue:1, 2020

Severe Thrombocytopenia During Dolutegravir-containing Antiretroviral Therapy.
Internal medicine (Tokyo, Japan), , Aug-15, Volume: 56, Issue:16, 2017

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Dolutegravir once daily with rifampicin for HIV and tuberculosis.
The lancet. HIV, , Volume: 10, Issue:7, 2023

Decreased Dolutegravir and Efavirenz Concentrations With Preserved Virological Suppression in Patients With Tuberculosis and Human Immunodeficiency Virus Receiving High-Dose Rifampicin.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-08, Volume: 76, Issue:3, 2023

Standard-dose versus double-dose dolutegravir in HIV-associated tuberculosis in South Africa (RADIANT-TB): a phase 2, non-comparative, randomised controlled trial.
The lancet. HIV, , Volume: 10, Issue:7, 2023

Dolutegravir for children with HIV-associated tuberculosis.
The lancet. HIV, , Volume: 9, Issue:9, 2022

Weight Gain Among Treatment-Naïve Persons With HIV Receiving Dolutegravir in Kenya.
Journal of acquired immune deficiency syndromes (1999), , 12-15, Volume: 91, Issue:5, 2022

Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex.
International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 116, 2022

Brief Report: Efficacy and Safety of Efavirenz, Raltegravir, and Dolutegravir in HIV-1/TB Coinfection. A Multicenter Retrospective Cohort Study in France.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

Real-world use and outcomes of dolutegravir-containing antiretroviral therapy in HIV and tuberculosis co-infection: a site survey and cohort study in sub-Saharan Africa.
Journal of the International AIDS Society, , Volume: 25, Issue:7, 2022

Immune reconstitution inflammatory syndrome: a report of TB-IRIS after switching from efavirenz to dolutegravir.
Tropical doctor, , Volume: 51, Issue:2, 2021

Managing Human Immunodeficiency Virus-associated Tuberculosis in the Dolutegravir Era.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-03, Volume: 70, Issue:4, 2020

Pharmacokinetics, SAfety/tolerability, and EFficacy of high-dose RIFampicin in tuberculosis-HIV co-infected patients on efavirenz- or dolutegravir-based antiretroviral therapy: study protocol for an open-label, phase II clinical trial (SAEFRIF).
Trials, , Feb-13, Volume: 21, Issue:1, 2020

Twice-Daily vs. Once-Daily Dolutegravir in Patients With Human Immunodeficiency Virus-Tuberculosis Coinfection Receiving Rifampicin-Based Tuberculosis Therapy.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 06-24, Volume: 71, Issue:1, 2020

Dosing of Dolutegravir in TB/HIV Coinfected Patients on Rifampicin: Twice Is (Always) Better Than Once.
Journal of acquired immune deficiency syndromes (1999), , 07-01, Volume: 84, Issue:3, 2020

Dolutegravir-based Antiretroviral Therapy for Patients Coinfected With Tuberculosis and Human Immunodeficiency Virus: A Multicenter, Noncomparative, Open-label, Randomized Trial.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-03, Volume: 70, Issue:4, 2020

Once-weekly rifapentine and isoniazid for tuberculosis prevention in patients with HIV taking dolutegravir-based antiretroviral therapy: a phase 1/2 trial.
The lancet. HIV, , Volume: 7, Issue:6, 2020

Prevention of tuberculosis in HIV infection with novel drugs.
The lancet. HIV, , Volume: 7, Issue:6, 2020

Clinical and Virological Outcomes of TB/HIV Coinfected Patients Treated With Dolutegravir-Based HIV Antiretroviral Regimens: Programmatic Experience From Botswana.
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 82, Issue:2, 2019

Failure of Dolutegravir First-Line ART with Selection of Virus Carrying R263K and G118R.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Dolutegravir for first-line antiretroviral therapy in low-income and middle-income countries: uncertainties and opportunities for implementation and research.
The lancet. HIV, , Volume: 5, Issue:7, 2018

Dolutegravir use in combination with rifampicin-based tuberculosis therapy: 3 years of real-world experience in a large UK teaching hospital.
Sexually transmitted infections, , Volume: 94, Issue:6, 2018

Effect of Rifabutin in Dolutegravir Dosing: A Case Series.
Journal of the International Association of Providers of AIDS Care, , Volume: 21

Recurrent ocular syphilis in a patient living with HIV.
International journal of STD & AIDS, , Volume: 31, Issue:11, 2020

[no title available]
Pharmacogenomics, , Volume: 22, Issue:15, 2021

Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex.
International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 116, 2022

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Interactions between integrase inhibitors and human arginase 1.
Journal of neurochemistry, , Volume: 142, Issue:1, 2017

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Gestational diabetes in women living with HIV in Botswana: lower rates with dolutegravir- than with efavirenz-based antiretroviral therapy.
HIV medicine, , Volume: 22, Issue:8, 2021

Dolutegravir pharmacokinetics during co-administration with either artemether/lumefantrine or artesunate/amodiaquine.
The Journal of antimicrobial chemotherapy, , 04-13, Volume: 76, Issue:5, 2021

Extensive brain masses and cavitary lung lesions associated with toxoplasmosis and acquired immunodeficiency syndrome.
International journal of STD & AIDS, , Volume: 28, Issue:11, 2017

Comparative Clinical Pharmacokinetics and Pharmacodynamics of HIV-1 Integrase Strand Transfer Inhibitors.
Clinical pharmacokinetics, , Volume: 56, Issue:1, 2017

Dolutegravir-induced liver injury leading to sub-acute liver failure requiring transplantation: a case report and review of literature.
International journal of STD & AIDS, , Volume: 29, Issue:4, 2018

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Expanding the use of dolutegravir-based antiretroviral therapy in multidrug-resistant TB.
The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease, , 09-01, Volume: 25, Issue:9, 2021

Cases of coronavirus disease-2019 in HIV-infected transgender women.
AIDS (London, England), , 07-15, Volume: 34, Issue:9, 2020

Highlights of AIDS 2020.
The lancet. HIV, , Volume: 7, Issue:8, 2020

Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients.
HIV clinical trials, , Volume: 15, Issue:5

Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study.
PloS one, , Volume: 15, Issue:12, 2020

Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy.
Journal of viral hepatitis, , Volume: 30, Issue:9, 2023

Long-term efficacy of dolutegravir in treatment-experienced subjects failing therapy with HIV-1 integrase strand inhibitor-resistant virus.
The Journal of antimicrobial chemotherapy, , Jan-01, Volume: 73, Issue:1, 2018

Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 72, Issue:3, 2017

Drug-Drug Interaction between the Direct-Acting Antiviral Regimen of Ombitasvir-Paritaprevir-Ritonavir plus Dasabuvir and the HIV Antiretroviral Agent Dolutegravir or Abacavir plus Lamivudine.
Antimicrobial agents and chemotherapy, , Volume: 60, Issue:10, 2016

Neuropsychiatric outcomes before and after switching to dolutegravir-based therapy in an acute HIV cohort.
AIDS research and therapy, , 01-07, Volume: 17, Issue:1, 2020

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Substance use, Unlike Dolutegravir, is Associated with Mood Symptoms in People Living with HIV.
AIDS and behavior, , Volume: 25, Issue:12, 2021

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Brief Report: Improvement in Metabolic Health Parameters at Week 48 After Switching From a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen to the 2-Drug Regimen of Dolutegravir/Lamivudine: The TANGO Study.
Journal of acquired immune deficiency syndromes (1999), , 06-01, Volume: 87, Issue:2, 2021

Improvement of lipid profile after switching from efavirenz or ritonavir-boosted protease inhibitors to rilpivirine or once-daily integrase inhibitors: results from a large observational cohort study (SCOLTA).
BMC infectious diseases, , 07-31, Volume: 18, Issue:1, 2018

Lymphocytic colitis in an HIV positive patient: is dolutegravir the cause?
AIDS (London, England), , 06-01, Volume: 33, Issue:7, 2019

Dolutegravir in Pregnancy as Compared with Current HIV Regimens in the United States.
The New England journal of medicine, , 09-01, Volume: 387, Issue:9, 2022

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

[Interventional study on Dolutegravir and other antiretrovirals in patients with subclinical atherosclerosis in the Kinshasa Hospital].
The Pan African medical journal, , Volume: 45, 2023

Brief Report: Evaluation of Inflammation and Atherogenesis Biomarkers Through 148 Weeks Postswitch to Dolutegravir and Rilpivirine in SWORD-1/SWORD-2.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

Atherogenicity of low-density lipoproteins after switching from a protease inhibitor to dolutegravir: a substudy of the NEAT022 study.
The Journal of antimicrobial chemotherapy, , 06-29, Volume: 77, Issue:7, 2022

Performance of Creatinine- and Cystatin C-Based Equations for Glomerular Filtration Rate Estimation in HIV-1-Infected Individuals Receiving Dolutegravir + Tenofovir Disoproxil Fumarate + Lamivudine as Initial Antiretroviral Therapy: A Retrospective Observ
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1, 2022

Renal effects of novel antiretroviral drugs.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, , 03-01, Volume: 32, Issue:3, 2017

Dolutegravir is not removed during hemodialysis.
AIDS (London, England), , 06-01, Volume: 30, Issue:9, 2016

Comparative Clinical Pharmacokinetics and Pharmacodynamics of HIV-1 Integrase Strand Transfer Inhibitors.
Clinical pharmacokinetics, , Volume: 56, Issue:1, 2017

Pharmacokinetics of dolutegravir in HIV-seronegative subjects with severe renal impairment.
European journal of clinical pharmacology, , Volume: 70, Issue:1, 2014

Probable hepatotoxicity with dolutegravir: report of two cases and review of the literature.
AIDS (London, England), , 06-01, Volume: 33, Issue:7, 2019

Severe cholestatic hepatitis related to abacavir/lamivudine/dolutegravir antiretroviral treatment in a HIV-1 infected subject.
AIDS (London, England), , 07-31, Volume: 32, Issue:12, 2018

Hepatoxicity of new antiretrovirals: a systematic review.
Clinics and research in hepatology and gastroenterology, , Volume: 37, Issue:2, 2013

Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients.
HIV clinical trials, , Volume: 15, Issue:5

Sustained virologic suppression with abacavir, emtricitabine, and crushed dolutegravir and tenofovir alafenamide in a patient with HIV and eosinophilic esophagitis.
International journal of STD & AIDS, , Volume: 31, Issue:3, 2020

Lifetime antiretroviral exposure and neurocognitive impairment in HIV.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

Psychiatric Symptoms in Patients Receiving Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , Apr-01, Volume: 74, Issue:4, 2017

Changes in functional connectivity in people with HIV switching antiretroviral therapy.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

Lifetime antiretroviral exposure and neurocognitive impairment in HIV.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Neuropsychiatric adverse drug reactions and associated factors in a cohort of individuals starting dolutegravir-based or efavirenz-based antiretroviral therapy in Belo Horizonte, Brazil.
Current medical research and opinion, , Volume: 39, Issue:4, 2023

Active Pharmacovigilance Project on the safety profile of Dolutegravir in Brazil.
AIDS care, , Volume: 35, Issue:5, 2023

High acceptability and viral suppression rate for first-Line patients on a dolutegravir-based regimen: An early adopter study in Nigeria.
PloS one, , Volume: 18, Issue:5, 2023

Knowledge and perceptions about Dolutegravir and Dolutegravir counselling: a qualitative study among women living with HIV.
BMC women's health, , 09-09, Volume: 23, Issue:1, 2023

Tenofovir alafenamide plus dolutegravir as a switch strategy in HIV-infected patients: a pilot randomized controlled trial.
Daru : journal of Faculty of Pharmacy, Tehran University of Medical Sciences, , Volume: 31, Issue:2, 2023

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

Efficacy and Safety of Two-Drug Regimens with Dolutegravir plus Rilpivirine or Lamivudine in HIV-1 Virologically Suppressed People Living with HIV.
Viruses, , 04-10, Volume: 15, Issue:4, 2023

Prevalence and factors associated with adverse drug events among patients on dolutegravir-based regimen at the Immune Suppression Syndrome Clinic of Mbarara Regional Referral Hospital, Uganda: a mixed design study.
AIDS research and therapy, , 04-02, Volume: 19, Issue:1, 2022

Pharmacokinetics of dolutegravir with and without darunavir/cobicistat in healthy volunteers.
The Journal of antimicrobial chemotherapy, , 01-01, Volume: 74, Issue:1, 2019

Real-world evaluation of the safety and tolerability of abacavir/dolutegravir/lamivudine in an incarcerated population.
International journal of STD & AIDS, , Volume: 30, Issue:12, 2019

Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study.
Antiviral research, , Volume: 169, 2019

Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-01, Volume: 68, Issue:1, 2019

Immediate Versus Deferred Switching From a Boosted Protease Inhibitor-based Regimen to a Dolutegravir-based Regimen in Virologically Suppressed Patients With High Cardiovascular Risk or Age ≥50 Years: Final 96-Week Results of the NEAT022 Study.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-01, Volume: 68, Issue:4, 2019

Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring.
Current drug safety, , Volume: 13, Issue:1, 2018

Adverse reactions associated with first-line regimens in patient initiating antiretroviral therapy.
European journal of clinical pharmacology, , Volume: 74, Issue:8, 2018

The transition to dolutegravir and other new antiretrovirals in low-income and middle-income countries: what are the issues?
AIDS (London, England), , 07-31, Volume: 32, Issue:12, 2018

New Dual Combination of Dolutegravir-Rilpivirine for Switching to Maintenance Antiretroviral Therapy.
AIDS reviews, , Volume: 20, Issue:4, 2018

Photoallergic dermatitis associated with fixed-dose combination of antiretroviral agent (abacavir-lamivudine-dolutegravir).
AIDS (London, England), , 06-19, Volume: 32, Issue:10, 2018

The effect of antiretroviral intensification with dolutegravir on residual virus replication in HIV-infected individuals: a randomised, placebo-controlled, double-blind trial.
The lancet. HIV, , Volume: 5, Issue:5, 2018

Adverse drug reactions to integrase strand transfer inhibitors.
AIDS (London, England), , 04-24, Volume: 32, Issue:7, 2018

Switching to fixed-dose bictegravir, emtricitabine, and tenofovir alafenamide from dolutegravir plus abacavir and lamivudine in virologically suppressed adults with HIV-1: 48 week results of a randomised, double-blind, multicentre, active-controlled, phas
The lancet. HIV, , Volume: 5, Issue:7, 2018

Adverse events of raltegravir and dolutegravir.
AIDS (London, England), , 08-24, Volume: 31, Issue:13, 2017

Prevalence of drug-drug interactions in the era of HIV integrase inhibitors: a retrospective clinical study.
The Netherlands journal of medicine, , Volume: 75, Issue:6, 2017

Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients.
HIV medicine, , Volume: 18, Issue:1, 2017

Evaluation of the concurrent use of dolutegravir and metformin in human immunodeficiency virus-infected patients.
International journal of STD & AIDS, , Volume: 28, Issue:12, 2017

Dolutegravir: a next-generation integrase inhibitor for treatment of HIV infection.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , Jul-15, Volume: 59, Issue:2, 2014

Tolerability of HIV integrase inhibitors.
Current opinion in HIV and AIDS, , Volume: 7, Issue:5, 2012

Dolutegravir Inhibition of Matrix Metalloproteinases Affects Mouse Neurodevelopment.
Molecular neurobiology, , Volume: 58, Issue:11, 2021

Crushed dolutegravir/abacavir/lamivudine given via nasogastric tube in gastric outlet obstruction caused by cancer resulted in rapid viral load suppression.
International journal of STD & AIDS, , Volume: 30, Issue:1, 2019

Photoallergic dermatitis associated with fixed-dose combination of antiretroviral agent (abacavir-lamivudine-dolutegravir).
AIDS (London, England), , 06-19, Volume: 32, Issue:10, 2018

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Expanding the use of dolutegravir-based antiretroviral therapy in multidrug-resistant TB.
The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease, , 09-01, Volume: 25, Issue:9, 2021

Cases of coronavirus disease-2019 in HIV-infected transgender women.
AIDS (London, England), , 07-15, Volume: 34, Issue:9, 2020

Highlights of AIDS 2020.
The lancet. HIV, , Volume: 7, Issue:8, 2020

A case of dolutegravir-induced cutaneous small vessel vasculitis.
AIDS (London, England), , 09-01, Volume: 33, Issue:11, 2019

Safety and tolerability of Triumeq in amyotrophic lateral sclerosis: the Lighthouse trial.
Amyotrophic lateral sclerosis & frontotemporal degeneration, , Volume: 20, Issue:7-8, 2019

Renal effects of novel antiretroviral drugs.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, , 03-01, Volume: 32, Issue:3, 2017

Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients.
HIV clinical trials, , Volume: 15, Issue:5

Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study.
PloS one, , Volume: 15, Issue:12, 2020

Acute pancreatitis associated with dolutegravir and lamivudine/abacavir administration.
AIDS (London, England), , Jan-28, Volume: 29, Issue:3, 2015

Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy.
Journal of viral hepatitis, , Volume: 30, Issue:9, 2023

Long-term efficacy of dolutegravir in treatment-experienced subjects failing therapy with HIV-1 integrase strand inhibitor-resistant virus.
The Journal of antimicrobial chemotherapy, , Jan-01, Volume: 73, Issue:1, 2018

Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 72, Issue:3, 2017

Drug-Drug Interaction between the Direct-Acting Antiviral Regimen of Ombitasvir-Paritaprevir-Ritonavir plus Dasabuvir and the HIV Antiretroviral Agent Dolutegravir or Abacavir plus Lamivudine.
Antimicrobial agents and chemotherapy, , Volume: 60, Issue:10, 2016

Neuropsychiatric outcomes before and after switching to dolutegravir-based therapy in an acute HIV cohort.
AIDS research and therapy, , 01-07, Volume: 17, Issue:1, 2020

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

HIV-1 Tat and opioids act independently to limit antiretroviral brain concentrations and reduce blood-brain barrier integrity.
Journal of neurovirology, , Volume: 25, Issue:4, 2019

Selection of the R263K mutation to dolutegravir in cerebrospinal fluid HIV-1 virus in one patient with HIV-associated neurocognitive disorders.
AIDS (London, England), , 09-10, Volume: 30, Issue:14, 2016

Substance use, Unlike Dolutegravir, is Associated with Mood Symptoms in People Living with HIV.
AIDS and behavior, , Volume: 25, Issue:12, 2021

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Neurotoxicities in the treatment of HIV between dolutegravir, rilpivirine and dolutegravir/rilpivirine: a meta-analysis.
Sexually transmitted infections, , Volume: 97, Issue:4, 2021

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Brief Report: Improvement in Metabolic Health Parameters at Week 48 After Switching From a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen to the 2-Drug Regimen of Dolutegravir/Lamivudine: The TANGO Study.
Journal of acquired immune deficiency syndromes (1999), , 06-01, Volume: 87, Issue:2, 2021

Improvement of lipid profile after switching from efavirenz or ritonavir-boosted protease inhibitors to rilpivirine or once-daily integrase inhibitors: results from a large observational cohort study (SCOLTA).
BMC infectious diseases, , 07-31, Volume: 18, Issue:1, 2018

Lymphocytic colitis in an HIV positive patient: is dolutegravir the cause?
AIDS (London, England), , 06-01, Volume: 33, Issue:7, 2019

Dolutegravir in Pregnancy as Compared with Current HIV Regimens in the United States.
The New England journal of medicine, , 09-01, Volume: 387, Issue:9, 2022

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

[Interventional study on Dolutegravir and other antiretrovirals in patients with subclinical atherosclerosis in the Kinshasa Hospital].
The Pan African medical journal, , Volume: 45, 2023

Atherogenicity of low-density lipoproteins after switching from a protease inhibitor to dolutegravir: a substudy of the NEAT022 study.
The Journal of antimicrobial chemotherapy, , 06-29, Volume: 77, Issue:7, 2022

Brief Report: Evaluation of Inflammation and Atherogenesis Biomarkers Through 148 Weeks Postswitch to Dolutegravir and Rilpivirine in SWORD-1/SWORD-2.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

Dolutegravir and pregnancy outcomes in women on antiretroviral therapy in Brazil: a retrospective national cohort study.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Performance of Creatinine- and Cystatin C-Based Equations for Glomerular Filtration Rate Estimation in HIV-1-Infected Individuals Receiving Dolutegravir + Tenofovir Disoproxil Fumarate + Lamivudine as Initial Antiretroviral Therapy: A Retrospective Observ
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1, 2022

Renal effects of novel antiretroviral drugs.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association, , 03-01, Volume: 32, Issue:3, 2017

Dolutegravir is not removed during hemodialysis.
AIDS (London, England), , 06-01, Volume: 30, Issue:9, 2016

Comparative Clinical Pharmacokinetics and Pharmacodynamics of HIV-1 Integrase Strand Transfer Inhibitors.
Clinical pharmacokinetics, , Volume: 56, Issue:1, 2017

Pharmacokinetics of dolutegravir in HIV-seronegative subjects with severe renal impairment.
European journal of clinical pharmacology, , Volume: 70, Issue:1, 2014

Immune reconstitution inflammatory syndrome: a report of TB-IRIS after switching from efavirenz to dolutegravir.
Tropical doctor, , Volume: 51, Issue:2, 2021

Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study.
Antiviral research, , Volume: 169, 2019

Risks of cardiovascular or central nervous system adverse events and immune reconstitution inflammatory syndrome, for dolutegravir versus other antiretrovirals: meta-analysis of randomized trials.
Current opinion in HIV and AIDS, , Volume: 13, Issue:2, 2018

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Remission of an HHV8-related extracavitary primary effusion lymphoma in an HIV-positive patient during antiretroviral treatment containing dolutegravir.
AIDS research and therapy, , 07-27, Volume: 16, Issue:1, 2019

Alternative dolutegravir dosing strategies with concurrent rifapentine utilized for latent tuberculosis treatment.
International journal of STD & AIDS, , Volume: 34, Issue:14, 2023

Viral suppression among adults with HIV receiving routine dolutegravir-based antiretroviral therapy and 3 months weekly isoniazid-rifapentine.
AIDS (London, England), , 06-01, Volume: 37, Issue:7, 2023

Cytokine-Mediated Systemic Adverse Drug Reactions in a Drug-Drug Interaction Study of Dolutegravir With Once-Weekly Isoniazid and Rifapentine.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 07-02, Volume: 67, Issue:2, 2018

Probable hepatotoxicity with dolutegravir: report of two cases and review of the literature.
AIDS (London, England), , 06-01, Volume: 33, Issue:7, 2019

Severe cholestatic hepatitis related to abacavir/lamivudine/dolutegravir antiretroviral treatment in a HIV-1 infected subject.
AIDS (London, England), , 07-31, Volume: 32, Issue:12, 2018

Hepatoxicity of new antiretrovirals: a systematic review.
Clinics and research in hepatology and gastroenterology, , Volume: 37, Issue:2, 2013

Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients.
HIV clinical trials, , Volume: 15, Issue:5

Sustained virologic suppression with abacavir, emtricitabine, and crushed dolutegravir and tenofovir alafenamide in a patient with HIV and eosinophilic esophagitis.
International journal of STD & AIDS, , Volume: 31, Issue:3, 2020

Changes in functional connectivity in people with HIV switching antiretroviral therapy.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy.
Journal of viral hepatitis, , Volume: 30, Issue:9, 2023

Real-world use and outcomes of dolutegravir-containing antiretroviral therapy in HIV and tuberculosis co-infection: a site survey and cohort study in sub-Saharan Africa.
Journal of the International AIDS Society, , Volume: 25, Issue:7, 2022

Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex.
International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 116, 2022

Brief Report: Efficacy and Safety of Efavirenz, Raltegravir, and Dolutegravir in HIV-1/TB Coinfection. A Multicenter Retrospective Cohort Study in France.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

COVID-19 in people living with HIV: Clinical implications of dynamics of the immune response to SARS-CoV-2.
Journal of medical virology, , Volume: 93, Issue:3, 2021

Immune reconstitution inflammatory syndrome: a report of TB-IRIS after switching from efavirenz to dolutegravir.
Tropical doctor, , Volume: 51, Issue:2, 2021

Managing Human Immunodeficiency Virus-associated Tuberculosis in the Dolutegravir Era.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-03, Volume: 70, Issue:4, 2020

Pharmacokinetics, SAfety/tolerability, and EFficacy of high-dose RIFampicin in tuberculosis-HIV co-infected patients on efavirenz- or dolutegravir-based antiretroviral therapy: study protocol for an open-label, phase II clinical trial (SAEFRIF).
Trials, , Feb-13, Volume: 21, Issue:1, 2020

Dolutegravir-based Antiretroviral Therapy for Patients Coinfected With Tuberculosis and Human Immunodeficiency Virus: A Multicenter, Noncomparative, Open-label, Randomized Trial.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-03, Volume: 70, Issue:4, 2020

Dosing of Dolutegravir in TB/HIV Coinfected Patients on Rifampicin: Twice Is (Always) Better Than Once.
Journal of acquired immune deficiency syndromes (1999), , 07-01, Volume: 84, Issue:3, 2020

Twice-Daily vs. Once-Daily Dolutegravir in Patients With Human Immunodeficiency Virus-Tuberculosis Coinfection Receiving Rifampicin-Based Tuberculosis Therapy.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 06-24, Volume: 71, Issue:1, 2020

Multidrug-resistant HIV viral rebound during early syphilis: a case report.
BMC infectious diseases, , Apr-07, Volume: 20, Issue:1, 2020

Improvement in insulin sensitivity and serum leptin concentration after the switch from a ritonavir-boosted PI to raltegravir or dolutegravir in non-diabetic HIV-infected patients.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Clinical and Virological Outcomes of TB/HIV Coinfected Patients Treated With Dolutegravir-Based HIV Antiretroviral Regimens: Programmatic Experience From Botswana.
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 82, Issue:2, 2019

Assessment of drug interaction potential between the HCV direct-acting antiviral agents elbasvir/grazoprevir and the HIV integrase inhibitors raltegravir and dolutegravir.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Impact of dolutegravir and efavirenz on immune recovery markers: results from a randomized clinical trial.
Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases, , Volume: 24, Issue:8, 2018

Long-term efficacy of dolutegravir in treatment-experienced subjects failing therapy with HIV-1 integrase strand inhibitor-resistant virus.
The Journal of antimicrobial chemotherapy, , Jan-01, Volume: 73, Issue:1, 2018

Comparative Clinical Pharmacokinetics and Pharmacodynamics of HIV-1 Integrase Strand Transfer Inhibitors.
Clinical pharmacokinetics, , Volume: 56, Issue:1, 2017

Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 72, Issue:3, 2017

Clinical experience with dolutegravir/abacavir/lamivudine in HIV-HCV co-infected patients treated with a sofosbuvir-based regimen-safety and efficacy.
HIV clinical trials, , Volume: 17, Issue:6, 2016

Dolutegravir efficacy at 48 weeks in key subgroups of treatment-naive HIV-infected individuals in three randomized trials.
AIDS (London, England), , Jan-14, Volume: 29, Issue:2, 2015

The use of HIV-1 integrase inhibitors in antiretroviral naive patients.
Current opinion in HIV and AIDS, , Volume: 7, Issue:5, 2012

Changes in functional connectivity in people with HIV switching antiretroviral therapy.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

Lifetime antiretroviral exposure and neurocognitive impairment in HIV.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Dolutegravir as a trigger for DRESS syndrome?
International journal of STD & AIDS, , Volume: 29, Issue:10, 2018

Knowledge and perceptions about Dolutegravir and Dolutegravir counselling: a qualitative study among women living with HIV.
BMC women's health, , 09-09, Volume: 23, Issue:1, 2023

Efficacy and Safety of Two-Drug Regimens with Dolutegravir plus Rilpivirine or Lamivudine in HIV-1 Virologically Suppressed People Living with HIV.
Viruses, , 04-10, Volume: 15, Issue:4, 2023

Tenofovir alafenamide plus dolutegravir as a switch strategy in HIV-infected patients: a pilot randomized controlled trial.
Daru : journal of Faculty of Pharmacy, Tehran University of Medical Sciences, , Volume: 31, Issue:2, 2023

Neuropsychiatric adverse drug reactions and associated factors in a cohort of individuals starting dolutegravir-based or efavirenz-based antiretroviral therapy in Belo Horizonte, Brazil.
Current medical research and opinion, , Volume: 39, Issue:4, 2023

High acceptability and viral suppression rate for first-Line patients on a dolutegravir-based regimen: An early adopter study in Nigeria.
PloS one, , Volume: 18, Issue:5, 2023

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

Active Pharmacovigilance Project on the safety profile of Dolutegravir in Brazil.
AIDS care, , Volume: 35, Issue:5, 2023

Prevalence and factors associated with adverse drug events among patients on dolutegravir-based regimen at the Immune Suppression Syndrome Clinic of Mbarara Regional Referral Hospital, Uganda: a mixed design study.
AIDS research and therapy, , 04-02, Volume: 19, Issue:1, 2022

Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-01, Volume: 68, Issue:1, 2019

Pharmacokinetics of dolutegravir with and without darunavir/cobicistat in healthy volunteers.
The Journal of antimicrobial chemotherapy, , 01-01, Volume: 74, Issue:1, 2019

Immediate Versus Deferred Switching From a Boosted Protease Inhibitor-based Regimen to a Dolutegravir-based Regimen in Virologically Suppressed Patients With High Cardiovascular Risk or Age ≥50 Years: Final 96-Week Results of the NEAT022 Study.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-01, Volume: 68, Issue:4, 2019

Real-world evaluation of the safety and tolerability of abacavir/dolutegravir/lamivudine in an incarcerated population.
International journal of STD & AIDS, , Volume: 30, Issue:12, 2019

Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study.
Antiviral research, , Volume: 169, 2019

The transition to dolutegravir and other new antiretrovirals in low-income and middle-income countries: what are the issues?
AIDS (London, England), , 07-31, Volume: 32, Issue:12, 2018

Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring.
Current drug safety, , Volume: 13, Issue:1, 2018

Photoallergic dermatitis associated with fixed-dose combination of antiretroviral agent (abacavir-lamivudine-dolutegravir).
AIDS (London, England), , 06-19, Volume: 32, Issue:10, 2018

Switching to fixed-dose bictegravir, emtricitabine, and tenofovir alafenamide from dolutegravir plus abacavir and lamivudine in virologically suppressed adults with HIV-1: 48 week results of a randomised, double-blind, multicentre, active-controlled, phas
The lancet. HIV, , Volume: 5, Issue:7, 2018

New Dual Combination of Dolutegravir-Rilpivirine for Switching to Maintenance Antiretroviral Therapy.
AIDS reviews, , Volume: 20, Issue:4, 2018

Adverse drug reactions to integrase strand transfer inhibitors.
AIDS (London, England), , 04-24, Volume: 32, Issue:7, 2018

The effect of antiretroviral intensification with dolutegravir on residual virus replication in HIV-infected individuals: a randomised, placebo-controlled, double-blind trial.
The lancet. HIV, , Volume: 5, Issue:5, 2018

Adverse reactions associated with first-line regimens in patient initiating antiretroviral therapy.
European journal of clinical pharmacology, , Volume: 74, Issue:8, 2018

Prevalence of drug-drug interactions in the era of HIV integrase inhibitors: a retrospective clinical study.
The Netherlands journal of medicine, , Volume: 75, Issue:6, 2017

Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients.
HIV medicine, , Volume: 18, Issue:1, 2017

Evaluation of the concurrent use of dolutegravir and metformin in human immunodeficiency virus-infected patients.
International journal of STD & AIDS, , Volume: 28, Issue:12, 2017

Adverse events of raltegravir and dolutegravir.
AIDS (London, England), , 08-24, Volume: 31, Issue:13, 2017

Dolutegravir: a next-generation integrase inhibitor for treatment of HIV infection.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , Jul-15, Volume: 59, Issue:2, 2014

Tolerability of HIV integrase inhibitors.
Current opinion in HIV and AIDS, , Volume: 7, Issue:5, 2012

Issues about periconception use of dolutegravir are reminiscent of early concerns about efavirenz.
The lancet. HIV, , Volume: 5, Issue:12, 2018

Dolutegravir Inhibition of Matrix Metalloproteinases Affects Mouse Neurodevelopment.
Molecular neurobiology, , Volume: 58, Issue:11, 2021

Dolutegravir and metformin: a clinically relevant or just a pharmacokinetic interaction?
AIDS (London, England), , 02-20, Volume: 32, Issue:4, 2018

Dolutegravir and metformin: a case of hyperlactatemia.
AIDS (London, England), , Sep-24, Volume: 31, Issue:15, 2017

Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels.
EBioMedicine, , Volume: 63, 2021

Is There a Safety Signal for Dolutegravir and Integrase Inhibitors During Pregnancy?
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Congenital anomalies following antenatal exposure to dolutegravir: a Canadian surveillance study.
BJOG : an international journal of obstetrics and gynaecology, , Volume: 126, Issue:11, 2019

Neural-Tube Defects and Antiretroviral Treatment Regimens in Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Protecting Mothers and Babies - A Delicate Balancing Act.
The New England journal of medicine, , Sep-06, Volume: 379, Issue:10, 2018

The Potential Teratogenicity Alert for Women Conceiving on Dolutegravir-Based Regimens: An Assessment of Risk Communication by an Urban HIV Clinic in Uganda and Choices made by Women.
Drug safety, , Volume: 43, Issue:11, 2020

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Protecting Mothers and Babies - A Delicate Balancing Act.
The New England journal of medicine, , Sep-06, Volume: 379, Issue:10, 2018

Dolutegravir and pregnancy outcomes in women on antiretroviral therapy in Brazil: a retrospective national cohort study.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Therapeutic candidates for the Zika virus identified by a high-throughput screen for Zika protease inhibitors.
Proceedings of the National Academy of Sciences of the United States of America, , 12-08, Volume: 117, Issue:49, 2020

A lesson to learn from dolutegravir roll-out.
The lancet. HIV, , Volume: 6, Issue:9, 2019

Highlights from the 10th IAS Conference on Science.
The lancet. HIV, , Volume: 6, Issue:9, 2019

Brief Report: Integrase Strand Transfer Inhibitors Are Associated With Lower Risk of Incident Cardiovascular Disease in People Living With HIV.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 84, Issue:4, 2020

Dolutegravir Plus 3TC in Virologically Suppressed PLWHIV: Immunological Outcomes in a Multicenter Retrospective Cohort in Spain during the COVID-19 Pandemic.
Viruses, , 01-24, Volume: 15, Issue:2, 2023

South African healthcare workers' knowledge of dolutegravir's drug-drug interactions in the first year of its rollout: a cross-sectional online survey.
Journal of the International AIDS Society, , Volume: 25, Issue:3, 2022

48-Week effectiveness and tolerability of dolutegravir (DTG) + lamivudine (3TC) in antiretroviral-naïve adults living with HIV: A multicenter real-life cohort.
PloS one, , Volume: 17, Issue:11, 2022

A reflective process led by a family physician to develop a renal-protection surveillance tool for HIV patients newly started on dolutegravir.
African journal of primary health care & family medicine, , Sep-30, Volume: 13, Issue:1, 2021

Comparing the effectiveness of Atazanavir/Ritonavir/Dolutegravir/Hydroxychloroquine and Lopinavir/Ritonavir/Hydroxychloroquine treatment regimens in COVID-19 patients.
Journal of medical virology, , Volume: 93, Issue:12, 2021

Highlights of AIDS 2020.
The lancet. HIV, , Volume: 7, Issue:8, 2020

Cases of coronavirus disease-2019 in HIV-infected transgender women.
AIDS (London, England), , 07-15, Volume: 34, Issue:9, 2020

Tolerability and effectiveness of albuvirtide combined with dolutegravir for hospitalized people living with HIV/AIDS.
Medicine, , Nov-10, Volume: 102, Issue:45, 2023

Efficacy and safety of dolutegravir/rilpivirine in real-world clinical practice. GeSIDA study 1119.
HIV medicine, , Volume: 24, Issue:8, 2023

Efficacy and Durability of Dolutegravir- or Darunavir-Based Regimens in ART-Naïve AIDS- or Late-Presenting HIV-Infected Patients.
Viruses, , 05-08, Volume: 15, Issue:5, 2023

The DoDo experience: an alternative antiretroviral 2-drug regimen of doravirine and dolutegravir.
Infection, , Volume: 51, Issue:6, 2023

Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children.
The Pediatric infectious disease journal, , 03-01, Volume: 41, Issue:3, 2022

Dolutegravir plus rilpivirine: benefits beyond viral suppression: DORIPEX retrospective study.
Medicine, , Jun-17, Volume: 101, Issue:24, 2022

Highlights of AIDS 2020.
The lancet. HIV, , Volume: 7, Issue:8, 2020

Highlights of the 17th European AIDS Conference.
The lancet. HIV, , Volume: 7, Issue:1, 2020

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Extensive brain masses and cavitary lung lesions associated with toxoplasmosis and acquired immunodeficiency syndrome.
International journal of STD & AIDS, , Volume: 28, Issue:11, 2017

Autophagy facilitates macrophage depots of sustained-release nanoformulated antiretroviral drugs.
The Journal of clinical investigation, , Mar-01, Volume: 127, Issue:3, 2017

Virologic Response Following a Switch to Dolutegravir-based Regimen in People Living with HIV/AIDS at a Tertiary Care Center in Nepal.
Kathmandu University medical journal (KUMJ), , Volume: 20, Issue:80

Crushed dolutegravir/abacavir/lamivudine given via nasogastric tube in gastric outlet obstruction caused by cancer resulted in rapid viral load suppression.
International journal of STD & AIDS, , Volume: 30, Issue:1, 2019

Contilisant, a Tetratarget Small Molecule for Alzheimer's Disease Therapy Combining Cholinesterase, Monoamine Oxidase Inhibition, and H3R Antagonism with S1R Agonism Profile.
Journal of medicinal chemistry, , Aug-09, Volume: 61, Issue:15, 2018

Development of novel phenoxyalkylpiperidines as high-affinity Sigma-1 (σ
European journal of medicinal chemistry, , Jan-15, Volume: 228, 2022

Safety and tolerability of Triumeq in amyotrophic lateral sclerosis: the Lighthouse trial.
Amyotrophic lateral sclerosis & frontotemporal degeneration, , Volume: 20, Issue:7-8, 2019

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

[Toxicity for warfarine switching from lopinavir/ritonavir to dolutegravir].
Farmacia hospitalaria : organo oficial de expresion cientifica de la Sociedad Espanola de Farmacia Hospitalaria, , 03-01, Volume: 41, Issue:2, 2017

Dolutegravir-induced extrapyramidal syndrome in a young woman.
AIDS (London, England), , 03-15, Volume: 33, Issue:4, 2019

Neuropsychiatric outcomes before and after switching to dolutegravir-based therapy in an acute HIV cohort.
AIDS research and therapy, , 01-07, Volume: 17, Issue:1, 2020

Lifetime antiretroviral exposure and neurocognitive impairment in HIV.
Journal of neurovirology, , Volume: 26, Issue:5, 2020

SLC22A2 variants and dolutegravir levels correlate with psychiatric symptoms in persons with HIV.
The Journal of antimicrobial chemotherapy, , 04-01, Volume: 74, Issue:4, 2019

Integrase strand transfer inhibitors and neuropsychiatric adverse events in a large prospective cohort.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Adverse events of raltegravir and dolutegravir.
AIDS (London, England), , 08-24, Volume: 31, Issue:13, 2017

Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients.
HIV medicine, , Volume: 18, Issue:1, 2017

Single-tablet antiretroviral treatment (once daily).
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , Sep-20, Volume: 188, Issue:13, 2016

Psychiatric disorders after starting dolutegravir: report of four cases.
AIDS (London, England), , Aug-24, Volume: 29, Issue:13, 2015

Changes in weight, body composition and metabolic parameters after switch to dolutegravir/lamivudine compared with continued treatment with dolutegravir/abacavir/lamivudine for virologically suppressed HIV infection (The AVERTAS trial): a randomised, open
BMJ open, , 08-21, Volume: 13, Issue:8, 2023

"It's only fatness, it doesn't kill": a qualitative study on perceptions of weight gain from use of dolutegravir-based regimens in women living with HIV in Uganda.
BMC women's health, , 06-21, Volume: 22, Issue:1, 2022

Letter to the Editor: Dolutegravir Monotherapy and Body Weight Gain in Antiretroviral Naïve Patients.
AIDS research and human retroviruses, , Volume: 38, Issue:10, 2022

Impact of switching to TAF/FTC/RPV, TAF/FTC/EVG/cobi and ABC/3TC/DTG on cardiovascular risk and lipid profile in people living with HIV: a retrospective cohort study.
BMC infectious diseases, , Jun-22, Volume: 21, Issue:1, 2021

ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg
BMC infectious diseases, , Jan-04, Volume: 21, Issue:1, 2021

Dolutegravir with emtricitabine and tenofovir alafenamide or tenofovir disoproxil fumarate versus efavirenz, emtricitabine, and tenofovir disoproxil fumarate for initial treatment of HIV-1 infection (ADVANCE): week 96 results from a randomised, phase 3, n
The lancet. HIV, , Volume: 7, Issue:10, 2020

Unveiling the basis of antiretroviral therapy-induced osteopenia: the effects of Dolutegravir, Darunavir and Atazanavir on osteogenesis.
AIDS (London, England), , 02-02, Volume: 35, Issue:2, 2021

Nivolumab in HIV-related non-small-cell lung cancer.
Annals of oncology : official journal of the European Society for Medical Oncology, , 11-01, Volume: 28, Issue:11, 2017

Loss of Virologic Control and Severe Pneumocystis pneumonia in an HIV-Infected Patient Receiving Chemotherapy for Non-Small Cell Lung Cancer.
AIDS research and human retroviruses, , Volume: 32, Issue:1, 2016

Neuropsychiatric Adverse Events with Dolutegravir and Other Integrase Strand Transfer Inhibitors
AIDS reviews, , Volume: 21, Issue:1, 2019

Treatment of Central Nervous System Manifestations of HIV in the Current Era.
Seminars in neurology, , Volume: 39, Issue:3, 2019

Selection of the R263K mutation to dolutegravir in cerebrospinal fluid HIV-1 virus in one patient with HIV-associated neurocognitive disorders.
AIDS (London, England), , 09-10, Volume: 30, Issue:14, 2016

Risks and benefits of dolutegravir-based antiretroviral drug regimens in sub-Saharan Africa: a modelling study.
The lancet. HIV, , Volume: 6, Issue:2, 2019

Severe cholestatic hepatitis related to abacavir/lamivudine/dolutegravir antiretroviral treatment in a HIV-1 infected subject.
AIDS (London, England), , 07-31, Volume: 32, Issue:12, 2018

Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-01, Volume: 68, Issue:1, 2019

Sustained virologic suppression with abacavir, emtricitabine, and crushed dolutegravir and tenofovir alafenamide in a patient with HIV and eosinophilic esophagitis.
International journal of STD & AIDS, , Volume: 31, Issue:3, 2020

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

Blood glucose trajectories and incidence of diabetes mellitus in Ugandan people living with HIV initiated on dolutegravir.
AIDS research and therapy, , 03-13, Volume: 20, Issue:1, 2023

How Relevant is the Interaction Between Dolutegravir and Metformin in Real Life?
Journal of acquired immune deficiency syndromes (1999), , 05-01, Volume: 75, Issue:1, 2017

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Folate deficiency increases the incidence of dolutegravir-associated foetal defects in a mouse pregnancy model.
EBioMedicine, , Volume: 95, 2023

Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels.
EBioMedicine, , Volume: 63, 2021

Lamivudine-resistant HIV
Journal of global antimicrobial resistance, , Volume: 20, 2020

Therapeutic candidates for the Zika virus identified by a high-throughput screen for Zika protease inhibitors.
Proceedings of the National Academy of Sciences of the United States of America, , 12-08, Volume: 117, Issue:49, 2020

Ultra-long-acting removable drug delivery system for HIV treatment and prevention.
Nature communications, , 10-08, Volume: 9, Issue:1, 2018

A humanized mouse model for HIV-2 infection and efficacy testing of a single-pill triple-drug combination anti-retroviral therapy.
Virology, , 01-15, Volume: 501, 2017

Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels.
EBioMedicine, , Volume: 63, 2021

Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1.
BMC infectious diseases, , 09-16, Volume: 17, Issue:1, 2017

A severe hypersensitivity reaction to abacavir following re-challenge.
International journal of STD & AIDS, , Volume: 28, Issue:3, 2017

Single-tablet antiretroviral treatment (once daily).
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , Sep-20, Volume: 188, Issue:13, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Dolutegravir as a trigger for DRESS syndrome?
International journal of STD & AIDS, , Volume: 29, Issue:10, 2018

Decreased Hepatic Steatosis in South African Adolescents With Perinatal HIV Switching to Dolutegravir-containing Regimens.
The Pediatric infectious disease journal, , Jul-01, Volume: 42, Issue:7, 2023

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

Folate deficiency increases the incidence of dolutegravir-associated foetal defects in a mouse pregnancy model.
EBioMedicine, , Volume: 95, 2023

Clinical Extrapolation of the Effects of Dolutegravir and Other HIV Integrase Inhibitors on Folate Transport Pathways.
Drug metabolism and disposition: the biological fate of chemicals, , Volume: 47, Issue:8, 2019

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Switch to Dolutegravir plus Rilpivirine Dual Therapy in cART-Experienced Subjects: An Observational Cohort.
PloS one, , Volume: 11, Issue:10, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers.
Antimicrobial agents and chemotherapy, , Volume: 54, Issue:1, 2010

Enhanced Eryptosis Following Exposure to Dolutegravir.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, , Volume: 39, Issue:2, 2016

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy.
Journal of viral hepatitis, , Volume: 30, Issue:9, 2023

Assessment of drug interaction potential between the HCV direct-acting antiviral agents elbasvir/grazoprevir and the HIV integrase inhibitors raltegravir and dolutegravir.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Switch to dolutegravir is well tolerated in Thais with HIV infection.
Journal of the International AIDS Society, , Volume: 22, Issue:7, 2019

Small increase in dolutegravir trough, but equivalent total dolutegravir exposure with simeprevir in HIV/HCV seronegative volunteers.
The Journal of antimicrobial chemotherapy, , Jan-01, Volume: 73, Issue:1, 2018

Clinical experience with dolutegravir/abacavir/lamivudine in HIV-HCV co-infected patients treated with a sofosbuvir-based regimen-safety and efficacy.
HIV clinical trials, , Volume: 17, Issue:6, 2016

The use of HIV-1 integrase inhibitors in antiretroviral naive patients.
Current opinion in HIV and AIDS, , Volume: 7, Issue:5, 2012

New drugs: simeprevir, sofosbuvir, and dolutegravir sodium.
Journal of the American Pharmacists Association : JAPhA, , Volume: 54, Issue:2

Remission of an HHV8-related extracavitary primary effusion lymphoma in an HIV-positive patient during antiretroviral treatment containing dolutegravir.
AIDS research and therapy, , 07-27, Volume: 16, Issue:1, 2019

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

HIV-1 drug resistance in people on dolutegravir-based antiretroviral therapy: a collaborative cohort analysis.
The lancet. HIV, , Volume: 10, Issue:11, 2023

Assessing the Virologic Impact of Archived Resistance in the Dolutegravir/Lamivudine 2-Drug Regimen HIV-1 Switch Study TANGO through Week 144.
Viruses, , 06-11, Volume: 15, Issue:6, 2023

An indirect comparison of 144-week efficacy, safety, and tolerability of dolutegravir plus lamivudine and second-generation integrase inhibitor-based, 3-drug, single-tablet regimens in therapy-naive people with HIV-1.
AIDS research and therapy, , 03-22, Volume: 20, Issue:1, 2023

Dolutegravir and rilpivirine as successful initial antiretroviral therapy in a treatment-naive patient with HIV-1: A case report.
Antiviral therapy, , Volume: 28, Issue:6, 2023

Efficacy and Safety of Two-Drug Regimens with Dolutegravir plus Rilpivirine or Lamivudine in HIV-1 Virologically Suppressed People Living with HIV.
Viruses, , 04-10, Volume: 15, Issue:4, 2023

Laboratory Based Surveillance of HIV-1 Acquired Drug Resistance in Cameroon: Implications for Use of Tenofovir-Lamivudine-Dolutegravir (TLD) as Second- or Third-Line Regimens.
Viruses, , 08-02, Volume: 15, Issue:8, 2023

High viral suppression and detection of dolutegravir-resistance associated mutations in treatment-experienced Tanzanian adults living with HIV-1 in Dar es Salaam.
Scientific reports, , Nov-22, Volume: 13, Issue:1, 2023

Effectiveness and Safety of Dolutegravir Versus Efavirenz-Based Antiviral Regimen in People Living With HIV-1 in Sichuan Province of China: A Real-World Study.
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1, 2022

Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial.
The lancet. HIV, , Volume: 9, Issue:5, 2022

Dolutegravir Plus Lamivudine Dual-Drug Regimen in Treatment-Naive HIV-1-Infected Patients With High-Level Viral Load: Preliminary Data From the Real World.
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1, 2022

Efficacy and Safety of a Simplified Lamivudine Plus Dolutegravir Dual Therapy in HIV-1-Infected Patients: A Multicenter Cohort Study in China.
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1, 2022

Viral suppression and HIV-1 drug resistance 1 year after pragmatic transitioning to dolutegravir first-line therapy in Malawi: a prospective cohort study.
The lancet. HIV, , Volume: 9, Issue:8, 2022

Performance of Creatinine- and Cystatin C-Based Equations for Glomerular Filtration Rate Estimation in HIV-1-Infected Individuals Receiving Dolutegravir + Tenofovir Disoproxil Fumarate + Lamivudine as Initial Antiretroviral Therapy: A Retrospective Observ
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1, 2022

DOLAVI Real-Life Study of Dolutegravir Plus Lamivudine in Naive HIV-1 Patients (48 Weeks).
Viruses, , 03-04, Volume: 14, Issue:3, 2022

Dolutegravir Plus Lamivudine as Initial Therapy for HIV-1 Infected and ARV-naïve Patients in West China, 24-Weeks Results of a Preliminary Real-world Study.
Current HIV research, , Volume: 20, Issue:3, 2022

Integrase resistance emergence with dolutegravir/lamivudine with prior HIV-1 suppression.
The Journal of antimicrobial chemotherapy, , 05-29, Volume: 77, Issue:6, 2022

Five Years With Dolutegravir Plus Lamivudine as a Switch Strategy: Much More Than a Positive Finding.
Journal of acquired immune deficiency syndromes (1999), , 11-01, Volume: 88, Issue:3, 2021

Efficacy and safety of dolutegravir plus emtricitabine versus standard ART for the maintenance of HIV-1 suppression: 48-week results of the factorial, randomized, non-inferiority SIMPL'HIV trial.
PLoS medicine, , Volume: 17, Issue:11, 2020

Risk of elevation of serum creatine kinase among HIV-positive individuals receiving dolutegravir-based combination antiretroviral therapy.
Medicine, , Volume: 98, Issue:26, 2019

Dolutegravir plus lamivudine for initial treatment of HIV-1-infected participants with HIV-1 RNA <500 000 copies/mL: week 48 outcomes from ACTG 5353.
The Journal of antimicrobial chemotherapy, , 05-01, Volume: 74, Issue:5, 2019

Efficacy and tolerability of lamivudine plus dolutegravir compared with lamivudine plus boosted PIs in HIV-1 positive individuals with virologic suppression: a retrospective study from the clinical practice.
BMC infectious diseases, , Jan-17, Volume: 19, Issue:1, 2019

Durability of first-line regimens including integrase strand transfer inhibitors (INSTIs): data from a real-life setting.
The Journal of antimicrobial chemotherapy, , 05-01, Volume: 74, Issue:5, 2019

Mutations in the HIV-1 envelope glycoprotein can broadly rescue blocks at multiple steps in the virus replication cycle.
Proceedings of the National Academy of Sciences of the United States of America, , 04-30, Volume: 116, Issue:18, 2019

Resistance to Dolutegravir-A Chink in the Armor?
The Journal of infectious diseases, , 07-24, Volume: 218, Issue:5, 2018

Dolutegravir-based maintenance monotherapy versus dual therapy with lamivudine: a planned 24 week analysis of the DOLAM randomized clinical trial.
The Journal of antimicrobial chemotherapy, , 07-01, Volume: 73, Issue:7, 2018

Reply to Darcis and Berkhout.
The Journal of infectious diseases, , 11-05, Volume: 218, Issue:12, 2018

Switching to fixed-dose bictegravir, emtricitabine, and tenofovir alafenamide from dolutegravir plus abacavir and lamivudine in virologically suppressed adults with HIV-1: 48 week results of a randomised, double-blind, multicentre, active-controlled, phas
The lancet. HIV, , Volume: 5, Issue:7, 2018

Cost-utility analysis of the fixed-dose combination of dolutegravir/abacavir/lamivudine as initial treatment of HIV+ patients in Spain.
Farmacia hospitalaria : organo oficial de expresion cientifica de la Sociedad Espanola de Farmacia Hospitalaria, , Sep-01, Volume: 41, Issue:5, 2017

Serum creatinine elevation after switch to dolutegravir in a human immunodeficiency virus-positive kidney transplant recipient.
Transplant infectious disease : an official journal of the Transplantation Society, , Volume: 18, Issue:4, 2016

Dolutegravir in breast milk and maternal and infant plasma during breastfeeding.
AIDS (London, England), , 11-13, Volume: 30, Issue:17, 2016

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

An evaluation of postmarketing reports of hyperglycaemia associated with dolutegravir for treatment of HIV in Eswatini.
AIDS research and therapy, , 11-24, Volume: 19, Issue:1, 2022

Dolutegravir-associated hyperglycaemia in patients with HIV.
The lancet. HIV, , Volume: 7, Issue:7, 2020

Dolutegravir-induced hyperglycaemia in a patient living with HIV.
The Journal of antimicrobial chemotherapy, , 01-01, Volume: 73, Issue:1, 2018

Early neuropsychological adverse events after switching from PI/r to dolutegravir could be related to hyperthyroidism in patients under levothyroxine.
Antiviral therapy, , Volume: 22, Issue:3, 2017

Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study.
PloS one, , Volume: 15, Issue:12, 2020

Inflammation and intracellular exposure of dolutegravir, darunavir, tenofovir and emtricitabine in people living with HIV.
British journal of clinical pharmacology, , Volume: 89, Issue:3, 2023

Long-term effects on subclinical cardiovascular disease of switching from boosted protease inhibitors to dolutegravir.
The Journal of antimicrobial chemotherapy, , 09-05, Volume: 78, Issue:9, 2023

Pro-Inflammatory Interactions of Dolutegravir with Human Neutrophils in an In Vitro Study.
Molecules (Basel, Switzerland), , Dec-19, Volume: 27, Issue:24, 2022

Differential effects of dolutegravir, bictegravir and raltegravir in adipokines and inflammation markers on human adipocytes.
Life sciences, , Nov-01, Volume: 308, 2022

Brief Report: Evaluation of Inflammation and Atherogenesis Biomarkers Through 148 Weeks Postswitch to Dolutegravir and Rilpivirine in SWORD-1/SWORD-2.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

The impact of integrase inhibitor-based regimens on markers of inflammation among HIV naïve patients.
Cytokine, , Volume: 126, 2020

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Immune activation, inflammation and HIV DNA after 96 weeks of ATV/r monotherapy: a MODAt substudy.
Antiviral therapy, , Volume: 23, Issue:7, 2018

Reply to Letter 'Morning dosing for dolutegravir-related insomnia and sleep disorders' by Capetti et al.
HIV medicine, , Volume: 19, Issue:5, 2018

Morning dosing for dolutegravir-related insomnia and sleep disorders.
HIV medicine, , Volume: 19, Issue:5, 2018

Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1.
BMC infectious diseases, , 09-16, Volume: 17, Issue:1, 2017

Psychiatric Symptoms in Patients Receiving Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , Apr-01, Volume: 74, Issue:4, 2017

Switch to Dolutegravir plus Rilpivirine Dual Therapy in cART-Experienced Subjects: An Observational Cohort.
PloS one, , Volume: 11, Issue:10, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Should dolutegravir always be withheld in people with HIV on dolutegravir with incident diabetes mellitus? a case report.
BMC infectious diseases, , Oct-30, Volume: 23, Issue:1, 2023

Long-term effects on subclinical cardiovascular disease of switching from boosted protease inhibitors to dolutegravir.
The Journal of antimicrobial chemotherapy, , 09-05, Volume: 78, Issue:9, 2023

Dolutegravir use over 48 weeks is not associated with worsening insulin resistance and pancreatic beta cell function in a cohort of HIV-infected Ugandan adults.
AIDS research and therapy, , 09-09, Volume: 20, Issue:1, 2023

Inhibition of Adipose Tissue Beiging by HIV Integrase Inhibitors, Dolutegravir and Bictegravir, Is Associated with Adipocyte Hypertrophy, Hypoxia, Elevated Fibrosis, and Insulin Resistance in Simian Adipose Tissue and Human Adipocytes.
Cells, , 06-04, Volume: 11, Issue:11, 2022

Bone mineral density, kidney function, weight gain and insulin resistance in women who switch from TDF/FTC/NNRTI to ABC/3TC/DTG.
HIV medicine, , Volume: 22, Issue:2, 2021

Brief Report: Improvement in Metabolic Health Parameters at Week 48 After Switching From a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen to the 2-Drug Regimen of Dolutegravir/Lamivudine: The TANGO Study.
Journal of acquired immune deficiency syndromes (1999), , 06-01, Volume: 87, Issue:2, 2021

HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells.
PloS one, , Volume: 15, Issue:1, 2020

The Integrase Inhibitors Dolutegravir and Raltegravir Exert Proadipogenic and Profibrotic Effects and Induce Insulin Resistance in Human/Simian Adipose Tissue and Human Adipocytes.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 12-17, Volume: 71, Issue:10, 2020

Improvement in insulin sensitivity and serum leptin concentration after the switch from a ritonavir-boosted PI to raltegravir or dolutegravir in non-diabetic HIV-infected patients.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Safety and efficacy of dolutegravir in hemodialysis.
International journal of STD & AIDS, , Volume: 30, Issue:6, 2019

Abacavir/lamivudine/dolutegravir single tablet regimen in patients with human immunodeficiency virus and end-stage renal disease on hemodialysis.
International journal of STD & AIDS, , Volume: 30, Issue:2, 2019

Drug interaction after ritonavir discontinuation: considerations for antiretroviral therapy changes in renal transplant recipients.
International journal of STD & AIDS, , Volume: 30, Issue:7, 2019

Serum creatinine elevation after switch to dolutegravir in a human immunodeficiency virus-positive kidney transplant recipient.
Transplant infectious disease : an official journal of the Transplantation Society, , Volume: 18, Issue:4, 2016

Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease.
Antimicrobial agents and chemotherapy, , Volume: 60, Issue:4, 2016

Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 72, Issue:3, 2017

Effect of a single supratherapeutic dose of dolutegravir on cardiac repolarization.
Pharmacotherapy, , Volume: 32, Issue:4, 2012

Nivolumab in HIV-related non-small-cell lung cancer.
Annals of oncology : official journal of the European Society for Medical Oncology, , 11-01, Volume: 28, Issue:11, 2017

Loss of Virologic Control and Severe Pneumocystis pneumonia in an HIV-Infected Patient Receiving Chemotherapy for Non-Small Cell Lung Cancer.
AIDS research and human retroviruses, , Volume: 32, Issue:1, 2016

Kaposi's Sarcoma Occurring in HIV Infection Controlled on HAART.
The American journal of medicine, , Volume: 133, Issue:6, 2020

Impact of Dolutegravir-Based Antiretroviral Therapy on Piperaquine Exposure following Dihydroartemisinin-Piperaquine Intermittent Preventive Treatment of Malaria in Pregnant Women Living with HIV.
Antimicrobial agents and chemotherapy, , 12-20, Volume: 66, Issue:12, 2022

Effect of dihydroartemisinin/piperaquine for malaria intermittent preventive treatment on dolutegravir exposure in pregnant women living with HIV.
The Journal of antimicrobial chemotherapy, , 05-29, Volume: 77, Issue:6, 2022

[Toxicity for warfarine switching from lopinavir/ritonavir to dolutegravir].
Farmacia hospitalaria : organo oficial de expresion cientifica de la Sociedad Espanola de Farmacia Hospitalaria, , 03-01, Volume: 41, Issue:2, 2017

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Brief Report: Integrase Strand Transfer Inhibitors Are Associated With Lower Risk of Incident Cardiovascular Disease in People Living With HIV.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 84, Issue:4, 2020

Acute myocarditis after switch to dolutegravir: a reminder of potential toxicity of integrase inhibitor-including HAART.
AIDS (London, England), , 11-01, Volume: 33, Issue:13, 2019

Two case reports of severe myocarditis associated with the initiation of dolutegravir treatment in HIV patients.
Medicine, , Volume: 95, Issue:47, 2016

Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects.
Drug and alcohol dependence, , Dec-01, Volume: 133, Issue:2, 2013

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Integrase strand transfer inhibitors and neuropsychiatric adverse events in a large prospective cohort.
The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3, 2019

Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring.
Current drug safety, , Volume: 13, Issue:1, 2018

Folate deficiency increases the incidence of dolutegravir-associated foetal defects in a mouse pregnancy model.
EBioMedicine, , Volume: 95, 2023

Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels.
EBioMedicine, , Volume: 63, 2021

No developmental toxicity observed with dolutegravir in rat whole embryo culture.
Birth defects research, , 10-01, Volume: 113, Issue:16, 2021

Dolutegravir Inhibition of Matrix Metalloproteinases Affects Mouse Neurodevelopment.
Molecular neurobiology, , Volume: 58, Issue:11, 2021

Lessons from dolutegravir and neural tube defects.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Dolutegravir and pregnancy outcomes in women on antiretroviral therapy in Brazil: a retrospective national cohort study.
The lancet. HIV, , Volume: 8, Issue:1, 2021

Dolutegravir for pregnant women living with HIV.
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , 03-02, Volume: 192, Issue:9, 2020

Dolutegravir and neural tube defects: a new insight.
The Lancet. Infectious diseases, , Volume: 20, Issue:4, 2020

HIV Drug May Increase Risk of Neural Tube Birth Defects.
The American journal of nursing, , Volume: 119, Issue:1, 2019

Risks and Benefits of Dolutegravir- and Efavirenz-Based Strategies for South African Women With HIV of Child-Bearing Potential: A Modeling Study.
Annals of internal medicine, , 05-07, Volume: 170, Issue:9, 2019

Dolutegravir becomes first choice for HIV.
The Lancet. Infectious diseases, , Volume: 19, Issue:9, 2019

Periconception dolutegravir use in women living with HIV and missed opportunities in maternal and child health.
The Lancet. Child & adolescent health, , Volume: 3, Issue:10, 2019

Health Care Autonomy of Women Living with HIV.
The New England journal of medicine, , Aug-29, Volume: 381, Issue:9, 2019

Neural-Tube Defects and Antiretroviral Treatment Regimens in Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Dolutegravir Use at Conception - Additional Surveillance Data from Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Optimizing responses to drug safety signals in pregnancy: the example of dolutegravir and neural tube defects.
Journal of the International AIDS Society, , Volume: 22, Issue:7, 2019

What will it take to refute the possible safety signal for dolutegravir and neural tube defects?
BJOG : an international journal of obstetrics and gynaecology, , Volume: 126, Issue:11, 2019

Clinical Extrapolation of the Effects of Dolutegravir and Other HIV Integrase Inhibitors on Folate Transport Pathways.
Drug metabolism and disposition: the biological fate of chemicals, , Volume: 47, Issue:8, 2019

Is There a Safety Signal for Dolutegravir and Integrase Inhibitors During Pregnancy?
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Assessing the risk of dolutegravir for women of childbearing potential.
The Lancet. Global health, , Volume: 6, Issue:9, 2018

Changes to dolutegravir policy in several African countries.
Lancet (London, England), , 07-21, Volume: 392, Issue:10143, 2018

Protecting Mothers and Babies - A Delicate Balancing Act.
The New England journal of medicine, , Sep-06, Volume: 379, Issue:10, 2018

Neural-Tube Defects with Dolutegravir Treatment from the Time of Conception.
The New England journal of medicine, , 09-06, Volume: 379, Issue:10, 2018

Two cases of neural tube defects with dolutegravir use at conception in south Brazil.
The Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases, , Volume: 25, Issue:2

Recurrent ocular syphilis in a patient living with HIV.
International journal of STD & AIDS, , Volume: 31, Issue:11, 2020

Case Report of Increased Exposure to Antiretrovirals following Sleeve Gastrectomy.
Antimicrobial agents and chemotherapy, , 03-24, Volume: 64, Issue:4, 2020

Switch from tenofovir disoproxil fumarate combination to dolutegravir with rilpivirine improves parameters of bone health.
AIDS (London, England), , 02-20, Volume: 32, Issue:4, 2018

Dual Sigma-1 receptor antagonists and hydrogen sulfide-releasing compounds for pain treatment: Design, synthesis, and pharmacological evaluation.
European journal of medicinal chemistry, , Feb-15, Volume: 230, 2022

Lamivudine-Associated Pancreatitis: Strongest Evidence to Date.
American journal of therapeutics, , Volume: 24, Issue:5

Dolutegravir-induced paresthesias.
AIDS (London, England), , Jul-17, Volume: 31, Issue:11, 2017

Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study.
Antiviral research, , Volume: 169, 2019

Loss of Virologic Control and Severe Pneumocystis pneumonia in an HIV-Infected Patient Receiving Chemotherapy for Non-Small Cell Lung Cancer.
AIDS research and human retroviruses, , Volume: 32, Issue:1, 2016

Pharmacokinetic profile of dolutegravir after transjugular intrahepatic portosystemic shunt placement.
The Journal of antimicrobial chemotherapy, , 05-01, Volume: 75, Issue:5, 2020

Updated assessment of risks and benefits of dolutegravir versus efavirenz in new antiretroviral treatment initiators in sub-Saharan Africa: modelling to inform treatment guidelines.
The lancet. HIV, , Volume: 7, Issue:3, 2020

Community acceptability of dolutegravir-based HIV treatment in women: a qualitative study in South Africa and Uganda.
BMC public health, , Dec-07, Volume: 20, Issue:1, 2020

Optimizing responses to drug safety signals in pregnancy: the example of dolutegravir and neural tube defects.
Journal of the International AIDS Society, , Volume: 22, Issue:7, 2019

Brief Report: Dolutegravir Plasma Protein Binding and Unbound Concentrations During Pregnancy and Postpartum.
Journal of acquired immune deficiency syndromes (1999), , 12-01, Volume: 94, Issue:4, 2023

Raltegravir-based Postnatal HIV Prophylaxis Therapy in a Neonate After in Utero Dolutegravir Exposure.
The Pediatric infectious disease journal, , 02-01, Volume: 41, Issue:2, 2022

The Effect of Pregnancy on the Pharmacokinetics of Total and Unbound Dolutegravir and Its Main Metabolite in Women Living With Human Immunodeficiency Virus.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-23, Volume: 72, Issue:1, 2021

Efficacy and safety of dolutegravir with emtricitabine and tenofovir alafenamide fumarate or tenofovir disoproxil fumarate, and efavirenz, emtricitabine, and tenofovir disoproxil fumarate HIV antiretroviral therapy regimens started in pregnancy (IMPAACT 2
Lancet (London, England), , 04-03, Volume: 397, Issue:10281, 2021

Dolutegravir for pregnant women living with HIV.
CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne, , 03-02, Volume: 192, Issue:9, 2020

Postmarketing Surveillance of Pregnancy Outcomes With Dolutegravir Use.
Journal of acquired immune deficiency syndromes (1999), , 01-01, Volume: 83, Issue:1, 2020

Fetal biometry following in-utero exposure to dolutegravir-based or efavirenz-based antiretroviral therapy.
AIDS (London, England), , 12-01, Volume: 34, Issue:15, 2020

Use of Dolutegravir for Antiretroviral Therapy for Women of Childbearing Age.
Journal of obstetric, gynecologic, and neonatal nursing : JOGNN, , Volume: 48, Issue:6, 2019

Dolutegravir becomes first choice for HIV.
The Lancet. Infectious diseases, , Volume: 19, Issue:9, 2019

Dolutegravir plus Two Different Prodrugs of Tenofovir to Treat HIV.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

[Dolutegravir in acute HIV-1 infection: first reported case].
Revista espanola de quimioterapia : publicacion oficial de la Sociedad Espanola de Quimioterapia, , Volume: 32, Issue:4, 2019

Congenital anomalies following antenatal exposure to dolutegravir: a Canadian surveillance study.
BJOG : an international journal of obstetrics and gynaecology, , Volume: 126, Issue:11, 2019

Dolutegravir Use at Conception - Additional Surveillance Data from Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

HIV Drug May Increase Risk of Neural Tube Birth Defects.
The American journal of nursing, , Volume: 119, Issue:1, 2019

Exposure to dolutegravir in pregnant women living with HIV in Central and Eastern Europe and neighboring countries - data from the ECEE Network Group.
Ginekologia polska, , Volume: 90, Issue:7, 2019

Neural-Tube Defects and Antiretroviral Treatment Regimens in Botswana.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Low plasmatic concentration of intensified antiretroviral therapy in a pregnant woman: a case report.
Journal of medical case reports, , Jul-23, Volume: 13, Issue:1, 2019

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV.
AIDS (London, England), , 03-27, Volume: 32, Issue:6, 2018

Evaluating outcomes of mother-infant pairs using dolutegravir for HIV treatment during pregnancy.
AIDS (London, England), , 09-10, Volume: 32, Issue:14, 2018

Dolutegravir in pregnancy-effects on HIV-positive women and their infants.
European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology, , Volume: 37, Issue:3, 2018

Comparative safety of dolutegravir-based or efavirenz-based antiretroviral treatment started during pregnancy in Botswana: an observational study.
The Lancet. Global health, , Volume: 6, Issue:7, 2018

Protecting Mothers and Babies - A Delicate Balancing Act.
The New England journal of medicine, , Sep-06, Volume: 379, Issue:10, 2018

Neural-Tube Defects with Dolutegravir Treatment from the Time of Conception.
The New England journal of medicine, , 09-06, Volume: 379, Issue:10, 2018

Early experience of dolutegravir pharmacokinetics in pregnancy: high maternal levels and significant foetal exposure with twice-daily dosing.
AIDS (London, England), , 05-15, Volume: 30, Issue:8, 2016

Integrase inhibitors in late pregnancy and rapid HIV viral load reduction.
American journal of obstetrics and gynecology, , Volume: 214, Issue:3, 2016

Substantially lowered dolutegravir exposure in a treatment-experienced perinatally HIV-1-infected pregnant woman.
AIDS (London, England), , 07-31, Volume: 30, Issue:12, 2016

Successful prevention of HIV mother-to-child transmission with dolutegravir-based combination antiretroviral therapy in a vertically infected pregnant woman with multiclass highly drug-resistant HIV-1.
AIDS (London, England), , Nov-28, Volume: 29, Issue:18, 2015

Congenital anomalies following antenatal exposure to dolutegravir: a Canadian surveillance study.
BJOG : an international journal of obstetrics and gynaecology, , Volume: 126, Issue:11, 2019

Dolutegravir: advancing ethical research in pregnancy.
Lancet (London, England), , 11-30, Volume: 394, Issue:10213, 2019

Exposure to dolutegravir in pregnant women living with HIV in Central and Eastern Europe and neighboring countries - data from the ECEE Network Group.
Ginekologia polska, , Volume: 90, Issue:7, 2019

Pregnancy and Neonatal Outcomes Following Prenatal Exposure to Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4, 2019

Early experience of dolutegravir pharmacokinetics in pregnancy: high maternal levels and significant foetal exposure with twice-daily dosing.
AIDS (London, England), , 05-15, Volume: 30, Issue:8, 2016

Discovery of dolutegravir-1,2,3-triazole derivatives against prostate cancer via inducing DNA damage.
Bioorganic chemistry, , Volume: 141, 2023

Effects of the androgen receptor inhibitor enzalutamide on the pharmacokinetics of dolutegravir and tenofovir: a case report.
AIDS (London, England), , 09-01, Volume: 36, Issue:11, 2022

An implicit threat: dolutegravir-induced schizophrenic brief psychotic disorder and persistent cenesthopathy.
AIDS (London, England), , 11-28, Volume: 32, Issue:18, 2018

Psychiatric Symptoms in Patients Receiving Dolutegravir.
Journal of acquired immune deficiency syndromes (1999), , Apr-01, Volume: 74, Issue:4, 2017

Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients.
HIV clinical trials, , Volume: 15, Issue:5

Selection of the R263K mutation to dolutegravir in cerebrospinal fluid HIV-1 virus in one patient with HIV-associated neurocognitive disorders.
AIDS (London, England), , 09-10, Volume: 30, Issue:14, 2016

[Safety profile of dolutegravir].
Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1, 2015

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Kaposi's sarcoma in a HIV-positive patient: an exuberant and widespread case report in the Amazon.
Revista do Instituto de Medicina Tropical de Sao Paulo, , Volume: 62, 2020

Kaposi's Sarcoma Occurring in HIV Infection Controlled on HAART.
The American journal of medicine, , Volume: 133, Issue:6, 2020

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Drug interactions are not always predictable: the curious case of valproic acid and dolutegravir and a possible explanation.
AIDS (London, England), , 08-01, Volume: 33, Issue:10, 2019

Kaposi's Sarcoma Occurring in HIV Infection Controlled on HAART.
The American journal of medicine, , Volume: 133, Issue:6, 2020

Kaposi's sarcoma in a HIV-positive patient: an exuberant and widespread case report in the Amazon.
Revista do Instituto de Medicina Tropical de Sao Paulo, , Volume: 62, 2020

Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-01, Volume: 68, Issue:1, 2019

Reply to Letter 'Morning dosing for dolutegravir-related insomnia and sleep disorders' by Capetti et al.
HIV medicine, , Volume: 19, Issue:5, 2018

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Crushed dolutegravir/abacavir/lamivudine given via nasogastric tube in gastric outlet obstruction caused by cancer resulted in rapid viral load suppression.
International journal of STD & AIDS, , Volume: 30, Issue:1, 2019

Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects.
Drug and alcohol dependence, , Dec-01, Volume: 133, Issue:2, 2013

Multidrug-resistant HIV viral rebound during early syphilis: a case report.
BMC infectious diseases, , Apr-07, Volume: 20, Issue:1, 2020

Recurrent ocular syphilis in a patient living with HIV.
International journal of STD & AIDS, , Volume: 31, Issue:11, 2020

Limited Weight Impact After Switching From Boosted Protease Inhibitors to Dolutegravir in Persons With Human Immunodeficiency Virus With High Cardiovascular Risk: A Post Hoc Analysis of the 96-Week NEAT-022 Randomized Trial.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 03-04, Volume: 76, Issue:5, 2023

Weight Gain Among Treatment-Naïve Persons With HIV Receiving Dolutegravir in Kenya.
Journal of acquired immune deficiency syndromes (1999), , 12-15, Volume: 91, Issue:5, 2022

Severe Thrombocytopenia During Dolutegravir-containing Antiretroviral Therapy.
Internal medicine (Tokyo, Japan), , Aug-15, Volume: 56, Issue:16, 2017

How the genomics revolution could finally help Africa.
Nature, , 04-05, Volume: 544, Issue:7648, 2017

Standard-dose versus double-dose dolutegravir in HIV-associated tuberculosis in South Africa (RADIANT-TB): a phase 2, non-comparative, randomised controlled trial.
The lancet. HIV, , Volume: 10, Issue:7, 2023

Dolutegravir once daily with rifampicin for HIV and tuberculosis.
The lancet. HIV, , Volume: 10, Issue:7, 2023

Decreased Dolutegravir and Efavirenz Concentrations With Preserved Virological Suppression in Patients With Tuberculosis and Human Immunodeficiency Virus Receiving High-Dose Rifampicin.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-08, Volume: 76, Issue:3, 2023

Dolutegravir for children with HIV-associated tuberculosis.
The lancet. HIV, , Volume: 9, Issue:9, 2022

Brief Report: Efficacy and Safety of Efavirenz, Raltegravir, and Dolutegravir in HIV-1/TB Coinfection. A Multicenter Retrospective Cohort Study in France.
Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1, 2022

Real-world use and outcomes of dolutegravir-containing antiretroviral therapy in HIV and tuberculosis co-infection: a site survey and cohort study in sub-Saharan Africa.
Journal of the International AIDS Society, , Volume: 25, Issue:7, 2022

Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex.
International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 116, 2022

Weight Gain Among Treatment-Naïve Persons With HIV Receiving Dolutegravir in Kenya.
Journal of acquired immune deficiency syndromes (1999), , 12-15, Volume: 91, Issue:5, 2022

Immune reconstitution inflammatory syndrome: a report of TB-IRIS after switching from efavirenz to dolutegravir.
Tropical doctor, , Volume: 51, Issue:2, 2021

Dosing of Dolutegravir in TB/HIV Coinfected Patients on Rifampicin: Twice Is (Always) Better Than Once.
Journal of acquired immune deficiency syndromes (1999), , 07-01, Volume: 84, Issue:3, 2020

Managing Human Immunodeficiency Virus-associated Tuberculosis in the Dolutegravir Era.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-03, Volume: 70, Issue:4, 2020

Pharmacokinetics, SAfety/tolerability, and EFficacy of high-dose RIFampicin in tuberculosis-HIV co-infected patients on efavirenz- or dolutegravir-based antiretroviral therapy: study protocol for an open-label, phase II clinical trial (SAEFRIF).
Trials, , Feb-13, Volume: 21, Issue:1, 2020

Twice-Daily vs. Once-Daily Dolutegravir in Patients With Human Immunodeficiency Virus-Tuberculosis Coinfection Receiving Rifampicin-Based Tuberculosis Therapy.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 06-24, Volume: 71, Issue:1, 2020

Once-weekly rifapentine and isoniazid for tuberculosis prevention in patients with HIV taking dolutegravir-based antiretroviral therapy: a phase 1/2 trial.
The lancet. HIV, , Volume: 7, Issue:6, 2020

Dolutegravir-based Antiretroviral Therapy for Patients Coinfected With Tuberculosis and Human Immunodeficiency Virus: A Multicenter, Noncomparative, Open-label, Randomized Trial.
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-03, Volume: 70, Issue:4, 2020

Prevention of tuberculosis in HIV infection with novel drugs.
The lancet. HIV, , Volume: 7, Issue:6, 2020

Failure of Dolutegravir First-Line ART with Selection of Virus Carrying R263K and G118R.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Clinical and Virological Outcomes of TB/HIV Coinfected Patients Treated With Dolutegravir-Based HIV Antiretroviral Regimens: Programmatic Experience From Botswana.
Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 82, Issue:2, 2019

Dolutegravir use in combination with rifampicin-based tuberculosis therapy: 3 years of real-world experience in a large UK teaching hospital.
Sexually transmitted infections, , Volume: 94, Issue:6, 2018

Dolutegravir for first-line antiretroviral therapy in low-income and middle-income countries: uncertainties and opportunities for implementation and research.
The lancet. HIV, , Volume: 5, Issue:7, 2018

Effect of Rifabutin in Dolutegravir Dosing: A Case Series.
Journal of the International Association of Providers of AIDS Care, , Volume: 21

Viral suppression among adults with HIV receiving routine dolutegravir-based antiretroviral therapy and 3 months weekly isoniazid-rifapentine.
AIDS (London, England), , 06-01, Volume: 37, Issue:7, 2023

Real world use of dolutegravir two drug regimens.
AIDS (London, England), , 04-01, Volume: 37, Issue:5, 2023

Diagnostic accuracy of a point-of-care urine tenofovir assay, and associations with HIV viraemia and drug resistance among people receiving dolutegravir and efavirenz-based antiretroviral therapy.
Journal of the International AIDS Society, , Volume: 26, Issue:9, 2023

Point-of-Care Viral Load Testing to Manage HIV Viremia During the Rollout of Dolutegravir-Based ART in South Africa: A Randomized Feasibility Study (POwER).
Journal of acquired immune deficiency syndromes (1999), , 08-15, Volume: 93, Issue:5, 2023

Recycling Tenofovir in Second-line Antiretroviral Treatment With Dolutegravir: Outcomes and Viral Load Trajectories to 72 weeks.
Journal of acquired immune deficiency syndromes (1999), , 04-15, Volume: 92, Issue:5, 2023

Integrase resistance emergence with dolutegravir/lamivudine with prior HIV-1 suppression.
The Journal of antimicrobial chemotherapy, , 05-29, Volume: 77, Issue:6, 2022

Low-level viraemia and virologic failure among people living with HIV who received maintenance therapy with co-formulated bictegravir, emtricitabine and tenofovir alafenamide versus dolutegravir-based regimens.
International journal of antimicrobial agents, , Volume: 60, Issue:3, 2022

Incidence and impact of low-level viremia among people living with HIV who received protease inhibitor- or dolutegravir-based antiretroviral therapy.
International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 105, 2021

Switching From a Protease Inhibitor-based Regimen to a Dolutegravir-based Regimen: A Randomized Clinical Trial to Determine the Effect on Peripheral Blood and Ileum Biopsies From Antiretroviral Therapy-suppressed Human Immunodeficiency Virus-infected Indi
Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 09-27, Volume: 69, Issue:8, 2019

Dolutegravir for first-line antiretroviral therapy in low-income and middle-income countries: uncertainties and opportunities for implementation and research.
The lancet. HIV, , Volume: 5, Issue:7, 2018

Monotherapy with either dolutegravir or raltegravir fails to durably suppress HIV viraemia in humanized mice.
The Journal of antimicrobial chemotherapy, , 09-01, Volume: 72, Issue:9, 2017

Drug resistance mutations in HIV-2 patients failing raltegravir and influence on dolutegravir response.
The Journal of antimicrobial chemotherapy, , 07-01, Volume: 72, Issue:7, 2017

Dolutegravir for the treatment of HIV-2 infection.
Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology, , Volume: 64, 2015

Lamivudine-based two-drug regimens with dolutegravir or protease inhibitor: Virological suppression in spite of previous therapy failure or renal dysfunction.
The Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases, , Volume: 27, Issue:3

[no title available]
Pharmacogenomics, , Volume: 22, Issue:15, 2021

Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex.
International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 116, 2022

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

HIV-associated neurocognitive disorder and HIV-associated myelopathy in a patient with a preserved CD4, but high viral load-a rarely reported phenomenon: a case report and literature review.
BMC infectious diseases, , Aug-05, Volume: 20, Issue:1, 2020

Interactions between integrase inhibitors and human arginase 1.
Journal of neurochemistry, , Volume: 142, Issue:1, 2017

Effect of dihydroartemisinin/piperaquine for malaria intermittent preventive treatment on dolutegravir exposure in pregnant women living with HIV.
The Journal of antimicrobial chemotherapy, , 05-29, Volume: 77, Issue:6, 2022

Recurrent ocular syphilis in a patient living with HIV.
International journal of STD & AIDS, , Volume: 31, Issue:11, 2020

Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects.
Drug and alcohol dependence, , Dec-01, Volume: 133, Issue:2, 2013

Short Communication: Comparative Evaluation of Coformulated Injectable Combination Antiretroviral Therapy Regimens in Simian Immunodeficiency Virus-Infected Rhesus Macaques.
AIDS research and human retroviruses, , Volume: 32, Issue:2, 2016

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Erratic enteric absorption of dolutegravir in a critically ill patient.
Revista espanola de quimioterapia : publicacion oficial de la Sociedad Espanola de Quimioterapia, , Volume: 35, Issue:4, 2022

Enteral Administration of Twice-Daily Dolutegravir and Rilpivirine as a Part of a Triple-Therapy Regimen in a Critically Ill Patient with HIV.
Journal of the International Association of Providers of AIDS Care, , Volume: 16, Issue:2

Gestational diabetes in women living with HIV in Botswana: lower rates with dolutegravir- than with efavirenz-based antiretroviral therapy.
HIV medicine, , Volume: 22, Issue:8, 2021

Dolutegravir pharmacokinetics during co-administration with either artemether/lumefantrine or artesunate/amodiaquine.
The Journal of antimicrobial chemotherapy, , 04-13, Volume: 76, Issue:5, 2021

Extensive brain masses and cavitary lung lesions associated with toxoplasmosis and acquired immunodeficiency syndrome.
International journal of STD & AIDS, , Volume: 28, Issue:11, 2017

Recurrent ocular syphilis in a patient living with HIV.
International journal of STD & AIDS, , Volume: 31, Issue:11, 2020

Successful treatment of an AIDS patient with prolonged Mycobacterium avium bacteremia, high HIV RNA, HBV infection, Kaposi's sarcoma and cytomegalovirus retinitis.
Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 26, Issue:2, 2020

Failure of Dolutegravir First-Line ART with Selection of Virus Carrying R263K and G118R.
The New England journal of medicine, , 08-29, Volume: 381, Issue:9, 2019

Progressive disseminated histoplasmosis with concomitant disseminated nontuberculous mycobacterial infection in a patient with AIDS from a nonendemic region (California).
BMC pulmonary medicine, , Feb-21, Volume: 19, Issue:1, 2019

Extensive brain masses and cavitary lung lesions associated with toxoplasmosis and acquired immunodeficiency syndrome.
International journal of STD & AIDS, , Volume: 28, Issue:11, 2017

HIV: new drugs, new guidelines.
Current opinion in infectious diseases, , Volume: 27, Issue:6, 2014

Comparative Clinical Pharmacokinetics and Pharmacodynamics of HIV-1 Integrase Strand Transfer Inhibitors.
Clinical pharmacokinetics, , Volume: 56, Issue:1, 2017

Dolutegravir-induced liver injury leading to sub-acute liver failure requiring transplantation: a case report and review of literature.
International journal of STD & AIDS, , Volume: 29, Issue:4, 2018

dolutegravir

Description

Cross-References

Synonyms (77)

Roles (1)

Drug Classes (4)

Protein Targets (28)

Potency Measurements

Inhibition Measurements

Activation Measurements

Other Measurements

Bioassays (235)

Research

Studies (1,108)

Study Types

Safety/Toxicity (90)

Long-term Use (3)

Pharmacokinetics (69)

Bioavailability (14)

Dosage (98)

Interactions (26)

Article	Year
Efficacy and safety profiles of dolutegravir plus lamivudine vs . bictegravir/emtricitabine/tenofovir alafenamide in therapy-naïve adults with HIV-1. Chinese medical journal, , Nov-20, Volume: 136, Issue:22	2023
Effectiveness, durability and safety of dolutegravir and lamivudine versus bictegravir, emtricitabine and tenofovir alafenamide in a real-world cohort of HIV-infected adults. PloS one, , Volume: 18, Issue:9	2023
Metabolic implications and safety of dolutegravir use in pregnancy. The lancet. HIV, , Volume: 10, Issue:9	2023
Safety and Efficacy of Triple Therapy With Dolutegravir Plus 2 Nucleoside Reverse Transcriptase Inhibitors in Treatment-Naive Human Immunodeficiency Virus Type 2 Patients: Results From a 48-Week Phase 2 Study. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 09-11, Volume: 77, Issue:5	2023
Efficacy and safety of pan-genotypic sofosbuvir and velpatasvir in patients with hepatitis C and HIV coinfection on dolutegravir-based antiretroviral therapy. Journal of viral hepatitis, , Volume: 30, Issue:9	2023
Efficacy and Safety of Two-Drug Regimens with Dolutegravir plus Rilpivirine or Lamivudine in HIV-1 Virologically Suppressed People Living with HIV. Viruses, , 04-10, Volume: 15, Issue:4	2023
Efficacy and safety of dolutegravir/rilpivirine in real-world clinical practice. GeSIDA study 1119. HIV medicine, , Volume: 24, Issue:8	2023
An indirect comparison of 144-week efficacy, safety, and tolerability of dolutegravir plus lamivudine and second-generation integrase inhibitor-based, 3-drug, single-tablet regimens in therapy-naive people with HIV-1. AIDS research and therapy, , 03-22, Volume: 20, Issue:1	2023
Safety and Effectiveness Analyses of Dolutegravir/Lamivudine in Patients with HIV: 2-Year Report of Post-Marketing Surveillance in Japan. Advances in therapy, , Volume: 40, Issue:4	2023
Real-World Effectiveness, Tolerability, and Safety of Dolutegravir/Lamivudine in Korea. Viruses, , 11-18, Volume: 14, Issue:11	2022
Effectiveness and safety of dolutegravir and raltegravir for treating children and adolescents living with HIV: a systematic review. Journal of the International AIDS Society, , Volume: 25, Issue:11	2022
Prevalence of neuropsychiatric adverse events and associated factors among adult patients on dolutegravir attending Mulago ISS clinic. HIV medicine, , Volume: 24, Issue:4	2023
Real-world efficacy and safety of dolutegravir plus lamivudine versus tenofovir plus lamivudine and efavirenz in ART-naïve HIV-1-infected adults. Medicine, , Oct-21, Volume: 101, Issue:42	2022
Efficacy and Safety of a Simplified Lamivudine Plus Dolutegravir Dual Therapy in HIV-1-Infected Patients: A Multicenter Cohort Study in China. Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1	2022
Effectiveness and Safety of Dolutegravir Versus Efavirenz-Based Antiviral Regimen in People Living With HIV-1 in Sichuan Province of China: A Real-World Study. Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 91, Issue:S1	2022
Pharmacokinetic and pharmacogenetic associations with dolutegravir neuropsychiatric adverse events in an African population. The Journal of antimicrobial chemotherapy, , 10-28, Volume: 77, Issue:11	2022
Brief Report: Efficacy and Safety of Efavirenz, Raltegravir, and Dolutegravir in HIV-1/TB Coinfection. A Multicenter Retrospective Cohort Study in France. Journal of acquired immune deficiency syndromes (1999), , 09-01, Volume: 91, Issue:1	2022
Active Pharmacovigilance Project on the safety profile of Dolutegravir in Brazil. AIDS care, , Volume: 35, Issue:5	2023
Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. The lancet. HIV, , Volume: 9, Issue:5	2022
Efficacy and safety of dolutegravir or darunavir in combination with lamivudine plus either zidovudine or tenofovir for second-line treatment of HIV infection (NADIA): week 96 results from a prospective, multicentre, open-label, factorial, randomised, non The lancet. HIV, , Volume: 9, Issue:6	2022
Efficacy and Safety of Switching to the 2-Drug Regimen Dolutegravir/Lamivudine Versus Continuing a 3- or 4-Drug Regimen for Maintaining Virologic Suppression in Adults Living With Human Immunodeficiency Virus 1 (HIV-1): Week 48 Results From the Phase 3, N Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 02-18, Volume: 76, Issue:4	2023
Efficacy and Safety of Switching to Dolutegravir/Lamivudine Versus Continuing a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen for Maintenance of Virologic Suppression in Adults Living With Human Immunodeficiency Virus Type 1: Results Through Week 144 F Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 09-29, Volume: 75, Issue:6	2022
Dolutegravir Impairs Stem Cell-Based 3D Morphogenesis Models in a Manner Dependent on Dose and Timing of Exposure: An Implication for Its Developmental Toxicity. Toxicological sciences : an official journal of the Society of Toxicology, , 11-24, Volume: 184, Issue:2	2021
Protocol for active safety monitoring of a cohort of patients using a dolutegravir-based antiretroviral regimen in Mozambique. BMJ open, , 09-07, Volume: 11, Issue:9	2021
Efficacy and safety of switching to dolutegravir plus lamivudine versus continuing triple antiretroviral therapy in virologically suppressed adults with HIV at 48 weeks (DOLAM): a randomised non-inferiority trial. The lancet. HIV, , Volume: 8, Issue:8	2021
Effectiveness, Durability, and Safety of Dolutegravir and Lamivudine Versus Dolutegravir, Lamivudine, and Abacavir in a Real-Life Cohort of HIV-Infected Adults. The Annals of pharmacotherapy, , Volume: 56, Issue:4	2022
Safety and Effectiveness Analysis of Dolutegravir in Patients with HIV-1: Interim Report of Post-Marketing Surveillance in Japan. Advances in therapy, , Volume: 38, Issue:8	2021
Efficacy and Safety of Triple versus Dolutegravir-based Dual Therapy in Patients with HIV-1 Infection: A Meta-analysis of Randomized Controlled Trials. AIDS reviews, , 06-03, Volume: 23, Issue:3	2021
Efficacy and safety of dolutegravir with emtricitabine and tenofovir alafenamide fumarate or tenofovir disoproxil fumarate, and efavirenz, emtricitabine, and tenofovir disoproxil fumarate HIV antiretroviral therapy regimens started in pregnancy (IMPAACT 2 Lancet (London, England), , 04-03, Volume: 397, Issue:10281	2021
ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg BMC infectious diseases, , Jan-04, Volume: 21, Issue:1	2021
Longitudinal trends and determinants of patient-reported side effects on ART-a Swedish national registry study. PloS one, , Volume: 15, Issue:12	2020
Efficacy and safety of dolutegravir plus emtricitabine versus standard ART for the maintenance of HIV-1 suppression: 48-week results of the factorial, randomized, non-inferiority SIMPL'HIV trial. PLoS medicine, , Volume: 17, Issue:11	2020
Discontinuation due to neuropsychiatric adverse events with efavirenz- and dolutegravir-based antiretroviral therapy: a comparative real-life study. European journal of hospital pharmacy : science and practice, , Volume: 29, Issue:4	2022
Nothing is perfect: the safety issues of integrase inhibitor regimens. Expert opinion on drug safety, , Volume: 19, Issue:6	2020
Neuropsychiatric adverse effects of dolutegravir in real-life clinical practice. Enfermedades infecciosas y microbiologia clinica (English ed.), , Volume: 39, Issue:2	2021
Pharmacokinetics, SAfety/tolerability, and EFficacy of high-dose RIFampicin in tuberculosis-HIV co-infected patients on efavirenz- or dolutegravir-based antiretroviral therapy: study protocol for an open-label, phase II clinical trial (SAEFRIF). Trials, , Feb-13, Volume: 21, Issue:1	2020
Efficacy and Safety of Switching to Dolutegravir/Lamivudine Fixed-Dose 2-Drug Regimen vs Continuing a Tenofovir Alafenamide-Based 3- or 4-Drug Regimen for Maintenance of Virologic Suppression in Adults Living With Human Immunodeficiency Virus Type 1: Phas Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 11-05, Volume: 71, Issue:8	2020
Absence of developmental and reproductive toxicity in animals exposed to dolutegravir. Birth defects research, , 02-01, Volume: 112, Issue:3	2020
Analysis of Pharmacovigilance Databases for Dolutegravir Safety in Pregnancy. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 06-10, Volume: 70, Issue:12	2020
Safety and pharmacokinetics of dolutegravir in pregnant mothers with HIV infection and their neonates: A randomised trial (DolPHIN-1 study). PLoS medicine, , Volume: 16, Issue:9	2019
Two-drug regimens with dolutegravir plus rilpivirine or lamivudine in HIV-1 treatment-naïve, virologically-suppressed patients: Latest evidence from the literature on their efficacy and safety. Journal of global antimicrobial resistance, , Volume: 20	2020
DOLAMA study: Effectiveness, safety and pharmacoeconomic analysis of dual therapy with dolutegravir and lamivudine in virologically suppressed HIV-1 patients. Medicine, , Volume: 98, Issue:32	2019
Safety and efficacy of elvitegravir, dolutegravir, and raltegravir in a real-world cohort of treatment-naïve and -experienced patients. Medicine, , Volume: 98, Issue:32	2019
Dual therapy with renally adjusted lamivudine and dolutegravir: a switch strategy to manage comorbidity and toxicity in older, suppressed patients? HIV medicine, , Volume: 20, Issue:9	2019
Efficacy and safety of dolutegravir-rilpivirine for maintenance of virological suppression in adults with HIV-1: 100-week data from the randomised, open-label, phase 3 SWORD-1 and SWORD-2 studies. The lancet. HIV, , Volume: 6, Issue:9	2019
Optimizing responses to drug safety signals in pregnancy: the example of dolutegravir and neural tube defects. Journal of the International AIDS Society, , Volume: 22, Issue:7	2019
Efficacy and safety of dolutegravir-based regimens in advanced HIV-infected naïve patients: results from a multicenter cohort study. Antiviral research, , Volume: 169	2019
The antagonism of folate receptor by dolutegravir: developmental toxicity reduction by supplemental folic acid. AIDS (London, England), , 11-01, Volume: 33, Issue:13	2019
Comparative efficacy and safety and dolutegravir and lamivudine in treatment naive HIV patients. AIDS (London, England), , 09-01, Volume: 33, Issue:11	2019
Efficacy and safety of dolutegravir plus boosted-darunavir dual therapy among highly treatment-experienced patients. Antiviral therapy, , Volume: 24, Issue:6	2019
Increasing levels of pretreatment HIV drug resistance and safety concerns for dolutegravir use in women of reproductive age. AIDS (London, England), , 09-01, Volume: 33, Issue:11	2019
Similar efficacy and safety of dolutegravir between age groups of HIV-1-infected paediatric and young adult patients aged 5 years and older. HIV medicine, , Volume: 20, Issue:8	2019
Safety and efficacy of dolutegravir in hemodialysis. International journal of STD & AIDS, , Volume: 30, Issue:6	2019
Is There a Safety Signal for Dolutegravir and Integrase Inhibitors During Pregnancy? Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 81, Issue:4	2019
Long-Term Safety and Efficacy of Dolutegravir in Treatment-Experienced Adolescents With Human Immunodeficiency Virus Infection: Results of the IMPAACT P1093 Study. Journal of the Pediatric Infectious Diseases Society, , Apr-30, Volume: 9, Issue:2	2020
Neuropsychiatric Adverse Events with Dolutegravir and Other Integrase Strand Transfer Inhibitors AIDS reviews, , Volume: 21, Issue:1	2019
Discontinuation of dolutegravir, elvitegravir/cobicistat and raltegravir because of toxicity in a prospective cohort. HIV medicine, , Volume: 20, Issue:3	2019
Integrase strand transfer inhibitors and neuropsychiatric adverse events in a large prospective cohort. The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3	2019
Tryptophan metabolism and its relationship with central nervous system toxicity in people living with HIV switching from efavirenz to dolutegravir. Journal of neurovirology, , Volume: 25, Issue:1	2019
Efficacy and safety of switching to dolutegravir plus emtricitabine/tenofovir disoproxil fumarate (TDF) or elvitegravir/cobicistat/emtricitabine/TDF in virologically suppressed HIV-infected patients in clinical practice: results from a multicentre, observ HIV medicine, , Volume: 20, Issue:2	2019
Efficacy and safety of the switch of Triumeq® to generic (abacavir + lamivudine) + Tivicay®: data at 24 weeks. BMC pharmacology & toxicology, , Oct-10, Volume: 19, Issue:1	2018
Safety, Tolerability, and Efficacy of Generic Dolutegravir-containing Antiretroviral Therapy Regimens Among South Indian Human Immunodeficiency Virus-infected Patients. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 03-05, Volume: 68, Issue:6	2019
Comparative safety of dolutegravir-based or efavirenz-based antiretroviral treatment started during pregnancy in Botswana: an observational study. The Lancet. Global health, , Volume: 6, Issue:7	2018
Dolutegravir Neuropsychiatric Adverse Events: Specific Drug Effect or Class Effect. AIDS reviews, , Volume: 20, Issue:1
Dolutegravir-based anti-retroviral therapy is effective and safe in HIV-infected paediatric patients. Italian journal of pediatrics, , Mar-20, Volume: 44, Issue:1	2018
Safety and Efficacy of Dolutegravir Plus Rilpivirine in Treatment-Experienced HIV-Infected Patients: The DORIVIR Study. Journal of the International Association of Providers of AIDS Care, , Volume: 17
Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring. Current drug safety, , Volume: 13, Issue:1	2018
Efficacy, safety, and tolerability of dolutegravir-rilpivirine for the maintenance of virological suppression in adults with HIV-1: phase 3, randomised, non-inferiority SWORD-1 and SWORD-2 studies. Lancet (London, England), , 03-03, Volume: 391, Issue:10123	2018
Risks of cardiovascular or central nervous system adverse events and immune reconstitution inflammatory syndrome, for dolutegravir versus other antiretrovirals: meta-analysis of randomized trials. Current opinion in HIV and AIDS, , Volume: 13, Issue:2	2018
Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1. BMC infectious diseases, , 09-16, Volume: 17, Issue:1	2017
Effectiveness, Safety, and Costs of a Treatment Switch to Dolutegravir Plus Rilpivirine Dual Therapy in Treatment-Experienced HIV Patients. The Annals of pharmacotherapy, , Volume: 52, Issue:1	2018
Adverse events of raltegravir and dolutegravir. AIDS (London, England), , 08-24, Volume: 31, Issue:13	2017
Clinical Experience with the Integrase Inhibitors Dolutegravir and Elvitegravir in HIV-infected Patients: Efficacy, Safety and Tolerance. Basic & clinical pharmacology & toxicology, , Volume: 121, Issue:5	2017
Higher rates of neuropsychiatric adverse events leading to dolutegravir discontinuation in women and older patients. HIV medicine, , Volume: 18, Issue:1	2017
Clinical experience with dolutegravir/abacavir/lamivudine in HIV-HCV co-infected patients treated with a sofosbuvir-based regimen-safety and efficacy. HIV clinical trials, , Volume: 17, Issue:6	2016
Comparative efficacy and safety of first-line antiretroviral therapy for the treatment of HIV infection: a systematic review and network meta-analysis. The lancet. HIV, , Volume: 3, Issue:11	2016
An Indirect Comparison of Efficacy and Safety of Elvitegravir/Cobicistat/Emtricitabine/Tenofovir Disoproxil Fumarate and Abacavir/Lamivudine + Dolutegravir in Initial Therapy. PloS one, , Volume: 11, Issue:5	2016
Safety, Pharmacokinetics and Efficacy of Dolutegravir in Treatment-experienced HIV-1 Infected Adolescents: Forty-eight-week Results from IMPAACT P1093. The Pediatric infectious disease journal, , Volume: 34, Issue:11	2015
A two-week regimen of high-dose integrase inhibitors does not cause nephrotoxicity in mice. Antiviral chemistry & chemotherapy, , Volume: 24, Issue:2	2015
Dolutegravir - a review of the pharmacology, efficacy, and safety in the treatment of HIV. Drug design, development and therapy, , Volume: 9	2015
[Safety profile of dolutegravir]. Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1	2015
Dolutegravir: clinical and laboratory safety in integrase inhibitor-naive patients. HIV clinical trials, , Volume: 15, Issue:5
Evaluation of dolutegravir safety for the treatment of HIV-1. Expert opinion on drug safety, , Volume: 14, Issue:1	2015
48-week efficacy and safety of dolutegravir relative to commonly used third agents in treatment-naive HIV-1-infected patients: a systematic review and network meta-analysis. PloS one, , Volume: 9, Issue:9	2014
[Pharmacokinetics and safety of dolutegravir in healthy Japanese subjects]. The Japanese journal of antibiotics, , Volume: 66, Issue:1	2013
Hepatoxicity of new antiretrovirals: a systematic review. Clinics and research in hepatology and gastroenterology, , Volume: 37, Issue:2	2013
Safety and efficacy of dolutegravir in treatment-experienced subjects with raltegravir-resistant HIV type 1 infection: 24-week results of the VIKING Study. The Journal of infectious diseases, , Mar-01, Volume: 207, Issue:5	2013
Assessing a theoretical risk of dolutegravir-induced developmental immunotoxicity in juvenile rats. Toxicological sciences : an official journal of the Society of Toxicology, , Volume: 130, Issue:1	2012
Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. AIDS (London, England), , Sep-10, Volume: 25, Issue:14	2011
Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers. Antimicrobial agents and chemotherapy, , Volume: 54, Issue:1	2010

Article	Year
Dolutegravir 50 mg thrice weekly plus atazanavir 400 mg daily in a long-term virologically suppressed HIV-infected patient. International journal of STD & AIDS, , Volume: 28, Issue:7	2017
Comparative changes of lipid levels in treatment-naive, HIV-1-infected adults treated with dolutegravir vs. efavirenz, raltegravir, and ritonavir-boosted darunavir-based regimens over 48 weeks. Clinical drug investigation, , Volume: 35, Issue:3	2015
Addition of E138K to R263K in HIV integrase increases resistance to dolutegravir, but fails to restore activity of the HIV integrase enzyme and viral replication capacity. The Journal of antimicrobial chemotherapy, , Volume: 69, Issue:10	2014

Article	Year
Effect of dolutegravir on folate, vitamin B12 and mean corpuscular volume levels among children and adolescents with HIV: a sub-study of the ODYSSEY randomized controlled trial. Journal of the International AIDS Society, , Volume: 26, Issue:9	2023
Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Clinical pharmacokinetics, , Volume: 62, Issue:10	2023
First Pharmacokinetic Data of Tenofovir Alafenamide Fumarate and Tenofovir With Dolutegravir or Boosted Protease Inhibitors in African Children: A Substudy of the CHAPAS-4 Trial. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 09-18, Volume: 77, Issue:6	2023
Pharmacokinetic Data of Dolutegravir in Second-line Treatment of Children With Human Immunodeficiency Virus: Results From the CHAPAS4 Trial. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 11-11, Volume: 77, Issue:9	2023
Pharmacokinetics and pharmacodynamics of adult dolutegravir tablets in treatment-experienced children with HIV weighing at least 20 kg. AIDS (London, England), , 07-15, Volume: 37, Issue:9	2023
Population pharmacokinetics of unbound and total dolutegravir concentrations in children aged 12 years and older: a PK substudy of the SMILE trial. The Journal of antimicrobial chemotherapy, , 04-03, Volume: 78, Issue:4	2023
Pharmacokinetic and pharmacogenetic associations with dolutegravir neuropsychiatric adverse events in an African population. The Journal of antimicrobial chemotherapy, , 10-28, Volume: 77, Issue:11	2022
Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. The lancet. HIV, , Volume: 9, Issue:5	2022
Pharmacokinetics and tissue distribution of tenofovir, emtricitabine and dolutegravir in mice. The Journal of antimicrobial chemotherapy, , 03-31, Volume: 77, Issue:4	2022
Pharmacokinetic features of dolutegravir with rifampicin and rifabutin among patients coinfected with human immunodeficiency virus and tuberculosis/mycobacterium avium complex. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases, , Volume: 116	2022
Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Journal of acquired immune deficiency syndromes (1999), , 01-01, Volume: 89, Issue:1	2022
Pharmacokinetics and placental transfer of dolutegravir in pregnancy. The Journal of antimicrobial chemotherapy, , 02-02, Volume: 77, Issue:2	2022
Ultra-long acting prodrug of dolutegravir and delivery system - Physicochemical, pharmacokinetic and formulation characterizations. International journal of pharmaceutics, , Sep-25, Volume: 607	2021
Point-of-Care Detection of Nonadherence to Antiretroviral Treatment for HIV-1 in Resource-Limited Settings Using Drug Level Testing for Efavirenz, Lopinavir, and Dolutegravir: A Validation and Pharmacokinetic Simulation Study. Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 87, Issue:4	2021
Pharmacokinetic parameters and weight change in HIV patients newly switched to dolutegravir-based regimens in SIMPL'HIV clinical trial. British journal of clinical pharmacology, , Volume: 87, Issue:11	2021
Dolutegravir pharmacokinetics during co-administration with either artemether/lumefantrine or artesunate/amodiaquine. The Journal of antimicrobial chemotherapy, , 04-13, Volume: 76, Issue:5	2021
Phase I evaluation of pharmacokinetics and tolerability of the HIV-1 maturation inhibitor GSK3640254 and dolutegravir in healthy adults. British journal of clinical pharmacology, , Volume: 87, Issue:9	2021
Physiologically Based Pharmacokinetic Modeling Framework to Predict Neonatal Pharmacokinetics of Transplacentally Acquired Emtricitabine, Dolutegravir, and Raltegravir. Clinical pharmacokinetics, , Volume: 60, Issue:6	2021
ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg BMC infectious diseases, , Jan-04, Volume: 21, Issue:1	2021
Infant Exposure to Dolutegravir Through Placental and Breast Milk Transfer: A Population Pharmacokinetic Analysis of DolPHIN-1. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 09-07, Volume: 73, Issue:5	2021
Prediction of Maternal and Fetal Pharmacokinetics of Dolutegravir and Raltegravir Using Physiologically Based Pharmacokinetic Modeling. Clinical pharmacokinetics, , Volume: 59, Issue:11	2020
The effect of veno-arterial extracorporeal oxygenation and nasogastric tube administration on the pharmacokinetic profile of abacavir, lamivudine and dolutegravir: a case report. Antiviral therapy, , Volume: 25, Issue:2	2020
ABCG2 Deficiency Does Not Alter Dolutegravir Metabolism and Pharmacokinetics. The Journal of pharmacology and experimental therapeutics, , Volume: 374, Issue:1	2020
The Effect of Pregnancy on the Pharmacokinetics of Total and Unbound Dolutegravir and Its Main Metabolite in Women Living With Human Immunodeficiency Virus. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-23, Volume: 72, Issue:1	2021
Pharmacokinetics, SAfety/tolerability, and EFficacy of high-dose RIFampicin in tuberculosis-HIV co-infected patients on efavirenz- or dolutegravir-based antiretroviral therapy: study protocol for an open-label, phase II clinical trial (SAEFRIF). Trials, , Feb-13, Volume: 21, Issue:1	2020
Genetic influence of ABCG2, UGT1A1 and NR1I2 on dolutegravir plasma pharmacokinetics. The Journal of antimicrobial chemotherapy, , 05-01, Volume: 75, Issue:5	2020
Assessment of Maternal and Fetal Dolutegravir Exposure by Integrating Ex Vivo Placental Perfusion Data and Physiologically-Based Pharmacokinetic Modeling. Clinical pharmacology and therapeutics, , Volume: 107, Issue:6	2020
Prediction of dolutegravir pharmacokinetics and dose optimization in neonates via physiologically based pharmacokinetic (PBPK) modelling. The Journal of antimicrobial chemotherapy, , 03-01, Volume: 75, Issue:3	2020
Safety and pharmacokinetics of dolutegravir in pregnant mothers with HIV infection and their neonates: A randomised trial (DolPHIN-1 study). PLoS medicine, , Volume: 16, Issue:9	2019
Pharmacokinetic profiles of boosted darunavir, dolutegravir and lamivudine in aging people living with HIV. AIDS (London, England), , 01-01, Volume: 34, Issue:1	2020
Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. The Journal of antimicrobial chemotherapy, , 09-01, Volume: 74, Issue:9	2019
Dolutegravir Population Pharmacokinetics in a Real-Life Cohort of People Living With HIV Infection: A Covariate Analysis. Therapeutic drug monitoring, , Volume: 41, Issue:4	2019
Pharmacokinetics of dolutegravir with and without darunavir/cobicistat in healthy volunteers. The Journal of antimicrobial chemotherapy, , 01-01, Volume: 74, Issue:1	2019
Pharmacokinetics of HIV-Integrase Inhibitors During Pregnancy: Mechanisms, Clinical Implications and Knowledge Gaps. Clinical pharmacokinetics, , Volume: 58, Issue:3	2019
Increased Dolutegravir Peak Concentrations in People Living With Human Immunodeficiency Virus Aged 60 and Over, and Analysis of Sleep Quality and Cognition. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 01-01, Volume: 68, Issue:1	2019
Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV. AIDS (London, England), , 03-27, Volume: 32, Issue:6	2018
Clinical benefits of using inulin clearance and cystatin C for determining glomerular filtration rate in HIV-1-infected individuals treated with dolutegravir. Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 24, Issue:3	2018
Pregnancy-related changes of antiretroviral pharmacokinetics: an argument for therapeutic drug monitoring. Antiviral therapy, , Volume: 22, Issue:4	2017
How recent findings on the pharmacokinetics and pharmacodynamics of integrase inhibitors can inform clinical use. Current opinion in infectious diseases, , Volume: 30, Issue:1	2017
A Two-Way Steady-State Pharmacokinetic Interaction Study of Doravirine (MK-1439) and Dolutegravir. Clinical pharmacokinetics, , Volume: 56, Issue:6	2017
Simultaneous quantification of tenofovir, emtricitabine, rilpivirine, elvitegravir and dolutegravir in mouse biological matrices by LC-MS/MS and its application to a pharmacokinetic study. Journal of pharmaceutical and biomedical analysis, , Sep-10, Volume: 129	2016
No clinically significant pharmacokinetic interactions between dolutegravir and daclatasvir in healthy adult subjects. BMC infectious diseases, , 07-22, Volume: 16	2016
The Effect of Dolutegravir on the Pharmacokinetics of Metformin in Healthy Subjects. Journal of acquired immune deficiency syndromes (1999), , 08-01, Volume: 72, Issue:4	2016
Effect of carbamazepine on dolutegravir pharmacokinetics and dosing recommendation. European journal of clinical pharmacology, , Volume: 72, Issue:6	2016
Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. The Journal of antimicrobial chemotherapy, , Volume: 70, Issue:12	2015
Safety, Pharmacokinetics and Efficacy of Dolutegravir in Treatment-experienced HIV-1 Infected Adolescents: Forty-eight-week Results from IMPAACT P1093. The Pediatric infectious disease journal, , Volume: 34, Issue:11	2015
[The in vitro HAART pharmacodynamics study with dolutegravir as the "anchor"]. Yao xue xue bao = Acta pharmaceutica Sinica, , Volume: 50, Issue:1	2015
Dolutegravir Has No Effect on the Pharmacokinetics of Oral Contraceptives With Norgestimate and Ethinyl Estradiol. The Annals of pharmacotherapy, , Volume: 49, Issue:7	2015
Pharmacokinetics of dolutegravir in a premature neonate after HIV treatment intensification during pregnancy. Antimicrobial agents and chemotherapy, , Volume: 59, Issue:6	2015
Population pharmacokinetics of dolutegravir in HIV-infected treatment-naive patients. British journal of clinical pharmacology, , Volume: 80, Issue:3	2015
Pharmacokinetic profile of raltegravir, elvitegravir and dolutegravir in plasma and mucosal secretions in rhesus macaques. The Journal of antimicrobial chemotherapy, , Volume: 70, Issue:5	2015
Pharmacokinetics of dolutegravir when administered with mineral supplements in healthy adult subjects. Journal of clinical pharmacology, , Volume: 55, Issue:5	2015
Effect of fosamprenavir-ritonavir on the pharmacokinetics of dolutegravir in healthy subjects. Antimicrobial agents and chemotherapy, , Volume: 58, Issue:11	2014
Effects of enzyme inducers efavirenz and tipranavir/ritonavir on the pharmacokinetics of the HIV integrase inhibitor dolutegravir. European journal of clinical pharmacology, , Volume: 70, Issue:10	2014
Effects of boceprevir and telaprevir on the pharmacokinetics of dolutegravir. British journal of clinical pharmacology, , Volume: 78, Issue:5	2014
Evaluation of the effect of UGT1A1 polymorphisms on dolutegravir pharmacokinetics. Pharmacogenomics, , Volume: 15, Issue:1	2014
Pharmacokinetics of dolutegravir in HIV-seronegative subjects with severe renal impairment. European journal of clinical pharmacology, , Volume: 70, Issue:1	2014
Dolutegravir does not affect methadone pharmacokinetics in opioid-dependent, HIV-seronegative subjects. Drug and alcohol dependence, , Dec-01, Volume: 133, Issue:2	2013
Lack of pharmacokinetic interaction between rilpivirine and integrase inhibitors dolutegravir and GSK1265744. Antimicrobial agents and chemotherapy, , Volume: 57, Issue:11	2013
Dolutegravir pharmacokinetics in the genital tract and colorectum of HIV-negative men after single and multiple dosing. Journal of acquired immune deficiency syndromes (1999), , Sep-01, Volume: 64, Issue:1	2013
Single and multiple dose pharmacokinetics of dolutegravir in the genital tract of HIV-negative women. Antiviral therapy, , Volume: 18, Issue:8	2013
Clinical pharmacokinetic, pharmacodynamic and drug-interaction profile of the integrase inhibitor dolutegravir. Clinical pharmacokinetics, , Volume: 52, Issue:11	2013
Effect of prednisone on the pharmacokinetics of the integrase inhibitor dolutegravir. Antimicrobial agents and chemotherapy, , Volume: 57, Issue:9	2013
[Pharmacokinetics and safety of dolutegravir in healthy Japanese subjects]. The Japanese journal of antibiotics, , Volume: 66, Issue:1	2013
Safety, tolerability, and pharmacokinetics of the HIV integrase inhibitor dolutegravir given twice daily with rifampin or once daily with rifabutin: results of a phase 1 study among healthy subjects. Journal of acquired immune deficiency syndromes (1999), , Jan-01, Volume: 62, Issue:1	2013
A phase 1 study to evaluate the effect of dolutegravir on renal function via measurement of iohexol and para-aminohippurate clearance in healthy subjects. British journal of clinical pharmacology, , Volume: 75, Issue:4	2013
Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. AIDS (London, England), , Sep-10, Volume: 25, Issue:14	2011
Effect of atazanavir and atazanavir/ritonavir on the pharmacokinetics of the next-generation HIV integrase inhibitor, S/GSK1349572. British journal of clinical pharmacology, , Volume: 72, Issue:1	2011
Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers. Antimicrobial agents and chemotherapy, , Volume: 54, Issue:1	2010

Article	Year
Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. The Pediatric infectious disease journal, , 03-01, Volume: 41, Issue:3	2022
Dolutegravir pharmacokinetics during co-administration with either artemether/lumefantrine or artesunate/amodiaquine. The Journal of antimicrobial chemotherapy, , 04-13, Volume: 76, Issue:5	2021
Raltegravir, Indinavir, Tipranavir, Dolutegravir, and Etravirine against main protease and RNA-dependent RNA polymerase of SARS-CoV-2: A molecular docking and drug repurposing approach. Journal of infection and public health, , Volume: 13, Issue:12	2020
Investigation of drug-polymer miscibility, biorelevant dissolution, and bioavailability improvement of Dolutegravir-polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer solid dispersions. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences, , Jan-15, Volume: 142	2020
A High-Throughput Screen of a Library of Therapeutics Identifies Cytotoxic Substrates of P-glycoprotein. Molecular pharmacology, , Volume: 96, Issue:5	2019
Low plasmatic concentration of intensified antiretroviral therapy in a pregnant woman: a case report. Journal of medical case reports, , Jul-23, Volume: 13, Issue:1	2019
Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. The Journal of antimicrobial chemotherapy, , 09-01, Volume: 74, Issue:9	2019
Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Journal of acquired immune deficiency syndromes (1999), , 12-15, Volume: 79, Issue:5	2018
Relative Bioavailability of a Dolutegravir Dispersible Tablet and the Effects of Low- and High-Mineral-Content Water on the Tablet in Healthy Adults. Clinical pharmacology in drug development, , Volume: 6, Issue:6	2017
Population pharmacokinetics of dolutegravir in HIV-infected treatment-naive patients. British journal of clinical pharmacology, , Volume: 80, Issue:3	2015
The comparative disposition and metabolism of dolutegravir, a potent HIV-1 integrase inhibitor, in mice, rats, and monkeys. Xenobiotica; the fate of foreign compounds in biological systems, , Volume: 45, Issue:1	2015
Relative bioavailability of a paediatric granule formulation of the HIV integrase inhibitor dolutegravir in healthy adult subjects. Antiviral therapy, , Volume: 19, Issue:3	2014
Pharmacology of HIV integrase inhibitors. Current opinion in HIV and AIDS, , Volume: 7, Issue:5	2012
Effect of food on the pharmacokinetics of the integrase inhibitor dolutegravir. Antimicrobial agents and chemotherapy, , Volume: 56, Issue:3	2012

Article	Year
Alternative dolutegravir dosing strategies with concurrent rifapentine utilized for latent tuberculosis treatment. International journal of STD & AIDS, , Volume: 34, Issue:14	2023
A novel formulation enabled transformation of 3-HIV drugs tenofovir-lamivudine-dolutegravir from short-acting to long-acting all-in-one injectable. AIDS (London, England), , 11-15, Volume: 37, Issue:14	2023
Population Pharmacokinetic Modeling of Dolutegravir to Optimize Pediatric Dosing in HIV-1-Infected Infants, Children, and Adolescents. Clinical pharmacokinetics, , Volume: 62, Issue:10	2023
First Pharmacokinetic Data of Tenofovir Alafenamide Fumarate and Tenofovir With Dolutegravir or Boosted Protease Inhibitors in African Children: A Substudy of the CHAPAS-4 Trial. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 09-18, Volume: 77, Issue:6	2023
Pharmacokinetic Data of Dolutegravir in Second-line Treatment of Children With Human Immunodeficiency Virus: Results From the CHAPAS4 Trial. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 11-11, Volume: 77, Issue:9	2023
Standard-dose versus double-dose dolutegravir in HIV-associated tuberculosis in South Africa (RADIANT-TB): a phase 2, non-comparative, randomised controlled trial. The lancet. HIV, , Volume: 10, Issue:7	2023
Initial Supplementary Dose of Dolutegravir in Second-Line Antiretroviral Therapy: A Noncomparative, Double-Blind, Randomized Placebo-Controlled Trial. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 05-24, Volume: 76, Issue:10	2023
Inflammation and intracellular exposure of dolutegravir, darunavir, tenofovir and emtricitabine in people living with HIV. British journal of clinical pharmacology, , Volume: 89, Issue:3	2023
Once-daily dolutegravir-based antiretroviral therapy in infants and children living with HIV from age 4 weeks: results from the below 14 kg cohort in the randomised ODYSSEY trial. The lancet. HIV, , Volume: 9, Issue:9	2022
Effect of Rifabutin in Dolutegravir Dosing: A Case Series. Journal of the International Association of Providers of AIDS Care, , Volume: 21
Real-world use and outcomes of dolutegravir-containing antiretroviral therapy in HIV and tuberculosis co-infection: a site survey and cohort study in sub-Saharan Africa. Journal of the International AIDS Society, , Volume: 25, Issue:7	2022
Transformation of dolutegravir into an ultra-long-acting parenteral prodrug formulation. Nature communications, , 06-09, Volume: 13, Issue:1	2022
Pharmacokinetics, safety, tolerability, and antiviral activity of dolutegravir dispersible tablets in infants and children with HIV-1 (IMPAACT P1093): results of an open-label, phase 1-2 trial. The lancet. HIV, , Volume: 9, Issue:5	2022
South African healthcare workers' knowledge of dolutegravir's drug-drug interactions in the first year of its rollout: a cross-sectional online survey. Journal of the International AIDS Society, , Volume: 25, Issue:3	2022
An eco- friendly, selective, and sensitive spectrofluorimetric method for the quantification of Dolutegravir in its bulk and tablet dosage form. Spectrochimica acta. Part A, Molecular and biomolecular spectroscopy, , May-15, Volume: 273	2022
Concentration-response relationships of dolutegravir and efavirenz with weight change after starting antiretroviral therapy. British journal of clinical pharmacology, , Volume: 88, Issue:3	2022
Development and validation of ultra performance liquid chromatography-tandem mass spectrometry method for the simultaneous estimation of dolutegravir, lamivudine and tenofovir in bulk and tablet dosage form. European journal of mass spectrometry (Chichester, England), , Volume: 27, Issue:6	2021
Development of Dolutegravir Single-entity and Fixed-dose Combination Formulations for Children. The Pediatric infectious disease journal, , 03-01, Volume: 41, Issue:3	2022
Patient experiences of switching from Efavirenz- to Dolutegravir-based antiretroviral therapy: a qualitative study in Uganda. BMC infectious diseases, , Nov-13, Volume: 21, Issue:1	2021
Validation and Clinical Application of a Liquid Chromatography-Ultraviolet Detection Method to Quantify Dolutegravir in Dried Blood Spots. Therapeutic drug monitoring, , 06-01, Volume: 44, Issue:3	2022
Optimizing Dolutegravir Initiation in Neonates Using Population Pharmacokinetic Modeling and Simulation. Journal of acquired immune deficiency syndromes (1999), , 01-01, Volume: 89, Issue:1	2022
Analysis of the ternary antiretroviral therapy dolutegravir, lamivudine and abacavir using UV spectrophotometry and chemometric tools. Spectrochimica acta. Part A, Molecular and biomolecular spectroscopy, , Jan-05, Volume: 264	2022
Dolutegravir in Mexico for special populations: A cost analysis perspective. AIDS reviews, , 07-01, Volume: 23, Issue:3	2021
Phase I evaluation of pharmacokinetics and tolerability of the HIV-1 maturation inhibitor GSK3640254 and dolutegravir in healthy adults. British journal of clinical pharmacology, , Volume: 87, Issue:9	2021
ODYSSEY clinical trial design: a randomised global study to evaluate the efficacy and safety of dolutegravir-based antiretroviral therapy in HIV-positive children, with nested pharmacokinetic sub-studies to evaluate pragmatic WHO-weight-band based doluteg BMC infectious diseases, , Jan-04, Volume: 21, Issue:1	2021
Dolutegravir in pregnant mice is associated with increased rates of fetal defects at therapeutic but not at supratherapeutic levels. EBioMedicine, , Volume: 63	2021
2019 update of the European AIDS Clinical Society Guidelines for treatment of people living with HIV version 10.0. HIV medicine, , Volume: 21, Issue:10	2020
Pharmacokinetics, SAfety/tolerability, and EFficacy of high-dose RIFampicin in tuberculosis-HIV co-infected patients on efavirenz- or dolutegravir-based antiretroviral therapy: study protocol for an open-label, phase II clinical trial (SAEFRIF). Trials, , Feb-13, Volume: 21, Issue:1	2020
Assessment of Maternal and Fetal Dolutegravir Exposure by Integrating Ex Vivo Placental Perfusion Data and Physiologically-Based Pharmacokinetic Modeling. Clinical pharmacology and therapeutics, , Volume: 107, Issue:6	2020
Prediction of dolutegravir pharmacokinetics and dose optimization in neonates via physiologically based pharmacokinetic (PBPK) modelling. The Journal of antimicrobial chemotherapy, , 03-01, Volume: 75, Issue:3	2020
Successful use of once-daily high-dose darunavir and dolutegravir in multidrug-resistant HIV. Journal of clinical pharmacy and therapeutics, , Volume: 45, Issue:2	2020
Cell-type specific differences in antiretroviral penetration and the effects of HIV-1 Tat and morphine among primary human brain endothelial cells, astrocytes, pericytes, and microglia. Neuroscience letters, , 11-01, Volume: 712	2019
Clinical and Virological Outcomes of TB/HIV Coinfected Patients Treated With Dolutegravir-Based HIV Antiretroviral Regimens: Programmatic Experience From Botswana. Journal of acquired immune deficiency syndromes (1999), , 10-01, Volume: 82, Issue:2	2019
Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. The Journal of antimicrobial chemotherapy, , 09-01, Volume: 74, Issue:9	2019
Safety and efficacy of dolutegravir in hemodialysis. International journal of STD & AIDS, , Volume: 30, Issue:6	2019
A model-based comparative meta-analysis of the efficacy of dolutegravir-based and efavirenz-based regimens in HIV-infected patients. Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 25, Issue:9	2019
Dolutegravir Population Pharmacokinetics in a Real-Life Cohort of People Living With HIV Infection: A Covariate Analysis. Therapeutic drug monitoring, , Volume: 41, Issue:4	2019
Increased dose of dolutegravir as a potential rescue therapy in multi-experienced patients. Antiviral therapy, , Volume: 24, Issue:1	2019
Pharmacokinetics of dolutegravir with and without darunavir/cobicistat in healthy volunteers. The Journal of antimicrobial chemotherapy, , 01-01, Volume: 74, Issue:1	2019
Effects of Low- and High-Mineral Content Water on the Relative Bioavailability of a Coformulated Abacavir/Dolutegravir/Lamivudine Dispersible Tablet in Healthy Adults. Journal of acquired immune deficiency syndromes (1999), , 12-15, Volume: 79, Issue:5	2018
Nanoformulated Antiretroviral Therapy Attenuates Brain Metabolic Oxidative Stress. Molecular neurobiology, , Volume: 56, Issue:4	2019
Bioequivalence of a Fixed-Dose Combination Tablet of the Complete Two-Drug Regimen of Dolutegravir and Rilpivirine for Treatment of HIV-1 Infection. Antimicrobial agents and chemotherapy, , Volume: 62, Issue:9	2018
Hybrid stochastic framework predicts efficacy of prophylaxis against HIV: An example with different dolutegravir prophylaxis schemes. PLoS computational biology, , Volume: 14, Issue:6	2018
Dolutegravir Dual Therapy as Maintenance Treatment in HIV-Infected Patients: A Review. The Annals of pharmacotherapy, , Volume: 52, Issue:7	2018
A potential drug interaction between phenobarbital and dolutegravir: A case report. Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy, , Volume: 24, Issue:6	2018
Dolutegravir pharmacokinetics in pregnant and postpartum women living with HIV. AIDS (London, England), , 03-27, Volume: 32, Issue:6	2018
Sustained viral suppression with co-administration of oxcarbazepine and dolutegravir. International journal of STD & AIDS, , Volume: 29, Issue:8	2018
Dolutegravir-Related Neurological Adverse Events: A Case Report of Successful Management with Therapeutic Drug Monitoring. Current drug safety, , Volume: 13, Issue:1	2018
Development of an oral once-weekly drug delivery system for HIV antiretroviral therapy. Nature communications, , 01-09, Volume: 9, Issue:1	2018
Small increase in dolutegravir trough, but equivalent total dolutegravir exposure with simeprevir in HIV/HCV seronegative volunteers. The Journal of antimicrobial chemotherapy, , Jan-01, Volume: 73, Issue:1	2018
High plasma concentrations of dolutegravir in patients with ABCG2 genetic variants. Pharmacogenetics and genomics, , Volume: 27, Issue:11	2017
Decreased Absorption of Dolutegravir and Tenofovir Disoproxil Fumarate, But Not Emtricitabine, in an HIV-Infected Patient Following Oral and Jejunostomy-Tube Administration. Pharmacotherapy, , Volume: 37, Issue:8	2017
Dolutegravir/abacavir/lamivudine versus current ART in virally suppressed patients (STRIIVING): a 48-week, randomized, non-inferiority, open-label, Phase IIIb study. Antiviral therapy, , Volume: 22, Issue:4	2017
Dolutegravir plasma concentrations according to companion antiretroviral drug: unwanted drug interaction or desirable boosting effect? Antiviral therapy, , Volume: 22, Issue:4	2017
Quantitative evaluation of the antiretroviral efficacy of dolutegravir. JCI insight, , 11-17, Volume: 1, Issue:19	2016
How recent findings on the pharmacokinetics and pharmacodynamics of integrase inhibitors can inform clinical use. Current opinion in infectious diseases, , Volume: 30, Issue:1	2017
A Two-Way Steady-State Pharmacokinetic Interaction Study of Doravirine (MK-1439) and Dolutegravir. Clinical pharmacokinetics, , Volume: 56, Issue:6	2017
Dolutegravir(DTG, S/GSK1349572) combined with other ARTs is superior to RAL- or EFV-based regimens for treatment of HIV-1 infection: a meta-analysis of randomized controlled trials. AIDS research and therapy, , Volume: 13, Issue:1	2016
No clinically significant pharmacokinetic interactions between dolutegravir and daclatasvir in healthy adult subjects. BMC infectious diseases, , 07-22, Volume: 16	2016
Usefulness of Integrase resistance testing in proviral HIV-1 DNA in patients with Raltegravir prior failure. BMC infectious diseases, , May-13, Volume: 16	2016
The Promise of Dolutegravir: A Novel Second Generation Integrase Strand Transfer Inhibitor. Current clinical pharmacology, , Volume: 11, Issue:2	2016
Effect of carbamazepine on dolutegravir pharmacokinetics and dosing recommendation. European journal of clinical pharmacology, , Volume: 72, Issue:6	2016
Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease. Antimicrobial agents and chemotherapy, , Volume: 60, Issue:4	2016
Dolutegravir and elvitegravir plasma concentrations following cessation of drug intake. The Journal of antimicrobial chemotherapy, , Volume: 71, Issue:4	2016
The preclinical discovery and development of dolutegravir for the treatment of HIV. Expert opinion on drug discovery, , Volume: 10, Issue:11	2015
Efficacy and Tolerability of Integrase Inhibitors in Antiretroviral-Naive Patients. AIDS reviews, , Volume: 17, Issue:3
Influence of nevirapine administration on the pharmacokinetics of dolutegravir in patients infected with HIV-1. The Journal of antimicrobial chemotherapy, , Volume: 70, Issue:12	2015
Safety, Pharmacokinetics and Efficacy of Dolutegravir in Treatment-experienced HIV-1 Infected Adolescents: Forty-eight-week Results from IMPAACT P1093. The Pediatric infectious disease journal, , Volume: 34, Issue:11	2015
HIV integrase inhibitors: a new era in the treatment of HIV. Expert opinion on pharmacotherapy, , Volume: 16, Issue:9	2015
Dolutegravir Has No Effect on the Pharmacokinetics of Oral Contraceptives With Norgestimate and Ethinyl Estradiol. The Annals of pharmacotherapy, , Volume: 49, Issue:7	2015
[Mechanisms of action, pharmacology and interactions of dolutegravir]. Enfermedades infecciosas y microbiologia clinica, , Volume: 33 Suppl 1	2015
Antiviral characteristics of GSK1265744, an HIV integrase inhibitor dosed orally or by long-acting injection. Antimicrobial agents and chemotherapy, , Volume: 59, Issue:1	2015
HIV: new drugs, new guidelines. Current opinion in infectious diseases, , Volume: 27, Issue:6	2014
Effect of fosamprenavir-ritonavir on the pharmacokinetics of dolutegravir in healthy subjects. Antimicrobial agents and chemotherapy, , Volume: 58, Issue:11	2014
Effects of boceprevir and telaprevir on the pharmacokinetics of dolutegravir. British journal of clinical pharmacology, , Volume: 78, Issue:5	2014
Dolutegravir, abacavir and lamivudine as HIV therapy. Expert opinion on pharmacotherapy, , Volume: 15, Issue:7	2014
Dolutegravir: a next-generation integrase inhibitor for treatment of HIV infection. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , Jul-15, Volume: 59, Issue:2	2014
Dolutegravir for the treatment of adult patients with HIV-1 infection. Expert review of anti-infective therapy, , Volume: 12, Issue:5	2014
Dolutegravir: a new integrase strand transfer inhibitor for the treatment of HIV. Pharmacotherapy, , Volume: 34, Issue:5	2014
Once-daily dolutegravir versus twice-daily raltegravir in antiretroviral-naive adults with HIV-1 infection (SPRING-2 study): 96 week results from a randomised, double-blind, non-inferiority trial. The Lancet. Infectious diseases, , Volume: 13, Issue:11	2013
Lack of pharmacokinetic interaction between rilpivirine and integrase inhibitors dolutegravir and GSK1265744. Antimicrobial agents and chemotherapy, , Volume: 57, Issue:11	2013
Dolutegravir pharmacokinetics in the genital tract and colorectum of HIV-negative men after single and multiple dosing. Journal of acquired immune deficiency syndromes (1999), , Sep-01, Volume: 64, Issue:1	2013
Single and multiple dose pharmacokinetics of dolutegravir in the genital tract of HIV-negative women. Antiviral therapy, , Volume: 18, Issue:8	2013
Carbamoyl pyridone HIV-1 integrase inhibitors 3. A diastereomeric approach to chiral nonracemic tricyclic ring systems and the discovery of dolutegravir (S/GSK1349572) and (S/GSK1265744). Journal of medicinal chemistry, , Jul-25, Volume: 56, Issue:14	2013
Effect of prednisone on the pharmacokinetics of the integrase inhibitor dolutegravir. Antimicrobial agents and chemotherapy, , Volume: 57, Issue:9	2013
[Pharmacokinetics and safety of dolutegravir in healthy Japanese subjects]. The Japanese journal of antibiotics, , Volume: 66, Issue:1	2013
Next-generation integrase inhibitors : where to after raltegravir? Drugs, , Volume: 73, Issue:3	2013
Safety and efficacy of dolutegravir in treatment-experienced subjects with raltegravir-resistant HIV type 1 infection: 24-week results of the VIKING Study. The Journal of infectious diseases, , Mar-01, Volume: 207, Issue:5	2013
Pharmacology of HIV integrase inhibitors. Current opinion in HIV and AIDS, , Volume: 7, Issue:5	2012
The use of HIV-1 integrase inhibitors in antiretroviral naive patients. Current opinion in HIV and AIDS, , Volume: 7, Issue:5	2012
Update on raltegravir and the development of new integrase strand transfer inhibitors. Southern medical journal, , Volume: 105, Issue:7	2012
From in vitro EC₅₀ to in vivo dose-response for antiretrovirals using an HIV disease model. Part I: a framework. Journal of pharmacokinetics and pharmacodynamics, , Volume: 39, Issue:4	2012
Effect of a single supratherapeutic dose of dolutegravir on cardiac repolarization. Pharmacotherapy, , Volume: 32, Issue:4	2012
Once daily dolutegravir (S/GSK1349572) in combination therapy in antiretroviral-naive adults with HIV: planned interim 48 week results from SPRING-1, a dose-ranging, randomised, phase 2b trial. The Lancet. Infectious diseases, , Volume: 12, Issue:2	2012
Antiviral activity, safety, and pharmacokinetics/pharmacodynamics of dolutegravir as 10-day monotherapy in HIV-1-infected adults. AIDS (London, England), , Sep-10, Volume: 25, Issue:14	2011
Pharmacokinetics of the HIV integrase inhibitor S/GSK1349572 co-administered with acid-reducing agents and multivitamins in healthy volunteers. The Journal of antimicrobial chemotherapy, , Volume: 66, Issue:7	2011
Effect of atazanavir and atazanavir/ritonavir on the pharmacokinetics of the next-generation HIV integrase inhibitor, S/GSK1349572. British journal of clinical pharmacology, , Volume: 72, Issue:1	2011
Pharmacokinetics and safety of S/GSK1349572, a next-generation HIV integrase inhibitor, in healthy volunteers. Antimicrobial agents and chemotherapy, , Volume: 54, Issue:1	2010

Article	Year
Tolerability and effectiveness of albuvirtide combined with dolutegravir for hospitalized people living with HIV/AIDS. Medicine, , Nov-10, Volume: 102, Issue:45	2023
Mechanistic Modeling of the Drug-Drug Interaction Between Efavirenz and Dolutegravir: Is This Interaction Clinically Relevant When Switching From Efavirenz to Dolutegravir During Pregnancy? Journal of clinical pharmacology, , Volume: 63 Suppl 1	2023
Efficacy and safety of dolutegravir or darunavir in combination with lamivudine plus either zidovudine or tenofovir for second-line treatment of HIV infection (NADIA): week 96 results from a prospective, multicentre, open-label, factorial, randomised, non The lancet. HIV, , Volume: 9, Issue:6	2022
South African healthcare workers' knowledge of dolutegravir's drug-drug interactions in the first year of its rollout: a cross-sectional online survey. Journal of the International AIDS Society, , Volume: 25, Issue:3	2022
Lack of a Clinically Meaningful Drug Interaction Between the HIV-1 Antiretroviral Agents Islatravir, Dolutegravir, and Tenofovir Disoproxil Fumarate. Clinical pharmacology in drug development, , Volume: 10, Issue:12	2021
Dolutegravir-based dual maintenance regimens combined with lamivudine/emtricitabine or rilpivirine: risk of virological failure in a real-life setting. The Journal of antimicrobial chemotherapy, , 12-24, Volume: 77, Issue:1	2021
Dolutegravir or Darunavir in Combination with Zidovudine or Tenofovir to Treat HIV. The New England journal of medicine, , 07-22, Volume: 385, Issue:4	2021
The dolutegravir/valproic acid drug-drug interaction is primarily based on protein displacement. The Journal of antimicrobial chemotherapy, , 04-13, Volume: 76, Issue:5	2021
Aging does not impact drug--drug interaction magnitudes with antiretrovirals. AIDS (London, England), , 05-01, Volume: 34, Issue:6	2020
Drug-Drug Interactions Between Antiretrovirals and Carbamazepine/Oxcarbazepine: A Real-Life Investigation. Therapeutic drug monitoring, , Volume: 42, Issue:2	2020
Population pharmacokinetics of dolutegravir: influence of drug-drug interactions in a real-life setting. The Journal of antimicrobial chemotherapy, , 09-01, Volume: 74, Issue:9	2019
Drug-drug interactions of a two-drug regimen of dolutegravir and lamivudine for HIV treatment. Expert opinion on drug metabolism & toxicology, , Volume: 15, Issue:3	2019
Barrier to Resistance of Dolutegravir in Two-Drug Combinations. Antimicrobial agents and chemotherapy, , Volume: 63, Issue:3	2019
Assessment of drug interaction potential between the HCV direct-acting antiviral agents elbasvir/grazoprevir and the HIV integrase inhibitors raltegravir and dolutegravir. The Journal of antimicrobial chemotherapy, , 03-01, Volume: 74, Issue:3	2019
Drug Interactions between Dolutegravir and Artemether-Lumefantrine or Artesunate-Amodiaquine. Antimicrobial agents and chemotherapy, , Volume: 63, Issue:2	2019
Optimizing concentrations of concomitant antiretrovirals by reducing etravirine doses: two case reports of complex drug-drug interactions. Antiviral therapy, , Volume: 24, Issue:1	2019
Cytokine-Mediated Systemic Adverse Drug Reactions in a Drug-Drug Interaction Study of Dolutegravir With Once-Weekly Isoniazid and Rifapentine. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, , 07-02, Volume: 67, Issue:2	2018
Effect of dolutegravir in combination with Nucleoside Reverse Transcriptase Inhibitors (NRTIs) on people living with HIV who have pre-existing NRTI mutations. International journal of antimicrobial agents, , Volume: 51, Issue:5	2018
Prevalence of drug-drug interactions in the era of HIV integrase inhibitors: a retrospective clinical study. The Netherlands journal of medicine, , Volume: 75, Issue:6	2017
Dolutegravir plasma concentrations according to companion antiretroviral drug: unwanted drug interaction or desirable boosting effect? Antiviral therapy, , Volume: 22, Issue:4	2017
Pharmacokinetics of dolutegravir and rilpivirine in combination with simeprevir and sofosbuvir in HIV/hepatitis C virus-coinfected patients with liver cirrhosis. The Journal of antimicrobial chemotherapy, , 03-01, Volume: 72, Issue:3	2017
Dolutegravir(DTG, S/GSK1349572) combined with other ARTs is superior to RAL- or EFV-based regimens for treatment of HIV-1 infection: a meta-analysis of randomized controlled trials. AIDS research and therapy, , Volume: 13, Issue:1	2016
Drug-Drug Interaction between the Direct-Acting Antiviral Regimen of Ombitasvir-Paritaprevir-Ritonavir plus Dasabuvir and the HIV Antiretroviral Agent Dolutegravir or Abacavir plus Lamivudine. Antimicrobial agents and chemotherapy, , Volume: 60, Issue:10	2016
Pharmacokinetics of dolutegravir when administered with mineral supplements in healthy adult subjects. Journal of clinical pharmacology, , Volume: 55, Issue:5	2015
In vitro investigations into the roles of drug transporters and metabolizing enzymes in the disposition and drug interactions of dolutegravir, a HIV integrase inhibitor. Drug metabolism and disposition: the biological fate of chemicals, , Volume: 41, Issue:2	2013
Pharmacokinetics of the HIV integrase inhibitor S/GSK1349572 co-administered with acid-reducing agents and multivitamins in healthy volunteers. The Journal of antimicrobial chemotherapy, , Volume: 66, Issue:7	2011

dolutegravir

Description

Cross-References

Synonyms (77)

Roles (1)

Drug Classes (4)

Protein Targets (28)

Potency Measurements

Inhibition Measurements

Activation Measurements

Other Measurements

Bioassays (235)

Research

Studies (1,108)

Study Types

Related Drugs (680)

Drugs in this Class (485)

Drugs with this Function (11)

Drugs in Same Class and Function (3)

Drugs Involved in Assays Together (46)

Drugs Researched Together (157)

Related Conditions (265)

Safety/Toxicity (90)

Long-term Use (3)

Pharmacokinetics (69)

Bioavailability (14)

Dosage (98)

Interactions (26)