warfarin and Antithrombin-III-Deficiency

Warfarin induced skin necrosis is a rare complication with a prevalence of 0.01-0.1 per cent. It was first described in 1943.. A literature review was undertaken using Medline; all relevant papers on this rare compli-cation of warfarin therapy were used.. There are several adverse skin manifestations associated with the use of oral anticoagulants, ranging from ecchymoses and purpura, haemorrhagic necrosis, maculopapular vesicular urticarial eruptions to purple toes. This article concentrates mainly on warfarin induced skin necrosis. The syndrome typically occurs during the first few days of warfarin therapy, often in association with the administration of a large initial loading dose of the drug. Although the precise nature of the disease is still unknown, advances in knowledge about protein C, protein S and antithrombin III anticoagulant pathways have led to a better understanding of the mechanisms involved in pathogenesis. Differential diagnosis between warfarin induced skin necrosis and necrotizing fasciitis, venous gangrene and other causes of skin necrosis may be difficult; the disease may also be confused with other dermatological entities.. Warfarin induced skin necrosis, while rare, is an important complication. All surgeons should be aware of its existence.

Topics: Anticoagulants; Antithrombin III Deficiency; Humans; Necrosis; Protein C Deficiency; Protein S Deficiency; Skin; Warfarin

In general, the current recommendations for treating and prophylaxing thrombotic patients with hereditary defects are similar to those for thrombotic individuals without a defect. Determinations as to the need for long-term anticoagulation require that a clinical assessment be made regarding the relative benefit in preventing thrombotic episodes versus the risk of increased bleeding. With our newly found ability to identify genetic risk factors in a substantial fraction of patients with venous thrombosis and pulmonary embolism, it will be possible to perform rigorously designed studies to determine whether they should be managed with more prolonged or intense anticoagulation after a thrombotic event or more aggressive prophylactic regimens in high risk situations such as a total hip replacement.

Topics: Abnormalities, Drug-Induced; Anticoagulants; Antithrombin III; Antithrombin III Deficiency; Blood Proteins; Coumarins; Disease Susceptibility; Drug Eruptions; Factor V Deficiency; Female; Fibrinolytic Agents; Genetic Predisposition to Disease; Humans; Infant, Newborn; Male; Necrosis; Pregnancy; Pregnancy Complications, Hematologic; Prevalence; Protein C; Protein S Deficiency; Puerperal Disorders; Purpura; Recurrence; Risk; Thrombolytic Therapy; Thrombosis; Warfarin

Topics: Animals; Anticoagulants; Antithrombin III; Antithrombin III Deficiency; Aprotinin; Blood Coagulation Tests; Cardiopulmonary Bypass; Heparin; Hirudin Therapy; Hirudins; Humans; Intraoperative Complications; Peptide Fragments; Postoperative Complications; Recombinant Proteins; Thrombin; Thrombosis; Warfarin

Significant advances have been made in defining the regulatory mechanisms that control blood clotting. These are reviewed, with special attention to the functions of the natural inhibitors antithrombin III, protein C, and protein S. Congenital deficiencies of these inhibitors as well as acquired abnormalities, such as defective fibrinolysis, and their role in promoting thrombosis are also discussed, as are thrombotic complications of pregnancy. Pregnancy decreases levels of protein S to 40% to 50% of normal levels. The decrease occurs early in pregnancy and persists into the postpartum period; it appears to be a hormonal rather than a dilutional effect. It is not known whether the thrombotic risk associated with pregnancy is increased in women who are congenitally deficient in protein S. Oral contraceptives decrease levels of protein S by about 20%. Women with a personal or family history of thrombosis should be evaluated for predisposing conditions before they start an oral contraceptive, as should women taking oral contraceptives who develop deep venous thrombosis.. Most people who experience venous thrombosis have normal hemostasis. Some people have inherited deficiencies of protein C, protein S, and antithrombin iii. They tend to have deep venous thrombosis which increases their risk for pulmonary emboli. Some acquired disorders which predisposes people to thrombosis include defective fibrinolysis which often occurs after surgery or infection, Trousseau's syndrome (excessive coagulant activity linked with adenocarcinoma), and lupus anticoagulant which is an immunoglobulin G or M antibody directed against negatively charged phospholipids. Hormones and probably not a dilution effect reduces free and bound protein S levels during pregnancy. Functional protein S activity is still 40-50% below normal levels 1-3 days after delivery. This decrease appears to protect against bleeding but does have venous thrombosis and pulmonary emboli during pregnancy as side effects. Non-oral-contraceptive (OC) users have greatly higher protein S levels than do OC users (28.6 mcg/ml vs. 24.3 mcg/ml; p.005) which gives more credence to the belief that hormones are responsible for the fall in protein S activity during pregnancy. OCs reduce free and total protein S levels almost 20%. Smoking may even further reduce these levels in women during pregnancy and who use Ocs. Women who have had venous thrombosis should not use OCs. Physicians should also consider family history especially age of affected family member, severity of thrombotic episodes, and the clinical setting. They should look for an underlying abnormality in patients who develop thrombosis while using OCs. If thrombosis develops during pregnancy, physicians should call for a venogram, venous duplex scanning, and, if required, invasive tests. The most sensible treatment is intravenous heparin for 5-7 days then therapeutic doses of heparin. Heparin therapy should stop before delivery and be reinstituted shortly thereafter and continued throughout the postpartum period. Physicians should take extra precautions when performing surgery on an OC user.

Topics: Antithrombin III; Antithrombin III Deficiency; Blood Coagulation; Blood Coagulation Disorders; Contraceptives, Oral; Female; Heparin; Humans; Pregnancy; Pregnancy Complications, Cardiovascular; Protein C; Protein C Deficiency; Protein S; Protein S Deficiency; Recurrence; Thrombophlebitis; Warfarin

Hereditary antithrombin III (ATIII) deficiency predisposes patients to venous thrombosis. The prothrombin fragment F1+2 radioimmunoassay demonstrates that many asymptomatic patients with this disorder not receiving antithrombotic therapy have elevated plasma factor Xa activity. The hemostatic system hyperactivity as measured by this assay could be specifically corrected by rising plasma ATIII levels of several persons into the normal range. This indicates that the prethrombotic state can be defined as an imbalance between the production and inhibition of factor Xa enzymatic activity. The effects of warfarin on factor Xa enzymatic activity in persons with congenital ATIII deficiency have also been evaluated. At equivalent intensities of oral anticoagulation, the mean plasma F1+2 level in patients with ATIII deficiency was significantly elevated as compared with anticoagulated persons without this inherited thrombotic disorder. It is concluded that the effect of warfarin on hemostatic system activation is modulated by the endogenous heparan sulfate-ATIII mechanism. This suggests that the F1+2 radioimmunoassay can be employed to improve the understanding of the hypercoagulable state associated with antithrombin III deficiency as well as to develop more effective treatment strategies to prevent thromboembolic events in patients with this disorder.

Topics: Antithrombin III Deficiency; Factor Xa; Hemostasis; Humans; Radioimmunoassay; Thrombophlebitis; Warfarin

Topics: Antithrombin III Deficiency; Blood Coagulation Factors; Female; Fetal Diseases; Heparin; Humans; Lupus Coagulation Inhibitor; Lupus Erythematosus, Systemic; Maternal-Fetal Exchange; Pregnancy; Pregnancy Complications, Cardiovascular; Thrombocytopenia; Thromboembolism; Warfarin

Topics: Acute Disease; Adolescent; Adult; Aged; Antithrombin III Deficiency; Blood Coagulation; Blood Coagulation Disorders; Female; Fibrinogen; Fibrinolysis; Glycoproteins; Humans; Male; Middle Aged; Pregnancy; Pregnancy Complications, Cardiovascular; Protein C; Thrombophlebitis; Warfarin

To investigate the effect of warfarin treatment on the early phase of tissue factor-induced coagulation, we measured plasma-activated factor VII (factor VIIa) levels by a direct fluorogenic assay in 74 cardiovascular disease patients on long-term oral anticoagulation. We divided the patients into three groups based on the international normalized ratio (INR). In the patients with INR ranges of < 1.7 and 1.7 to 2.5, factor VIIa levels were 42% and 61% lower, respectively, than in age- and sex-matched controls. Factor VII coagulant activity (factor VIIc), factor VII antigen (factor VIIag), protein C, and factor X levels were also reduced to a similar extent in both groups. However, in patients with an INR > 2.5, the factor VIIa level was not decreased compared with that at an INR of 1.7 to 2.5, although the factor VIIc, factor VIIag, factor X, and protein C levels were all decreased further. Although the precise relation between the reduction of factor VIIa levels and the increase of INR requires appropriately designed long-term clinical trials, our data suggest that an INR range of 1.7 to 2.5 is sufficient for the suppression of factor VIIa. During the long-term follow-up of three patients with congenital antithrombin III or protein C deficiency, the factor VIIa level was more responsive to changes in the warfarin dose than the INR, and there were generally no corresponding changes of the thrombin-antithrombin III complex (TAT) level. However, one patient showed a transient marked increase of factor VIIa during the discontinuation of warfarin that was accompanied by an increase in TAT. Based on these findings, factor VIIa could be useful for monitoring both hypercoagulable and hypocoagulable states.

Topics: Adult; Aged; Antithrombin III Deficiency; Biomarkers; Cardiovascular Diseases; Factor VIIa; Female; Humans; Male; Middle Aged; Protein C Deficiency; Warfarin

Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia.. A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain.. The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4).. An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy.. The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed.. By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

Topics: Adolescent; Anticoagulants; Antithrombin III; Antithrombin III Deficiency; Antithrombins; Heparin; Humans; Male; Mutation; Thrombophilia; Thrombosis; Vena Cava, Inferior; Warfarin

A 41-year-old female with hereditary deficiency of antithrombin III (ATIII) was diagnosed with atrial septal defect( ASD) and scheduled for the closure of ASD. She had been taking warfarin since she suffered from deep vein thrombosis 10 years ago. Preoperative management of anticoagulation included discontinuation of warfarin, and supplementation of antithrombin with heparin infusion. On the day of operation, antithrombin activity was maintained above 80% by administering antithrombin, and closure of ASD was carried out under standard cardiopulmonary bypass support using heparin. Heparin infusion was continued with antithrombin supplementation until prothrombin time-international normalized ratio(PT-INR) recovered to around 2.5 with warfarin. Her intra-and postoperative courses did not show any thromboembolic events, and she was discharged 20 days after the surgery.

Topics: Adult; Anticoagulants; Antithrombin III; Antithrombin III Deficiency; Cardiac Surgical Procedures; Female; Heart Septal Defects, Atrial; Heparin; Humans; International Normalized Ratio; Postoperative Complications; Preoperative Care; Thrombin Time; Treatment Outcome; Venous Thrombosis; Warfarin

One of the rare causes of venous thromboembolism in pregnancy is antithrombin III deficiency. Antithrombin III deficiency is estimated to carry a 30% risk of venous thrombotic complication during each pregnancy and postpartum.. We present thea case of a A 21-year-old pregnant woman (Para 1+) with a history of large atrial septal defect repair at our hospital (Imam Ali Hospital, 2 May 2014). The patient, with unknown history of antithrombin III deficiency, was admitted at our emergency center with dyspnea and chest pain for the rule out of tamponade. She presented with a right atrial thrombosis in the second trimester of pregnancy despite the use of therapeutic doses of heparin and warfarin in the postoperative period as thromboembolic prophylaxis. The risk of warfarin emberyopaty led to termination of pregnancy, and successful redo-cardiac surgery outcome was achieved with the combined use of therapeutic anticoagulation and regular plasma-derived antithrombin concentrate infusions to normalize her antithrombin levels.. She recovered from the operation uneventfully, and wad discharged in the 12(th) postoperative day. In the 6(th) month of follow-up, antithrombin III increased to 70% in more stable level and transethoracic echocardiography showed no recurrence of right atrial thrombus formation. This case leads to further debate regarding whether full anticoagulation should be a worthy preventive measure for venous thromboembolic prophylaxis after an open heart surgery complicated by pregnancy in a women with inherited antithrombin III deficiency. This point may become more relevant as further experience is gained with the use of recombinant human antithrombin in known cases during open cardiac surgery.

Topics: Adult; Anticoagulants; Antithrombin III; Antithrombin III Deficiency; Antithrombins; Cardiac Surgical Procedures; Female; Heart Atria; Heart Septal Defects, Atrial; Humans; Postoperative Complications; Pregnancy; Pregnancy Complications; Pregnancy Trimester, Second; Venous Thrombosis; Warfarin; Young Adult

Topics: Adult; Anticoagulants; Antithrombin III; Antithrombin III Deficiency; Autoimmune Diseases; Humans; Inflammatory Bowel Diseases; Intracranial Thrombosis; Magnetic Resonance Imaging; Male; Warfarin

Antithrombin III (AT III) deficiency is a rare hereditary disease that predisposes to thromboembolic complications. We report a case of AT III deficiency complicated with acute pulmonary thromboembolism, successfully treated with emergency pulmonary thromboembolectomy after insertion of an inferior vena cava filter. AT III activity before treatment was found to be 44% of normal value and remained less than 50% of normal throughout the postoperative course. In his family line, both the patient's aunt and deceased father had a history of pulmonary infarction. AT III activity of the patient's aunt was 47 to 58% of normal value. The patient was discharged on the 15th day after surgery and has been doing well for four years receiving warfarin as anticoagulant therapy. Careful follow-up is essential for early detection of the recurrent pulmonary thromboembolism resulting in pulmonary hypertension and/or right heart failure.

Topics: Acute Disease; Adolescent; Anticoagulants; Antithrombin III Deficiency; Embolectomy; Humans; Male; Pulmonary Artery; Pulmonary Embolism; Treatment Outcome; Vena Cava Filters; Warfarin

Topics: Anticoagulants; Antithrombin III Deficiency; Bandages; Debridement; Female; Humans; Leg Ulcer; Middle Aged; Necrosis; Skin Care; Venous Thrombosis; Warfarin

We report a patient with Budd-Chiari syndrome (BCS) and extrahepatic portal obstruction (EHO) associated with congenital antithrombin (AT) III deficiency. A 35-year-old man was admitted to Nishi Kobe Medical Center for evaluation of abnormal intrahepatic veins. By various imaging modalities, BCS and EHO were diagnosed. Laboratory data revealed parallel decreases in activity and antigen concentration of AT III despite normal liver function. Taken together, the etiology of both BCS and EHO was considered to be thrombosis, associated with congenital AT III deficiency. Two years after beginning warfarin therapy, the patient has no symptoms and his liver function remains normal. Anticoagulant therapy is considered useful for preventing progression of the disease.

Topics: Adult; Anticoagulants; Antithrombin III Deficiency; Budd-Chiari Syndrome; Humans; Japan; Male; Portal System; Warfarin

Topics: Accidents, Home; Adult; Anticoagulants; Antithrombin III Deficiency; Arginine; Burns; Cardiovascular Agents; Coronary Vasospasm; Debridement; Drug Therapy, Combination; Explosions; Humans; Male; Pipecolic Acids; Sulfonamides; Ventricular Dysfunction, Left; Warfarin

To determine the prevalence of endogenous and exogenous risk factors for venous thrombosis in patients with upper limb deep vein thrombosis (DVT), and to evaluate the risk of clinically detectable pulmonary embolus, recurrent DVT, and postphlebitic symptoms in these patients.. A combined prospective and retrospective descriptive analysis of a cohort of patients with upper limb DVT compared with age- and sex-matched patients with lower limb DVT.. Internal medicine departments, and hematology and vascular surgery outpatient clinics at a tertiary-care university hospital.. Consecutive patients with "spontaneous" upper limb DVT diagnosed between 1989 and 1997 were studied. Twenty age- and sex-matched patients with lower limb DVT admitted to the hospital via the emergency department served as control patients.. Eighteen patients with upper limb DVT were studied. An endogenous risk factor (thrombophilia) was present in 11 of 18 patients vs 8 of 20 control patients (p = not significant). In the upper limb group, nine patients had activated protein C resistance, four patients had anticardiolipin antibodies, and two patients had both forms of thrombophilia. Furthermore, 14 of the upper limb DVT patients were found to have an exogenous risk factor for thrombosis compared with 7 of the patients with lower limb DVT (p = 0.01), and 66.6% of patients with upper limb DVT had both an exogenous and an endogenous risk factor for thrombosis vs 15% of patients with lower limb DVT (p < 0.002). No clinically detectable pulmonary emboli occurred among the upper limb DVT patients. Three patients have minor postphlebitic symptoms. Two patients experienced recurrent DVT.. In the majority of patients with upper limb DVT that we studied in this relatively small study, exogenous (environmental) or endogenous risk factors for venous thrombosis, or a combination of both, were found. Furthermore, in our patients, these thromboses had a low propensity to cause clinically significant pulmonary embolus and did not cause significant postphlebitic symptoms. Finally, we suggest that anticoagulant therapy for these thromboses may be adequate and that thrombolytic agents and surgical intervention are not routinely indicated.

Topics: Activated Protein C Resistance; Adult; Aged; Antithrombin III Deficiency; Drug Therapy, Combination; Enoxaparin; Female; Fibrinolytic Agents; Humans; Leg; Male; Middle Aged; Phlebography; Pregnancy; Prospective Studies; Protein S Deficiency; Recurrence; Retrospective Studies; Risk Factors; Streptokinase; Thrombolytic Therapy; Thrombophilia; Treatment Outcome; Ultrasonography, Doppler, Color; Venous Thrombosis; Warfarin

We report a severe vena cava inferior thrombosis in a mature two day-old boy. Pregnancy and birth were event free. The mother had antithrombin deficiency. During pregnancy she was treated with enoxaparin and just before delivery with 2000 IE antithrombin concentrate. At admission the child had unmeasurable antithrombin and low protein C concentrations. He was treated with antithrombin concentrate and heparin. The thrombus disappeared, and now he is on maintenance treatment with warfarin. Risk factors and treatment of inherited antithrombin deficiency are discussed.

Topics: Adult; Anticoagulants; Antithrombin III Deficiency; Female; Genetic Predisposition to Disease; Humans; Infant, Newborn; Male; Pedigree; Pregnancy; Pregnancy Complications, Cardiovascular; Vena Cava, Inferior; Venous Thrombosis; Warfarin

We present an infant who was exposed to warfarin throughout pregnancy and has warfarin embryopathy. When the child was examined radiologically at 20 months areas of calcification were visible in the septal and alar cartilages of the small external part of the nose. The location of this ectopic calcification is consistent with that seen in an animal model of the warfarin embryopathy. It supports the hypothesis that warfarin interferes with the prenatal growth of the cartilaginous nasal septum by inhibiting the normal formation of a vitamin K-dependent protein that prevents calcification of cartilage. The child also had severe abnormalities of the cervical vertebrae and secondary damage to the spinal cord. Cervical vertebral anomalies are a relatively common finding in the warfarin embryopathy and in the related Binder syndrome.

Topics: Adolescent; Antithrombin III Deficiency; Calcinosis; Cervical Vertebrae; Female; Humans; Infant; Male; Middle Aged; Nasal Septum; Pregnancy; Prenatal Exposure Delayed Effects; Radiography; Spinal Cord Diseases; Warfarin

Congenital deficiency of antithrombin III (AT III) is the only inherited hypercoagulable disorder for which a concentrate of purified protein is available for replacement therapy during periods of increased thrombotic risk. This report describes how such concentrates have been used in a patient with congenital AT-III deficiency undergoing venous surgery. A 40-year-old woman with AT III deficiency was evaluated for bilateral grade 3 chronic venous insufficiency. Noninvasive venous assessment and ascending venography revealed incompetence of the lower leg perforators, a patent deep venous system, and competent greater and lesser saphenous veins. Staged subfascial ligations were performed. Pasteurized AT III was administered 1 hour before surgery and at 30 hours at a dose calculated to increase AT-III activity to at least 120%. Perioperative AT III activity levels were measured. Subcutaneous heparin and oral warfarin were initiated the evening of surgery. An infusion of AT III increased plasma AT III from the baseline activity of 51% to 180%; it was 87% 13 hours later. Two measurements of the initial half-life of AT III were 7 and 14 hours. No perioperative thrombotic complications occurred. The ulcers healed, and the patient remains symptom free. Pasteurized AT III concentrates are now commercially available, easily administered, and provide a useful adjunct to the anticoagulation regimen of patients with AT III deficiency undergoing vascular surgery.

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; Female; Heparin; Humans; Intraoperative Complications; Postoperative Care; Postoperative Complications; Preoperative Care; Risk Factors; Thrombosis; Vascular Surgical Procedures; Venous Insufficiency; Warfarin

The aetiology of non-arteritic ischaemic optic neuropathy (ION) is multifactorial with local anatomical and systemic haemodynamic abnormalities both playing a role. A careful search for treatable vascular disease risk factors is required to allow rational therapy, to optimise the visual prognosis and to allow new insights into pathogenesis. We describe 7 cases in which there was an associated thrombophilic (prothrombotic) state; 4 had deficiencies of the physiological anticoagulants proteins C and S and antithrombin III and 2 had anti-phospholipid antibody (lupus anticoagulant) syndromes. A further patient had reduced levels of the physiological fibrinolytic agent tissue plasminogen activator (t-PA). In 5 patients other risk factors for small vessel occlusive disease were also present, and 4 had recurrent episodes of ION in the same eye. The visual prognosis in these patients may be improved by anticoagulation with warfarin.

Topics: Adult; Aged; Antithrombin III Deficiency; Blood Coagulation Disorders; Female; Humans; Ischemia; Lupus Coagulation Inhibitor; Male; Middle Aged; Optic Nerve; Optic Nerve Diseases; Prognosis; Protein C Deficiency; Protein S Deficiency; Tissue Plasminogen Activator; Warfarin

Fixed mini-dose warfarin has been used for thromboprophylaxis in high-risk nonpregnant patients with encouraging results. The usefulness of this strategy in pregnant women requires documentation of fetal safety.. A woman with antithrombin III deficiency suffered a venous thrombosis during early pregnancy and could not be successfully managed long term with heparin. One milligram of warfarin daily was used for prophylaxis, and serial fetal blood samples were used to monitor the fetal coagulation status. No apparent coagulation abnormalities were demonstrated in the fetus at 33, 36, and 38 weeks' gestation. The woman suffered no further thromboses throughout the remainder of her pregnancy and puerperium.. The efficacy of fixed mini-dose warfarin for prophylaxis in pregnancies at risk for thromboembolic disease will require further investigation. This fetus did not appear vulnerable to coagulation abnormalities as a consequence of the warfarin regimen.

Topics: Adult; Antithrombin III Deficiency; Contraindications; Female; Fetal Blood; Humans; Pregnancy; Pregnancy Complications, Hematologic; Subclavian Vein; Thrombosis; Warfarin

Topics: Antithrombin III Deficiency; Female; Heparin; Humans; Metabolism, Inborn Errors; Pregnancy; Pregnancy Complications, Hematologic; Thromboembolism; Warfarin

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; Female; Glycoproteins; Humans; Male; Middle Aged; Plasminogen; Protein C; Protein C Deficiency; Protein S; Thrombosis; Warfarin

The members of this family with ATIII deficiency have been followed for at least 12 years (1976-1989). All those with previous venous thrombo-embolism have been free from recurrence when on warfarin. During the half century 1931-1981, all 11 full term pregnancies in four affected patients were associated with venous thromboembolism; one patient was enigmatic having one full term pregnancy, without thrombotic event; between 1982 and 1989 three pregnancies have been actively managed with no clinical thrombosis. Management involved use of monitored, self administered, subcutaneous heparin before or very soon after conception and throughout pregnancy (warfarin having been stopped), planned delivery under cover of intravenous antithrombin III, reduction of heparin dosage at delivery and reintroduction of warfarin in the puerperium. The recognised hazards of heparin therapy in pregnancy did not occur. The involvement of the arterial system is reviewed. Clinical evidence provides tentative suggestions on (a) possible additional risk of cigarette smoking (b) avoidance of venography (c) avoidance of varicose vein surgery. A probe is now available for the defective antithrombin III gene in this family, but there has been no occasion yet to apply this in antenatal diagnosis.

Topics: Abortion, Spontaneous; Adult; Antithrombin III; Antithrombin III Deficiency; Cause of Death; Contraindications; Drug Administration Schedule; Female; Follow-Up Studies; Genetic Counseling; Heparin; Humans; Incidence; Infant, Newborn; Male; Metabolism, Inborn Errors; Pedigree; Phlebography; Pregnancy; Pregnancy Complications, Hematologic; Thromboembolism; Warfarin

Topics: Antithrombin III Deficiency; Danazol; Drug Therapy, Combination; Humans; Male; Middle Aged; Thromboembolism; Warfarin

Three patients with familial antithrombin III (ATIII) deficiency, who also have histories of thromboembolism, were treated with oxymetholone in combination with warfarin. Thrombolysis was observed in one patient with acute thrombosis of inferior vena cava during the oxymetholone and warfarin therapy. No further thromboembolic episodes occurred in these patients after initiation of warfarin with or without oxymetholone. The levels of plasma ATIII, alpha 1-antitrypsin, plasminogen and Cl-inactivator were significantly increased in all patients after the introduction of oxymetholone therapy. This suggests that oxymetholone augments anticoagulant and fibinolytic activity. Hence we consider that oxymetholone in combination with warfarin may be possible thrombolytic therapy in patients with familial ATIII deficiency.

Topics: Adolescent; Antithrombin III; Antithrombin III Deficiency; Blood Coagulation Tests; Drug Therapy, Combination; Female; Humans; Japan; Male; Middle Aged; Oxymetholone; Thromboembolism; Warfarin

Topics: Adolescent; Antithrombin III Deficiency; Blood Coagulation Disorders; Drug Therapy, Combination; Dura Mater; Humans; Male; Oxymetholone; Sinus Thrombosis, Intracranial; Thrombosis; Vena Cava, Inferior; Warfarin

Deep venous thrombosis is a complex process involving many factors in the circulatory system, an important one apparently being the intrinsic fibrinolytic system. Specific activators of the process include venous trauma and hypercoagulability states. In spite of efforts at prophylaxis, venous thrombosis will occur, a dangerous condition in itself and also a precursor of pulmonary embolism. Several schemes for prophylaxis, including drug regimens and mechanical means, have been tried, and future research will surely identify others. A patient's best protection against thrombosis at present, however, is a vigilant physician with a high index of suspicion who will expedite diagnosis and treatment if necessary.

Topics: Antithrombin III Deficiency; Aspirin; Blood Coagulation Disorders; Catheters, Indwelling; Contraceptives, Oral; Dihydroergotamine; Female; Glycoproteins; Heparin; Humans; Parity; Postoperative Complications; Pregnancy; Pregnancy Complications; Protein C; Sulfinpyrazone; Thrombophlebitis; Warfarin

Heparin cofactor II (HC II) is a recently characterized protein that is capable of neutralizing thrombin but not activated factor X. Recent evidence suggests that it may be a physiologically important regulator of thrombin activity. We evaluated and modified a method for clinical laboratory determination of this protein and then utilized the method to analyze HC II activity in various clinical samples. Low levels were associated with liver disease, consumptive coagulopathy, and preeclampsia; normal levels were seen with uncomplicated pregnancy, oral anticoagulant therapy, hereditary antithrombin III (AT III) deficiency, and in 31 patients evaluated for a thrombotic tendency. Except in hereditary AT III deficiency, decreased HC II activity was associated with decreased AT III activity. The potential clinical role of this assay is discussed.

Topics: Antithrombin III; Antithrombin III Deficiency; Antithrombins; Dermatan Sulfate; Disseminated Intravascular Coagulation; Female; Glycoproteins; Heparin Cofactor II; Humans; Liver Diseases; Methods; Pre-Eclampsia; Pregnancy; Thrombosis; Warfarin

Topics: Adult; Antithrombin III Deficiency; Cerebral Infarction; Drug Evaluation; Humans; Male; Thrombophlebitis; Warfarin

We report on a newly diagnosed family with hereditary antithrombin III deficiency, with thromboembolic complications in the propositus. Both the propositus and his asymptomatic sister had decreased plasma levels of antithrombin III antigen and activity (28-52% of normal with good agreement between functional and immunologic assays). The propositus developed deep venous thrombosis, followed by massive pulmonary emboli despite heparin therapy and was treated with streptokinase and heparin with excellent results. Shortly thereafter, small bowel obstruction required surgical intervention, and antithrombin III concentrate, recently available in the United States as an investigational new drug (I.N.D.), was administered with no postoperative thrombotic complications. He was subsequently asymptomatic while on warfarin prophylaxis but twice developed venous thrombosis when he failed to take warfarin. The addition of danazol therapy led to a sustained rise in the antithrombin III level. Each of these therapeutic approaches is discussed and the literature reviewed with emphasis on the newer agents--streptokinase, antithrombin III concentrate, and danazol.

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; Danazol; Humans; Male; Warfarin

The pregnancy and the serum antithrombin III levels during the antenatal and postpartum period of two patients with hereditary antithrombin III deficiency is described. Both antithrombin III antigen and activity levels dropped to their lowest levels immediately after delivery. A review of the literature emphasizes the high risk for thromboembolism in patients with hereditary antithrombin III deficiency. Important considerations for the obstetrician concerning hereditary antithrombin III deficiency are discussed, including: 1) the need to therapeutically anticoagulate these patients postpartum, 2) the need to consider prophylactic anticoagulation throughout pregnancy especially in patients with a history of thrombosis, 3) the practical aspects of assaying antithrombin III in plasma rather than serum, 4) the normally low antithrombin III levels in normal newborns, and 5) the need to provide prepregnancy counseling, including information about the autosomal dominant inheritance of hereditary antithrombin III deficiency.

Topics: Adult; Anticoagulants; Antigens; Antithrombin III; Antithrombin III Deficiency; Female; Humans; Mesenteric Veins; Postpartum Period; Pregnancy; Pregnancy Complications, Hematologic; Pulmonary Embolism; Risk; Thrombophlebitis; Thrombosis; Warfarin

A case of cerebral venous thrombosis with familial antithrombin III (AT III) deficiency was reported and we discussed the anticoagulant therapy of cerebral venous thrombosis from the viewpoint of AT III. The patient, a 17-year-old boy, was admitted to our clinic with severe bifrontal headache, generalized convulsions and progressive disturbance of consciousness. He developed deep vein thrombosis in his right leg and pulmonary emboli two years earlier when he was placed on heparin and so forth, followed by warfarin sodium. Warfarin was terminated 9 months prior to his recent illness. On neurological examination on admission, he was semicomatous with blurred disc margins, roving eye movements with right abducens nerve palsy, nuchal stiffness and right flaccid hemiplegia. Left carotid angiogram and CT scan revealed extensive superior sagittal sinus thrombosis, complicated with hemorrhagic infarcts in bilateral frontal lobes. When examined for coagulation studies, the patient and his father had decrease in AT III activity and antigen levels. He was treated successfully with antiedematous agents and anticonvulsants during acute phase of illness. He was thereafter placed on warfarin 5-6 mg/day with no further clinical thromboembolic event for 2 years 9 months. There was no neurological abnormality when he was last examined, although he was treated with valproic acid 1,200 mg/day and phenytoin 250 mg/day to control occasional adversive seizures. A coagulation study following infusion of 5,000 units of AT III was carried out. Warfarin was discontinued the day before the study. 0.64 U/kg of AT III administration resulted in a 1% increase in AT III level after the infusion. The biological half life of AT III was 14.4 hours.(ABSTRACT TRUNCATED AT 250 WORDS)

Topics: Adolescent; Antithrombin III; Antithrombin III Deficiency; Humans; Male; Sinus Thrombosis, Intracranial; Tomography, X-Ray Computed; Warfarin

Plasma antithrombin (AT) measured as heparin cofactor activity decreased 0.16 +/- 0.13 U/ml (mean +/- SD) in 198 patients who received heparin infusion during 1 wk for deep venous thrombosis (DVT). The decrease was weakly, but significantly correlated to heparin dose (r = 0.15, p = 0.02) and to heparin plasma concentration (r = 0.12, p = 0.05). In patients with subnormal AT at start of heparin treatment, AT decreased less and tended to normalize at the end of heparin infusion, suggesting increased synthetic rate. The decrease in AT was apparently unrelated to the extension or the fate of the thrombus, and also unrelated to other patient and disease characteristics apart from a significantly higher decrease in diabetics. 5 out of 9 patients with AT values below 0.60 U/ml had serious disease, and 1 died from pulmonary embolism (PE) shortly after cessation of heparin (AT 0.22 U/ml). We conclude that the main decrease in AT occurs during the initial 3 d of heparin treatment. If AT stays above 0.70 U/ml after 3 d of treatment, further AT monitoring is hardly indicated.

Topics: Adult; Antithrombin III Deficiency; Diabetes Complications; Female; Heparin; Humans; Infusions, Parenteral; Male; Middle Aged; Prognosis; Thrombosis; Warfarin

A patient with antithrombin III (ATT) deficiency after arterial embolism manifested an increasing requirement for heparin to adjust a partial thromboplastin time. This was corrected by dramatically increasing doses of heparin and by conversion to warfarin sodium. "Heparin-resistance" should direct the physician to examine antithrombin III levels, and ATT levels should be determined as a baseline before anticoagulation therapy.

Topics: Antithrombin III Deficiency; Femoral Artery; Heparin; Humans; Male; Middle Aged; Partial Thromboplastin Time; Thromboembolism; Warfarin

Two patients with familial antithrombin III deficiency developed deep venous thrombosis of the lower limb. The diagnosis of venous thrombosis was made by the indium labelled platelet technique which also allowed for the daily assessment of thrombus size. Each patient received treatment with Warfarin, subcutaneous heparin, and infusions of antithrombin III concentrates. The authors conclude that infusions of antithrombin III concentrates may be of value in limiting the extent of acute thrombosis in patients with a severe deficiency of this protein and may help prevent pulmonary embolism. The haemorrhagic risk of continuing modest doses of heparin with high dose ATIII therapy appears small. In addition to its value in the diagnosis of venous thrombosis the indium platelet technique may give an early indication of thrombus extension and may thus indicate the effectiveness of treatment.

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; Blood Platelets; Heparin; Humans; Indium; Leg; Male; Middle Aged; Pulmonary Embolism; Radioisotopes; Radionuclide Imaging; Thrombophlebitis; Warfarin

Topics: Adult; Antithrombin III Deficiency; Female; Humans; Middle Aged; Thrombophlebitis; Thrombosis; Warfarin

Antithrombin III is the major physiological inhibitor of the coagulation mechanism and a deficiency of this protein results in a marked predisposition to venous thromboembolic disease. Three Scottish families with a deficiency of this protein are described and other reported families are reviewed. The properties, functions and methods of assay of antithrombin III are outlined; the molecular abnormalities, inheritance, clinical and laboratory characteristics of antithrombin III deficiency are described, and the use of antithrombotic drugs and human antithrombin III concentrates in this deficiency is discussed.

Topics: Adolescent; Adult; Aged; Antithrombin III; Antithrombin III Deficiency; Child; Female; Humans; Male; Middle Aged; Pedigree; Pregnancy; Pregnancy Complications, Hematologic; Pulmonary Embolism; Thrombophlebitis; Warfarin

The catabolism of purified radiolabelled antithrombin III (AT III) concentrate was studied in two normals and two patients with congenital AT III deficiency both alone and combined with warfarin. The radiolabelling with iodine monochloride did not change the quality of the concentrate. The half-life varied between 3.4 and 4.8 days. No difference between normals and patients with congenital deficiency in non-acute stage could be observed in the catabolic parameters; nor was there any influence with warfarin.

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; Humans; Immunoelectrophoresis, Two-Dimensional; Iodine Radioisotopes; Kinetics; Male; Middle Aged; Radioisotope Dilution Technique; Warfarin

Antithrombin III is a potent coagulant inhibitor in plasma. Congenital deficiency of antithrombin III may predispose to thrombotic events and may complicate surgical management. We describe a patient with congenital antithrombin III deficiency who developed superior mesenteric vein thrombosis after the cessation of warfarin therapy which resulted in venous gangrene of the small intestine. Initial treatment of this deficiency with fresh frozen plasma and subsequent long-term management with warfarin therapy has been effective in avoiding further thrombotic events.

Topics: Adult; Antithrombin III Deficiency; Blood Coagulation Disorders; Blood Transfusion; Child; Female; Gangrene; Humans; Intestine, Small; Male; Mesenteric Veins; Pedigree; Thrombosis; Warfarin

Two cases of acute aortic thrombosis, a previously unreported complication of antithrombin III deficiency, are reported. Both patients had abnormally low antithrombin III levels, which improved to normal levels with warfarin ;sodium therapy. The possibility of antithrombin III deficiency should be considered in young patients with acute arterial thrombosis.

Topics: Acute Disease; Adult; Antithrombin III; Antithrombin III Deficiency; Aorta, Abdominal; Aortic Diseases; Female; Humans; Infarction; Intermittent Claudication; Kidney; Male; Thrombosis; Warfarin

Familial antithrombin III deficiency, which is inherited by autosomal dominant transmission, is now well recognized as a cause of recurrent venous thromboembolism. Many such families have now been described, but few came from Asia. This report details a Chinese kindred with three members living in Sydney, two of whom are affected.

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; China; Female; Humans; Male; Thrombophlebitis; Warfarin

A family with a tendency to thrombosis and decreased antithrombin III (AT III) activity in plasma, but normal immunoreactive AT III is reported. 7 members of the family had the AT III defect, 4 of whom have had thrombotic episodes. The importance of biological determination of AT III when studying patients with recurrent thrombotic episodes is emphasized.

Topics: Adult; Antithrombin III; Antithrombin III Deficiency; Female; Humans; Male; Middle Aged; Pedigree; Pulmonary Embolism; Recurrence; Thrombophlebitis; Warfarin

A 60-year old man with familial antithrombin III deficiency, a primary cause of hypercoagulation, developed central retinal vein occlusion. Familial antithrombin III deficiency is inherited as an autosomal dominant condition. It is characterized by recurrent episodes of thromboembolism. The occurrence of central retinal vein occlusion in a person with familial deficiency of antithrombin III suggests the possibility of a casual relationship.

Topics: Animals; Antithrombin III Deficiency; Humans; Intraocular Pressure; Male; Middle Aged; Pedigree; Retinal Vein; Thrombosis; Visual Acuity; Warfarin