rifampin and AIDS-Related-Opportunistic-Infections

The treatment of latent tuberculosis infection (LTBI) has been established as valid for patients at high risk for developing active tuberculosis. Treatment of LTBI is also considered an important strategy for eliminating tuberculosis (TB) in Japan. In recent years, interferon-gamma release assays have come into widespread use; isoniazid (INH) preventive therapy for HIV patients has come to be recommended worldwide; and there have been increases in both types of biologics used in the treatment of immune diseases as well as the diseases susceptible to treatment. In light of the above facts, the Prevention Committee and the Treatment Committee of the Japanese Society for Tuberculosis have jointly drafted these guidelines. In determining subjects for LTBI treatment, the following must be considered: 1) risk of TB infection/ development; 2) infection diagnosis; 3) chest image diagnosis; 4) the impact of TB development; 5) the possible manifestation of side effects; and 6) the prospects of treatment completion. LTBI treatment is actively considered when relative risk is deemed 4 or higher, including risk factors such as the following: HIV/AIDS, organ transplants (immunosuppressant use), silicosis, dialysis due to chronic renal failure, recent TB infection (within 2 years), fibronodular shadows in chest radiographs (untreated old TB), the use of biologics, and large doses of corticosteroids. Although the risk is lower, the following risk factors require consideration of LTBI treatment when 2 or more of them are present: use of oral or inhaled corticosteroids, use of other immunosuppressants, diabetes, being underweight, smoking, gastrectomy, and so on. In principle, INH is administered for a period of 6 or 9 months. When INH cannot be used, rifampicin is administered for a period of 4 or 6 months. It is believed that there are no reasons to support long-term LTBI treatment for immunosuppressed patients in Japan, where the risk of infection is not considered markedly high. For pregnant women, HIV-positive individuals, heavy drinkers, and individuals with a history of liver injury, regular liver function tests are necessary when treatment is initiated and when symptoms are present. There have been reports of TB developing during LTBI treatment; therefore, attention should be paid to TB development symptoms. When administering LTBI treatment, patients must be educated about side effects, the risk of developing TB onset, and the risks associated with discontinuing m

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; HIV Infections; Humans; Immunosuppressive Agents; Isoniazid; Japan; Latent Tuberculosis; Patient Education as Topic; Practice Guidelines as Topic; Rifampin; Risk Factors; Tuberculosis Societies

Rapid progress has been made in the development of new diagnostic assays for tuberculosis in recent years. New technologies have been developed and assessed, and are now being implemented. The Xpert MTB/RIF assay, which enables simultaneous detection of Mycobacterium tuberculosis (MTB) and rifampicin (RIF) resistance, was endorsed by WHO in December, 2010. This assay was specifically recommended for use as the initial diagnostic test for suspected drug-resistant or HIV-associated pulmonary tuberculosis. By June, 2012, two-thirds of countries with a high tuberculosis burden and half of countries with a high multidrug-resistant tuberculosis burden had incorporated the assay into their national tuberculosis programme guidelines. Although the development of the Xpert MTB/RIF assay is undoubtedly a landmark event, clinical and programmatic effects and cost-effectiveness remain to be defined. We review the rapidly growing body of scientific literature and discuss the advantages and challenges of using the Xpert MTB/RIF assay in areas where tuberculosis is endemic. We also review other prospects within the developmental pipeline. A rapid, accurate point-of-care diagnostic test that is affordable and can be readily implemented is urgently needed. Investment in the tuberculosis diagnostics pipeline should remain a major priority for funders and researchers.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Cost of Illness; Cost-Benefit Analysis; Drug Resistance, Bacterial; Global Health; Health Care Costs; Humans; Mycobacterium tuberculosis; Nucleic Acid Amplification Techniques; Point-of-Care Systems; Predictive Value of Tests; Rifampin; Sputum; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

The global control of tuberculosis remains a challenge from the standpoint of diagnosis, detection of drug resistance, and treatment. This is an area of special concern to the health of women and children, particularly in regions of the world with high infant mortality rates and where women have limited access to health care.. Because treatment can only be initiated when infection is detected, and is guided by the results of antimicrobial susceptibility testing, there recently has been a marked increase in the development and testing of novel assays designed to detect Mycobacterium tuberculosis complex, with or without simultaneous detection of resistance to isoniazid and/or rifampin. Both nonmolecular and molecular assays have been developed. This review will summarize the current knowledge about the use of rapid tests to detect M tuberculosis and drug resistance.. Review of the most recent World Health Organization Global Tuberculosis Report, as well as selected publications in the primary research literature, meta-analyses, and review articles.. To a large extent, nonmolecular methods are refinements or modifications of conventional methods, with the primary goal of providing more rapid test results. In contrast, molecular methods use novel technologies to detect the presence of M tuberculosis complex and genes conferring drug resistance. Evaluations of molecular assays have generally shown that these assays are of variable sensitivity for detecting the presence of M tuberculosis complex, and in particular are insensitive when used with smear-negative specimens. As a group, molecular assays have been shown to be of high sensitivity for detecting resistance to rifampin, but of variable sensitivity for detecting resistance to isoniazid.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Child, Preschool; Coinfection; Comorbidity; DNA, Bacterial; Drug Resistance, Bacterial; Female; Global Health; HIV; Humans; Infant; Isoniazid; Meta-Analysis as Topic; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Rifampin; Time Factors; Tuberculosis; Women's Health

Nine months of daily isoniazid is efficacious in treating latent M. tuberculosis infection, but completion rates are low, limiting treatment effectiveness. In 2011, three important studies were published involving novel regimens for the treatment of latent M. tuberculosis infection. At least 36 months of isoniazid was more effective than 6 months of isoniazid in one study, but not in another-both of which were conducted among tuberculin skin test positive HIV-infected adults living in high tuberculosis incidence settings. Three months of once-weekly isoniazid plus rifapentine or twice-weekly isoniazid plus rifampin (both given under direct observation) resulted in tuberculosis rates similar to those seen with 6 months of isoniazid among HIV-infected persons in high tuberculosis incidence settings. Three months of once-weekly, directly-observed isoniazid plus rifapentine was at least as effective as 9 months of daily isoniazid among predominantly HIV-uninfected persons living in low and medium tuberculosis incidence countries. The 3-month once-weekly isoniazid plus rifapentine regimen demonstrates promise for treatment of latent M. tuberculosis infection in HIV-infected persons.

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Drug Administration Schedule; Drug Therapy, Combination; Female; Humans; Isoniazid; Latent Tuberculosis; Male; Rifampin; Time Factors; Treatment Outcome; Tuberculin Test; Tuberculosis, Multidrug-Resistant

Intermittent tuberculosis treatment regimens have been developed to facilitate treatment supervision. Their efficacy has been substantiated by clinical trials and tuberculosis control programmes, notwithstanding the lack of head-to-head comparison between daily and intermittent regimens. Recently, there has been opposing evidence from observational studies, pharmacokinetic-pharmacodynamic studies and animal models that intermittent treatment increases the risk of relapse, treatment failure or acquired rifamycin resistance, especially among HIV-infected patients. Systematic reviews have been conflicting. PubMed, Ovid MEDLINE and EMBASE were systematically searched for publications in English to evaluate the evidence about dosing schedules and treatment efficacy. Levels of evidence and grades of recommendation were assigned largely according to clinical evidence with reference to the Scottish Intercollegiate Guidelines Network guideline development handbook. A total of 32 articles were included after excluding 331 ineligible articles, 42 non-analytical studies, 22 narrative reviews or expert opinions and 44 articles embedded in systematic reviews. These included 9 systematic reviews, 8 controlled studies, 9 pharmacokinetic-pharmacodynamic studies, 5 mouse studies and 1 article about guinea pig experiments. Findings suggest high levels of evidence for using daily dosing schedules, especially during the initial phase in the presence of cavitation, isoniazid resistance and advanced HIV co-infection, to reduce the risk of treatment failure, recurrence and acquired drug resistance including acquired rifamycin resistance. This review justifies the use of daily schedules in standard tuberculosis treatment regimens (particularly in the initial phase), corroborates prevailing understanding of pharmacokinetics-pharmacodynamics and mycobacterial persisters, and supports exploration of rifapentine-containing regimens in higher dosages and frequency.

Topics: AIDS-Related Opportunistic Infections; Animals; Antitubercular Agents; Child; Disease Models, Animal; Drug Administration Schedule; Humans; Isoniazid; Rifampin; Treatment Outcome; Tuberculosis; Tuberculosis, Multidrug-Resistant

Coadministration of antitubercular and antiretroviral therapy is common in high-burden countries where tuberculosis is the commonest opportunistic infection. Concomitant use of rifampicin and many antiretroviral drugs is complicated by drug-drug interactions caused by the potent induction by rifampicin of genes involved in drug metabolism and transport, which could result in subtherapeutic antiretroviral drug concentrations. This review focuses on drug-drug interactions involving antiretrovirals used in resource-limited settings: the non-nucleoside reverse transcriptase inhibitors (NNRTIs) efavirenz or nevirapine, and ritonavir-boosted protease inhibitors. The reduction of nevirapine concentrations with concomitant rifampicin is greater than with efavirenz, particularly during the lead-in dose period when subtherapeutic concentrations occur in the majority of patients. There is reassuring data on the effectiveness of standard doses of efavirenz with concomitant rifampicin, but the largest cohort study found a higher risk of virological failure with nevirapine. The drug-drug interaction between rifampicin and ritonavir-boosted protease inhibitors is more marked than with the NNRTIs, and therapeutic concentrations have only been achieved with adjusted doses of lopinavir/ritonavir or with saquinavir/ritonavir (400/400 mg every 12 h). The major barrier to using adjusted dose protease inhibitors with rifampicin is the high rates of hepatotoxicity seen in healthy volunteers. The alternative strategy followed in resource-rich settings is to replace rifampicin with rifabutin, but even if the price of rifabutin were to be dramatically reduced it would be difficult to implement in high-burden countries where standardized antitubercular regimens with fixed-dose combinations are used.

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Drug Interactions; Drug Therapy, Combination; HIV Infections; Humans; Randomized Controlled Trials as Topic; Reverse Transcriptase Inhibitors; Rifampin; Treatment Outcome; Tuberculosis

Access to antiretroviral therapy is rapidly expanding in resource-limited settings, where tuberculosis is the most common opportunistic infection. Coadministration of antitubercular and antiretroviral agents is, therefore, occurring commonly, and it is associated with 3 major complications. First, induction of cytochrome P-450 enzymes and P-glycoprotein by rifampin results in reduced concentrations of nonnucleoside reverse-transcriptase inhibitors and, particularly, protease inhibitors. This potentially results in the loss of antiviral efficacy and the development of viral resistance. Replacing rifampin with rifabutin, which does not significantly affect the concentrations of antiretroviral agents, is advocated but is currently unaffordable in resource-limited settings. Second, overlapping toxicities of antitubercular and antiretroviral agents occur frequently, necessitating discontinuation of therapy and increasing the risk of nonadherence. Third, immunopathological reactions, termed "the immune reconstitution inflammatory syndrome," occur frequently when antiretroviral therapy is initiated in patients with tuberculosis. These complexities of coadministration of antitubercular and antiretroviral agents are reviewed, and research priorities are highlighted.

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; ATP Binding Cassette Transporter, Subfamily B, Member 1; Cytochrome P-450 Enzyme System; Developing Countries; Drug Interactions; Drug Resistance, Viral; Enzyme Induction; HIV; Humans; Immune System Diseases; Inflammation; Protease Inhibitors; Reverse Transcriptase Inhibitors; Rifampin; Rifamycins; Tuberculosis

The current 6-month tuberculosis (TB) therapy is suboptimal with significant side effects and a poor patient compliance problem that frequently selects drug-resistant organisms. The increasing drug-resistant TB problem highlights the need to develop new and more effective drugs. Significant progress has been made recently with several new drug candidates currently in clinical trials. Improved understanding of persister biology and development of persister drugs are likely to be important for developing a more effective therapy.

Topics: Adamantane; AIDS-Related Opportunistic Infections; Animals; Anti-Bacterial Agents; Antitubercular Agents; Drug Administration Schedule; Drug Resistance, Bacterial; Drug Therapy, Combination; Drugs, Investigational; Ethylenediamines; Extensively Drug-Resistant Tuberculosis; Fluoroquinolones; Humans; Isoniazid; Mycobacterium tuberculosis; Nitroimidazoles; Oxazoles; Pyrazinamide; Rifampin; Treatment Refusal; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Because of the increasing availability of antiretroviral (ARV) agents for HIV in low-income countries, many clinicians now need training on their use. This is especially true for clinicians caring for individuals with tuberculosis (TB), given its close relationship with HIV/AIDS. This article summarizes the key decisions facing clinicians who manage HIV-infected persons, with particular reference to issues regarding those dually infected with TB. Health care provider-initiated diagnostic testing using rapid HIV tests should be offered to all individuals with symptoms and signs suggesting HIV infection, including all persons with TB. Issues to be included in pre- and post-test counseling sessions are discussed. HIV-infected patients should be evaluated to determine clinical staging of HIV; certain laboratory examinations should ideally be performed to assess the degree of immunosuppression and to aid decisions about when best to start ARV therapy and preventive therapies. The recommended ARV regimens and guidance on proposed patient follow-up are presented. Good adherence to ARVs is required and factors that induce and reinforce compliance are suggested. The treatment of TB is a high priority, and follows the same principles whether the patient is HIV-infected or not. Suggestions are made about ARV use in patients with TB. A standardized and complementary information system should be developed to monitor management of HIV-TB patients and performance of joint TB and HIV care efforts. By diagnosing and managing additional HIV cases detected through the portal of the TB control programme, clinicians will contribute to diminishing the burden of HIV, and thus, TB.

Topics: Acquired Immunodeficiency Syndrome; AIDS-Related Opportunistic Infections; Anti-Retroviral Agents; Antibiotics, Antitubercular; Comorbidity; HIV Infections; Humans; Patient Compliance; Poverty Areas; Reverse Transcriptase Inhibitors; Rifampin; Tuberculosis

Tuberculosis and other mycobacterial diseases are frequent coinfections in AIDS patients with an increased related mortality. In this review we have updated the treatment of the main mycobacterial diseases (tuberculosis and Mycobacterium avium disease), under the scope of pharmacological interactions between antimycobacterial drugs, specially rifampicin and clarithromycin, and anti-retroviral drugs. Antimycobacterial treatment schemes, their duration, primary and secondary chemoprophylaxis and the optimal time to start the anti-retroviral therapy are analized. Finally, the immnune reconstitution inflammatory syndrome and its treatment are discussed.

Topics: Acquired Immunodeficiency Syndrome; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Anti-Retroviral Agents; Clarithromycin; Drug Interactions; Humans; Mycobacterium Infections; Rifampin; Tuberculosis

The administration of isoniazid (INH) has been proposed, evaluated and implemented to prevent tuberculosis (TB) disease among patients who are infected with the human immunodeficiency virus (HIV). This strategy has been developed in communities where TB is highly endemic and at a time when antiretroviral (ARV) treatment was not, or was rarely available. Although INH prevention programmes were somewhat pushed to the background due to the worldwide advocacy for ARV drugs, prevention of TB remains of paramount importance. The dual HIV-TB infection poses problems, not only for the individual and his/her clinician but also for the programme manager. We review various aspects of TB preventive treatment in countries with a high prevalence of HIV-TB co-infection and limited resources but with increasing access to ARV treatment.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antiretroviral Therapy, Highly Active; Antitubercular Agents; CD4 Lymphocyte Count; Developing Countries; Drug Therapy, Combination; Humans; Isoniazid; Rifampin; Tuberculosis

Several rifamycin derivatives have been developed during the last 15 years for the treatment of mycobacterial infections. For tuberculosis, rifabutin (RFB) showed strong activity and seemed to be suitable when tuberculosis patients were also treated for their AIDS infection. Rifapentine (RPT) was evaluated in patients with or without AIDS for its intermittent use. It displayed promising activity but must be strengthened in situations, such as AIDS or patients without AIDS but with cavities. Rifalazil (RLZ) has been evaluated in mice but the dosages used were much higher than those tolerated by patients. Regarding Mycobacterium avium infections, RFB showed significant prophylactic activity in humans, RPT displayed some activity in mice and RLZ showed modest activity in mice.

Topics: AIDS-Related Opportunistic Infections; Animals; Disease Models, Animal; Drug Evaluation, Preclinical; France; Humans; Meta-Analysis as Topic; Mycobacterium avium-intracellulare Infection; Randomized Controlled Trials as Topic; Rifampin; Switzerland; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; BCG Vaccine; Drug Therapy, Combination; Ethambutol; France; Humans; Isoniazid; Mycobacterium tuberculosis; Rifampin; Tuberculin Test; Tuberculosis; Tuberculosis, Pulmonary

Clinically significant interactions occurring during antituberculous chemotherapy principally involve rifampicin (rifampin), isoniazid and the fluoroquinolones. Such interactions between the antituberculous drugs and coadministered agents are definitely much more important than among antituberculous drugs themselves. These can be associated with consequences even amounting to therapeutic failure or toxicity. Most of the interactions are pharmacokinetic rather than pharmacodynamic in nature. The cytochrome P450 isoform enzymes are responsible for many interactions (especially those involving rifampicin and isoniazid) during drug biotransformation (metabolism) in the liver and/or intestine. Generally, rifampicin is an enzyme inducer and isoniazid acts as an inhibitor. The agents interacting significantly with rifampicin include anticoagulants, anticonvulsants, anti-infectives, cardiovascular therapeutics, contraceptives, glucocorticoids, immunosuppressants, psychotropics, sulphonylureas and theophyllines. Isoniazid interacts principally with anticonvulsants, theophylline, benzodiapines, paracetamol (acetaminophen) and some food. Fluoroquinolones can have absorption disturbance due to a variety of agents, especially the metal cations. Other important interactions of fluoroquinolones result from their enzyme inhibiting potential or pharmacodynamic mechanisms. Geriatric and immunocompromised patients are particularly at risk of drug interactions during treatment of their tuberculosis. Among the latter, patients who are HIV infected constitute the most important group. This is largely because of the advent of new antiretroviral agents such as the HIV protease inhibitors and the non-nucleoside reverse transcriptase inhibitors in the armamenterium of therapy. Compounding the complexity of drug interactions, underlying medical diseases per se may also contribute to or aggravate the scenario. It is imperative for clinicians to be on the alert when treating tuberculosis in patients with difficult co-morbidity requiring polypharmacy. With advancement of knowledge and expertise, it is hoped that therapeutic drug monitoring as a new paradigm of care can enable better management of these drug interactions.

Topics: AIDS-Related Opportunistic Infections; Anti-Infective Agents; Antibiotics, Antitubercular; Antitubercular Agents; Drug Interactions; Fluoroquinolones; Humans; Rifampin; Tuberculosis

Rifampin is a potent inducer of cytochrome P-450 oxidative enzymes. A few examples of well-documented clinically significant interactions include interactions with warfarin, oral contraceptives, cyclosporine, glucocorticoids, ketoconazole or itraconazole, theophylline, quinidine sulfate, digitoxin or digoxin, verapamil hydrochloride, human immunodeficiency virus-related protease inhibitors, zidovudine, delavirdine mesylate, nifedipine, and midazolam. Recent reports have demonstrated clinically relevant interactions with numerous other drugs, such as buspirone hydrochloride, zolpidem tartrate, simvastatin, propafenone hydrochloride, tacrolimus, ondansetron hydrochloride, and opiates. Rifabutin reduces serum concentrations of antiretroviral agents, but less so than rifampin. To avoid a reduced therapeutic response, therapeutic failure, or toxic reactions when rifampin is added to or discontinued from medication regimens, clinicians need to be cognizant of these interactions. Enhanced knowledge of known interactions will continue to develop, including research on the induction of specific cytochrome P-450 isoenzymes and on the importance of the P-glycoprotein transport system. New rifampin and rifabutin interactions will be discovered with further investigations.

Topics: AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Anti-HIV Agents; Antibiotics, Antitubercular; Antiemetics; ATP Binding Cassette Transporter, Subfamily B, Member 1; Cardiovascular Agents; Cytochrome P-450 Enzyme System; Drug Interactions; Enzyme Induction; Enzyme Inhibitors; Humans; Immunosuppressive Agents; Narcotics; Psychotropic Drugs; Rifabutin; Rifampin

Six-month regimens that include rifampin for the treatment of tuberculosis in patients without human immunodeficiency virus (HIV) infection are recommended because of low percentage of relapses. Whether a similar duration of therapy should be used to treat tuberculosis in HIV-infected patients is unclear. Six studies of patients with HIV-infection and 3 of patients without HIV infection were reviewed and compared. The studies differed in terms of design, eligibility criteria, site of disease, frequency of dosing, dose administration methods, and outcome definitions. Among HIV-infected patients, the following percentages were found: cure, 59.4%--97.1%; treatment success, 34.0%--100%; effective treatment, 29.4%--88.2%; and relapse, 0%--10%. In those without HIV infection, percentages were as follows: cure, 62.3%--88.0%; treatment success, 91.2%--98.8%; effective treatment, 70.6%--83.8%; and relapse, 0%--3.4%. Although the rate of relapse appeared to be higher in some studies of HIV-infected patients with tuberculosis, this review demonstrates the limitation in the use of relapse as the exclusive outcome of interest when comparing studies.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Clinical Trials as Topic; Humans; Patient Selection; Prospective Studies; Randomized Controlled Trials as Topic; Recurrence; Research Design; Rifampin; Treatment Outcome; Tuberculosis; Tuberculosis, Pulmonary

The highest burden of human immunodeficiency virus (HIV) related tuberculosis (TB) is in sub-Saharan Africa. HIV complicates several areas of TB control, one of which involves treatment and treatment outcome. Large patient numbers cause congestion on TB wards, there is increased morbidity, an increased risk of adverse drug reactions, an increased case fatality, and an increased recurrence of TB after treatment completion. TB Control Programmes have responded to these problems by taking actions such as abolishing thioacetazone and decentralising the initial phase of treatment to peripheral health centres and the community. Despite this response, there are three major on-going concerns which need to be addressed by research studies. There is a need to reduce case fatality rates focusing on 1) stronger treatment regimens, 2) adequacy of rifampicin levels when intermittent treatment regimens are used, and 3) adjunctive treatments. There is a need to reduce recurrent rates of TB by 1) determining the relative role of re-infection and reactivation as a cause of recurrence, 2) assessing the importance of duration and type of anti-TB treatment for the first episode of TB, and 3) determining the role of secondary isoniazid preventive therapy. There is a need to evaluate how best to decentralise treatment from the perspective of the health service and the patient. Research studies should be relevant to the needs and resources of TB control programmes, and should include pharmacokinetic studies, controlled clinical trials and operational research, including economic analysis and social science evaluation.

Topics: Africa South of the Sahara; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Drug Resistance, Bacterial; Drug Therapy, Combination; Government Programs; Humans; Isoniazid; Recurrence; Rifampin; Risk Factors; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; BCG Vaccine; Ethambutol; Forecasting; Humans; Immunocompetence; Isoniazid; Mass Screening; Patient Compliance; Rifampin; Risk Factors; Tuberculin Test; Tuberculosis

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Disease Susceptibility; HIV Infections; Humans; Polymorphism, Restriction Fragment Length; Rifampin; Tuberculosis; Tuberculosis, Multidrug-Resistant

Topics: AIDS-Related Opportunistic Infections; Animals; Antibiotics, Antitubercular; HIV-1; Humans; Rifabutin; Rifampin; Tuberculosis, Pulmonary

Tuberculosis is once more a subject of world wide preoccupation; since 1985 a disturbing recrudescence of this disease has been noted in numerous countries related to population growth and the worsening of poverty in those countries without natural resources, and disadvantaged groups living on the margins of society in rich countries, along with the occurrence of an epidemic of HIV (VIH). In numerous developed countries where tuberculosis no longer represents a public health problem, the care services have little by little been closed or re-orientated and the principles of treatment of tuberculosis have been forgotten. The direct consequence of this has often been inadequate treatment and its corollary: the emergence of strains multiresistant to Isoniazid and Rifampicin. If the current epidemiological tendencies are confirmed and no supplementary action is taken, the WHO (OMS) has estimated that during the ten years between 1990 and the millennium there will be 88 million new cases of tuberculosis and 30 million people will die of tuberculosis. However the tendencies can be reversed and tuberculosis could still be eliminated. The struggle against tuberculosis is a world wide emergency and the hope of controlling the situation before an increase in multiresistant strains which would render the trend irreversible, rests on a general application of correct and coherent national programmes. Such a programme as the UICTMR model had already been carried out as has the proof of their efficacy.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Developed Countries; Developing Countries; Global Health; Health Promotion; HIV Infections; Humans; Incidence; Isoniazid; Population Growth; Poverty; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary; World Health Organization

Changing incidence and nature of mycobacterial infections subsequent to the historical regression of tuberculosis and the acquired human immunodeficiency syndrome (AIDS) epidemic, as well as the development of new technical tools for molecular biology, have profoundly modified the methods used for the bacteriological diagnosis of mycobacteria infections. Although microscopic search for acid-fast bacilli, culture and antibiotic resistance tests on Löwenstein-Jensen medium remain the reference methods, more rapid and sophisticated methods are now available. Culture on radiolabeled media using the Bactec system has shortened the delay for positive culture and interpretable antibiotic sensitivity tests. Molecular techniques allow: 1) rapid identification of the most frequently isolated mycobacteria strains, including the most frequent laboratory contaminant M. gordonae, with genome probes; 2) genome typing of M. tuberculosis strains to trace interhuman transmission, detect recurrence or exogenous reinfection or demonstrate laboratory contamination; 3) rapid detection of rifampicin resistance; and 4) direct detection of M. tuberculosis and M. avium in pathological specimens. The role of mycobacteria in the environment causing opportunistic infections, atypical mycobacteria or non-tuberculosis mycobacteria (NTM), particularly the aviaire complex, has grown considerably. Isolation and identification relies on methods used to detect bacilli as well as blood cultures and analysis of fecal matter. NTM are naturally resistant to most of the antituberculosis antibiotics but are sometimes sensitive to aminoglycosides, fluoroquinolones or new macrolides.

Topics: AIDS-Related Opportunistic Infections; Aminoglycosides; Anti-Bacterial Agents; Anti-Infective Agents; Antitubercular Agents; Bacteriological Techniques; Culture Media; Drug Resistance, Microbial; Fluoroquinolones; Genome, Bacterial; Humans; Incidence; Macrolides; Microbial Sensitivity Tests; Molecular Biology; Mycobacterium avium; Mycobacterium avium Complex; Mycobacterium avium-intracellulare Infection; Mycobacterium Infections, Nontuberculous; Mycobacterium tuberculosis; Nontuberculous Mycobacteria; Radiopharmaceuticals; Recurrence; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Treatment of tuberculosis has three major goals: healing the patient, preventing selection of resistant strains and control transmission of tuberculosis. A 6 month regimen consisting of isoniazid, rifampin with addition of pyrazinamide for 2 months is the preferred treatment for pulmonary and extra-pulmonary tuberculosis. If resistance to isoniazid is suspected, ethambutol should be added until drug susceptibility studies become available. This treatment is effective in both HIV infected and uniinfected persons. Treatment failure is mostly related to lack of patient adherence to the drug regimen and to multidrug-resistant tuberculosis. The treatment of multidrug-resistant tuberculosis requires second line drugs which are less effective and poorly tolerated. Prevention of resistant tuberculosis needs adequate treatment of each case of tuberculosis and improving of the patient compliance.

Topics: Aged; AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Clinical Protocols; Drug Combinations; Ethambutol; Follow-Up Studies; HIV Seronegativity; Humans; Isoniazid; Patient Compliance; Patient Education as Topic; Pyrazinamide; Rifampin; Treatment Failure; Tuberculosis; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

This article reviews recent studies conducted outside the United States assessing the efficacy and safety of rifabutin in the treatment of tuberculosis (TB) in HIV-infected patients, in patients with newly diagnosed TB, and in patients with multidrug-resistant TB. A 6-month pilot study of 50 Ugandan patients with TB associated with HIV infection showed that rifabutin and rifampin were similarly effective with regard to conversion of sputum-smear findings (sputum conversion) and in bringing about clinical and radiologic improvement. Compared with rifampin, rifabutin showed potential for reducing the time to sputum conversion for these patients. Multicenter studies in five countries compared two rifabutin dosages (150 mg/d and 300 mg/d) with rifampin as part of a combination regimen for treatment of newly diagnosed TB in 935 patients. Rifabutin compared favorably with rifampin in sputum conversion; administration of 150 mg/d of rifabutin yielded good results and the fewest adverse effects. The use of rifabutin by 270 patients in five countries who had multidrug-resistant TB (approximately 90% of isolates tested were resistant to rifampin and isoniazid) was assessed in another study. For the majority of these patients, signs and symptoms diminished; one-third had bacteriologic conversions.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Clinical Trials as Topic; Humans; Pilot Projects; Rifabutin; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

The World Health Organization estimates that more than four million people worldwide are infected with both Mycobacterium tuberculosis and HIV. HIV infection is the strongest known risk factor for the development of tuberculosis (TB). Mechanisms for the development of active TB include the reactivation of latent infection, rapid progression in primary infection, and/or reinfection with Mycobacterium tuberculosis. Indeed, HIV-infected people with a positive tuberculin skin test have a 5-8% annual risk and a 30% or greater lifetime risk of developing TB. Case-finding and treatment, preventive therapy, the use of BCG, and environmental measures can, however, control TB. Emphasis in developing countries has been upon case-finding and treatment, and providing infants with BCG. Preventive therapy has not been recommended except for breastfeeding infants of mothers with pulmonary TB or other children under five years old living with infectious persons. The high incidence of TB in HIV-infected people in developing countries has, however, led to reconsideration of the role of preventive therapy as a public health strategy. The authors briefly discuss preventive therapy for TB in HIV-infected persons, research issues, and the international role of preventive therapy.

Topics: AIDS Serodiagnosis; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Humans; Isoniazid; Research; Rifampin; Tuberculin Test; Tuberculosis

During the last decade, there has been a marked increase in the number of gravity of tuberculosis cases both in developing countries and in industrialized nations. This is, in part, due to the acquired immune deficiency syndrome (AIDS) pandemic, but global economic depression, increased homelessness and declining control programmes have also contributed. One of the more insidious consequences of this resurgence has been the recent emergence and nosocomial transmission of multidrug-resistant strains of Mycobacterium tuberculosis, thus raising the possibility that untreatable forms of the disease may become widespread. Somewhat surprisingly, given the difficulties of working with this slow-growing pathogen, remarkable progress has been made in a relatively short time, in understanding the molecular epidemiology, the genetic basis, and the biochemical mechanisms of drug resistance. Furthermore, a number of promising molecular tools are now available to help counter tuberculosis and to further understanding.

Topics: AIDS-Related Opportunistic Infections; Amino Acid Sequence; Antitubercular Agents; Cross Infection; Developing Countries; Drug Resistance, Multiple; Humans; Microbial Sensitivity Tests; Molecular Sequence Data; Mycobacterium tuberculosis; Polymerase Chain Reaction; Rifampin; Risk Factors; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Rifabutin is a derivative of rifamycin S with activity against mycobacteria including atypical organisms such as Mycobacterium avium and M. intracellulare, also referred to as Mycobacterium avium-intracellulare complex (MAC). To date, rifabutin is the only drug to have been studied in large prospective placebo-controlled trials that has been shown to significantly reduce the incidence of disseminated MAC infection when administered prophylactically as a single agent to patients with acquired immune deficiency syndrome (AIDS). Initial studies also indicate that rifabutin may be a useful component of multiple drug regimens for the treatment of MAC infection, although further studies combining rifabutin with other recently available antimycobacterial drugs are required to determine the most effective regimens. When rifabutin is combined with at least two other antimycobacterial drugs, the combination appears to be of similar efficacy to rifampicin (rifampin)-containing regimens in patients with newly diagnosed pulmonary tuberculosis. Since available therapy for MAC infection in patients with AIDS is still suboptimal, rifabutin, at present the only first-line agent for prophylaxis against disseminated MAC infection in patients with advanced human immunodeficiency virus (HIV) infection, has the potential to make a valuable contribution to the continuing attempts to preserve the quality of life of patients with AIDS.

Topics: AIDS-Related Opportunistic Infections; Animals; Bacteria; Biological Availability; Drug Interactions; Half-Life; Humans; Intestinal Absorption; Metabolic Clearance Rate; Mycobacterium avium-intracellulare Infection; Rifabutin; Rifampin; Tissue Distribution; Tuberculosis, Pulmonary

A 57-year-old man with an HIV infection, diagnosed a year ago, complained of fever and cough. The haemoglobin level was 7.5 g/dl, white cell count 3800/microliters, T-helper cell count 60/microliters and the CD4-CD8 ratio 0.1. Erythrocyte sedimentation rate was raised to 21/39 mm. Bacteriological tests were at first negative. The chest radiograph showed slight widening of the upper mediastinum which further increased over the next 10 days, at which time it also revealed a shadow in the right upper lobe. Computed tomography suggested necrotizing mediastinal lymph-nodes. Treatment was begun with rifampicin (600 mg daily) ethambutol (1.2 g daily), pyrazinamide (1.5 g daily) and ciprofloxacin (500 mg twice daily). Oesophagoduodenoscopy, performed after 3 weeks, revealed several fistulae which, after ingestion of contrast medium, were demonstrated to communicate with the mediastinum, presumably as a result of lymph-node liquefaction. Mycobacterium tuberculosis was demonstrated in gastric juice, sputum and stool only after tuberculostatic drugs had been started.

Topics: AIDS-Related Opportunistic Infections; Ciprofloxacin; Drug Therapy, Combination; Esophageal Fistula; Ethambutol; Fistula; HIV-1; Humans; Male; Mediastinal Diseases; Middle Aged; Pyrazinamide; Rifampin; Tuberculosis, Lymph Node

Invasive aspergillosis is generally a life-threatening invasive opportunistic mycosis affecting principally the upper and lower respiratory tract. Therapeutic response rates vary considerably from one host group to another with particularly high mortality rates in bone marrow transplant, liver transplant and patients with aplastic anaemia or AIDS. Only two drugs are useful for therapy, amphotericin and itraconazole. Recent advances in the formulation of amphoterin B (AmBisome and Amphocil) have resulted in intravenous preparations with lower toxicity, particularly nephrotoxicity, but it has yet to be shown that they have an increased therapeutic index for the treatment of invasive aspergillosis. Itraconazole can only be used orally and in some particularly high-risk or critically ill patients adequate serum concentrations cannot be achieved. The addition of flucytosine or rifampicin to amphotericin B therapy has, at best, only a marginal benefit. Surgery is essential for some manifestations of invasive aspergillosis. This article reviews therapeutic strategies including criteria for initiation of therapy, combination and sequential therapy, duration of therapy and secondary prophylaxis and indications for surgery in invasive aspergillosis.

Topics: AIDS-Related Opportunistic Infections; Amphotericin B; Aspergillosis; Cholesterol Esters; Drug Carriers; Drug Therapy, Combination; Flucytosine; Humans; Immunocompromised Host; Infusions, Intravenous; Itraconazole; Liposomes; Opportunistic Infections; Rifampin

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Resistance, Microbial; Drug Therapy, Combination; HIV Infections; Humans; Isoniazid; Rifampin; Streptomycin; Tuberculosis; Tuberculosis, Pulmonary

Optimum treatment of tuberculosis in persons with human immunodeficiency virus (HIV) infection is still being defined. Tuberculosis treatment failure in an HIV-infected patient is described and 10 similar cases from the medical literature are reviewed to search for common patterns associated with an adverse outcome of therapy in this setting. Six patients were poorly compliant. In nine patients, the subsequent episode of tuberculosis was disseminated or extrapulmonary; in four the central nervous system was involved. In five patients, a problem with rifampin usage was encountered: Three had rifampin-resistant Mycobacterium tuberculosis, one experienced an adverse reaction to rifampin, leading to withdrawal from the regimen after 1 week, and one was receiving a drug that may interfere with rifampin's antimycobacterial effect. This case report and literature review suggest that particular attention should be directed toward ensuring that patients with HIV infection comply with treatment of tuberculosis. For the majority of patients, the already stretched resources available for the treatment of tuberculosis and HIV infection should be devoted to compliance enhancement rather than to more prolonged or intensive drug regimens. However, it should be emphasized that patients with disseminated tuberculosis or central nervous system disease and those who are not able to receive rifampin because of drug resistance or an adverse reaction should be managed individually.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Drug Therapy, Combination; Ethambutol; Female; HIV Seropositivity; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Pyrazinamide; Pyridoxine; Rifampin; Tuberculosis

Cohort studies in Bangladesh showed promising cure rates among patients with multidrug-resistant tuberculosis who received existing drugs in regimens shorter than that recommended by the World Health Organization (WHO) in 2011.. We conducted a phase 3 noninferiority trial in participants with rifampin-resistant tuberculosis that was susceptible to fluoroquinolones and aminoglycosides. Participants were randomly assigned, in a 2:1 ratio, to receive a short regimen (9 to 11 months) that included high-dose moxifloxacin or a long regimen (20 months) that followed the 2011 WHO guidelines. The primary efficacy outcome was a favorable status at 132 weeks, defined by cultures negative for. Of 424 participants who underwent randomization, 383 were included in the modified intention-to-treat population. Favorable status was reported in 79.8% of participants in the long-regimen group and in 78.8% of those in the short-regimen group - a difference, with adjustment for human immunodeficiency virus status, of 1.0 percentage point (95% confidence interval [CI], -7.5 to 9.5) (P = 0.02 for noninferiority). The results with respect to noninferiority were consistent among the 321 participants in the per-protocol population (adjusted difference, -0.7 percentage points; 95% CI, -10.5 to 9.1). An adverse event of grade 3 or higher occurred in 45.4% of participants in the long-regimen group and in 48.2% in the short-regimen group. Prolongation of either the QT interval or the corrected QT interval (calculated with Fridericia's formula) to 500 msec occurred in 11.0% of participants in the short-regimen group, as compared with 6.4% in the long-regimen group (P = 0.14); because of the greater incidence in the short-regimen group, participants were closely monitored and some received medication adjustments. Death occurred in 8.5% of participants in the short-regimen group and in 6.4% in the long-regimen group, and acquired resistance to fluoroquinolones or aminoglycosides occurred in 3.3% and 2.3%, respectively.. In persons with rifampin-resistant tuberculosis that was susceptible to fluoroquinolones and aminoglycosides, a short regimen was noninferior to a long regimen with respect to the primary efficacy outcome and was similar to the long regimen in terms of safety. (Funded by the U.S. Agency for International Development and others; Current Controlled Trials number, ISRCTN78372190; ClinicalTrials.gov number, NCT02409290.).

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Drug Therapy, Combination; Female; Humans; Intention to Treat Analysis; Kaplan-Meier Estimate; Male; Medication Adherence; Middle Aged; Moxifloxacin; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Tuberculosis is the leading killer of patients with human immunodeficiency virus (HIV) infection. Preventive therapy is effective, but current regimens are limited by poor implementation and low completion rates.. We conducted a randomized, open-label, phase 3 noninferiority trial comparing the efficacy and safety of a 1-month regimen of daily rifapentine plus isoniazid (1-month group) with 9 months of isoniazid alone (9-month group) in HIV-infected patients who were living in areas of high tuberculosis prevalence or who had evidence of latent tuberculosis infection. The primary end point was the first diagnosis of tuberculosis or death from tuberculosis or an unknown cause. Noninferiority would be shown if the upper limit of the 95% confidence interval for the between-group difference in the number of events per 100 person-years was less than 1.25.. A total of 3000 patients were enrolled and followed for a median of 3.3 years. Of these patients, 54% were women; the median CD4+ count was 470 cells per cubic millimeter, and half the patients were receiving antiretroviral therapy. The primary end point was reported in 32 of 1488 patients (2%) in the 1-month group and in 33 of 1498 (2%) in the 9-month group, for an incidence rate of 0.65 per 100 person-years and 0.67 per 100 person-years, respectively (rate difference in the 1-month group, -0.02 per 100 person-years; upper limit of the 95% confidence interval, 0.30). Serious adverse events occurred in 6% of the patients in the 1-month group and in 7% of those in the 9-month group (P = 0.07). The percentage of treatment completion was significantly higher in the 1-month group than in the 9-month group (97% vs. 90%, P<0.001).. A 1-month regimen of rifapentine plus isoniazid was noninferior to 9 months of isoniazid alone for preventing tuberculosis in HIV-infected patients. The percentage of patients who completed treatment was significantly higher in the 1-month group. (Funded by the National Institute of Allergy and Infectious Diseases; BRIEF TB/A5279 ClinicalTrials.gov number, NCT01404312.).

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; CD4 Lymphocyte Count; Drug Administration Schedule; Drug Therapy, Combination; Female; HIV Infections; Humans; Isoniazid; Latent Tuberculosis; Male; Medication Adherence; Rifampin; Tuberculosis

Current diagnostics for HIV-associated tuberculosis are suboptimal, with missed diagnoses contributing to high hospital mortality and approximately 374 000 annual HIV-positive deaths globally. Urine-based assays have a good diagnostic yield; therefore, we aimed to assess whether urine-based screening in HIV-positive inpatients for tuberculosis improved outcomes.. We did a pragmatic, multicentre, double-blind, randomised controlled trial in two hospitals in Malawi and South Africa. We included HIV-positive medical inpatients aged 18 years or more who were not taking tuberculosis treatment. We randomly assigned patients (1:1), using a computer-generated list of random block size stratified by site, to either the standard-of-care or the intervention screening group, irrespective of symptoms or clinical presentation. Attending clinicians made decisions about care; and patients, clinicians, and the study team were masked to the group allocation. In both groups, sputum was tested using the Xpert MTB/RIF assay (Xpert; Cepheid, Sunnyvale, CA, USA). In the standard-of-care group, urine samples were not tested for tuberculosis. In the intervention group, urine was tested with the Alere Determine TB-LAM Ag (TB-LAM; Alere, Waltham, MA, USA), and Xpert assays. The primary outcome was all-cause 56-day mortality. Subgroup analyses for the primary outcome were prespecified based on baseline CD4 count, haemoglobin, clinical suspicion for tuberculosis; and by study site and calendar time. We used an intention-to-treat principle for our analyses. This trial is registered with the ISRCTN registry, number ISRCTN71603869.. Between Oct 26, 2015, and Sept 19, 2017, we screened 4788 HIV-positive adults, of which 2600 (54%) were randomly assigned to the study groups (n=1300 for each group). 13 patients were excluded after randomisation from analysis in each group, leaving 2574 in the final intention-to-treat analysis (n=1287 in each group). At admission, 1861 patients were taking antiretroviral therapy and median CD4 count was 227 cells per μL (IQR 79-436). Mortality at 56 days was reported for 272 (21%) of 1287 patients in the standard-of-care group and 235 (18%) of 1287 in the intervention group (adjusted risk reduction [aRD] -2·8%, 95% CI -5·8 to 0·3; p=0·074). In three of the 12 prespecified, but underpowered subgroups, mortality was lower in the intervention group than in the standard-of-care group for CD4 counts less than 100 cells per μL (aRD -7·1%, 95% CI -13·7 to -0·4; p=0.036), severe anaemia (-9·0%, -16·6 to -1·3; p=0·021), and patients with clinically suspected tuberculosis (-5·7%, -10·9 to -0·5; p=0·033); with no difference by site or calendar period. Adverse events were similar in both groups.. Urine-based tuberculosis screening did not reduce overall mortality in all HIV-positive inpatients, but might benefit some high-risk subgroups. Implementation could contribute towards global targets to reduce tuberculosis mortality.. Joint Global Health Trials Scheme of the Medical Research Council, the UK Department for International Development, and the Wellcome Trust.

Topics: Adult; AIDS-Related Opportunistic Infections; Developing Countries; Double-Blind Method; Drug Resistance, Bacterial; Female; HIV Seropositivity; Humans; Malawi; Male; Mass Screening; Middle Aged; Rifampin; South Africa; Sputum; Tuberculosis; Urinalysis

Tuberculous meningitis is often lethal. Early antituberculosis treatment and adjunctive treatment with glucocorticoids improve survival, but nearly one third of patients with the condition still die. We hypothesized that intensified antituberculosis treatment would enhance the killing of intracerebral Mycobacterium tuberculosis organisms and decrease the rate of death among patients.. We performed a randomized, double-blind, placebo-controlled trial involving human immunodeficiency virus (HIV)-infected adults and HIV-uninfected adults with a clinical diagnosis of tuberculous meningitis who were admitted to one of two Vietnamese hospitals. We compared a standard, 9-month antituberculosis regimen (which included 10 mg of rifampin per kilogram of body weight per day) with an intensified regimen that included higher-dose rifampin (15 mg per kilogram per day) and levofloxacin (20 mg per kilogram per day) for the first 8 weeks of treatment. The primary outcome was death by 9 months after randomization.. A total of 817 patients (349 of whom were HIV-infected) were enrolled; 409 were randomly assigned to receive the standard regimen, and 408 were assigned to receive intensified treatment. During the 9 months of follow-up, 113 patients in the intensified-treatment group and 114 patients in the standard-treatment group died (hazard ratio, 0.94; 95% confidence interval, 0.73 to 1.22; P=0.66). There was no evidence of a significant differential effect of intensified treatment in the overall population or in any of the subgroups, with the possible exception of patients infected with isoniazid-resistant M. tuberculosis. There were also no significant differences in secondary outcomes between the treatment groups. The overall number of adverse events leading to treatment interruption did not differ significantly between the treatment groups (64 events in the standard-treatment group and 95 events in the intensified-treatment group, P=0.08).. Intensified antituberculosis treatment was not associated with a higher rate of survival among patients with tuberculous meningitis than standard treatment. (Funded by the Wellcome Trust and the Li Ka Shing Foundation; Current Controlled Trials number, ISRCTN61649292.).

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Double-Blind Method; Drug Resistance, Bacterial; Drug Therapy, Combination; Female; HIV Infections; Humans; Kaplan-Meier Estimate; Levofloxacin; Male; Middle Aged; Mycobacterium tuberculosis; Proportional Hazards Models; Rifampin; Tuberculosis, Meningeal

Hospitals in sub-Saharan Africa are inundated with HIV-infected patients and tuberculosis (TB) is the commonest opportunistic infection in this sub-group. Up to one third of TB-HIV co-infected patients fail to produce a sputum sample (sputum scarce) and diagnosis is thus often delayed or missed. We investigated the sensitivity of urine-based methods (Xpert MTB/RIF, LAM strip test and LAM ELISA) in such patients.. 281 HIV-infected hospitalised patients with clinically suspected TB provided a spot urine sample. The reference standard was culture positivity for Mycobacterium tuberculosis on ≥1 sputum or extra-pulmonary sample. MTB/RIF was performed using 1 ml of both unprocessed and, when possible, concentrated urine. Each unconcentrated urine sample was also tested using the Clearview LAM ELISA and Alere LAM strip test. 42% (116/242) of patients had culture-proven TB. 18% (20/54) were sputum scarce. In sputum-scarce patients, the sensitivity of urine MTB/RIF and LAM ELISA was 40% (95%CI: 22-61) and 60% (95%CI: 39-78), respectively. Urine MTB/RIF specificity was 98% (95%CI: 95-100). Combined sensitivity of urine LAM ELISA and MTB/RIF was better than MTB/RIF alone [MTB/RIF and LAM: 70% (95%CI: 48-85) vs. MTB/RIF: 40% (95%CI: 22-61), p = 0.03]. Significant predictors of urine MTB/RIF positivity were CD4<50 cells/ml (p = 0.001), elevated protein-to-creatinine ratio (p<0.001) and LAM ELISA positivity (p<0.001). Urine centrifugation and pelleting significantly increased the sensitivity of MTB/RIF over unprocessed urine in paired samples [42% (95%CI: 26-58) vs. 8% (95%CI: 0-16), p<0.001]. Urine MTB/RIF-generated C(T) values correlated poorly with markers of bacillary burden (smear grade and time-to-positivity).. This preliminary study indicates that urine-based MTB/RIF, alone or in combination with LAM antigen detection, may potentially aid the diagnosis of TB in HIV-infected patients with advanced immunosuppression when sputum-based diagnosis is not possible. Concentration of urine prior to MTB/RIF-testing significantly improves sensitivity.

Topics: Adult; AIDS-Related Opportunistic Infections; Antigens, Bacterial; Centrifugation; Drug Resistance, Bacterial; Enzyme-Linked Immunosorbent Assay; Feasibility Studies; HIV Infections; Hospitalization; Humans; Male; Mycobacterium tuberculosis; Reagent Strips; Rifampin; Sensitivity and Specificity; Sputum; Tuberculosis; Urinalysis

Concerns about the immune reconstitution inflammatory syndrome (IRIS) remain a barrier to antiretroviral therapy (ART) initiation during antituberculosis treatment in co-infected patients.. To assess IRIS incidence, severity, and outcomes relative to the timing of ART initiation in patients with HIV-related tuberculosis.. Randomized, open-label clinical trial. (ClinicalTrials.gov registration number: NCT00398996). An outpatient clinic in Durban, South Africa.. 642 patients co-infected with HIV and tuberculosis.. In a secondary analysis of the SAPiT (Starting Antiretroviral Therapy at Three Points in Tuberculosis) trial, IRIS was assessed in patients randomly assigned to initiate ART within 4 weeks of tuberculosis treatment initiation (early integrated treatment group), within 4 weeks of completion of the intensive phase of tuberculosis treatment (late integrated treatment group), or within 4 weeks after tuberculosis therapy completion (sequential treatment group). The syndrome was defined as new-onset or worsening symptoms, signs, or radiographic manifestations temporally related to treatment initiation, accompanied by a treatment response. Severity of IRIS, hospitalization, and time to resolution were monitored.. Incidence of IRIS was 19.5 (n = 43), 7.5 (n = 18), and 8.1 (n = 19) per 100 person-years in the early integrated, late integrated, and sequential treatment groups, respectively. Among patients with a baseline CD4+ count less than 0.050 × 109 cells/L, IRIS incidence was 45.5, 9.7, and 19.7 per 100 person-years in the early integrated, late integrated, and sequential treatment groups, respectively. Incidence of IRIS was higher in the early integrated treatment group than in the late integrated (incidence rate ratio, 2.6 [95% CI, 1.5 to 4.8]; P < 0.001) or sequential (incidence rate ratio, 2.4 [CI, 1.4 to 4.4]; P < 0.001) treatment groups. More severe IRIS cases occurred in the early integrated treatment group than in the other 2 groups (35% vs. 19%; P = 0.179), and patients in the early integrated treatment group had significantly higher hospitalization rates (42% vs. 14%; P = 0.007) and longer time to resolution (70.5 vs. 29.0 days; P = 0.001) than patients in the other 2 groups.. It was not possible to assess IRIS in more patients in the sequential treatment group (n = 74) than in the late integrated (n = 50) and early integrated (n = 32) treatment groups because of loss to follow-up, withdrawal, or death within 6 months of scheduled ART initiation. This study did not assess IRIS risk in nonambulatory patients or in those with extrapulmonary and smear-negative tuberculosis.. Initiation of ART in early stages of tuberculosis treatment resulted in significantly higher IRIS rates, longer time to resolution, and more severe cases of IRIS requiring hospitalization. These findings are particularly relevant to patients initiating ART with a CD4+ count less than 0.050 × 109 cells/L, given the increased survival benefit of early ART initiation in this group.. Comprehensive International Program of Research on AIDS.

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Retroviral Agents; Antibiotics, Antitubercular; CD4 Lymphocyte Count; Female; HIV Infections; Humans; Immune Reconstitution Inflammatory Syndrome; Immunocompromised Host; Incidence; Kaplan-Meier Estimate; Male; Prospective Studies; Rifampin; Risk Factors; Severity of Illness Index; Tuberculosis

Increasing efavirenz (EFV) dose from 600 mg to 800 mg daily has been suggested with concomitant rifampicin (RFN), as induction of cytochrome P450 isoenzymes may reduce EFV plasma concentrations.. Individuals from the CIPRA-South Africa cohort taking EFV-based antiretroviral therapy with concomitant tuberculosis (TB) were dosed with either increased (800 mg) or standard (600 mg) dose EFV during TB treatment. After TB therapy, all individuals took 600 mg EFV. Two mid-dosing interval EFV concentrations were determined from each individual: after 4 weeks of concomitant EFV and RFN therapy, and ≥4 weeks after TB therapy completion. Mid-dosing interval EFV concentrations were compared within individuals using the Wilcoxon signed-rank test.. Paired samples were collected from 72 individuals. Overall, 45 (63%) were women and median weight was 59 kg (IQR 52-67). At antiretroviral therapy start, median CD4(+) T-cell count was 114 cells/mm(3) (IQR 37-165), median viral load was 5.5 log (IQR 5.1-5.9). A total of 38 (53%) individuals took 800 mg EFV during TB treatment and 34 (47%) took 600 mg. EFV concentrations in the 800 mg group were higher with RFN (2.9 mg/l [IQR 1.8-5.6]) than without (2.1 mg/l [IQR 1.4-3.0]; P=0.0003). There was no significant difference in EFV concentrations with RFN (2.4 mg/l [IQR 1.2-5.1]) or without (2.2 mg/l [IQR 1.4-3.7]) in the 600 mg group. There was no increase in EFV-linked adverse effects in either group. The proportion of virologically suppressed individuals at 48 weeks was similar in both groups.. EFV concentrations were significantly increased in the EFV 800 mg group on RFN. There was no significant decrease in EFV concentrations when on RFN in the 600 mg group. Dose escalation of EFV 600 mg to 800 mg is not required during concomitant TB therapy in South Africa.

Topics: AIDS-Related Opportunistic Infections; Alkynes; Anti-HIV Agents; Antitubercular Agents; Benzoxazines; Cyclopropanes; Drug Administration Schedule; Drug Therapy, Combination; Female; HIV Infections; Humans; Male; Reverse Transcriptase Inhibitors; Rifampin; South Africa; Treatment Outcome; Tuberculosis

Treatment of latent tuberculosis in patients infected with the human immunodeficiency virus (HIV) is efficacious, but few patients around the world receive such treatment. We evaluated three new regimens for latent tuberculosis that may be more potent and durable than standard isoniazid treatment.. We randomly assigned South African adults with HIV infection and a positive tuberculin skin test who were not taking antiretroviral therapy to receive rifapentine (900 mg) plus isoniazid (900 mg) weekly for 12 weeks, rifampin (600 mg) plus isoniazid (900 mg) twice weekly for 12 weeks, isoniazid (300 mg) daily for up to 6 years (continuous isoniazid), or isoniazid (300 mg) daily for 6 months (control group). The primary end point was tuberculosis-free survival.. The 1148 patients had a median age of 30 years and a median CD4 cell count of 484 per cubic millimeter. Incidence rates of active tuberculosis or death were 3.1 per 100 person-years in the rifapentine-isoniazid group, 2.9 per 100 person-years in the rifampin-isoniazid group, and 2.7 per 100 person-years in the continuous-isoniazid group, as compared with 3.6 per 100 person-years in the control group (P>0.05 for all comparisons). Serious adverse reactions were more common in the continuous-isoniazid group (18.4 per 100 person-years) than in the other treatment groups (8.7 to 15.4 per 100 person-years). Two of 58 isolates of Mycobacterium tuberculosis (3.4%) were found to have multidrug resistance.. On the basis of the expected rates of tuberculosis in this population of HIV-infected adults, all secondary prophylactic regimens were effective. Neither a 3-month course of intermittent rifapentine or rifampin with isoniazid nor continuous isoniazid was superior to 6 months of isoniazid. (Funded by the National Institute of Allergy and Infectious Diseases and others; ClinicalTrials.gov number, NCT00057122.).

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Retroviral Agents; Antitubercular Agents; Cause of Death; Drug Administration Schedule; Drug Resistance, Bacterial; Drug Therapy, Combination; Female; Follow-Up Studies; HIV Infections; Humans; Isoniazid; Kaplan-Meier Estimate; Male; Mycobacterium tuberculosis; Patient Compliance; Proportional Hazards Models; Rifampin; Risk; Tuberculosis; Tuberculosis, Multidrug-Resistant

The outcome of fully intermittent thrice-weekly antituberculosis treatment of various durations in HIV-associated tuberculosis is unclear.. To compare the efficacy of an intermittent 6-month regimen (Reg6M: 2EHRZ(3)/4HR(3) [ethambutol, 1,200 mg; isoniazid, 600 mg; rifampicin, 450 or 600 mg depending on body weight <60 or > or =60 kg; and pyrazinamide, 1,500 mg for 2 mo; followed by 4 mo of isoniazid and rifampicin at the same doses]) versus a 9-month regimen (Reg9M: 2EHRZ(3)/7HR(3)) in HIV/tuberculosis (TB).. HIV-infected patients with newly diagnosed pulmonary or extrapulmonary TB were randomly assigned to Reg6M (n = 167) or Reg9M (n = 160) and monitored by determination of clinical, immunological, and bacteriological parameters for 36 months. Primary outcomes included favorable responses at the end of treatment and recurrences during follow-up, whereas the secondary outcome was death. Intent-to-treat and on-treatment analyses were performed. All patients were antiretroviral treatment-naive during treatment.. Of the patients, 70% had culture-positive pulmonary TB; the median viral load was 155,000 copies/ml and the CD4(+) cell count was 160 cells/mm(3). Favorable response to antituberculosis treatment was similar by intent to treat (Reg6M, 83% and Reg9M, 76%; P = not significant). Bacteriological recurrences occurred significantly more often in Reg6M than in Reg9M (15 vs. 7%; P < 0.05) although overall recurrences were not significantly different (Reg6M, 19% vs. Reg9M, 13%). By 36 months, 36% of patients undergoing Reg6M and 35% undergoing Reg9M had died, with no significant difference between regimens. All 19 patients who failed treatment developed acquired rifamycin resistance (ARR), the main risk factor being baseline isoniazid resistance.. Among antiretroviral treatment-naive HIV-infected patients with TB, a 9-month regimen resulted in a similar outcome at the end of treatment but a significantly lower bacteriological recurrence rate compared with a 6-month thrice-weekly regimen. ARR was high with these intermittent regimens and neither mortality nor ARR was altered by lengthening TB treatment. Clinical Trials Registry Information: ID# NCT00376012 registered at www.clinicaltrials.gov.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; CD4 Lymphocyte Count; Drug Administration Schedule; Drug Resistance, Multiple, Bacterial; Drug Therapy, Combination; Ethambutol; Female; HIV Infections; Humans; Isoniazid; Kaplan-Meier Estimate; Logistic Models; Male; Medication Adherence; Pyrazinamide; Rifampin; Tuberculosis; Viral Load

We compared the nutritional status of individuals with human immunodeficiency virus (HIV) infection alone, individuals with HIV infection and tuberculosis (after completion of antituberculosis treatment), and HIV-negative individuals and found that malnutrition, anemia, and hypoalbuminemia were most pronounced among HIV-positive patients with tuberculosis. Weight loss was associated with loss of fat in female patients and with loss of body cell mass in male patients.

Topics: Adult; AIDS-Related Opportunistic Infections; Anemia; Antitubercular Agents; Body Composition; Drug Therapy, Combination; Ethambutol; HIV Infections; HIV Seronegativity; Humans; Hypoalbuminemia; India; Isoniazid; Malnutrition; Nutritional Status; Pyrazinamide; Rifampin; Treatment Outcome; Tuberculosis, Pulmonary

To assess the drug concentrations, efficacy and safety of concomitant use of rifampicin and regimens containing ritonavir/saquinavir (400mg/400mg twice daily) in tuberculosis-HIV treatment-naive patients.. This was an open-label, non-randomised, multiple-dose study. On study day (D)1, tuberculosis treatment (rifampicin 600mg/isoniazid 400mg per day fasting plus pyrazinamide 2 g/day) was introduced in 30 patients. On D31, highly active antiretroviral therapy (HAART) consisting of two nucleoside analogues plus ritonavir/saquinavir 400mg/400mg twice daily was initiated (n = 20). The pharmacokinetics were assayed with a validated reversed-phase HPLC method before the introduction of HAART on D30 (for rifampicin), after 30 days of HAART at D60 (for rifampicin plus ritonavir/saquinavir), and at the end of the study (without rifampicin) on D210 (for ritonavir/saquinavir). Clinical evaluations were performed on a monthly basis. CD4 counts and viral load were collected on D30, D60 and D180. Genotyping test for HIV was collected at baseline and at D180. Primary endpoints were drug concentration and viral load at D180 (<80 copies/mL). Secondary endpoints were presence of grade 3 and serious adverse events, clinical improvement, CD4 count and genotypic resistance to ritonavir/saquinavir.. Ten patients dropped out of the study during tuberculosis therapy alone. Mean (+/- SD) baseline CD4 count (on D30) was 151.89 (+/- 146.77) cells/mm(3) and viral load was 5.34 (+/- 0.4) log. During the antiretroviral therapy, 15 patients dropped out, 14 because of adverse events. One patient (of five) presented a viral load of <80 copies/mL at D180. All but one patient increased CD4 counts from baseline. No genotypic resistance was detected. Clinical improvement was evident in all five patients who tolerated the therapy. Serum concentrations of ritonavir/saquinavir and rifampicin remained within the therapeutic range.. Therapeutic concentrations of the studied drugs and reduction of viral load were achieved; adverse events are the main limitation of use of a ritonavir/saquinavir regimen in treatment-naive patients, but its clinical benefits were evident.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antiretroviral Therapy, Highly Active; Area Under Curve; Bisexuality; CD4 Lymphocyte Count; Drug Administration Schedule; Female; Half-Life; HIV Infections; HIV Protease Inhibitors; Homosexuality; Humans; Karnofsky Performance Status; Male; Metabolic Clearance Rate; Rifampin; Ritonavir; Saquinavir; Time Factors; Treatment Outcome; Tuberculosis; Viral Load

The comparison of initial treatment with amphotericin B (0.7 mg/kg/d) plus rifampin (600 mg/d) with amphotericin B (0.7 mg/kg/d) alone for 2 weeks, both followed by fluconazole (400 mg/ d) for 8 weeks in the acute treatment of cryptococcal meningitis in AIDS by an open- randomized, controlled, prospective clinical trial is reported. Twenty patients were enrolled in each group. There were no significant differences between the groups in regard to a negative CSF culture for Cryptococcus neoformans in the 2nd and 10th weeks of treatment, time until normal body temperature after treatment, number of patients who died, and persistence of high CSF pressure after completion of treatment. Elevated intracranial pressure was an important factor associated with the patients who died. These results indicate that the combination of amphotericin B plus rifampin is not superior to amphotericin B alone.

Topics: Adult; AIDS-Related Opportunistic Infections; Amphotericin B; Antifungal Agents; Cryptococcus neoformans; Enzyme Inhibitors; Female; Fluconazole; Humans; Male; Meningitis, Cryptococcal; Prospective Studies; Rifampin

Concomitant use of efavirenz and rifampicin is common for treatment of HIV and tuberculosis. Plasma efavirenz levels can be reduced by rifampicin, but the appropriate daily dosage of efavirenz is unclear.. HIV-infected patients with active tuberculosis, receiving rifampicin > 1 month, were randomized to receive stavudine and lamivudine plus efavirenz 600 or 800 mg daily. Plasma efavirenz levels were measured (at 12 h after dosing and on day 14) by high-performance liquid chromatography. Plasma HIV RNA was assessed at 16 and 24 weeks after antiretroviral therapy.. Baseline characteristics were comparable in the 84 patients (two groups of 42). Median plasma efavirenz levels were 3.02 mg/l (range, 0.07-12.21) in the 600 mg group and 3.39 mg/l (range, 1.03-21.31) in the 800 mg group (P = 0.632). Plasma efavirenz levels were < 1 mg/l in 3 of 38 (7.9%) patients in the 600 mg group and in none of the 800 mg group (P = 0.274). Approximately 40 and 45% of patients had efavirenz levels > 4 mg/l, respectively. There was no significant difference in time to HIV RNA < 50 copies/ml (P = 0.848).. Median plasma efavirenz levels were comparable among both groups. Efavirenz 600 mg/day should be sufficient for most Thai HIV-infected patients receiving rifampicin with body weight approximately 50 kg. These results may not be applicable to other ethic populations who have higher body weights. However, the study of long-term virological and immunological outcomes is needed and under further investigation.

Topics: Adolescent; Adult; Aged; AIDS-Related Opportunistic Infections; Alkynes; Anti-HIV Agents; Antibiotics, Antitubercular; Antiretroviral Therapy, Highly Active; Benzoxazines; Cyclopropanes; Dose-Response Relationship, Drug; Female; HIV-1; Humans; Male; Middle Aged; Oxazines; Rifampin; RNA, Viral; Treatment Outcome; Tuberculosis

To evaluate the pharmacokinetic interactions between efavirenz and rifampicin (rifampin) in patients with HIV infection and tuberculosis.. Nonblind, randomised, pharmacokinetic study.. 24 patients (21 male, 3 female; mean age 37 years) with HIV infection and tuberculosis.. Patients were randomised to one of the following treatments: group A (n = 16) received antituberculosis drugs without rifampicin, plus highly active antiretroviral therapy (HAART) including efavirenz 600 mg once daily, on days 1 to 7. Patients were then switched to rifampicin in bodyweight-adjusted fixed-dose combination plus HAART including efavirenz 600 mg once daily (group A-1; n = 8) or efavirenz 800 mg once daily (group A-2; n = 8). Group B (n = 8) received rifampicin in bodyweight-adjusted fixed-dose combination on days 1 to 7; on day 8, HAART including efavirenz 800 mg once daily was added. Blood samples were obtained on days 7 and 14.. Plasma concentrations of efavirenz and rifampicin were quantified by using validated high performance liquid chromatography assays, and pharmacokinetic parameter values were determined by noncompartmental methods. The differences between pharmacokinetic parameters on days 7 and 14 were used to assess interactions.. There was a correlation between the pharmacokinetic parameters of efavirenz and the dose/kg administered. For efavirenz, mean (median) peak concentration, trough concentration and area under the concentration-time curve over the administration interval decreased 24% (24%), 25% (18%) and 22% (10%), respectively, in the presence of rifampicin. Large interpatient variability was observed, suggesting that plasma concentration monitoring of efavirenz may be advisable. Overall, the pharmacokinetics of efavirenz 800 mg plus rifampicin were similar to those of efavirenz 600 mg without rifampicin. The pharmacokinetics of rifampicin did not change substantially in the presence of efavirenz. Differences in patients' bodyweight appeared to cause further differences in exposure to efavirenz. Plasma concentrations of efavirenz in patients weighing <50 kg were similar to those previously described in HIV-infected patients without concomitant tuberculosis. However, plasma concentrations in patients weighing >or=50 kg were almost halved compared with those in patients weighing <50 kg.. Although the minimal effective efavirenz plasma concentration that assures virological success is not currently known, it may be advisable to increase the dosage of efavirenz to 800 mg once daily when it is coadministered with rifampicin. Rifampicin can be used with efavirenz without dosage modification.

Topics: Adult; AIDS-Related Opportunistic Infections; Alkynes; Anti-HIV Agents; Antitubercular Agents; Area Under Curve; Benzoxazines; CD4 Lymphocyte Count; Cyclopropanes; Drug Interactions; Female; Half-Life; Humans; Male; Metabolic Clearance Rate; Oxazines; Rifampin; Tuberculosis

To determine the long-term effect of preventive therapy (PT) for tuberculosis on the rates of tuberculosis, mortality and HIV progression.. In a randomized controlled trial, 1053 HIV-positive Zambian adults received isoniazid (H) for 6 months, rifampicin plus pyrazinamide (RZ) for 3 months, or a placebo. CD4 percentage, neopterin, absolute lymphocyte count and haemoglobin were measured from enrolment (absolute CD4 cell counts from 12 months after enrolment). Because PT reduced the incidence of tuberculosis, eligible placebo subjects were offered H. Here, tuberculosis and mortality rates are compared in the three original arms (intention to treat) using data beyond the end of the trial (average follow-up 3 years; maximum 7 years).. There were 102 cases of tuberculosis and 281 deaths (rates 3.6 and 9.0/100 person-years, respectively). There was no significant difference between the tuberculosis rates in the H and RZ groups at any time. The effect of H/RZ on tuberculosis diminished over time (P = 0.011) but the cumulative risk of tuberculosis in the first 2.5 years was significantly lower in the H/RZ group than the placebo group (rate ratio 0.55; 95% confidence interval 0.32-0.93; P = 0.028). There was no significant effect of PT on mortality or progression markers. Tuberculosis was associated with an increased mortality (adjusted rate ratio 1.96; 95% confidence interval 1.21-3.18; P = 0.006).. Both PT regimens protect against tuberculosis for at least 2.5 years but appear to have no effect on HIV progression or mortality. These results may be used in cost-effectiveness models of PT.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; CD4 Lymphocyte Count; Cohort Studies; Disease Progression; Female; Follow-Up Studies; HIV Infections; Humans; Isoniazid; Male; Pyrazinamide; Rifampin; Time Factors; Treatment Outcome; Tuberculosis; Zambia

Topics: Acquired Immunodeficiency Syndrome; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Desensitization, Immunologic; Dose-Response Relationship, Drug; Ethambutol; Female; Humans; Isoniazid; Male; Pyrazinamide; Rifampin; Stevens-Johnson Syndrome; Treatment Outcome; Tuberculosis

Treatment of latent infection is needed to protect HIV-infected individuals against tuberculosis. A previous report addressed short-term efficacy of three regimens in HIV-infected adults. We now report on long-term efficacy of the study regimens.. Three daily self-administered regimens were compared in a randomized placebo-controlled trial in 2736 purified protein derivative (PPD)-positive and anergic HIV-infected adults. PPD-positive subjects were treated with isoniazid (INH) for 6 months (6H), INH plus rifampicin for 3 months (3HR), INH plus rifampicin and pyrazinamide for 3 months (3HRZ), or placebo for 6 months. Anergic subjects were randomized to 6H or placebo.. 6H initially protected against tuberculosis in PPD-positive individuals; however, benefit was lost within the first year of treatment. Sustained benefit was observed in persons receiving 3HR and 3HRZ. In a Cox regression analysis, the adjusted relative risk for tuberculosis compared with placebo was 0.67 [95% confidence interval (CI), 0.42-1.07] for 6H, 0.49 (95% CI, 0.29-0.82) for 3HR, and 0.41 (95% CI, 0.22-0.76) for 3HRZ. When the rifampicin-containing regimens were combined, the adjusted relative risk for tuberculosis compared with placebo was 0.46 (95% CI, 0.29-0.71). Among anergic subjects, a modest degree of protection with 6H was present (adjusted relative risk, 0.61; 95% CI, 0.32-1.16). Treatment of latent tuberculosis infection had no effect on mortality.. Six months of INH provided short-term protection against tuberculosis in PPD-positive HIV-infected adults. Three month regimens including INH plus rifampicin or INH, rifampicin and pyrazinamide provided sustained protection for up to 3 years.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Female; HIV Infections; Humans; Incidence; Isoniazid; Male; Microbial Sensitivity Tests; Middle Aged; Mycobacterium tuberculosis; Pyrazinamide; Rifampin; Time Factors; Treatment Outcome; Tuberculin Test; Tuberculosis, Pulmonary

Because of problems with adherence, toxicity, and increasing resistance associated with 6- to 12-month isoniazid regimens, an alternative short-course tuberculosis preventive regimen is needed.. To compare a 2-month regimen of daily rifampin and pyrazinamide with a 12-month regimen of daily isoniazid in preventing tuberculosis in persons with human immunodeficiency virus (HIV) infection.. Randomized, open-label controlled trial conducted from September 1991 to May 1996, with follow-up through October 1997.. Outpatient clinics in the United States, Mexico, Haiti, and Brazil.. A total of 1583 HIV-positive persons aged 13 years or older with a positive tuberculin skin test result.. Patients were randomized to isoniazid, 300 mg/d, with pyridoxine hydrochloride for 12 months (n = 792) or rifampin, 600 mg/d, and pyrazinamide, 20 mg/kg per day, for 2 months (n = 791).. The primary end point was culture-confirmed tuberculosis; secondary end points were proven or probable tuberculosis, adverse events, and death, compared by treatment group.. Of patients assigned to rifampin and pyrazinamide, 80% completed the regimen compared with 69% assigned to isoniazid (P<.001). After a mean follow-up of 37 months, 19 patients (2.4%) assigned to rifampin and pyrazinamide and 26 (3.3%) assigned to isoniazid developed confirmed tuberculosis at rates of 0.8 and 1.1 per 100 person-years, respectively (risk ratio, 0.72 [95% confidence interval, 0.40-1.31]; P = .28). In multivariate analysis, there were no significant differences in rates for confirmed or probable tuberculosis (P = .83), HIV progression and/or death (P = .09), or overall adverse events (P = .27), although drug discontinuation was slightly higher in the rifampin and pyrazinamide group (P = .01). Neither regimen appeared to lead to the development of drug-resistant tuberculosis.. Our data suggest that for preventing tuberculosis in HIV-infected patients, a daily 2-month regimen of rifampin and pyrazinamide is similar in safety and efficacy to a daily 12-month regimen of isoniazid. This shorter regimen offers practical advantages to both patients and tuberculosis control programs.

Topics: Adolescent; Adult; Aged; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Drug Therapy, Combination; Female; HIV Infections; Humans; Isoniazid; Male; Middle Aged; Patient Compliance; Proportional Hazards Models; Pyrazinamide; Rifampin; Statistics, Nonparametric; Tuberculin Test; Tuberculosis

Our objective was to compare the effect of 2 regimens for treatment of Mycobacterium avium complex (MAC) bacteraemia in an HIV-positive population on symptoms and health status outcomes using a substudy of an open-label randomized controlled trial. The study was conducted in 24 hospital-based human immunodeficiency virus (HIV) clinics in 16 Canadian cities. Patients had HIV infection and MAC bacteraemia and were given either rifampin 600 mg, ethambutol 15 mg/kg daily, clofazimine 100 mg daily and ciprofloxacin 750 mg twice daily (4-drug arm) or rifabutin 600 mg daily (amended to 300 mg daily in mid-trial), ethambutol 15 mg/kg daily and clarithromycin 1000 mg twice daily (3-drug arm). The primary health status outcome was the change on the 8-item symptom subscale of the Medical Outcome Study (MOS)-HIV Health Survey adapted for MAC. Changes on other MOS-HIV subscales and on the Karnofsky score were also evaluated. Patients on the 3-drug arm had better outcomes on the MOS-HIV symptom subscale at 16 weeks (P=0.06), with statistically significant differences restricted to night sweats and fever and chills (P < 0.001). The proportion of patients improving on the symptom subscale relative to baseline was 55% on the 3-drug arm and 40% on the 4-drug arm. Patients on the 3-drug arm also had better Karnofsky score at 16 weeks (P < 0.001) and better outcomes on the social function, mental health, energy/fatigue, health distress and cognitive function subscales of the MOS-HIV. The 3-drug arm is superior to the 4-drug arm in terms of impact on MAC-associated symptoms, functional status and other aspects of health status.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Bacteremia; Canada; Ciprofloxacin; Clarithromycin; Clofazimine; Drug Therapy, Combination; Ethambutol; Health Status; Humans; Mycobacterium avium-intracellulare Infection; Outcome and Process Assessment, Health Care; Rifabutin; Rifampin; Treatment Outcome

To assess the compliance, tolerance and efficacy of a short chemoprophylaxis regimen (IR) for tuberculosis using isoniazid (INH) plus rifampin (RIF) during 3 months versus a standard regimen (I) of isoniazid during 12 months in HIV positive patients.. Prospective, comparative, randomized and open clinical trial in four general hospitals and one prison hospital of Castilla-La Mancha. Prophylaxis was administered to PPD-positive patients and to anergic patients according to the CDC recommendations (1991). Patients were randomized in two treatment groups: regimen IR, isoniazid 300 mg daily and rifampin 600 mg daily; regimen I, isoniazid 300 mg during 12 months.. 133 patients were included, 64 to regimen I and 69 to regimen IR. Regimen IR had a better tolerance with a 28% of adverse effects versus 55% in regimen I. Hepatotoxicity was more frequent in regimen I with a RR = 2.2 (CI 95% 1.23-4.01). Severe hepatotoxicity leading to treatment withdrawal was related to drug administration time and was more frequent in the 12 months regimen group. Short regimen showed a better compliance, without significant differences. Tuberculosis incidence rate was a 4.23 cases/100 persons--year for regimen I and 2.08 in regimen IR, with a relative risk for developing tuberculosis with regimen IR group of 0.51 (CI 95% 0.09-2.8) versus regimen I group, without statistical significance. Prison stay was associated to a significant risk for tuberculosis, regardless of both regimens (RR = 9.2 CI 95%, 1.06-80.2).. In HIV-infected patients with PPD(+) or anergic, regimen with IR is at least as effective as regimen I for preventing the development of tuberculous disease, and has less adverse effects.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Female; Humans; Incidence; Isoniazid; Liver; Male; Prospective Studies; Rifampin; Time Factors; Tuberculin Test; Tuberculosis

Rifampin is the cornerstone of short-course chemotherapy for the treatment of tuberculosis (TB). Rifampin monoresistance (RMR) is less common than resistance to isoniazid alone or in combination with other antituberculous medications. We conducted a retrospective case-control study to identify risk factors for RMR-TB. Complete records for 21 of a total of 26 RMR patients from 1990 to 1997 were available for review, and were compared with those of 48 patients with drug-susceptible TB, controlling for year of diagnosis. Cases more frequently had a history of TB than did controls (61% versus 22%, p < 0.01), and were more often human immunodeficiency virus (HIV) positive (81% versus 46%, p = 0.02). With control for HIV status, cases were more likely to have extrapulmonary involvement (47.6% versus 11.6%, p = 0.05). Four cases (19%) and one control (2. 1%) died (p = 0.02) during hospitalization. Cases more often had a history of incarceration (71.4% versus 37.5%, p = 0.09). Among the 13 cases with a history of TB, five had evidence of malabsorption (vomiting and/or diarrhea), versus none of the 11 controls with prior TB. These data support the hypothesis that RMR is seen primarily in individuals with a history of TB and who are HIV positive. Cases were frequently noncompliant with previous treatment for TB, had a history of incarceration, and had poor outcomes.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Case-Control Studies; CD4 Lymphocyte Count; Drug Resistance, Microbial; Female; Follow-Up Studies; HIV; HIV Seropositivity; Humans; Length of Stay; Male; Middle Aged; Mycobacterium tuberculosis; Rifampin; Risk Factors; Treatment Outcome; Tuberculosis, Pulmonary

Rifapentine is undergoing development for the treatment of pulmonary tuberculosis. This study was conducted to characterize the single-dose pharmacokinetics of rifapentine and its 25-desacetyl metabolite and to assess the effect of food on the rate and extent of absorption in participants infected with human immunodeficiency virus (HIV). Twelve men and four women, mean age, 38.6 +/- 6.9 years, received a single 600-mg oral dose of rifapentine in an open-label, randomized two-way, complete crossover study. Each volunteer received rifapentine following a high-fat breakfast or during a fasting period. Serial blood samples were collected for 72 h and both rifapentine and its metabolite were assayed by a validated high-performance liquid chromatography method. Pharmacokinetics of rifapentine and 25-desacetylrifapentine were determined by noncompartmental methods. Mean (+/- the standard deviation) maximum concentrations of rifapentine in serum and areas under the curve from time zero to infinity following a high-fat breakfast were 14.09 +/- 2.81 and 373.63 +/- 78.19 micrograms/ml, respectively, and following a fasting period they were 9.42 +/- 2.67 and 256.10 +/- 86.39 micrograms. h/ml, respectively. Pharmacokinetic data from a previously published healthy volunteer study were used for comparison. Administration of rifapentine with a high-fat breakfast resulted in a 51% increase in rifapentine bioavailability, an effect also observed in healthy volunteers. Although food increased the exposure of these patients to rifapentine, the infrequent dosing schedule for the treatment of tuberculosis (e.g., once- or twice-weekly dosing) would be unlikely to lead to accumulation. Additionally, autoinduction has been previously studied and has not been demonstrated with this compound, unlike with rifabutin and rifampin. Rifapentine was well tolerated by HIV-infected study participants. The results of our study suggest that no dosage adjustments may be required for rifapentine in HIV-infected patients (Centers for Disease Control and Prevention classification A1, A2, B1, or B2) undergoing treatment for tuberculosis.

Topics: Administration, Oral; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Cross-Over Studies; Female; Food; HIV Seropositivity; HIV-1; Humans; Male; Middle Aged; Mycobacterium Infections; Rifampin; Tuberculosis

Rifapentine is a cyclopentyl-substituted rifamycin whose serum half-life is five times that of rifampin. The US Public Health Service Study 22 compared a once-weekly regimen of isoniazid and rifapentine with twice weekly isoniazid and rifampin in the continuation phase (the last 4 months) of treatment for pulmonary tuberculosis in HIV-seropositive and HIV-seronegative patients. This report concerns only the HIV-seropositive part of the trial, which has ended. The HIV-seronegative part will stop follow-up in 2001.. Adults with culture-positive, drug-susceptible pulmonary tuberculosis who completed 2 months of four-drug (isoniazid, rifampin, pyrazinamide, ethambutol) treatment (induction phase) were randomly assigned 900 mg isoniazid and 600 mg rifapentine once weekly, or 900 mg isoniazid and 600 mg rifampin twice weekly. All therapy was directly observed. Statistical analysis used univariate, Kaplan-Meier, and logistic and proportional hazards regression methods.. 71 HIV-seropositive patients were enrolled: 61 completed therapy and were assessed for relapse. Five of 30 patients in the once-weekly isoniazid/rifapentine group relapsed, compared with three of 31 patients in the twice-weekly isoniazid/rifampin group (log rank chi2=0.69, p=0.41). However, four of five relapses in the once-weekly isoniazid/rifapentine group had monoresistance to rifamycin, compared with none of three in the rifampin group (p=0.05). Patients who relapsed with rifamycin monoresistance were younger (median age 29 vs 41 years), had lower baseline CD4 cell counts (median 16 vs 144 microL), and were more likely to have extrapulmonary involvement (75% vs 18%, p=0.03) and concomitant therapy with antifungal agents (75% vs 9%, p=0.006). No rifamycin monoresistant relapse has occurred among 1004 HIV-seronegative patients enrolled to date.. Relapse with rifamycin monoresistant tuberculosis occurred among HIV-seropositive tuberculosis patients treated with a once-weekly isoniazid/rifapentine continuation-phase regimen. Until more effective regimens have been identified and assessed in clinical trials, HIV-seropositive people with tuberculosis should not be treated with a once-weekly isoniazid/rifapentine regimen.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Drug Administration Schedule; Drug Resistance, Microbial; Drug Therapy, Combination; Female; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Recurrence; Rifampin; Time Factors; Tuberculosis, Pulmonary

To evaluate the influence of the dose of co-trimoxazole prophylaxis on the risk of toxoplasmosis in human immunodeficiency virus (HIV)-infected patients, we performed a nested case-control study of 32 patients with toxoplasmosis (case patients) and 64 patients without toxoplasmosis (control patients) who were matched by CD4 cell count and Toxoplasma gondii serostatus; these patients were from a cohort of 521 HIV-infected patients who underwent a diagnostic neuroimaging study between March 1993 and January 1997. Twenty-seven (84.4%) of 32 case patients and 33 (51.6%) of 64 control patients received low doses of co-trimoxazole, a finding associated with an adjusted odds ratio (OR) of 9.36 (95% confidence interval [CI], 2.05-42.75) and indicating 89% protective efficacy for high doses. Fifteen (46.9%) of 32 case patients and 16 (25%) of 64 control patients were exposed to rifampin (adjusted OR, 3.38; 95% CI, 1.08-10.61). These results indicate that high doses of co-trimoxazole appear to be more effective than low doses for lowering the risk of toxoplasmosis in HIV-infected patients and that rifampin therapy may reduce the efficacy of co-trimoxazole.

Topics: Adult; AIDS-Related Opportunistic Infections; Animals; Anti-Infective Agents; Antibiotics, Antitubercular; Case-Control Studies; Dose-Response Relationship, Drug; Drug Therapy, Combination; Encephalitis; Female; HIV Infections; Humans; Male; Rifampin; Toxoplasma; Toxoplasmosis, Cerebral; Treatment Outcome; Trimethoprim, Sulfamethoxazole Drug Combination

Tuberculosis is a common complication of HIV-1 infection, especially in developing countries. Practical and effective chemoprophylaxis regimens for HIV-1-related tuberculosis are needed. Our aim was to test the efficacy of isoniazid versus rifampicin with pyrazinamide for prevention of tuberculosis in HIV-1-positive individuals.. We compared the efficacy of 6 months of isoniazid with 2 months of rifampicin and pyrazinamide for prevention of tuberculosis in HIV-1-seropositive individuals. Eligible participants were aged 16-77 years, HIV-1 seropositive, had a positive purified-protein derivative (PPD) skin test reaction of at least 5 mm, and had a normal chest radiograph. Participants were randomly assigned partially supervised twice weekly isoniazid for 24 weeks or twice weekly rifampicin and pyrazinamide for 8 weeks. Participants were followed up for up to 4 years for the development of tuberculosis and survival.. Tuberculosis developed in 14 (3.8%) of 370 participants assigned isoniazid and 19 (5.0%) of 380 participants assigned rifampicin and pyrazinamide (Cox model rate ratio 1.3 [95% CI 0.7-2.7]). The Kaplan-Meier estimate of the risk of tuberculosis during the first 10 months after entry was 3.7% among participants who received rifampicin and pyrazinamide compared with 1.0% (p=0.03) among participants who received isoniazid, and 5.4% versus 5.1%, respectively (p=0.9) at 36 months after entry. Higher rates of tuberculosis were observed in people with baseline CD4 percentages (of total lymphocytes) of less than 20 (rate ratio 4.0 [95% CI 1.8-9.0]). There were no significant differences in total mortality at any time.. Twice-weekly isoniazid preventive therapy for 6 months or rifampicin and pyrazinamide for 2 months provided similar overall protection against tuberculosis in HIV-1-infected, PPD-positive adults. The better protection among recipients of isoniazid during the first 10 months was most likely secondary to the longer duration of chemoprophylaxis. Preventive therapy for HIV-1-seropositive, PPD-positive individuals could be practical in developing countries with a once weekly clinic visit, but optimum duration of chemoprophylaxis has not been determined.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Female; Follow-Up Studies; HIV Infections; HIV-1; Humans; Isoniazid; Male; Prospective Studies; Pyrazinamide; Rifampin; Time Factors; Tuberculosis, Pulmonary

This study examined whether adding levofloxacin to a standard four-drug regimen improved the 8-week culture response and compared effectiveness of 9 versus 6 months of intermittent therapy for human immunodeficiency virus-related pansusceptible pulmonary tuberculosis. Patients were randomized to receive either four or five drugs, the fifth being levofloxacin. Patients who completed induction therapy were randomized to complete 9 versus 6 months of intermittent therapy with isoniazid and rifampin. In the randomized induction phase, 97.3% of patients in the four-drug group and 95.8% in the five-drug group had sputum culture conversion at 8 weeks (P = 1.00). In the continuation phase, one patient (2%) assigned to 9 months and two patients (3.9%) assigned to 6 months of therapy had treatment failure/relapse (P = 1.00). In conclusion, this study showed that levofloxacin added no benefit to a highly effective, largely intermittent, four-drug induction regimen. Both 9 and 6 months of intermittent therapy were associated with low treatment failure/relapse rates.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Drug Therapy, Combination; Ethambutol; Female; Humans; Isoniazid; Levofloxacin; Male; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Ofloxacin; Pyrazinamide; Recurrence; Rifampin; Sputum; Treatment Outcome; Tuberculosis, Pulmonary

To investigate the effects of rifampicin on the pharmacokinetics of itraconazole in humans.. Our study was conducted with six healthy normal volunteers and three AIDS patients. All subjects received a 200 mg single dose of oral itraconazole on day 1 and day 15 and 600 mg of oral rifampicin once daily from day 2 to day 15. Itraconazole pharmacokinetics studies were carried out on day 1 (phase 1) and day 15 (phase 2). The limit of detection for itraconazole concentration was 16 ng x ml(-1).. Concentrations itraconazole were higher when it was administered alone than when it was administered with rifampicin. Coadministration of rifampicin resulted in undetectable levels of itraconazole in all subjects except one normal volunteer. The mean AUC0-24 was 3.28 vs 0.39 microg x h x ml(-1) in phase 1 and 2, respectively, in healthy normal volunteers. Therefore, the estimated minimum decrease of the mean AUC0-24 of itraconazole in phase 2 was approximately 88% compared with phase 1. The mean AUC0-24 was 1.07 vs 0.38 microg x h x ml(-1) in phase 1 and 2, respectively, in AIDS patients. Therefore, the estimated minimum decrease of the mean AUC0-24 of itraconazole in phase 2 was approximately 64% compared with phase 1.. Rifampicin has a very strong inducing effect on the metabolism of itraconazole, so that these two drugs should not be administered concomitantly.

Topics: Adult; AIDS-Related Opportunistic Infections; Antifungal Agents; Antitubercular Agents; Drug Interactions; Female; Humans; Itraconazole; Male; Middle Aged; Reference Values; Rifampin; Tuberculosis, Pulmonary

To determine the clinical and microbiologic benefit of adding amikacin to a four-drug oral regimen for treatment of disseminated Mycobacterium avium infection in HIV-infected patients.. A randomized, open-labeled, comparative trial.. Outpatient clinics.. Seventy-four patients with HIV and symptomatic bacteremic M. avium infection.. Rifampin 10 mg/kg daily, ciprofloxacin 500 mg twice daily, clofazimine 100 mg every day, and ethambutol 15 mg/kg orally daily for 24 weeks, with or without amikacin 10 mg/kg intravenously or intramuscularly 5 days weekly for the first 4 weeks.. Clinical and microbiologic response at 4 weeks; quantitative level of bacteremia with M. avium.. No difference in clinical response was noted with the addition of amikacin to the four-drug oral regimen, and only 25% in either group had a complete or partial response at 4 weeks. A comparable quantitative decrease in bacteremia was noted in both treatment groups, with 16% of patients being culture-negative at 4 weeks and 38% at 12 weeks. Toxicities were mainly gastrointestinal. Amikacin was well tolerated. Median survival was 30 weeks in both groups.. The addition of amikacin to a four-drug oral regimen of rifampin, ciprofloxacin, clofazimine, and ethambutol did not provide clinical or microbiologic benefit.

Topics: Adult; AIDS-Related Opportunistic Infections; Amikacin; Bacteremia; Ciprofloxacin; Clofazimine; Colony Count, Microbial; Drug Therapy, Combination; Ethambutol; Female; Humans; Male; Microbial Sensitivity Tests; Mycobacterium avium Complex; Mycobacterium avium-intracellulare Infection; Rifampin

A randomized double-blind placebo-controlled trial was conducted to estimate the efficacy of preventive therapy for tuberculosis (TB) in HIV-infected adults in Lusaka, Zambia. The main outcome measures were the incidence of TB, mortality and adverse drug reactions.. During a 2 year period, 1053 HIV-positive individuals without evidence of clinical TB were randomly assigned to receive 6 months of isoniazid twice a week (H), or 3 months of rifampicin twice a week (R) plus pyrazinamide (Z), or a placebo. Therapy was taken twice a week and was self administered. Subjects presenting with symptoms during the follow-up period were investigated for TB.. The 1053 subjects in the study were followed up for a total of 1631 person-years (median = 1.8 years). Twenty-nine subjects were taken off treatment as a result of adverse drug reactions. A total of 96 cases of TB/probable TB (59 TB and 37 probable TB) were diagnosed during the study period and 185 deaths were reported. One hundred and fifteen subjects (11%) did not return to the study clinic at any time after enrolment. The incidence of TB was lower in those subjects on preventive therapy (H and RZ groups combined) compared with those on placebo (rate ratio = 0.60, 95% CI: 0.36-1.01, P = 0.057), as was the incidence of TB/probable TB (rate ratio = 0.60, 95% CI: 0.40-0.89, P = 0.013). The effect of preventive therapy was greater in those with a tuberculin skin test (TST) of 5 mm or greater, in those with a lymphocyte count of 2x10(9)/l or higher, and in those with haemoglobin of 10 g/dl or higher. There was no difference in mortality rates between the preventive therapy and placebo groups. The effect of preventive therapy declined after the first year of the study so that by 18 months the rates of TB in the treated groups were similar to that in the placebo group.. This study has demonstrated that preventive therapy with either twice weekly isoniazid for 6 months or a combination of rifampicin and pyrazinamide for 3 months reduced the incidence of TB in HIV-infected persons in Zambia. No effect was observed on mortality. The effect was greatest in persons who had a positive TST or a lymphocyte count of 2x10(9)/l or greater, indicating that preventive therapy may be more effective in people with less advanced immunosuppression. The limited duration of the protective effect reported in this study raises the question of the need for lifelong preventive therapy or re-prophylaxis.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotic Prophylaxis; Antibiotics, Antitubercular; Antitubercular Agents; Double-Blind Method; Drug Therapy, Combination; Female; Humans; Incidence; Isoniazid; Male; Patient Compliance; Pyrazinamide; Rifampin; Treatment Outcome; Tuberculin Test; Tuberculosis, Pulmonary; Zambia

To test the hypothesis that antituberculous drug disposition is altered in patients with AIDS, we studied the steady-state pharmacokinetics of isoniazid (300 mg/d), rifampin (600 mg/d), and pyrazinamide (1,500 mg/d) in 29 adults (14 patients infected with human immunodeficiency virus [HIV] and 15 non-HIV-infected patients) with tuberculosis in Nairobi, Kenya. Intestinal integrity was assessed with xylose. Neither HIV infection nor diarrhea accounted for the interpatient variability in the area-under-the-plasma concentration vs. time curve (AUC), the maximum concentration, or the terminal half-life (t1/2) of isoniazid, rifampin, and pyrazinamide. No significant association between HIV infection or diarrhea and pharmacokinetics was seen for any of the compounds. In addition, neither the AUC nor the t1/2 of any of these drugs reflected interpatient differences in CD4 lymphocyte counts. Xylose absorption was uniformly low. We did not demonstrate that HIV infection, diarrhea, or CD4 lymphocyte counts contributed significantly to the variability in pharmacokinetics of isoniazid, rifampin, and pyrazinamide in TB patients in Nairobi.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Biological Availability; Diarrhea; Female; Humans; Isoniazid; Male; Prospective Studies; Pyrazinamide; Rifampin; Tuberculosis

Infection with the human immunodeficiency virus (HIV) greatly increases the risk of reactivation tuberculosis. We evaluated the safety and efficacy of three preventive-therapy regimens in a setting where exposure to tuberculosis is common.. We performed a randomized, placebo-controlled trial in 2736 HIV-infected adults recruited in Kampala, Uganda. Subjects with positive tuberculin skin tests (induration, > or =5 mm) with purified protein derivative (PPD) were randomly assigned to one of four regimens: placebo (464 subjects), isoniazid daily for six months (536), isoniazid and rifampin daily for three months (556), or isoniazid, rifampin, and pyrazinamide daily for three months (462). Subjects with anergy (0 mm induration in reaction to PPD and candida antigens) were randomly assigned to receive either placebo (323 subjects) or six months of isoniazid (395). The medications were dispensed monthly and were self-administered.. Among the PPD-positive subjects, the incidence of tuberculosis in the three groups that received preventive therapy was lower than the rate in the placebo group (P=0.002 by the log-rank test). The relative risk of tuberculosis with isoniazid alone, as compared with placebo, was 0.33 (95 percent confidence interval, 0.14 to 0.77); with isoniazid and rifampin, 0.40 (0.18 to 0.86); and with isoniazid, rifampin, and pyrazinamide, 0.51 (0.24 to 1.08). Among the subjects with anergy, the relative risk of tuberculosis was 0.83 (95 percent confidence interval, 0.34 to 2.04) with isoniazid as compared with placebo. Side effects were more common with the multidrug regimens, and particularly with the regimen containing pyrazinamide. Survival did not differ among the groups, but the subjects with anergy had a higher mortality rate than the PPD-positive subjects.. A six-month course of isoniazid confers short-term protection against tuberculosis among PPD-positive, HIV-infected adults. Multidrug regimens with isoniazid and rifampin taken for three months also reduce the risk of tuberculosis.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Female; HIV Infections; Humans; Isoniazid; Male; Pyrazinamide; Rifampin; Risk; Treatment Outcome; Tuberculin Test; Tuberculosis, Pulmonary

To characterize the susceptibility to levofloxacin of clinical isolates of Mycobacterium tuberculosis (MTB) obtained from patients with HIV-related tuberculosis and to characterize the molecular genetics of levofloxacin resistance.. Isolates from culture-positive patients in a United States multicenter trial of HIV-related TB were tested for susceptibility to levofloxacin by minimum inhibitory concentration (MIC) determinations in Bactec 7H12 broth. Automated sequencing of the resistance determining region of gyrA was performed.. Of the 135 baseline MTB isolates tested, 134 (99%; 95% exact binomial confidence interval, 95.9-99.9%) were susceptible to levofloxacin with an MIC < or = 1.0 microg/ml. We identified a previously unrecognized mis-sense mutation occurring at codon 88 of gyrA in a levofloxacin mono-resistant MTB isolate obtained from a patient with AIDS who had received ofloxacin for 8 months prior to the diagnosis of tuberculosis.. Clinical MTB isolates from HIV-infected patients were generally susceptible to levofloxacin. However, the identification of a clinical isolate with mono-resistance to levofloxacin highlights the need for circumspection in the use of fluoroquinolones in the setting of potential HIV-related tuberculosis and for monitoring of rates of resistance of MTB isolates to fluoroquinolones.

Topics: AIDS-Related Opportunistic Infections; Anti-Infective Agents; Antibiotics, Antitubercular; Antitubercular Agents; Drug Resistance, Microbial; Drug Therapy, Combination; Ethambutol; Humans; In Vitro Techniques; Isoniazid; Levofloxacin; Male; Microbial Sensitivity Tests; Middle Aged; Mycobacterium tuberculosis; Ofloxacin; Pyrazinamide; Rifampin; Sputum; Tuberculosis

Prospective randomised clinical trial comparing the safety and efficacy of rifampicin- and thiacetazone-containing regimens in human immunodeficiency virus (HIV)-infected adults with pulmonary tuberculosis (TB) at the National Tuberculosis Treatment Centre, Kampala, Uganda.. To assess demographic, clinical and laboratory risk factors associated with toxicity during treatment with streptomycin, thiacetazone and isoniazid (STH) of HIV-1 infected adults with pulmonary TB.. Nested case-control study of all subjects randomized to the STH treatment arm. Baseline demographic, clinical, microbiological, hematological and radiographic characteristics were compared between subjects who developed and those who did not develop adverse drug reactions (ADR).. Of the 90 subjects randomized to STH, 13 developed ADR yielding an incidence rate of 19.6 events per 100 person years of observation (PYO). Eleven of the 13 ADR were cutaneous hypersensitivity reactions, including one fatal case of Stevens-Johnson syndrome. Eight of 13 patients who developed ADR were tuberculin anergic, compared to 12 of 77 patients who did not develop ADR (P < 0.001). An absolute lymphocyte count below 2000 cells/mm3 was also associated with ADR (P = 0.02).. Initial anergy to tuberculin and lymphocytopenia, markers of advanced HIV infection and immunosuppression, were associated with increased risk for adverse drug reactions during STH chemotherapy.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Case-Control Studies; Clonal Anergy; Confidence Intervals; Developing Countries; Drug Eruptions; Drug Therapy, Combination; Female; HIV-1; Humans; Incidence; Jaundice; Lymphopenia; Male; Middle Aged; Odds Ratio; Prospective Studies; Rifampin; Risk Factors; Stevens-Johnson Syndrome; Survival Rate; Thioacetazone; Tuberculosis, Pulmonary; Uganda

A study conducted by the Uganda-Case Western Reserve University Research Collaboration in Kampala, Uganda, a country with high incidence rates of tuberculosis (TB) and human immunodeficiency virus type 1 (HIV-1) infection.. To assess clinical, microbiologic and radiographic factors associated with risk for relapse in HIV-infected adults treated for initial episodes of pulmonary TB.. Nested case-control study within a randomized prospective clinical trial comparing the safety and efficacy of thiacetazone- and rifampicin-containing regimens for TB treatment in HIV-infected adults.. The analysis was based on 119 patients who completed therapy. Median follow-up for all subjects was 22.3 months. Ten patients relapsed a median of 12.7 months after the end of therapy; seven of these were initially treated with the thiacetazone (T)-containing regimen. Each relapse case was matched to four controls by length of follow-up after initial TB treatment. In a univariate analysis risk for relapse was associated with treatment with the T-containing regimen (OR = 4.2, P = 0.08), age > or = 30 yrs (OR = 2.9, P = 0.16), and irregular compliance (OR = 3.6, P = 0.1). Baseline anergy on Mantoux tuberculin skin testing, cavitary disease, radiographic extent of disease and sputum bacillary burden, two month culture negativity, and residual cavitary disease at the end of treatment did not differ between relapses and controls.. Older HIV-1 infected patients, those with poor treatment compliance, and those being treated with T-containing regimens, may be at increased risk for relapse after TB treatment and require closer post-treatment surveillance. Risk for relapse in HIV-infected adults with pulmonary TB after treatment with a nine month rifampicin-containing regimen was low (3.1 per 100 person-years observation) compared with those treated with a thiacetazone-containing regimen (10.1 per 100 person-years observation).

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Case-Control Studies; Developing Countries; Drug Therapy, Combination; Female; Follow-Up Studies; HIV-1; Humans; Logistic Models; Lung; Male; Middle Aged; Patient Compliance; Prospective Studies; Radiography; Recurrence; Rifampin; Risk Factors; Sputum; Survival Rate; Thioacetazone; Tuberculosis, Pulmonary; Uganda

To describe the clinical response to antituberculosis therapy in HIV-1 disease, 49 HIV-1 positive Ugandan adults (mean age 29.4 years; 68% men) with active pulmonary tuberculosis (PTB) were studied in a trial of rifampicin containing short-course antituberculosisis regimens. At presentation, 18 patients were PPD non-reactors (PPD skin test induration < 2mm), ten patients (20%) had non-cavitary lung disease. The mean CD4 lymphocyte count at presentation was 339/microliters (+/- SD 275). Among patients with abnormal baseline clinical values, the median time to resolution of fever, weight gain of 10%, increase of haemoglobin to 10g/dl and of Karnofsky performance score (KPS) to 80 occurred before sputum smear and culture conversion. Short-term survival was associated with: baseline lymphocytes < 1200/microliters, (Odds ratio (OR) 17.5), CD4+ lymphocytes < 200/microliters (OR 9.8), cavitary lung disease, (OR 0.6), atypical chest radiograph, (OR 6.7), and PPD non-reactivity, (OR 13.5), PPD non-reactivity and non-cavitary disease were associated with significantly lower CD4 lymphocyte counts. Affordable serial measurements parallel the response to therapy and predict survival in HIV-associated PTB.. Tuberculosis (TB) is the most often seen and serious opportunistic infection in HIV-1-infected individuals in developing countries. Infection with HIV-1 predisposes individuals to TB, both progressive primary and reactivation disease. To describe the clinical response to anti-TB therapy in HIV-1 disease, 49 HIV-1-positive Ugandan adults of mean age 29.4 years with active pulmonary TB (PTB) were studied in a trial of rifampicin containing short-course anti-TB regimens. At presentation, 18 patients were PPD skin test nonreactive, and 39 had cavitary lung disease. The mean CD4 lymphocyte count at presentation was 339/mcl. Among patients with abnormal baseline clinical values, the median time to resolution of fever, weight gain of 10%, increase of hemoglobin to 10 g/dl, and Karnofsky performance score (KPS) to 80 occurred before sputum smear and culture conversion. Short-term survival was associated with baseline lymphocytes of less than 1200/mcl, cavitary lung disease, atypical chest radiograph, and PPD nonreactivity. PPD nonreactivity and noncavitary disease were associated with significantly lower CD4 lymphocyte counts. Study findings demonstrate that the careful monitoring of clinical symptoms and simple, inexpensive, and widely available laboratory markers permit the satisfactory evaluation of early clinical response to anti-TB therapy in HIV-1-infected patients with pulmonary TB.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; CD4 Lymphocyte Count; Disease Progression; Female; HIV Seropositivity; HIV-1; Humans; Male; Middle Aged; Predictive Value of Tests; Radiography; Rifampin; Survival Analysis; Tuberculin Test; Tuberculosis, Pulmonary; Uganda

The ability of various in vitro methods of antibiotic susceptibility testing to predict therapeutic outcome in patients infected with Mycobacterium avium complex (MAC) was evaluated. Pretreatment bloodstream MAC isolates from 38 patients with AIDS, previously treated in a randomized fashion with either ethambutol, rifampin, or clofazimine, were tested by three conventional methods using broth or agar, as well as by cocultivation with macrophages. The results obtained with each method were compared with the quantitatively determined bacteriologic response to the administration of the single agent in humans. None of the conventional in vitro susceptibility methods was predictive of therapeutic outcome, while the results of cocultivation with macrophages were of moderate predictive value. The positive predictive value of a response in humans based on a response in macrophages (defined by > or = to 1.0 log reduction in baseline colony counts after 5 days of treatment) was 74%. The negative predictive value was 82%.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Bacteremia; Clofazimine; Ethambutol; Humans; In Vitro Techniques; Macrophages; Microbial Sensitivity Tests; Mycobacterium avium Complex; Mycobacterium avium-intracellulare Infection; Rifampin

To determine the predictive value of a standard murine model in the treatment of disseminated Myocardium avium complex (MAC) infection, beige mice were infected with MAC strains isolated from human immunodeficiency virus-infected patients and treated with the same antibiotic (ethambutol, clofazimine, or rifampin) that had been administered to the subject from whom that strain had been recovered. While ethambutol had the greatest bacteriologic efficacy in humans (mean decrease +/-SD, 1.0+/-0.5 log 10 cfu/mL of blood), clofazimine had the greatest bacteriostatic efficacy in mice (mean decrease +/- SD, 2.8 +/- 0.7 log(10) cfu/g of tissue). A linear correlation was not observed between bacteriostatic activity in mouse liver or spleen and the degree of bacteriologic response in humans (P > or = to .1). Odds ratios for a response in humans based on a bacteriologic response in mice were not significant for each agent (P > or = to .1, all cases).

Topics: AIDS-Related Opportunistic Infections; Animals; Antitubercular Agents; Clofazimine; Colony Count, Microbial; Disease Models, Animal; Ethambutol; Humans; Liver; Mice; Mycobacterium avium-intracellulare Infection; Rifampin; Species Specificity; Spleen

Bacteremia with the Mycobacterium avium complex is common in patients with the acquired immunodeficiency syndrome (AIDS), but the most effective treatment for this infection remains unclear.. We randomly assigned 229 patients with AIDS and M. avium complex bacteremia to receive either rifampin (600 mg daily), ethambutol (approximately 15 mg per kilogram of body weight daily), clofazimine (100 mg daily), and ciprofloxacin (750 mg twice daily) (the four-drug group) or rifabutin (600 mg daily), ethambutol (as above), and clarithromycin (1000 mg twice daily) (the three-drug group). In the three-drug group the dose of rifabutin was reduced by half after 125 patients were randomized, because 24 of 63 patients had uveitis.. Among 187 patients who could be evaluated, blood cultures became negative more often in the three-drug group than in the four-drug group (69 percent vs. 29 percent, P<0.001). Among patients treated for at least four weeks, the bacteremia resolved more frequently in the three-drug group (78 percent vs. 40 percent, P<0.001). In the three-drug group, bacteremia resolved more often with the 600-mg dose of rifabutin than with the 300-mg dose (P=0.025), but the latter regimen was more effective than the four-drug regimen (P<0.05). The median survival was 8.6 months in the three-drug group and 5.2 months in the four-drug group (P = 0.001). The median Karnofsky performance score was higher in the three-drug group than in the four-drug group from week 2 to week 16 (P<0.05). Mild uveitis developed in 3 of the 53 patients receiving the 300-mg dose of rifabutin, an incidence about one quarter that observed with the 600-mg dose (P<0.001).. In patients with AIDS and M. avium complex bacteremia, treatment with the three-drug regimen of rifabutin, ethambutol, and clarithromycin leads to resolution of the bacteremia more frequently and more rapidly than treatment with rifampin, ethambutol, clofazimine, and ciprofloxacin, and survival rates are better.

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Antitubercular Agents; Bacteremia; Ciprofloxacin; Clarithromycin; Clofazimine; Drug Therapy, Combination; Ethambutol; Female; Humans; Male; Mycobacterium avium Complex; Mycobacterium avium-intracellulare Infection; Rifabutin; Rifampin; Survival Analysis; Treatment Outcome; Uveitis

The fluoroquinolones are promising new antituberculous agents. A randomized controlled trial of 200 adult patients with sputum smear-positive pulmonary tuberculosis was conducted in Tanzania. Patients received either a trial regimen (HRC) consisting of isoniazid (300 mg), rifampin (600 mg), and ciprofloxacin (750 mg) or a control regimen (HRZE) consisting of isoniazid (300 mg), rifampin (600 mg), pyrazinamide (25 mg/kg), and ethambutol (15 mg/kg). The 168 evaluable patients all had negative smears and cultures by month 6, but the time to conversion to negativity was longer for the HRC group than for the HRZE group because of the poor response of patients infected with human immunodeficiency virus (HIV) to the HRC regimen. Relapse was more frequent in the HRC group. The sterilizing activity of ciprofloxacin does not appear to be equal to that of the combination of pyrazinamide and ethambutol, but the difference in outcome was significant only among HIV-infected patients.

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Infective Agents; Antitubercular Agents; Ciprofloxacin; Ethambutol; Female; HIV-1; Humans; Isoniazid; Male; Middle Aged; Pyrazinamide; Rifampin; Time Factors; Tuberculosis, Pulmonary

To evaluate the effect of fluconazole on rifampicin pharmacokinetics, eleven AIDS patients received rifampicin (300 mg/day; days 1-28) and fluconazole (400 mg/day; days 15-28). Rifampicin pharmacokinetics were studied on days 14 and 28. There was no significant effect of fluconazole on rifampicin pharmacokinetics. These results suggest that rifampicin dosage adjustment may not be necessary when this drug is coadministered with fluconazole.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antifungal Agents; Drug Administration Schedule; Drug Interactions; Drug Therapy, Combination; Female; Fluconazole; Humans; Male; Meningitis, Cryptococcal; Middle Aged; Rifampin

The population pharmacokinetics of dapsone were examined in human immunodeficiency virus-infected patients receiving dapsone at a dosage of 100 mg twice weekly for the prevention of Pneumocystis carinii pneumonia. Nonlinear mixed-effect modeling was used to determine the best pharmacostatistical model for the data. A one-compartment open model with first-order absorption and elimination was used as the structural pharmacokinetic model. Several covariates were tested for their influence on pharmacokinetic parameters. Rifampin was found to increase the values of clearance/bioavailability (CL/F) and volume of distribution/ bioavailability (V/F) by approximately 70%. CL/F and V/F were 1.83 liters/h and 69.6 liters, respectively, for patients not taking rifampin. The effect of rifampin on the pharmacokinetic parameters of dapsone was appreciably less than expected on the basis of studies with healthy volunteers. Increased bilirubin levels were associated with a significant decrease in the absorption rate constant (Ka). However, this finding may be considered clinically irrelevant because the post hoc Bayesian estimates of Ka for patients with high bilirubin levels ( > 1.2 mg/dl) were at the lower bound of the values for patients with normal bilirubin levels. The value of Ka was 0.957 h-1 for a patient with a bilirubin level of 0.7 mg/dl. After inclusion of covariates in the model, the interpatient variability was 35% for CL/F, not significant for V/F, and 85% for Ka. Simulation of plasma concentration-versus-time curves indicated that the administration of 100 mg of dapsone biweekly is associated with sustained dapsone levels in the plasma of the majority of the patients. Dosage adjustments for patients concomitantly treated with rifampin may be necessary.

Topics: Adult; AIDS-Related Opportunistic Infections; Analysis of Variance; Anti-Infective Agents; Antibiotics, Antitubercular; Dapsone; Drug Interactions; Female; Humans; Male; Middle Aged; Pneumonia, Pneumocystis; Rifampin

This pilot study was conducted at the Joint Clinical Research Centre (JCRC) in Kampala, Uganda, where tuberculosis (TB) is an epidemic health problem aggravated by the HIV-1 pandemic.. To evaluate the feasibility of a larger phase III trial utilizing rifabutin as a substitute for rifampicin in short-course therapy for pulmonary TB.. Single-blind randomized trial in 50 patients with new onset smear- and culture-positive pulmonary tuberculosis and HIV-1 infection. Comparison of daily, intermittently supervised 6-month treatment regimens of rifabutin versus rifampicin, together with isoniazid, ethambutol and pyrazinamide.. Rifabutin- and rifampicin-containing regimens had comparable efficiency. However, rifabutin-treated patients had significantly more rapid clearance of acid-fast bacilli from sputum at 2 months (P < 0.05, Fisher exact test) and over the entire study period (P < 0.05, logrank test) than rifampicin-treated patients. The presence of cavitary disease was associated with a longer sputum conversion time for patients treated with either regimen. No major adverse events requiring dosage reduction or withdrawal of any study medication were seen in either treatment group. Mean absolute peripheral blood CD4 T lymphocyte counts increased by 28% from week 0 to week 12 in all subjects (334-427/microliters, respectively). An unexpected finding was the isolation of Mycobacterium africanum from 49% of the sputum cultures. This is the first report indicating a high prevalence of M. africanum in human TB in Uganda.. Short-course antituberculosis regimens containing rifabutin or rifampicin are both safe and efficacious in the treatment of HIV-1 associated tuberculosis. Rifabutin-containing regimens were associated with earlier sputum smear and culture conversion.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Female; HIV-1; Humans; Male; Mycobacterium tuberculosis; Pilot Projects; Retrospective Studies; Rifabutin; Rifampin; Single-Blind Method; Sputum; Tuberculosis, Pulmonary

To assess the response to therapy for tuberculosis using rifampicin-containing short-course chemotherapy, and to compare recurrence and mortality rates in seronegative persons and those with HIV-1, HIV-2, and dual serologic reactivity in West Africa.. A cohort of 835 adult patients (167 HIV-1-positive, 143 HIV-2-positive, 243 dual-reactive, 282 HIV-negative) with smear-positive pulmonary tuberculosis was followed for 2 years under programme conditions. Standard self-administered treatment was daily rifampicin and isoniazid for 6 months, and in addition pyrazinamide during the first 2 months. Outcomes evaluated were rates of completion of therapy, cure, failure of treatment, recurrence after cure, and mortality.. HIV-positive patients had lower rates of completion of therapy (65-73%) than seronegative patients (79%), mainly because of increased mortality. Among patients completing therapy, failure of treatment was similarly low in HIV-positive (2%) and seronegative patients (1%). Recurrence rates after cure did not differ significantly in the 18 months of follow-up in the four serologic groups (3-7%). The respective mortality rates for HIV-1-positive, HIV-2-positive, and dually reactive patients were 20.3, 8.3, and 25.5 per 100 person-years (PY), compared with 2.2 per 100 PY among seronegatives.. Rifampicin-containing short-course chemotherapy for pulmonary tuberculosis is associated with similar cure and recurrence rates in HIV-positive and HIV-negative persons completing 6 months of therapy. HIV-2 infection is associated with more favourable survival than HIV-1 infection or dual reactivity, even when AIDS-defining illness is already present. However, mortality is significantly increased in all seropositive groups compared with HIV-negative tuberculosis patients; thus, establishing the causes of this increased mortality is a priority.

Topics: Adolescent; Adult; Africa, Western; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Drug Therapy, Combination; Female; Follow-Up Studies; HIV Seronegativity; HIV Seropositivity; HIV-1; HIV-2; Humans; Isoniazid; Male; Pyrazinamide; Recurrence; Rifampin; Treatment Failure; Tuberculosis, Pulmonary

Studies have shown clarithromycin (Biaxin) and rifabutin to be effective against Mycobacterium avium complex (MAC), and to improve survivability. Abbott Laboratories is seeking approval from the Food and Drug Administration (FDA) for clarithromycin use in preventing MAC. Marion Merrell Dow, the manufacturer of rifabutin, is planning a prophylaxis trial with a close cousin of the drug, rifapentine. Rifapentine has a long half-life, and has the potential to lengthen intermittent treatment for tuberculosis. It is believed that this long half-life may mean it can maintain a higher blood level and thereby maintain better effectiveness than rifabutin against fast-growing MAC organisms.

Topics: AIDS-Related Opportunistic Infections; Animals; Antitubercular Agents; CD4 Lymphocyte Count; Clarithromycin; Half-Life; Humans; Mycobacterium avium-intracellulare Infection; Placebos; Randomized Controlled Trials as Topic; Rifabutin; Rifampin

Among HIV-positive patients who received treatment for active tuberculosis, thiacetazone has been associated with cutaneous hypersensitivity and recurrent tuberculosis. No controlled trials have investigated the safety and efficacy of thiacetazone-containing regimens compared with alternative regimens among patients with HIV. In a randomised clinical trial of 191 HIV-positive patients with active pulmonary tuberculosis, we examined the safety and short-term efficacy of isoniazid, rifampicin, and pyrazinamide for two months followed by isoniazid and rifampicin for seven months (RHZ) compared with streptomycin, thiacetazone, and isoniazid for two months followed by thiacetazone and isoniazid for ten months (STH). Between May, 1990, and September, 1991, 191 HIV-positive adult Ugandan patients with acid-fast bacilli sputum smear-positive pulmonary tuberculosis (93% confirmed by culture) received either STH or RHZ. Subjects had a standard evaluation that included Mantoux skin test, complete blood count with differential white blood cell count, and chest radiography. After starting therapy, subjects were followed-up over one year for three outcomes: complications of anti-tuberculosis therapy, early sterilisation of cultures, and survival. Of 191 eligible subjects, 90 received STH and 101 received RHZ. The overall one-year survival was similar for STH and RHZ (65% vs 72%), but when controlled for baseline differences in Mantoux reaction size and absolute lymphocyte count, the relative risk of death for STH compared with RHZ was 1.57 (95% CI 1.0-2.48). Overall, 12 adverse drug reactions occurred in the STH arm (18.2 reactions per 100 person years [PYO]) compared with one in the RHZ arm (1.6 reactions per 100 PYO) for a relative risk of 11.7 (95% CI 1.52-90.0). 10 cutaneous reactions occurred in the STH arm (15.2 events per 100 PYO) compared with one event in the RHZ arm (1.6 events per 100 PYO) for a relative risk of 9.7 (95% CI: 1.24, 75.8). A greater proportion of RHZ patients compared with STH patients had sterilised their sputum within two months (74% vs 37%, p < 0.001). In developing countries, rifampicin-containing regimens should be given, when possible, to HIV-positive patients to reduce drug toxicity and to prolong survival.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Drug Eruptions; Drug Hypersensitivity; Drug Therapy, Combination; Female; Humans; Isoniazid; Male; Middle Aged; Pyrazinamide; Rifampin; Streptomycin; Survival Rate; Thioacetazone; Tuberculosis, Pulmonary; Uganda

The purpose of this study was to determine the efficacy and toxicity of a standard antituberculosis regimen in patients with human immunodeficiency virus (HIV) infection. We prospectively evaluated 89 patients with tuberculosis and HIV infection at an urban medical center. Eighty-two patients received isoniazid, rifampin, and pyrazinamide, with or without ethambutol, for 2 mo, followed by isoniazid and rifampin for 7 mo. Seven patients received other regimens because of drug resistance or intolerance. Therapy was self-administered in 57 patients and directly observed in 32 cases. All patients showed rapid clinical improvement during the first month of therapy, and sputum cultures reverted to negative after 3 mo in 52 of 54 patients from whom specimens were obtained. Adverse reactions to isoniazid or rifampin prompted alterations in antituberculosis regimens in five patients (6%). Forty patients (45%) died during follow-up, and tuberculosis was a potential contributory cause of death in three cases. Treatment failure occurred in five patients (6%), four of whom were noncompliant with therapy. The fifty patient had an isoniazid-resistant organism. No relapses occurred in 916 patient-months of follow-up posttreatment. We thus conclude that the 9-mo regimen used for treatment of drug-susceptible tuberculosis in HIV-infected patients is effective and well tolerated.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Ethambutol; Female; HIV-1; Humans; Isoniazid; Los Angeles; Male; Mycobacterium tuberculosis; Patient Compliance; Prospective Studies; Pyrazinamide; Remission Induction; Rifampin; Time Factors; Treatment Outcome; Tuberculosis, Pulmonary

The individual antibacterial activities of clofazimine, ethambutol, and rifampin in the treatment of Mycobacterium avium complex bacteremia in patients with AIDS were determined. Sixty human immunodeficiency virus 1-infected patients who had at least one blood culture positive for M. avium complex were randomized to receive either clofazimine (200 mg), ethambutol (15 mg/kg), or rifampin (600 mg) once daily for 4 weeks. Only ethambutol resulted in a statistically significant reduction in the level of mycobacteremia. The median change in individual baseline colony counts was -0.60 log10 cfu/mL after 4 weeks of ethambutol (P = .046). In contrast, median changes in individual baseline colony counts were -0.2 log10 cfu/mL and +0.2 log10 cfu/mL for clofazimine and rifampin, respectively (both, P > .4). Ethambutol had greater antibacterial activity, as determined by changes in the level of mycobacteremia, than either rifampin or clofazimine, supporting its continued use in combination with other agents in the treatment of M. avium infection.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Bacteremia; Clofazimine; Ethambutol; Female; Humans; Male; Microbial Sensitivity Tests; Middle Aged; Mycobacterium avium-intracellulare Infection; Rifampin

It is generally assumed that Mycobacterium avium complex (MAC) bacteremia, once it develops, is unremitting. On the basis of this presumption, changes in the level of mycobacteremia are used to gauge therapeutic response. In 7 (12%) of 60 patients enrolled in a prospective trial of MAC bacteremia and AIDS, bacteremia became undetectable before the initiation of antimycobacterial therapy. Patients with transient bacteremia reported fewer and shorter symptoms and survived longer than those with sustained bacteremia (59 vs. 31 weeks; P = .022). There was no difference in the duration of AIDS, CD4+ cell count, hematocrit, or body weight between groups. Two additional patients with transient bacteremia were identified outside this study setting. Despite disappearance of detectable mycobacteremia and subsequent administration of antimycobacterial agent(s), bacteremia once again became detectable in 6 patients 4-45 weeks after their negative pretreatment cultures. Patients with disseminated MAC may have fluctuating levels of mycobacteremia that become undetectable in the absence of antimycobacterial therapy.

Topics: Adult; AIDS-Related Opportunistic Infections; Bacteremia; Clofazimine; Drug Therapy, Combination; Ethambutol; Humans; Life Tables; Mycobacterium avium-intracellulare Infection; Prospective Studies; Recurrence; Rifampin; Risk Factors; Survival Analysis

Patients with AIDS and disseminated Mycobacterium avium complex (MAC) infection received rifampin (600 mg) plus ethambutol (25 mg/kg) plus ciprofloxacin (750 mg) or matching placebos daily for 8 weeks. Patients were monitored every 2 weeks clinically and by quantitating MAC colony-forming units (cfu) per milliliter of blood. Analysis of baseline characteristics revealed no significant differences between groups. After 8 weeks, MAC cfu had decreased by > or = 1 log/mL in 4 of 9 treated patients versus 0 of 10 placebo recipients while increasing by > or = 1 log/mL in 1 and 7, respectively (P = .006). While the average combined clinical response score declined in both groups, it tended to decrease less in treated patients (P = .36). On the other hand, dose-limiting toxicity (primarily nausea and adverse drug interactions) occurred in 9 of 12 treatment versus 1 of 12 placebo patients (P = .005). Combined rifampin [corrected]-ethambutol-ciprofloxacin therapy for disseminated MAC infection had significant microbiologic efficacy with some evidence of clinical efficacy but was associated with drug intolerance.

Topics: Adult; AIDS-Related Opportunistic Infections; Ciprofloxacin; Double-Blind Method; Drug Synergism; Drug Therapy, Combination; Ethambutol; Female; Humans; Male; Middle Aged; Mycobacterium avium-intracellulare Infection; Rifampin

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Calibration; Chromatography, High Pressure Liquid; Drug Monitoring; Ethambutol; Humans; Isoniazid; Pyrazinamide; Reference Standards; Reproducibility of Results; Rifabutin; Rifampin; Sensitivity and Specificity; Tandem Mass Spectrometry; Tuberculosis

Isoniazid resistant tuberculosis is the most prevalent type of resistance in Swaziland and over two-thirds of the isoniazid resistant tuberculosis patients are tuberculosis and human immunodeficiency virus co-infected. The study aimed to determine risk factors associated with isoniazid resistant tuberculosis among human immunodeficiency virus positive patients in Swaziland.. This was a case-control study conducted in nine healthcare facilities across Swaziland. Cases were patients with isoniazid resistant tuberculosis (including 78 patients with isoniazid mono-resistant tuberculosis, 42 with polydrug-resistant tuberculosis, and 77 with multidrug-resistant tuberculosis). Controls were presumed drug-susceptible tuberculosis patients (n = 203). Multinomial logistic regression was used to determine related factors.. The median time lag from diagnosis to tuberculosis treatment initiation was 50 days for isoniazid mono or poly drug-resistant tuberculosis, 17 days for multidrug-resistant tuberculosis compared to 1 day for drug-susceptible tuberculosis patients. History of previous tuberculosis treatment was positively associated with either isoniazid mono or poly drug-resistant tuberculosis (OR = 7.91, 95% CI: 4.14-15.11) and multidrug-resistant tuberculosis (OR = 12.20, 95% CI: 6.07-24.54). Isoniazid mono or poly resistant tuberculosis patients were more likely to be from rural areas (OR = 2.05, 95% CI: 1.23-3.32) and current heavy alcohol drinkers compared to the drug-susceptible tuberculosis group. Multi drug-resistant tuberculosis patients were more likely to be non-adherent to tuberculosis treatment compared to drug-susceptible tuberculosis group (OR = 3.01, 95% CI: 1.56-5.82).. To prevent and control isoniazid resistant tuberculosis among HIV-positive patients in Swaziland, the tuberculosis program should strengthen the use of rapid diagnostic tests, detect resistance early, promptly initiate supervised tuberculosis treatment and decentralize quality tuberculosis services to the rural areas. Adherence to tuberculosis treatment should be improved.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Case-Control Studies; Eswatini; Female; HIV Infections; Humans; Isoniazid; Male; Microbial Sensitivity Tests; Middle Aged; Rifampin; Risk Factors; Socioeconomic Factors; Tuberculosis; Tuberculosis, Multidrug-Resistant

Most studies assessing drug resistant tuberculosis (DRTB) in human immunodeficiency virus (HIV) co-infected patients in India have used conventional culture- based systems to diagnose DRTB that have a longer turnaround time leading to risk of amplification of resistance to an empirical regimen. We determined the prevalence of DRTB amongst people living with HIV (PLHIV) using the line probe assay and determined risk factors associated with the presence of multi drug resistant tuberculosis (MDRTB).. A Cross-sectional study was undertaken at Poona Hospital and Research Center (PHRC) and the Institute of Infectious Diseases, two tertiary level private care centers in Pune, India. Consenting PLHIV with confirmed Pulmonary TB (PTB) and/or extra-pulmonary TB (EPTB) diagnosed based on detection of Mycobacterium TB by line probe assay (Geno Type MTBDRplus version 2) on clinical specimens were included. Those with documented past history of DRTB were excluded. Resistance against anti-TB drugs was determined by the same assay. The prevalence of any form of drug resistant TB (DRTB), MDRTB, Rifampicin resistant TB (RRTB) and Isoniazid (INH) mono-resistant TB were determined as the proportion of these amongst all included PLHIV-TB. A multivariate analysis was conducted to determine risk factors that were statistically associated with MDRTB, DRTB, RRTB and INH mono-resistant TB.. Two hundred PLHIV were recruited. The prevalence (95% CI) of MDRTB, INH mono- resistance and RR resistance was 12.5% (7.9-17.1%), 9% (6.9-11.2%) and 2.5% (1.4-3.6%), respectively. The prevalence (95% CI) of MDRTB among new and relapsed patients was 8.8% (6.5-11.1%) and 23.1% (17.2-28.9%), respectively. Tuberculosis relapse was the only factor significantly associated with MDRTB, DRTB and INH mono-resistant TB.. We document a high prevalence of drug resistance to anti-TB drugs including MDRTB among PLHIV in our setting using Geno Type MTBDRplus directly on clinical specimens. This validates the WHO recommendation of performing routine rapid molecular resistance testing prior to initiating anti-TB treatment among all PLHIV with presumptive TB. Using rapid molecular testing especially Geno Type MTBDRplus (that detects resistance to INH and Rifampicin simultaneously) reduces the turn-around time helping in optimizing treatment.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Cross-Sectional Studies; Female; HIV Infections; Humans; India; Isoniazid; Male; Middle Aged; Prevalence; Rifampin; Risk Factors; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antibiotics, Antitubercular; Antifungal Agents; Dose-Response Relationship, Drug; Drug Interactions; Fluconazole; HIV Infections; Humans; Mycoses; Rifampin; Sertraline; Tuberculosis

The relatively simple and cheaper light-emitting diode fluorescent microscopy (LED-FM) was recommended by the World Health Organization (WHO) to replace the conventional tuberculosis (TB) microscopy in both high- and low-volume laboratories. More recently the WHO also endorsed one more technique, Xpert MTB/RIF® assay (Xpert), for improved TB diagnosis particularly among human immunodeficiency virus (HIV)-infected cases. However, the relative performance of both of these tools differs from setting to setting in reference to the conventional TB diagnostics. This study thus aimed to evaluate these tools for TB detection in individuals visiting Ambo Hospital, west-central Ethiopia.. Cross-sectional early-morning sputum samples were collected from presumptive TB patients between January and August 2015. Socio-demographic data were captured using a structured questionnaire. Clinical information was gathered from patients' medical records. The sputum samples were diagnosed using LED-FM, Xpert, concentrated Ziehl-Neelsen (cZN) staining and Lowenstein-Jensen (LJ) culture as the gold standard. Drug sensitivity test (DST) was also conducted.. Out of 362 sputum samples collected and processed, 36(9.9%) were positive by LED-FM, 42(11.6%) by cZN and 50(13.8%) by Xpert. But, only 340 samples could be declared culture positive or negative for mycobacteria. Of these 340, eight were non-tubercle mycobacteria (NTM). Out of the remaining 332 samples, 45(13.6%) had culture-confirmed TB with 11(24.4%) being HIV co-infected. LED-FM, Xpert and culture detected 54.5% (6/11), 90.9% (10/11) and 100% (11/11) mycobacteria in HIV-positive individuals and 81.3% (26/32), 73.7% (28/38), 78.8% (26/33) and 73.2% (30/41), in HIV negatives respectively. Two samples were rifampicin resistant by both Xpert and DST. The overall sensitivity, specificity, positive and negative predictive values of LED-FM and Xpert were 77.8, 100, 100 and 96; and 93.3, 98, 97.5 and 98.9% respectively.. The data demonstrated the high diagnostic yield of Xpert. LED-FM sensitivity is higher compared to results quoted by recent systematic reviews although it appears to be lower than what was cited in the WHO policy statement (83.6%) during the recommendation of the technology. The high specificity of LED-FM in the study area is encouraging and is expected to boost its reliability and uptake.

Topics: Adolescent; Adult; Aged; Aged, 80 and over; AIDS-Related Opportunistic Infections; Biological Assay; Child; Child, Preschool; Coinfection; Cross-Sectional Studies; Drug Resistance, Bacterial; Ethiopia; Female; HIV Infections; Hospitals; Humans; Male; Microscopy, Fluorescence; Middle Aged; Mycobacterium tuberculosis; Rifampin; Sensitivity and Specificity; Sputum; Tuberculosis, Pulmonary; Young Adult

Since the recent introduction of GeneXepert for the detection of Tuberculosis (TB) drug resistance mutations in both primary resistance and acquired resistance in Zambia, little has been documented in literature on the issue of rifampicin resistance especially in the face of a high National TB burden. The study aimed to determine the prevalence of rifampicin resistance in tuberculosis patients at Livingstone Central Hospital for the year 2015.. This was a cross sectional study conducted at Livingstone Central Hospital where we reviewed 152 records (from January 1, 2015 to 31st December, 2015) involving patients who presented with clinically suspected TB or documented TB, whose samples were sent to the laboratory for GeneXpert Mycobacterium tuberculosis/rifampicin testing. Statistical evaluations used a one-sample test of proportion and Fisher's exact test.. The age of participants ranged from 8 months to 73 years old (median = 34). Of the participants with complete data on gender, 99 (66%) and 52 (34%) were males and females respectively. The TB co-infection with HIV prevalence was 98.3% (p < 0.001). Prevalence of rifampicin resistance was 5.9% and there was no statistical significant difference between being male or female (p = 0.721).. We were able to show from our study, evidence of rifampicin resistance at Livingstone Central Hospital. Hence, there was need for further in-depth research and appropriate interventions (i.e close follow-up and patient care for drug resistance positive patients).

Topics: Adolescent; Adult; Aged; AIDS-Related Opportunistic Infections; Child; Child, Preschool; Cross-Sectional Studies; Drug Resistance, Bacterial; Female; Hospitals; Humans; Infant; Male; Middle Aged; Mutation; Mycobacterium tuberculosis; Prevalence; Rifampin; Tuberculosis; Young Adult; Zambia

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Female; Humans; Levofloxacin; Male; Rifampin; Tuberculosis, Meningeal

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Female; Humans; Levofloxacin; Male; Rifampin; Tuberculosis, Meningeal

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Female; Humans; Levofloxacin; Male; Rifampin; Tuberculosis, Meningeal

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Female; Humans; Levofloxacin; Male; Rifampin; Tuberculosis, Meningeal

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Female; Humans; Levofloxacin; Male; Rifampin; Tuberculosis, Meningeal

Microscopic Observation Drug Susceptibility (MODS) and Xpert MTB/Rif (Xpert) are highly sensitive tests for diagnosis of pulmonary tuberculosis (PTB). This study evaluated the cost effectiveness of utilizing MODS versus Xpert for diagnosis of active pulmonary TB in HIV infected patients in Uganda.. A decision analysis model comparing MODS versus Xpert for TB diagnosis was used. Costs were estimated by measuring and valuing relevant resources required to perform the MODS and Xpert tests. Diagnostic accuracy data of the tests were obtained from systematic reviews involving HIV infected patients. We calculated base values for unit costs and varied several assumptions to obtain the range estimates. Cost effectiveness was expressed as costs per TB patient diagnosed for each of the two diagnostic strategies. Base case analysis was performed using the base estimates for unit cost and diagnostic accuracy of the tests. Sensitivity analysis was performed using a range of value estimates for resources, prevalence, number of tests and diagnostic accuracy.. The unit cost of MODS was US$ 6.53 versus US$ 12.41 of Xpert. Consumables accounted for 59 % (US$ 3.84 of 6.53) of the unit cost for MODS and 84 % (US$10.37 of 12.41) of the unit cost for Xpert. The cost effectiveness ratio of the algorithm using MODS was US$ 34 per TB patient diagnosed compared to US$ 71 of the algorithm using Xpert. The algorithm using MODS was more cost-effective compared to the algorithm using Xpert for a wide range of different values of accuracy, cost and TB prevalence. The cost (threshold value), where the algorithm using Xpert was optimal over the algorithm using MODS was US$ 5.92.. MODS versus Xpert was more cost-effective for the diagnosis of PTB among HIV patients in our setting. Efforts to scale-up MODS therefore need to be explored. However, since other non-economic factors may still favour the use of Xpert, the current cost of the Xpert cartridge still needs to be reduced further by more than half, in order to make it economically competitive with MODS.

Topics: AIDS-Related Opportunistic Infections; Algorithms; Bacteriological Techniques; Cost-Benefit Analysis; Decision Support Techniques; Disease Susceptibility; DNA, Bacterial; HIV Infections; Humans; Isoniazid; Microbial Sensitivity Tests; Microscopy; Models, Theoretical; Mycobacterium tuberculosis; Prevalence; Real-Time Polymerase Chain Reaction; Rifampin; Sensitivity and Specificity; Tuberculosis, Pulmonary; Uganda

Khayelitsha, South Africa, with high burdens of rifampicin-resistant tuberculosis (RR-TB) and HIV co-infection.. To describe time to antiretroviral treatment (ART) initiation among HIV-infected RR-TB patients initiating RR-TB treatment and to assess the association between time to ART initiation and treatment outcomes.. A retrospective cohort study of patients with RR-TB and HIV co-infection not on ART at RR-TB treatment initiation.. Of the 696 RR-TB and HIV-infected patients initiated on RR-TB treatment between 2009 and 2013, 303 (44%) were not on ART when RR-TB treatment was initiated. The median CD4 cell count was 126 cells/mm3. Overall 257 (85%) patients started ART during RR-TB treatment, 33 (11%) within 2 weeks, 152 (50%) between 2-8 weeks and 72 (24%) after 8 weeks. Of the 46 (15%) who never started ART, 10 (21%) died or stopped RR-TB treatment within 4 weeks and 16 (37%) had at least 4 months of RR-TB treatment. Treatment success and mortality during treatment did not vary by time to ART initiation: treatment success was 41%, 43%, and 50% among patients who started ART within 2 weeks, between 2-8 weeks, and after 8 weeks (p = 0.62), while mortality was 21%, 13% and 15% respectively (p = 0.57). Mortality was associated with never receiving ART (adjusted hazard ratio (aHR) 6.0, CI 2.1-18.1), CD4 count ≤100 (aHR 2.1, CI 1.0-4.5), and multidrug-resistant tuberculosis (MDR-TB) with second-line resistance (aHR 2.5, CI 1.1-5.4).. Despite wide variation in time to ART initiation among RR-TB patients, no differences in mortality or treatment success were observed. However, a significant proportion of patients did not initiate ART despite receiving >4 months of RR-TB treatment. Programmatic priorities should focus on ensuring all patients with RR-TB/HIV co-infection initiate ART regardless of CD4 count, with special attention for patients with CD4 counts ≤ 100 to initiate ART as soon as possible after RR-TB treatment initiation.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Child; Child, Preschool; Female; Humans; Infant; Infant, Newborn; Male; Rifampin; South Africa; Treatment Outcome; Tuberculosis, Multidrug-Resistant; Young Adult

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Hypersensitivity Syndrome; Humans; Male; Patch Tests; Recurrence; Rifampin; Tuberculosis, Pulmonary

The efficacy of tuberculosis (TB) treatment in Human Immunodeficiency Syndrome (HIV) co-infected patients may be compromised by genetic and pharmacokinetic variation in drug disposition. Rifampicin is a critical component of TB treatment. We investigated the influence of drug transporter gene polymorphisms on rifampicin concentrations in TB-HIV co-infected patients in Durban, South Africa.. Rifampicin concentrations were measured 2.5 hours post-dose (approximated peak, C2.5 hr) in patients receiving either 450mg or 600mg rifampicin, randomized to either integrated or sequential antiretroviral treatment. Patients were genotyped for SLCO1B1 (rs4149032) polymorphisms. A mixed effects regression model was fitted to assess the influence of various factors on rifampicin concentrations. TB recurrence rates were also estimated.. In 57 patients, median (IQR) C2.5 hr was 3.6 (2.8-5.0) µg/mL. Polymorphism frequency in the SLCO1B1 (rs4149032) drug transporter gene was high (0.76) and was associated with low median rifampicin C2.5 hr, 3.7 (2.8-5.0) µg/mL in the heterozygous and 3.4 (2.7-4.7) µg/mL in the homozygous variant carriers. Concentrations were also low in males (p < 0.0001) and those with low haemoglobin (p = 0.02). Although reinfection could not be distinguished from reactivation for the 43 patients followed post trial, the incidence of TB recurrence was 7.1 per 100 person-years. Of the eight patients in whom TB recurred, seven had the polymorphism.. Approximated peak rifampicin concentrations were well below the recommended target range of 8 to 24 µg/mL in this patient population with its high frequency of the SLCO1B1 (rs4149032) polymorphism. Increased rifampicin dosage may be warranted in African, HIV- TB co-infected patients.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Cohort Studies; Female; HIV Infections; Humans; Liver-Specific Organic Anion Transporter 1; Male; Middle Aged; Organic Anion Transporters; Plasma; Polymorphism, Genetic; Recurrence; Rifampin; South Africa; Time Factors; Tuberculosis; Young Adult

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Developing Countries; DNA, Bacterial; Humans; Meta-Analysis as Topic; Mycobacterium tuberculosis; Nucleic Acid Amplification Techniques; Rifampin; Sputum; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Communicable Diseases; Health Policy; Humans; Mycobacterium tuberculosis; Point-of-Care Systems; Rifampin; Tuberculosis; Tuberculosis Vaccines; Tuberculosis, Multidrug-Resistant

Topics: Adolescent; AIDS-Related Opportunistic Infections; Antitubercular Agents; BCG Vaccine; Child; Child, Preschool; Disease Susceptibility; Humans; Immunity, Innate; Isoniazid; Mycobacterium tuberculosis; Rifampin; Risk Factors; Tuberculosis; Tuberculosis Vaccines; Tuberculosis, Multidrug-Resistant

Tygerberg Children's Hospital (TCH) and Brooklyn Chest Hospital (BCH), South Africa.. To describe paediatric cases of rifampicin (RMP) monoresistant tuberculosis (RMR-TB) disease.. Records of children with culture-confirmed RMR-TB between 1 March 2003 and 28 February 2009 were identified from a prospectively recorded database of drug-resistant TB at TCH and BCH. Mutation analysis was performed on available specimens.. Eighteen children with a median age of 6.9 years (range 2 months-12.8 years) were identified. Nine (50%) were human immunodeficiency virus (HIV) infected and four (22%) were HIV-exposed but non-infected. Eleven (61%) had had previous TB treatment or prophylaxis. Nine children (50%) had cavitary disease and five children (22%) had extra-pulmonary disease. Twelve (67%) had adult TB source cases, including five (42%) adults with known RMR-TB. Primary transmission occurred among 11 children (61%) and acquisition of RMR-TB was possible in seven (39%) with prior RMP exposure. Median delay to specific RMR-TB treatment was 70 days (range 23-188). One child died from RMR-TB meningitis. Gene mutations consistent with RMR-TB were confirmed in five available samples.. RMR-TB disease is increasingly encountered, particularly among HIV-infected and HIV-exposed non-infected children. Delay in commencing appropriate treatment for RMR-TB and high rates of cavitary disease could be a source of RMR-TB transmission.

Topics: Adolescent; Age Factors; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Child; Child, Preschool; Coinfection; DNA Mutational Analysis; DNA, Bacterial; Drug Resistance, Bacterial; Female; HIV Infections; Hospitals, Pediatric; Humans; Infant; Infant, Newborn; Male; Microbial Sensitivity Tests; Microscopy; Mutation; Mycobacterium tuberculosis; Predictive Value of Tests; Retrospective Studies; Rifampin; South Africa; Sputum; Treatment Outcome; Tuberculosis, Pulmonary

In Kenya, which ranks thirteenth of 27 high tuberculosis burden countries, diagnosis is based on Ziehl-Neelsen staining alone and patients are treated without information on sensitivity patterns. This study aimed to determine resistance patterns of Mycobacterium tuberculosis isolated from pulmonary samples.. Pulmonary tuberculosis patients in Nairobi were randomly sampled after informed consent and recruited into the study using a structured questionnaire. Specimens were cultured in liquid and solid media, and drug susceptibility tests were performed for first-line drugs including (isoniazid, rifampin, streptomycin, ethambutol and pyrazinamide).. Eighty-six (30%) of 286 isolates were resistant to at least one of five antibiotics tested. Thirty-seven (30.2%) isolates were resistant to isoniazid; 15 (11.6%) to streptomycin; 13 (4.5%) to ethambutol; four (1.4%) to rifampin ; and 30 (10.4%) to pyrazinamide. Double resistance was seen as follows: four (1.4%) isolates were resistant to both isoniazid and pyrazinamide; four (1.4%) to streptomycin and isoniazid; and one (0.3%) to rifampin and streptomycin. Two isolates (0.7%) were multidrug resistant, and one was triple resistant with an additional resistance to ethambutol. Results also showed 88.7% of patients were below the age of 40 years, while 26.3% were HIV positive. The majority of the patients (66.5%) were unemployed or self-employed in small businesses, with 79.4% earning less than 100 USD per month.. The high resistance observed in isoniazid, which is a first-line drug, could result in an increase in multidrug resistance unless control programs are strengthened. Poverty should be addressed to reduce infection rates.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance, Bacterial; Female; HIV Infections; Humans; Isoniazid; Kenya; Male; Microbial Sensitivity Tests; Middle Aged; Mycobacterium tuberculosis; Rifampin; Surveys and Questionnaires; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Arthritis, Infectious; Bacteremia; Candidiasis, Oral; Clarithromycin; Drug Therapy, Combination; Ethambutol; Humans; Immunocompromised Host; Isoniazid; Knee Joint; Male; Mycobacterium Infections, Nontuberculous; Mycobacterium kansasii; Radiography; Rifampin; Tuberculosis, Osteoarticular

Tygerberg Children's Hospital, Cape Town, South Africa.. To determine the prevalence and trend of drug resistance and human immunodeficiency virus (HIV) co-infection among children with culture-confirmed tuberculosis (TB).. Prospective surveillance from March 2007 to February 2009, compared to three previous surveys (1994-1998, 2003-2005, 2005-2007). Drug susceptibility testing (DST) against isoniazid (INH) and rifampicin (RMP) was performed using genotypic and phenotypic testing. If multidrug-resistant TB (MDR-TB) was detected, further DST against ethambutol (EMB) and second-line drugs was performed.. A total of 294 children with a median age of 26 months (range 3 days-13 years) were diagnosed with culture-confirmed TB. DST results were available for 292 (99.3%); 41 (14%) were INH-resistant, including 26 (8.9%) with MDR-TB. Four children (1.4%) had RMP monoresistance. EMB resistance was present in 12/24 (50%) MDR-TB cases tested. Two isolates were resistant to ofloxacin; none had extensively drug-resistant TB. Of those tested, 29% (63/217) were HIV-infected. Any resistance to RMP increased between 1994 and 2009 (P < 0.001), as did RMP monoresistance (P = 0.009) and MDR-TB (P < 0.001). Sensitivity was 87.5% and specificity 100% for genotypic compared to phenotypic testing for INH resistance.. RMP, and consequently multidrug, resistance is increasing among children with TB in this setting. EMB resistance is common among children with resistance to RMP and INH.

Topics: Adolescent; AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Child, Preschool; Coinfection; Epidemics; Ethambutol; Female; HIV Infections; Humans; Infant; Infant, Newborn; Isoniazid; Male; Mycobacterium tuberculosis; Prevalence; Rifampin; South Africa; Tuberculosis, Multidrug-Resistant

To estimate the impact of antiretroviral therapy (ART) on the incidence of recurrent tuberculosis (TB) in an African population.. A long-term population cohort in Karonga District, northern Malawi.. Patients who had completed treatment for laboratory-confirmed TB diagnosed since 1996 were visited annually to record vital status, ART use and screen for TB. Survival analysis estimated the effect of HIV/ART status at completion of treatment on mortality and recurrence. Analyses were stratified by time since treatment completion to estimate the effects on relapse (predominates during first year) and reinfection disease (predominates later).. Among 1133 index TB cases contributing 4353 person-years of follow-up, there were 307 deaths and 103 laboratory-confirmed recurrences (recurrence rate 4.6 per 100 person-years). Half the recurrences occurred in the first year since completing treatment. HIV infection increased the recurrence rate [rate ratio adjusted for age, sex, period and TB type 2.69, 95% confidence interval (CI) 1.69-4.26], but with less effect in the first year (adjusted rate ratio 1.71, 95% CI 0.87-3.35) than subsequently (adjusted rate ratio 4.2, 95% CI 2.16-8.15). Recurrence rates on ART were intermediate between those of HIV-negative individuals and HIV-positive individuals without ART. Compared with HIV-positive individuals without ART, the adjusted rate ratio was 0.74 (95% CI 0.27-2.06) in the first year, and 0.43 (95% CI 0.11-1.73) later.. The increased incidence of TB recurrence observed in HIV-positive patients appeared to be reduced by ART. The effects are mostly on later (likely reinfection) disease so the impact of ART on reducing recurrence will be highest in high TB incidence settings.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; CD4 Lymphocyte Count; Cohort Studies; Drug Administration Schedule; Female; Follow-Up Studies; HIV Seropositivity; Humans; Incidence; Isoniazid; Malawi; Male; Middle Aged; Population Surveillance; Recurrence; Rifampin; Risk Factors; Streptomycin; Survival Analysis; Treatment Outcome; Tuberculosis; Young Adult

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance, Bacterial; Drug Therapy, Combination; Humans; Infant; Infant, Newborn; Isoniazid; Rifampin; Tuberculosis

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Bacteriological Techniques; Drug Resistance, Bacterial; False Negative Reactions; Humans; Molecular Diagnostic Techniques; Mycobacterium tuberculosis; Retrospective Studies; Rifampin; Severity of Illness Index; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Bacteriological Techniques; Drug Resistance, Bacterial; Humans; India; Microbial Sensitivity Tests; Molecular Diagnostic Techniques; Mycobacterium tuberculosis; Rifampin; Sensitivity and Specificity; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Bacteriological Techniques; Cost-Benefit Analysis; Direct Service Costs; Drug Resistance, Bacterial; Humans; Microbial Sensitivity Tests; Molecular Diagnostic Techniques; Mycobacterium tuberculosis; Rifampin; Sensitivity and Specificity; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Abscess; Adult; AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antiretroviral Therapy, Highly Active; Antitubercular Agents; Axilla; Clarithromycin; Darunavir; Dideoxynucleosides; Enfuvirtide; Ethambutol; HIV Envelope Protein gp41; HIV-1; Humans; Immune Reconstitution Inflammatory Syndrome; Isoniazid; Lamivudine; Lymph Node Excision; Lymphadenitis; Male; Mycobacterium avium-intracellulare Infection; Peptide Fragments; Pyrazinamide; Rifampin; Ritonavir; Streptomycin; Sulfonamides

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antibiotics, Antitubercular; HIV-2; Humans; Male; Middle Aged; Pyrrolidinones; Raltegravir Potassium; Rifampin; Tuberculosis

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Clinical Trials as Topic; Drug Resistance, Bacterial; HIV Infections; Humans; India; Rifampin; Tuberculosis

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Antibiotics, Antitubercular; Buruli Ulcer; Drug Therapy, Combination; Humans; Male; Rifampin; Streptomycin

The population pharmacokinetics (PK) of lopinavir in tuberculosis (TB)/human immunodeficiency virus (HIV) co-infected South African children taking super-boosted lopinavir (lopinavir/ritonavir ratio 1:1) as part of antiretroviral treatment in the presence of rifampicin were compared with the population PK of lopinavir in HIV-infected South African children taking standard doses of lopinavir/ritonavir (ratio 4:1).. Lopinavir concentrations were measured in 15 TB/HIV-co-infected paediatric patients who were sampled during and after rifampicin-based TB treatment and in 15 HIV-infected children without TB. During TB therapy, the dose of ritonavir was increased to lopinavir/ritonavir 1:1 in order to compensate for the induction of rifampicin. The children received median (interquartile range=IQR) doses of lopinavir 292 mg/m(2) (274, 309) and ritonavir 301 mg/m(2) (286, 309) twice daily. After TB treatment completion the children received standard doses of lopinavir/ritonavir 4:1 (median [IQR] lopinavir dose 289 mg/m(2) [286, 303] twice daily) as did those without TB (median [IQR] lopinavir dose 265 mg/m(2) [249, 289] twice daily).. Lopinavir oral clearance (CL/F) was about 30% lower in children without TB than in co-infected children treated with super-boosted lopinavir. However, the predicted lopinavir C(min) was above the recommended minimum therapeutic concentration during TB/HIV co-treatment in the 15 children. Lopinavir CL/F increased linearly during the dosing interval.. Increasing the ritonavir dose to achieve a lopinavir/ritonavir ratio of 1:1 when given in combination with rifampicin-based TB treatment did not completely compensate for the enhancement of lopinavir CL/F caused by rifampicin. The time-dependent lopinavir CL/F might be due to a time-dependent recovery from ritonavir inhibition of lopinavir metabolism during the dosing interval.

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Child, Preschool; Dose-Response Relationship, Drug; Drug Administration Schedule; Drug Therapy, Combination; Female; HIV Infections; HIV Protease Inhibitors; Humans; Infant; Lopinavir; Male; Pyrimidinones; Rifampin; Ritonavir; South Africa; Time Factors; Treatment Outcome; Tuberculosis, Pulmonary

Tuberculosis is the leading cause of death in South Africa by death notification, but accurate diagnosis of tuberculosis is challenging in this setting of high HIV prevalence. We conducted limited autopsies on young adults dying in a single public hospital in the province of KwaZulu-Natal between October 2008 and August 2009 in order to estimate the magnitude of deaths attributable to tuberculosis.. We studied a representative sample of 240 adult inpatients (aged 20-45 years) dying after admission to Edendale Hospital. Limited autopsies included collection of respiratory tract secretions and tissue by needle core biopsies of lung, liver, and spleen. Specimens were examined by fluorescent microscopy for acid-fast bacilli and cultured in liquid media; cultures positive for M. tuberculosis were tested for drug susceptibility to first- and second-line antibiotics. Ninety-four percent of our study cohort was HIV seropositive and 50% of decedents had culture-positive tuberculosis at the time of death. Fifty percent of the participants were on treatment for tuberculosis at the time of death and 58% of these treated individuals remained culture positive at the time of death. Of the 50% not receiving tuberculosis treatment, 42% were culture positive. Seventeen percent of all positive cultures were resistant to both isoniazid and rifampin (i.e., multidrug resistant); 16% of patients dying during the initiation phase of their first ever course of tuberculosis treatment were infected with multidrug-resistant bacilli.. Our findings reveal the immense toll of tuberculosis among HIV-positive individuals in KwaZulu-Natal. The majority of decedents who remained culture positive despite receiving tuberculosis treatment were infected with pan-susceptible M. tuberculosis, suggesting that the diagnosis of tuberculosis was made too late to alter the fatal course of the infection. There is also a significant burden of undetected multidrug-resistant tuberculosis among HIV-coinfected individuals dying in this setting. New public health approaches that improve early diagnosis of tuberculosis and accelerate the initiation of treatment are urgently needed in this setting. Please see later in the article for the Editors' Summary.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Autopsy; Drug Resistance, Bacterial; Female; HIV; HIV Seropositivity; Hospitals; Humans; Isoniazid; Male; Middle Aged; Mycobacterium tuberculosis; Prevalence; Rifampin; South Africa; Tuberculosis, Multidrug-Resistant; Young Adult

Topics: Adolescent; Age Distribution; Aged; AIDS-Related Opportunistic Infections; Amikacin; Anti-Infective Agents; Buruli Ulcer; Child; Combined Modality Therapy; Debridement; Drug Therapy, Combination; Female; Humans; Metronidazole; Mycobacterium ulcerans; Osteomyelitis; Rifampin; Streptomycin

A retrospective study was carried out from January 2000 to December 2003 to assess the resistance of Mycobacterium tuberculosis to antituberculosis drugs and the impact of this on the treatment result. Two hundred and two patients' files were studied (average age: 36 years; sex-ratio: 1.7). Pulmonary localisation (85.7%) or extrapulmonary localisation (14.3%). HIV status is negative (71.3%), positive (10.8%) or unknown (17.9%). The overall recovery rate is 60.7% (61.4% in HIV-; 46.1% in HIV+), the rate of treatment failure is 2.7% (1.1% in HIV-; 15.4% in HIV+), the death rate due to tuberculosis is 6.3% (2.3% in HIV-; 23.1% in HIV+), and the rate of patients who disappeared from the system is 30.3% (35.2% in HIV-; 14.2% in HIV+). Hepatotoxicity that occurred during treatment is observed in 14.3% of cases (recovery: 56.2%; failure: 6.2%; lost from the system: 18.8%). Eighty-four percent of patients never received antituberculosis treatment (group A) versus 15.8% of patients who had already received one or more antituberculosis drugs (group B). The rates of resistance to isoniazid are 6.4% (A) and 12.5% (B), to rifampicin 1.7% (A) and 12.5% (B), to ethambutol 0.5% (A) and 0% (B), to streptomycin 24.1% (A) and 46.8% (B). The percentage of multiresistant strains is 1% in patients not treated previously and 11% in those who had already received antituberculosis treatment. When the patients are carriers of a strain that is responsive to the treatment administered, the recovery rate is 64.2% versus 46.7% in patients whose strain is resistant to at least one of the treatments administered.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Ethambutol; Female; HIV Infections; Hospitals, University; Humans; Immunocompromised Host; Isoniazid; Male; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Retrospective Studies; Rifampin; Senegal; Streptomycin; Treatment Failure; Treatment Outcome; Tuberculosis; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Anti-HIV Agents; Antitubercular Agents; Drug Interactions; HIV Infections; Humans; Rifampin

Topics: AIDS-Related Opportunistic Infections; Alkynes; Anti-HIV Agents; Antibiotics, Antitubercular; Benzoxazines; Cyclopropanes; Drug Interactions; Humans; Male; Middle Aged; Rifampin; Tuberculosis

The objective of this study was to observe the prevalence of drug resistance in Mycobacterium tuberculosis isolates in HIV associated tuberculosis co-infected patients in Phnom Penh City. The isolates of M. tuberculosis were collected during active laboratory-based surveillance. Of the 98 isolates studied, M. tuberculosis resistance to isoniazid was seen in 23.5%, resistance to rifampicin was seen in 16.3% and multidrug-resistance (MDR-TB) was seen in 5.1%. Our findings reveal an alarmingly high level of resistance to isoniazid and rifampicin, and confirms the need for drug susceptibility testing to guide treatment in patients with culture positive tuberculosis.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Cambodia; HIV Infections; HIV Seropositivity; HIV-1; Humans; Isoniazid; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Prevalence; Rifampin; Risk Factors; Streptomycin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

This study aimed to determine the prevalence and risk factors of drug-resistant tuberculosis (TB), and to develop a diagnostic algorithm for newly-diagnosed TB patients.. This is a retrospective medical chart review of 290 patients who were diagnosed with bacteriological-proven pulmonary TB between 2000 and 2006 in Ramathibodi Hospital, Thailand. Patient characteristics, radiological and microbiological findings, as well as a history of previous TB disease and treatment, were included in the analysis of predictive factors of drug resistance. Predictive scores were derived from statistically significant factors at the cut-off point of the receiver-operating curve that yielded the best area under the curve.. The resistance rate to each of these drugs among 290 patients was: isoniazid, 6.9 percent; rifampicin, 4.5 percent; either isoniazid or rifampicin, 9.0 percent; and multidrug resistance, 2.4 percent. Far advanced TB was an independent risk factor for isoniazid resistance. Rifampicin resistance was associated with recurrent TB within six months after the completion of treatment and prior incomplete TB treatment. A drug-resistant TB predictive score of either isoniazid or rifampicin resistance was developed based on the aforementioned factors. The cut-off score of greater than or equal to 3 yielded the least error of classification in differentiating patients with the resistant strain from those with the susceptible strain at a sensitivity of 57.7 percent, a specificity of 67.8 percent, a positive predictive value of 15 percent and a negative predictive value of 94.2 percent.. Our study suggested a drug-resistant TB predictive score for the exclusion of either isoniazid or rifampicin resistance, and provides a decisional guide for the clinician on whether to send a patient's respiratory specimen for sputum culture and drug susceptibility testing.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; Algorithms; Antitubercular Agents; Cross-Sectional Studies; Female; Humans; Incidence; Isoniazid; Male; Microbial Sensitivity Tests; Middle Aged; Retrospective Studies; Rifampin; Risk Factors; Thailand; Tuberculosis, Multidrug-Resistant

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Chemical and Drug Induced Liver Injury; Drug Interactions; HIV Protease Inhibitors; Humans; Research Design; Rifampin; Tuberculosis

There is limited comparative data between efavirenz (EFV) 600 mg/day and nevirapine (NVP) 400 mg/day-based antiretroviral therapy (ART) among HIV-1 patients with tuberculosis (TB) and receiving rifampicin.. A retrospective cohort study was conducted in all ART-naïve patients who were receiving rifampicin between January 2002 and December 2005.. Of 188 patients, 77 and 111 patients were initiated on EFV-based ART (EFV group) and NVP-based ART (NVP group), respectively. Overall, median [interquartile range (IQR)] CD4 count was 36 (15-77) cells/microL and median (IQR) viral load was 5.6 (5.2-5.9) HIV-1 RNA log copies/mL. At 48 weeks, 77.9% (60/77) in the EFV group and 67.6% (75/111) in the NVP group achieved HIV-1 RNA <50 copies/mL (P=0.140, odds ratio=0.590, 95% confidence interval=0.302-1.153). At 24 and 48 weeks, respective median CD4 counts were 174 and 254 cells/muL in the EFV group and 156 and 218 cells/microL in the NVP group (P>0.05). By binary logistic regression, treatment group was not associated with HIV-1 RNA <50 copies/mL (P>0.05). No patient in the EFV group and eight (7.2%) patients in the NVP group discontinued ART because of adverse reactions (P=0.084).. For HIV-TB co-infected patients who receive rifampicin, efficacy of 600 mg EFV-based and 400 mg NVP-based ART may be similar, although adverse events tend to be higher in NVP-based ART.

Topics: Adult; AIDS-Related Opportunistic Infections; Alkynes; Antitubercular Agents; Benzoxazines; CD4 Lymphocyte Count; Cohort Studies; Cyclopropanes; Drug Administration Schedule; Drug Therapy, Combination; Female; HIV Infections; HIV-1; Humans; Male; Nevirapine; Retrospective Studies; Reverse Transcriptase Inhibitors; Rifampin; Treatment Outcome; Tuberculosis; Viral Load

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Capreomycin; Clinical Trials as Topic; Drug Administration Routes; Humans; Isoniazid; Microbial Sensitivity Tests; New York City; Rifampin; Time Factors; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Tuberculosis (TB) is a common opportunistic infection among HIV-infected people, and rifampicin is an important drug for the treatment of TB. However, administration of rifampicin in combination with antiretroviral therapy, particularly protease inhibitors, is difficult because of drug-drug interactions.. We have performed a prospective study in three HIV-infected patients with TB treated with a rifampicin-containing regimen (rifampicin 600 mg per day) and antiretroviral therapy including only nucleoside reverse transcriptase inhibitors (NRTIs) plus atazanavir 300 mg once a day (qd) and ritonavir 100 mg qd, to evaluate whether the inducing effect of rifampicin on the drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 could be overcome by the inhibitory effect of ritonavir. A complete pharmacokinetic evaluation of the steady-state concentrations of atazanavir and ritonavir was performed.. In all three cases, more than 50% of the time the atazanavir level was below the minimum recommended trough plasma level (150 ng/mL according to current pharmacokinetic guidelines) to inhibit HIV wild-type replication.. These results strongly indicate that the administration of rifampicin with a combination of atazanavir 300 mg qd plus ritonavir 100 mg qd must be avoided because subtherapeutic concentrations of atazanavir are produced.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Area Under Curve; Atazanavir Sulfate; Cytochrome P-450 CYP3A; Cytochrome P-450 Enzyme Inhibitors; Drug Interactions; Drug Therapy, Combination; Female; HIV Protease Inhibitors; Humans; Male; Oligopeptides; Prospective Studies; Pyridines; Rifampin; Ritonavir; Tuberculosis

Drug-resistant tuberculosis (DR-TB) is a serious threat in developing countries where the prevalence of both HIV and TB are high. Antiretroviral therapy (ART) has been more accessible in these countries. The present study aimed to determine the impact of ART on the prevalence of DR-TB among HIV/TB co-infected patients.. A retrospective cohort study was conducted among HIV-infected patients with culture-proved TB from 1999 to 2004. Susceptibilities of Mycobacterium tuberculosis to antituberculous drugs and rate ofART use were studied.. There were 225 patients, mean age 35.8 years, 72.4% male and median CD, 44 cells/mm(3). Patients who had received ART increased from 18.5% in 1999 to 92.1% in 2004 (p

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Comorbidity; Ethambutol; Female; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Prevalence; Retrospective Studies; Rifampin; Streptomycin; Thailand; Tuberculosis, Multidrug-Resistant

The tuberculosis (TB) mortality rate of registered TB patients in Malawi is 23%, and 59% of the deaths occur in the first 2 months of treatment. HIV-related complications appear to be an important cause. Starting antiretroviral therapy early during tuberculosis treatment may improve outcome but problems often arise with drug interactions, adherence, toxicity and immune reconstitution disease (IRD).. We prospectively followed 27 HIV-infected adult Malawians after starting Triomune (a generic fixed drug combination of stavudine, lamivudine and nevirapine) in the second week of tuberculosis treatment.. At baseline, 88% had CD4+ T-cell counts <100 cells/ml, all were anaemic and 78% were malnourished. Five patients (19%) died, two withdrew consent and one stopped all drugs due to hepatitis. At 6 months, all but one of the 19 remaining patients had good virological results (16 patients: <400 copies/ml, two patients: <1,000 copies/ml) and the median CD4+ T cell increase was 170 cells/ml. Adverse events were numerous, particularly in the first 2 months. Suspected IRD episodes could be managed without treatment interruptions. During the lead-in phase, 59% of nevirapine plasma levels were sub-therapeutic despite good adherence, compared with only 14% during weeks 4 and 8.. It is feasible to start Triomune early during TB treatment with good treatment outcome. The nevirapine lead-in phase should be avoided when rifampicin-based tuberculosis treatment is started >1 week beforehand.

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Drug Administration Schedule; Drug Therapy, Combination; HIV Infections; HIV-1; Humans; Lamivudine; Malawi; Middle Aged; Nevirapine; Reverse Transcriptase Inhibitors; Rifampin; Stavudine; Treatment Outcome; Tuberculosis

Bacillary angiomatosis is an opportunistic bacterial infection caused by either Bartonella henselae or B. quintana. The classic histologic presentation of bacillary angiomatosis involves three components: a lobular proliferation of capillaries with enlarged endothelial cells, neutrophilic debris, and clumps of finely granular material identified as bacteria with staining techniques. Pseudoepitheliomatous hyperplasia is a histologic reaction pattern characterized by epithelial proliferation in response to a variety of stimuli, including mycobacterial, fungal, and bacterial infections. We describe a case of bacillary angiomatosis associated with pseudoepitheliomatous hyperplasia in an immunocompromised patient with Acquired Immunodeficiency Syndrome. Histologic examination of a finger lesion demonstrated a capillary proliferation with neutrophilic debris and characteristic amorphous granular deposits. Warthin-Starry and Giemsa staining revealed clumps of coccobacilli. Cervical lymph node tissue also revealed organisms identified as Bartonella with PCR techniques. Stains and cultures for acid fast bacilli, fungus, and bacteria were negative. To our knowledge, there has been only one other report of bacillary angiomatosis presenting with pseudoepitheliomatous hyperplasia. We conclude that the differential diagnosis of entities associated with pseudoepitheliomatous hyperplasia should be expanded to include bacillary angiomatosis.

Topics: Acquired Immunodeficiency Syndrome; AIDS-Related Opportunistic Infections; Angiomatosis, Bacillary; Anti-Bacterial Agents; Bartonella; DNA, Bacterial; Doxycycline; Drug Therapy, Combination; Epidermis; Fingers; Humans; Hyperplasia; Immunocompromised Host; Lymph Nodes; Male; Middle Aged; Ofloxacin; Rifampin; Treatment Outcome

To assess the diagnostic utility of expanded case definitions for HIV-associated smear-negative pulmonary tuberculosis (PTB) and extra-pulmonary TB (EPTB), and to derive objective criteria for response to anti-tuberculosis treatment.. A prospective cohort study of HIV-infected adults who met expanded clinical case definitions for smear-negative PTB and EPTB.. All participants were started on rifampicin-based anti-tuberculosis treatment after mycobacterial cultures from multiple sites. At weeks 2, 4 and 8, response to treatment (RTT) was assessed by measuring changes in weight, haemoglobin, C-reactive protein, Karnofsky performance score and symptom count ratio.. Of 147 participants enrolled, 105 (71%) were diagnosed with definite (culture-positive) or probable (histological features) TB and 25 (17%) with possible TB (treatment response). The positive predictive value for the most common case definitions ranged from 89% to 96%. Significant improvements in all the RTT parameters occurred in the subjects with confirmed TB (P < 0.001). Clinically relevant RTT criteria were derived, two or more of which were met at week 8 in 97.5% of subjects with confirmed TB, 91.3% of subjects with possible TB and none of the subjects without TB.. Expanded case definitions could enhance the diagnosis of PTB and EPTB in HIV-infected adults in resource-limited settings. Using objective criteria, RTT can be assessed within 8 weeks of initiating anti-tuberculosis treatment.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; C-Reactive Protein; Cohort Studies; Female; Hemoglobins; HIV Infections; Humans; Karnofsky Performance Status; Male; Mycobacterium tuberculosis; Predictive Value of Tests; Rifampin; Sensitivity and Specificity; Sputum; Tuberculosis

The human immunodeficiency virus (HIV) is a key factor responsible for the high rates of tuberculosis (TB) in sub-Saharan Africa. Treatment of TB with rifampicin (R, RMP) containing short-course regimens is highly effective in HIV-infected adults. We conducted a study to compare the efficacy and safety of intermittent ethambutol (E, EMB) with two RMP-containing regimens to treat pulmonary TB in HIV-infected patients.. National Tuberculosis Treatment Centre, Mulago Hospital, Kampala, Uganda.. This was a prospective cohort compared to two non-randomised control groups. The study group and the two control arms were treated with 2 months of isoniazid (H), RMP, pyrazinamide (Z) and EMB followed by 6 E3H3 for the study group and 4HR or 6HR for controls.. Between April 1993 and March 2000, 136 patients were enrolled in the 2EHRZ/E3H3 arm, 147 in the 2EHRZ/4HR arm and 266 in the 2EHRZ/6HR arm. The relapse rate was 18.2 per 100 person-years observation (PYO) for the study regimen compared to 9.7/100 PYO (P = 0.0063) and 4.8/100 PYO (P = 0.0001) in patients treated with 2 EHRZ/4HR or 2EHRZ/6HR, respectively.. The 2EHRZ/6E3H3 regimen is safe and effective but has a significant risk of relapse.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Administration Schedule; Drug Therapy, Combination; Ethambutol; Female; Humans; Male; Recurrence; Rifampin; Treatment Outcome; Tuberculosis, Pulmonary; Uganda

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Developing Countries; Drug Therapy, Combination; HIV Protease Inhibitors; Humans; Rifampin; Ritonavir; Saquinavir; Tuberculosis

To present the clinical, histopathological, and molecular biologic findings in fifteen cases of ocular tuberculosis (TB) in patients with acquired immune deficiency syndrome (AIDS).. Retrospective, observational, noncomparative case series of HIV-infected patients with ophthalmic complaints and/or with advanced disease (CD4+ cell count < 200), seen between the years 1993 to 2005 at tertiary care ophthalmic and AIDS care hospitals.. Each patient underwent a complete ophthalmic examination and relevant laboratory and radiologic investigations and was treated accordingly. The study was carried out in this cohort to describe the ocular manifestations of TB. The main outcome measures were to describe the clinical course histopathologic and molecular biologic features of ocular lesions attributable to tuberculosis in AIDS patients in our center.. Ocular TB was seen in 15 (1.95%) out of 766 consecutive cases of HIV/AIDS. Nineteen eyes of 15 patients were affected. Four cases (26.66%) had bilateral presentation. Presentations of ocular TB included choroidal granulomas in 10 eyes (52.63%), subretinal abscess in seven eyes (36.84%), worsening to panophthalmitis in three eyes, conjunctival tuberculosis, and panophthalmitis each in one eye (5.26%). All cases had evidence of pulmonary tuberculosis. Coexistent central nervous system (CNS) tuberculosis was seen in two cases and one case had abdominal tuberculosis. CD4+ cell counts were done in 14 patients; the count ranged from 14 to 560 cells/microl--mean 160.85 cells/microl.. Ocular TB in AIDS is relatively rare and can occur even at CD4+ cell counts greater than 200 cells/microl. It can have varied presentations with severe sight-threatening complications.

Topics: Abscess; Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; CD4 Lymphocyte Count; Child; Conjunctival Diseases; Drug Therapy, Combination; Ethambutol; Female; Humans; Isoniazid; Male; Middle Aged; Panophthalmitis; Pyrazinamide; Retinal Diseases; Retrospective Studies; Rifampin; Tuberculosis, Central Nervous System; Tuberculosis, Ocular; Tuberculosis, Pulmonary

Rhodococcus equi, a bacterium present in soil, is a common cause of pneumonia in foals. This organism has been recognized as an opportunistic pathogen in humans, typically causing infection in immunocompromised hosts such as HIV-infected patients and organ transplant recipients. However, human infection with R. equi has not been reported in Japan except in a case involving a laboratory worker. We report the first human case of VapB-positive R. equi pneumonia, which involved an HIV-infected patient living in an urban area in Japan. The patient was treated successfully with 450 mg rifampicin and 600 mg tosufloxacin, even though his CD4+ lymphocyte count at the time of diagnosis was 10/microl. The patient's dogs were suspected in the epidemiology of this infection, but unfortunately we could not isolate the organism from canine-associated specimens in this case. R. equi infections in companion animals have been thought to be very rare, but they may be increasing in dogs. Therefore, further epidemiological research may clarify the prevalence of R. equi infection and the factors predisposing dogs to this infection.

Topics: Actinomycetales Infections; AIDS-Related Opportunistic Infections; Animals; Anti-Bacterial Agents; CD4 Lymphocyte Count; Diagnosis, Differential; Dogs; Fluoroquinolones; Humans; Male; Microbial Sensitivity Tests; Middle Aged; Naphthyridines; Rhodococcus equi; Rifampin; Tomography, X-Ray Computed

The relationship between rifamycin use and either relapse or treatment failure with acquired rifampin resistance (ARR) among human immunodeficiency virus (HIV)-infected patients with tuberculosis (TB) is not well understood.. We conducted a retrospective cohort study of HIV-infected and HIV-uninfected persons with rifampin-susceptible TB, (1) to compare relapse rates, ARR, and treatment failure, according to HIV serostatus; and (2) to examine whether and how use of rifamycin was associated with clinical outcomes of interest among HIV-infected patients with TB.. HIV-infected patients were more likely to have ARR than were HIV-uninfected patients (0.9% vs. 0.1%; P = .007), and the association remained significant in multivariate analysis (adjusted odds ratio [OR], 5.5; 95% confidence interval [CI], 1.4-21.5). Among HIV-infected patients with TB, none of 57 patients treated with rifabutin-based regimens alone had ARR, and only 1 of 395 patients treated with rifabutin given in combination with a rifampin-based regimen had ARR, whereas 6 of 355 patients treated with a rifampin-based regimen alone had relapse and ARR. HIV-infected patients treated with rifampin-based regimens alone had a higher risk for relapse and development of rifampin resistance if intermittent dosing of rifampin was started during the intensive phase of treatment, compared with patients who did not receive intermittent dosing (hazard ratio [HR] for relapse, 6.7 [95% CI, 1.1-40.1]; HR for ARR, 6.4 [95% CI, 1.1-38.4]). This association remained when confined to patients with a CD4+ T lymphocyte count of < 100 lymphocytes/mm3. Intermittent dosing started only after the intensive phase of treatment did not increase the risks of relapse and ARR among HIV-infected patients with TB.. The risk for ARR among HIV-infected persons with TB did not depend on the rifamycin used but, rather, on the rifampin dosing schedule in the intensive phase of treatment.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Cohort Studies; Drug Resistance, Bacterial; Female; HIV Infections; Humans; Male; Mycobacterium tuberculosis; New York City; Recurrence; Retrospective Studies; Rifabutin; Rifampin; Treatment Failure; Tuberculosis

The concomitant treatment of HIV-tuberculosis co-infection is complicated by pharmacological interactions between drugs, resulting in unpredictable drug levels. We monitored efavirenz levels in all tuberculosis-HIV-treated patients over 2 years. Using 800 mg/day of efavirenz, high levels and toxicity were detected in seven out of nine patients, necessitating reduction or discontinuation. Polymorphisms in cytochrome P450 2B6 may account for this. Therapeutic drug monitoring, dose reduction or a lower starting dose may be appropriate in some patients to abrogate toxicity.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; Alkynes; Anti-HIV Agents; Antibiotics, Antitubercular; Benzoxazines; Cyclopropanes; Drug Interactions; Drug Therapy, Combination; Female; Humans; Male; Middle Aged; Oxazines; Rifampin; Tuberculosis

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotic Prophylaxis; Antitubercular Agents; Diarrhea; Humans; Rifampin; Tuberculosis

Topics: Adult; AIDS-Related Opportunistic Infections; Antimony Sodium Gluconate; Antiprotozoal Agents; Antiretroviral Therapy, Highly Active; CD4 Lymphocyte Count; Diagnosis, Differential; Humans; India; Leishmaniasis, Mucocutaneous; Male; Rifampin

Topics: AIDS-Related Opportunistic Infections; Drug Resistance, Bacterial; Ethambutol; Humans; Isoniazid; Myanmar; Mycobacterium tuberculosis; Pyrazinamide; Rifampin; Streptomycin; Treatment Failure; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

The antimicrobial susceptibilities of 30 Rhodococcus equi isolates obtained from 30 patients between 1993 and 2001 in northern Thailand were investigated. The MICs showed a tendency toward resistance to various antibiotics but sensitivity to imipenem, minocycline, vancomycin, and teicoplanin (MICs, /=64 micro g/ml) to rifampin. PCR amplification and DNA sequencing of the rpoB gene and molecular typing by pulsed-field gel electrophoresis (PFGE) were performed for eight R. equi isolates from eight AIDS patients with pneumonia or lung abscess caused by R. equi between 1998 and 2001, including one low- and three high-level rifampin-resistant isolates. As a result, two high-level rifampin-resistant strains with PFGE pattern A had a Ser531Trp (Escherichia coli numbering) mutation, and one high-level rifampin-resistant strain with PFGE pattern B had a His526Tyr mutation, whereas one low-level rifampin-resistant strain with PFGE pattern C had a Ser509Pro mutation. Four rifampin-susceptible strains with PFGE patterns D and E showed an absence of mutation in the rpoB region. Our results indicate the presence of several types of rifampin-resistant R. equi strains among AIDS patients in northern Thailand.

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Animals; Antibiotics, Antitubercular; DNA-Directed RNA Polymerases; Drug Resistance, Bacterial; Female; Humans; Lung Abscess; Male; Microbial Sensitivity Tests; Mutation; Pneumonia, Bacterial; Rhodococcus equi; Rifampin; Thailand

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Anti-Infective Agents; Drug Therapy, Combination; HIV Infections; Humans; Levofloxacin; Lung Diseases; Male; Ofloxacin; Rhodococcus equi; Rifampin

The resurgence of tuberculosis is one of the most serious global public health challenges of the twenty-first century. This paper argues that the decline of tuberculosis since the nineteenth century is far better understood than its resurgence over the last twenty years. It is suggested that insights gained from the historical study of disease may provide a better analytical framework for understanding the contemporary dynamics of disease epidemiology than the current emphasis on the bio-medical and behavioural characteristics of individual patients. It is concluded that tuberculosis research requires a combination of advances in bio-medical knowledge with a broader understanding of the evolving relationship between disease and modern societies.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Attitude to Health; Communicable Disease Control; Cost of Illness; Global Health; Humans; Incidence; Poverty; Public Health; Rifampin; Social Justice; Socioeconomic Factors; Tuberculosis; Tuberculosis, Multidrug-Resistant

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Clarithromycin; Drug Therapy, Combination; Ethambutol; Female; Humans; Mycobacterium Infections, Nontuberculous; Mycobacterium ulcerans; Polymerase Chain Reaction; Rifampin

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Resistance, Microbial; Humans; Male; Rifampin; Tuberculosis

To determine the completion rate and tolerability of short-course rifamycin and pyrazinamide treatment of latent tuberculosis infection (LTBI) in HIV-infected patients through a comprehensive community-based program.. Prospective cohort, with comparison to a historical control group.. Of 3,118 patients with HIV infection screened for LTBI between February 1999 and March 2001, 135 patients were placed on rifamycin/pyrazinamide for 2 months under directly observed therapy and were compared to a historical group comprised of 93 HIV-infected patients who were placed on self-administered treatment of isoniazid for 12 months between 1996 and 1998.. Of 135 patients receiving rifamycin/pyrazinamide, 124 patients (92%) completed treatment; 5 patients had to discontinue treatment due to side effects (allergic skin reactions [n = 4], hepatitis [n = 1]). The completion rate of the historical group who received isoniazid therapy was 61% (57 of 93 patients; p < 0.001); none of those who received isoniazid experienced significant side effects.. In our experience, a comprehensive, community-based program of rifamycin/pyrazinamide for LTBI achieved significantly higher adherence than that of traditional isoniazid therapy, and thus may provide improved tuberculosis prevention in a community with high prevalence of HIV-infected patients.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; Antitubercular Agents; Case-Control Studies; Cohort Studies; Community Health Services; Drug Administration Schedule; Drug Therapy, Combination; Female; Florida; Follow-Up Studies; Humans; Male; Middle Aged; Patient Compliance; Probability; Prospective Studies; Pyrazinamide; Rifampin; Severity of Illness Index; Statistics, Nonparametric; Treatment Outcome; Tuberculosis, Pulmonary

This study was undertaken to describe treatment outcomes in patients started on a re-treatment drug regimen, assess the quality of follow up procedures and the adequacy of the currently advocated re-treatment drug regimen in Nairobi, Kenya.. A retrospective study.. Mbagathi District Hospital (MDH), Nairobi, a public hospital that serves as the Tuberculosis (Tb) referral centre for Nairobi.. The Tb register at the MDH was used to identify patients who were on the re-treatment regimen for Tb. Case records for these patients were then retrieved. From these sources, information on age, sex, HIV status, previous and current tuberculosis disease and drug regimens, adherence to treatment and treatment outcomes, was obtained. Descriptive statistics was used to analyse the data.. Of the total of 4702 patients registered at the MDH between 1996 and 1997, 593 (12.6%) were patients with either recurrent Tb, returning to treatment after default or had failed initial treatment. Of the 593 patients, case records were unavailable for 168 and 17 were children below the age of ten in whom the diagnosis of Tb was uncertain making a total of 185 patients who were excluded from the study. Of the remaining 408 patients, 77 (18.9%) were cured, 61 (15.0%) completed treatment without confirmation of cure, two (0.5%) defaulted, six (1.5%) died and 262 (64.2%) had no outcome information. There were no treatment failures. Treatment success defined as cure or treatment completion was achieved in 94.5% of the 146 patients in whom outcome data were available. HIV positive patients had a statistically significant poorer success rate (34/40, 85%) when compared with HIV negative patients (104/106, 94%), p=0.004. Mycobacterium tuberculosis culture and drug susceptibility testing, was not done.. The high number of patients with no treatment outcome information at the MDH is worrying, as these patients may harbour drug resistant bacilli and reflects an inadequate follow up service for Tb re-treatment in Nairobi. However, where treatment outcomes could be assessed, the currently advocated re-treatment regimen achieved a high success rate. These observations point to an urgent need to improve Tb documentation and follow up procedures within the public service in Nairobi in order to forestall the emergence and spread of drug resistant Tb.

Topics: Adolescent; Adult; Aged; Aged, 80 and over; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Female; HIV Seropositivity; Humans; Isoniazid; Kenya; Male; Middle Aged; Pyrazinamide; Recurrence; Retrospective Studies; Rifampin; Treatment Outcome; Tuberculosis, Pulmonary

Little is known about transmission and drug resistance of tuberculosis (TB) in Bauru, State of S o Paulo. The objective of this study was to evaluate risk factors for transmission of Mycobacterium tuberculosis strains in this area. Strains were collected from patients attended at ambulatory services in the region and susceptibility towards the main first line antibiotics was determined and fingerprinting performed. A total of 57 strains were submitted to susceptibility testing: 23 (42.6%) were resistant to at least one drug while 3 (13%) were resistant against both rifampicin and isoniazide. Resistant strains had been isolated from patients that had not (n = 13) or had (n = 9) previously been submitted to anti-TB treatment, demonstrating a preoccupying high level of primary resistance in the context of the study. All strains were submitted to IS6110 restriction fragment length polymorphism (IS6110-RFLP) and double repetitive element PCR (DRE-PCR). Using IS6110-RFLP, 26.3% of the strains were clustered and one cluster of 3 patients included 2 HIV-infected individuals that had been hospitalized together during 16 days; clustering of strains of patients from the hospital was however not higher than that of patients attended at health posts. According to DRE-PCR, 55.3% belonged to a cluster, confirming the larger discriminatory power of IS6110-RFLP when compared to DRE-PCR, that should therefore be used as a screening procedure only. No clinical, epidemiological or microbiological characteristics were associated with clustering so risk factors for transmission of TB could not be defined in the present study.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Brazil; DNA Fingerprinting; Female; Genotype; Humans; Isoniazid; Male; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Rifampin; Risk Factors; Tuberculosis, Pulmonary

A prospective study was conducted on 79 advanced immunosuppressed AIDS patients from 1997 to 1999, during which nine cases of tuberculosis (TB) were diagnosed. The main clinical and laboratory characteristics and the response to TB treatment were reviewed. The clinical manifestations of TB were: pulmonary (six cases), extrapulmonary (two cases) and disseminated (one case). These patients were being treated with highly active antiretroviral treatment (HAART) and were not responding. In three cases an optional regimen without rifampicin (RMP) was indicated to maintain HAART during TB treatment. A clinical response to TB treatment (disappearance of fever) was observed in 6/9 patients during a mean of 73 days (SD = 96). The three unresponsive patients were those treated without RMP. A switch to TB regimens containing RMP was proposed and successful. In our study, though it was limited by a small sample size, the response to TB regimens without rifampin was poor in immunosupressed patients failing HAART.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antiretroviral Therapy, Highly Active; Drug Therapy, Combination; Female; Humans; Immunocompromised Host; Male; Middle Aged; Prospective Studies; Rifampin; Treatment Outcome; Tuberculosis, Pulmonary

The use of short-course chemotherapy (SCC) in directly-observed treatment, short-course (DOTS) programmes in sub-Saharan Africa was often restricted to patients with infectious and serious forms of tuberculosis, because of high costs of such regimens. With reduced drug prices and wide-scale substitution of thiacetazone by ethambutol in the continuation phase of treatment, various short-course regimens are now available at the same or even lower costs than long-course regimens. Several DOTS programmes are considering extending access to short-course chemotherapy to non-infectious patients, or have done so already. The authors provide an overview of the issues regarding the debate on the introduction of universal SCC in national tuberculosis control programmes in low-income countries in sub-Saharan Africa. They advise on a low-risk strategy to avoid the emergence of rifampicin resistance as a consequence of the wide availability of rifampicin associated with universal short-course, and strengthening of the health system to maintain high performance levels in diagnosis and treatment.

Topics: Africa South of the Sahara; AIDS-Related Opportunistic Infections; Antitubercular Agents; Cost-Benefit Analysis; Drug Administration Schedule; Humans; National Health Programs; Outcome Assessment, Health Care; Rifampin; Sputum; Tuberculosis; Tuberculosis, Multidrug-Resistant

Topics: Adult; AIDS-Related Opportunistic Infections; Aminosalicylic Acid; Drug Resistance, Microbial; Drug Resistance, Multiple; Drug Therapy, Combination; Erythromycin; Ethambutol; Fatal Outcome; Female; Humans; Isoniazid; Microbial Sensitivity Tests; Mycobacterium Infections, Nontuberculous; Mycobacterium kansasii; Rifampin; Streptomycin; Treatment Refusal

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; CD4 Lymphocyte Count; Consumer Product Safety; Drug Therapy, Combination; HIV Protease Inhibitors; HIV-1; Humans; Pilot Projects; Pyrazinamide; Rifampin; Ritonavir; RNA, Viral; Tuberculosis; Viral Load

To assess the frequency of resistance of Mycobacterium tuberculosis to antituberculosis drugs and the factors associated with it among patients with tuberculosis (TB) and acquired immunodeficiency syndrome (AIDS).. The medical records of TB and AIDS cases diagnosed from 1992 to 1997 in a public service for AIDS care were reviewed.. Resistance was diagnosed in 82 (19%) of 431 cases. The mean and median values between the diagnosis of AIDS and the diagnosis of TB were 214.8 days and 70.5 days, respectively. Multidrug-resistant TB (MDR TB) occurred in 11.3% of cases. Of the 186 patients with no previous treatment, 13 (6.9%) presented primary MDR TB. Of the 90 cases with previous treatment, six (6.7%) presented monoresistance to rifampin and 27 (30%) presented MDR TB. The distribution of cases with sensitive and resistant M. tuberculosis strains was homogeneous in terms of the following variables: gender, age, category of exposure to human immunodeficiency virus (HIV), alcoholism, and homelessness. Multivariate analysis showed an association between resistance and the two following variables: previous treatment and duration of AIDS prior to TB exceeding 71 days. The rates of primary multiresistance and of monoresistance to rifampin were higher than those detected in HIV-negative patients in Brazil.. In this patient series, M. tuberculosis resistance was predominantly of the acquired type, and resistance was independently associated with previous treatment for TB and with duration of AIDS prior to TB exceeding 71 days.

Topics: Acquired Immunodeficiency Syndrome; Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Brazil; Community Health Centers; Confidence Intervals; Drug Resistance, Microbial; Drug Resistance, Multiple; Female; Humans; Male; Middle Aged; Mycobacterium tuberculosis; Odds Ratio; Rifampin; Time Factors; Tuberculosis

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Centers for Disease Control and Prevention, U.S.; Drug Therapy, Combination; Humans; Practice Guidelines as Topic; Pyrazinamide; Rifampin; Tuberculosis; United States

We report two patients treated with the combination of itraconazole plus rifampin for more than 4 months. While on itraconazole plus rifampin, patient 1 lost weight at a rate of 30 g/d. After stopping rifampin, he gained 14 g/d. While on itraconazole plus rifampin, patient 2 lost 41 grams/day. After stopping rifampin, he gained 33 g/d. Weight loss while taking the combination of itraconazole plus rifampin, followed by weight gain after stopping rifampin, suggests the possibility of a clinically significant drug interaction between itraconazole and rifampin.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antifungal Agents; Drug Interactions; Drug Therapy, Combination; Histoplasmosis; Humans; Itraconazole; Male; Middle Aged; Mycobacterium avium-intracellulare Infection; Rifampin; Weight Loss

The result of initial treatment with amphotericin B (0.7 mg/kg/day) plus rifampin (600 mg/day) for 2 weeks, followed by fluconazole (400 mg/day) for 8 weeks in the acute treatment of cryptococcal meningitis in AIDS is reported. There were 10 patients in the study: at 2 weeks, all had made a clinical response and cerebrospinal fluid was sterile in 4 patients; at 10 weeks, all had negative cerebrospinal fluid cultures. Serious side effects were not detected.

Topics: Adult; AIDS-Related Opportunistic Infections; Amphotericin B; Antifungal Agents; DNA-Directed RNA Polymerases; Drug Therapy, Combination; Enzyme Inhibitors; Female; Humans; Male; Meningitis, Cryptococcal; Rifampin

Cross-contamination during sequential processing of sputum specimens from different patients causes false-positive growth of Mycobacterium tuberculosis in culture. We describe an unusual case of cross-contamination in a 36-year-old man with acquired immunodeficiency syndrome and possible persistent tuberculosis. Culture with 1 of 3 sputum specimens was positive for rifampin-susceptible M tuberculosis. Review of processing revealed that his single culture-positive sputum specimen had followed a sputum specimen from another patient with active pulmonary tuberculosis that was positive in culture for M tuberculosis resistant to rifampin. Molecular strain typing by restriction fragment length polymorphism demonstrated the 2 isolates to be an identical strain of M tuberculosis. Agar proportion susceptibility testing of the rifampin-resistant isolate revealed low numbers of resistant organisms in a range of 1.5% to 3.3%. It was concluded that rifampin-susceptible organisms that constituted approximately 98% of the resistant isolate contaminated sputum from the patient with possible persistent tuberculosis. His culture result was, therefore, considered false positive, not an indication of tuberculosis.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Diagnostic Errors; Drug Resistance, Microbial; Drug Therapy, Combination; Equipment Contamination; False Positive Reactions; Humans; Male; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Polymorphism, Restriction Fragment Length; Rifampin; Specimen Handling; Tuberculosis, Pulmonary

Percentages of primary and acquired resistance to anti-tuberculosis drugs provide an epidemiological indicator useful for assessing national anti-tuberculosis programs. Rifampicin and isoniazide are widely used in countries with a high prevalence of tuberculosis. In tropical Africa, these drugs are the mainstay treatment for tuberculosis, used both in the initial and long-term regimens. Simultaneous resistance to these two antibiotics would seriously jeopardize therapeutic efficacy. We studied simultaneous rifampicin and isoniazide resistance in patients hospitalized for tuberculosis in the respiratory disease unit of the Treichville University hospital in Abidjan, Ivory Coast. Mycobacterium tuberculosis was isolated in 8 patients. All the strains isolated were resistant to streptomycin. History taking revealed that resistance was observed at the initial prescription in 6 cases. A notion of contagion was present in 4 cases. Six patients were HIV-positive. Surveillance of resistance to anti-tuberculosis drugs is helpful in detecting early changes which could compromise the efficacy of the therapeutic scheme.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Cote d'Ivoire; Ethambutol; Female; Humans; Isoniazid; Male; Medical History Taking; Mycobacterium tuberculosis; Rifampin; Streptomycin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

National Tuberculosis (TB) Treatment Centre, Mulago Hospital and Joint Clinical Research Centre, Kampala, Uganda.. To compare the quantitative sputum bacillary load between TB patients infected with the human immunodeficiency virus (HIV) and those non-infected, during treatment with standard short course chemotherapy (SCC).. To compare clinical characteristics and quantitative sputum bacillary load as measured by quantitative acid-fast bacilli (AFB) smears, colony forming unit (cfu) assay and time until positive culture in the BACTEC radiometric liquid system between 14 HIV-infected and 22 non-HIV-infected adults with initial episodes of smear-positive pulmonary TB at baseline and during treatment with standard four-drug SCC.. Other than cavitation (P = 0.042) and adenopathy (P = 0.03), which were more common among non-HIV-infected and HIV-infected patients, respectively, there were no significant differences in baseline demographic, clinical, radiological and laboratory characteristics between the groups. Mean pretreatment sputum bacillary burden (6.5+/-0.51 log10 AFB/ml, 5.91+/-0.91 log10 cfu/ml and 1.8+/-1.7 days until positive BACTEC culture for HIV-infected patients and 6.32+/-0.85 log10 AFB/ml, 5.58+/-0.68 log10 cfu/ml and 1+/-1.2 days until positive BACTC culture for non-HIV-infected patients) were comparable between HIV-infected and non-HIV-infected patients. Clinical and bacteriological responses to standard SCC and treatment outcome did not differ between the groups.. Quantitative sputum bacillary load at baseline and during SCC did not differ significantly between HIV-infected and non-HIV-infected adults with initial episodes of smear-positive TB.

Topics: Adolescent; Adult; Aged; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Colony Count, Microbial; Female; Humans; Male; Middle Aged; Rifampin; Sputum; Tuberculosis, Pulmonary

To measure the rate of primary and secondary drug resistance of Mycobacterium tuberculosis on an ongoing basis.. Data on all culture-positive tuberculosis were collected prospectively from 1995 through 1997 from a microbiological laboratory network of 19 university hospitals throughout France, and submitted quarterly to the National Reference Centre for Surveillance of Mycobacterial Diseases.. A total of 2998 patients were included in the study. Among the 2333 (78%) previously untreated patients, 8.6% had isolates resistant to any drug, 4.8% to streptomycin (SM) alone, 1.2% to isoniazid (INH) alone, 1.8% to SM + INH, and 0.3% to INH + rifampicin (RMP) or multidrug resistance (MDR). Foreign birth was independently associated with a higher risk of primary resistance to any drug (odds ratio [OR] 1.5). Among the 268 (9%) previously treated patients, 20.9% had isolates resistant to any drug, 6.3% to SM alone, 3.4% to INH alone, 4.1% to SM + INH, and 3.7% to INH + RMP. Foreign birth (OR = 2.3), and human immunodeficiency virus positive status (OR = 4.4) were independently associated with a higher risk of secondary resistance to any drug.. During the last 30 years there has been no increase in resistance to any drug among previously untreated patients. As expected, secondary resistance was highly associated with foreign birth. MDR-TB remains a rare event in France.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance, Microbial; Drug Resistance, Multiple; Female; France; Hospitals, University; Humans; Isoniazid; Male; Middle Aged; Mycobacterium tuberculosis; Rifampin; Streptomycin; Tuberculosis, Multidrug-Resistant

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antitubercular Agents; Cytochrome P-450 Enzyme System; Drug Interactions; HIV Protease Inhibitors; Humans; Rifabutin; Rifampin; Rifamycins; Tuberculosis, Pulmonary

Topics: Acquired Immunodeficiency Syndrome; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Cephalexin; Cephalosporins; Child; Female; Humans; Immunocompromised Host; Lymph Nodes; Pathology; Rifampin; Staphylococcal Infections; Staphylococcus aureus; Treatment Outcome

Corynebacterium minutissimum, known as the causative agent of erythrasma, has recently been reported as a clinically significant pathogen in the immunocompromised host. We report for the first time the possible involvement of a multidrug-resistant C. minutissimum strain in a costochondral abscess occurring in an HIV-infected patient.

Topics: Abscess; Adult; AIDS-Related Opportunistic Infections; Amikacin; Amoxicillin; Anti-Bacterial Agents; Anti-Infective Agents; Antibiotics, Antitubercular; Ciprofloxacin; Corynebacterium; Corynebacterium Infections; Drug Resistance, Microbial; Drug Resistance, Multiple; HIV Infections; HIV-1; Humans; Male; Penicillins; Ribs; Rifampin; Tomography, X-Ray Computed; Vancomycin

We report a case of an HIV-infected child with a second episode of tuberculosis 22 months after completing antituberculosis treatment. DNA fingerprinting of organisms from both episodes showed an identical strain of Mycobacterium tuberculosis. We believe this to be the first case of confirmed relapsed tuberculosis in an HIV-infected child, and suggest that a longer course of antituberculosis treatment be given to such children. ¿ 2000 The British Infection Society.

Topics: AIDS-Related Opportunistic Infections; Amoxicillin-Potassium Clavulanate Combination; Antibiotics, Antitubercular; Antitubercular Agents; Child, Preschool; DNA, Bacterial; Drug Therapy, Combination; Ethionamide; HIV; HIV Infections; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Polymorphism, Restriction Fragment Length; Pyrazinamide; Radiography, Thoracic; Rifampin; Secondary Prevention; South Africa; Tomography, X-Ray Computed; Tuberculin Test; Tuberculosis; Tuberculosis, Meningeal

National Tuberculosis Treatment Centre, Mulago Hospital, Kampala, Uganda.. To assess the efficacy of a daily, self-administered 8-month rifampicin-containing regimen for the treatment of pulmonary tuberculosis (TB) in human immunodeficiency virus (HIV) infected adults.. Treatment outcomes in patients with pulmonary TB treated with a single 8-month regimen and followed in a prospective epidemiological study.. Two hundred and sixty-five HIV-infected and 26 non-HIV-infected adults with initial episodes of pulmonary tuberculosis were treated with 2 months of daily isoniazid (INH), rifampicin (RMP), ethambutol and pyrazinamide followed by 6 months of daily INH + RMP. Median follow-up was 17.8 months. Ninety-five per cent of the HIV-infected and all of the non-HIV-infected patients who had sputum examined were sputum culture negative after 2 months of treatment. Twenty-two HIV-infected and no non-HIV-infected patients died during treatment. Relapse rates were 8.4% (5.9 per 100 person-years of observation [PYO], 95%CI 3.2-8.6) among HIV-infected patients and 4.5% (2.1/100 PYO, 95%CI 0-7.8) for non-HIV-infected patients. Adverse drug reactions occurred in 37% of the HIV-infected patients; most were minor and self-limiting.. An 8-month RMP-containing regimen was well tolerated and effective in the treatment of HIV-infected adults with initial episodes of pulmonary TB. Relapse rates were similar to those reported with 6-month short-course regimens in HIV-infected individuals. Decisions about the duration of anti-tuberculosis treatment for HIV-infected adults must balance programme resources and the likelihood of poor compliance with longer regimens with the potential for a modest decrease in relapses with longer treatment.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Therapy, Combination; Female; Humans; Male; Prospective Studies; Rifampin; Tuberculosis, Pulmonary; Uganda

A previously published report provided guidelines for managing the pharmacologic interactions that can result when patients receive protease inhibitors and nonnucleoside reverse transcriptase inhibitors (NNRTIs) for treatment of human immunodeficiency virus (HIV) infection together with rifamycins for the treatment of tuberculosis (TB). Protease inhibitors and NNRTIs are antiretroviral agents that are substrates that may inhibit or induce cytochrome P-450 isoenzymes (CYP450). Rifamycins are antituberculosis agents that induce CYP450 and may decrease substantially blood levels of the antiretroviral drugs. The pharmacologic interactions are called "drug-drug" because, in addition to the effect rifamycins have on protease inhibitors and NNRTIs, the antiretroviral agents may affect the blood levels of rifamycins. This notice presents updated data pertaining to drug-drug interactions between these agents and recommendations for their use from a group of CDC scientists and outside expert consultants.

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antibiotics, Antitubercular; HIV Infections; Humans; Rifabutin; Rifampin; Tuberculosis

The postantibiotic effects (PAEs) of rifampin, amikacin, clarithromycin, and ethambutol were determined radiometrically against five AIDS-associated isolates of Mycobacterium avium. and were found to be 20.8+/-3.4. 18.4+/-2.5, 11.8+/-1.7. and 2.4+/-0.9 h, respectively. Various two-, three- or four-drug combinations were also screened: the PAEs for a two-drug combination were generally longer than individual drugs (mean PAE of 13.8+/-1.5 to 29.2+/-7.4 h instead of 2.4+/-0.9 to 18.4+/-2.5 h for single drugs). The addition of a third drug further increased the mean PAE to a range of 21.0+/-2.6 to 32.4+/-6.1 h. Both rifampin+clarithromycin and rifampin+amikacin were the most potent two-drug combinations resulting in longer PAEs than individual drugs, whereas rifampin+amikacin+clarithromycin was the most potent three-drug combination. Parallel viable count determinations showed a good correlation between the PAE results obtained by the radiometric method or by bacterial viability assessment. These results are useful in planning future clinical investigations to clarify the possible implication of PAE in drug schedule and dosage, a line of information that is urgently needed to guide the drug administration in M. avium-infected AIDS patients, who are presently over-burdened with the administration of too many drugs for HIV-treatment and opportunistic infections.

Topics: AIDS-Related Opportunistic Infections; Amikacin; Anti-Bacterial Agents; Antitubercular Agents; Clarithromycin; Colony Count, Microbial; Drug Therapy, Combination; Ethambutol; Humans; Mycobacterium avium Complex; Mycobacterium avium-intracellulare Infection; Radiometry; Rifampin

To determine the effectiveness of twice-weekly directly observed therapy (DOT) for tuberculosis (TB) in HIV-infected and uninfected patients, irrespective of their previous treatment history. Also to determine the predictive value of 2-3 month smears on treatment outcome.. Four hundred and sixteen new and 113 previously treated adults with culture positive pulmonary TB (58% HIV infected, 9% combined drug resistance) in Hlabisa, South Africa. Daily isoniazid (H), rifampicin (R), pyrazinamide (Z) and ethambutol (E) given in hospital (median 17 days), followed by HRZE twice a week to 2 months and HR twice a week to 6 months in the community.. Outcomes at 6 months among the 416 new patients were: transferred out 2%; interrupted treatment 17%; completed treatment 3%; failure 2%; and cured 71%. Outcomes were similar among HIV-infected and uninfected patients except for death (6 versus 2%; P = 0.03). Cure was frequent among adherent HIV-infected (97%; 95% CI 94-99%) and uninfected (96%; 95% CI 92-99%) new patients. Outcomes were similar among previously treated and new patients, except for death (11 versus 4%; P = 0.01), and cure among adherent previously treated patients 97% (95% CI 92-99%) was high. Smear results at 2 months did not predict the final outcome.. A twice-weekly rifampicin-containing drug regimen given under DOT cures most adherent patients irrespective of HIV status and previous treatment history. The 2 month smear may be safely omitted. Relapse rates need to be determined, and an improved system of keeping treatment interrupters on therapy is needed. Simplified TB treatment may aid implementation of the DOTS strategy in settings with high TB caseloads secondary to the HIV epidemic.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Cohort Studies; Drug Therapy, Combination; Ethambutol; Female; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Predictive Value of Tests; Prospective Studies; Pyrazinamide; Rifampin; South Africa; Sputum; Treatment Outcome; Tuberculosis

To determine the rate of tuberculosis relapse among HIV-seropositive and -seronegative persons treated for active tuberculosis with short-course (6-month) therapy.. Consecutive cohort study.. City of Baltimore tuberculosis clinic.. Tuberculosis patients treated between 1 January 1993 and 31 December 1996.. Patients received 2 months of isoniazid, rifampin, pyrazinamide and ethambutol followed by 4 months of isoniazid and rifampin.. Passive follow-up for tuberculosis relapse was performed through September 30, 1998.. There were 423 cases of tuberculosis during the study period; 280 patients completed a 6-month course of therapy. Therapy was directly-observed for 94% of patients. Of those who completed therapy, 47 (17%) were HIV-seropositive, 127 (45%) were HIV-seronegative, and 106 (38%) had unknown HIV status. HIV-infected patients required more time to complete therapy (median 225 versus 205 days; P = 0.04) but converted sputum culture to negative within the same time period (median 77 versus 72 days; P = 0.43) as HIV-seronegative or unknown patients. Relapse occurred in three out of 47 (6.4%) HIV-infected patients compared to seven out of 127 (5.5%) HIV-seronegative patients (P = 1.0). Relapse rates also did not differ when HIV-seropositive patients were compared with HIV-seronegative and patients with unknown HIV status (6.4% versus 3.0%; P = 0.38). Of the 10 patients with tuberculosis relapse, restriction fragment length polymorphism data were available for five; all five relapse isolates matched the initial isolate.. These results support current recommendations to treat tuberculosis in HIV-infected patients with short-course (6-month) therapy.

Topics: Adolescent; Adult; Aged; Aged, 80 and over; AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Child, Preschool; Cohort Studies; Ethambutol; Female; Follow-Up Studies; Humans; Infant; Isoniazid; Male; Middle Aged; Pyrazinamide; Recurrence; Rifampin; Time Factors; Tuberculosis

The increase in the incidence of AIDS-related tuberculosis over the last decades has fueled the dissemination of multiple drug resistance tuberculosis (including resistant strains to INH and rifampin). This has now been recognized in a variety of settings including hospitals, prisons and shelters. We have identified a nosocomial epidemic at the Muñiz Hospital in the city of Buenos Aires, Argentina. This has evolved as one of the largest institutional outbreaks yet to be recognized. The purpose of this paper is to characterize the evolution of this outbreak which at the end of 1997 had involved in excess of 500 cases. Among the 3,322 patients discharged at the Muñiz Hospital during the years 1996-1997 with the diagnosis of tuberculosis, 440 (13.24%) were discharged with the diagnosis of multiple drug resistance tuberculosis. The immediate mortality (during the ensuing four months following the bacteriological diagnosis) was of 91.3% of cases in 1995 and decreased progressively to 65.9% in 1996 and 55.9% in 1997. The bacteriological confirmation of the diagnosis was made after the patients death in a decreasing number of cases, going from 72.5% of the cases in 1995 to 28.3% of the cases in 1997. Despite the significant progress achieved with regard to the diagnosis and treatment of multiple drug resistance tuberculosis, the measures undertaken to decrease the spread of the cases have had limited success. This is chiefly attributable to the inability to isolate cases. This has continued to promote nosocomial spread of multiple drug resistance tuberculosis in our environment.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Argentina; Cohort Studies; Cross Infection; Disease Outbreaks; Female; Humans; Isoniazid; Male; Rifampin; Tuberculosis, Multidrug-Resistant

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Interactions; Humans; Nevirapine; Reverse Transcriptase Inhibitors; Rifampin; Tuberculosis, Pulmonary

To investigate if there is a difference in response to tuberculosis treatment between HIV seronegative and HIV seropositive patients following two months of intensive phase tuberculosis treatment.. Prospective cohort study.. St. Francis Leprosy Centre, south-east Uganda.. Four hundred fifty seven patients with never previously treated sputum smear-positive tuberculosis admitted during a two-year period in 1991/1993.. Intensive phase treatment with streptomycin, isoniazid, rifampicin and pyrazinamide.. Sputum conversion from a positive to a negative smear at eight weeks of treatment.. HIV seropositivity prevalence was 28%. Among HIV seronegative patients, conversion to a negative smear status occurred in 76% persons compared to 78% in HIV seropositive patients. This difference was not statistically significant (OR = 0.9; 95% CI, 0.6-1.5). HIV seropositive patients, however, were more likely to die (p = 0.017). A high prevalence of resistance to isoniazid and streptomycin was found. Isoniazid resistance was more likely in HIV seronegative patients with M. tuberculosis strains compared to HIV seropositive persons (p < 0.005). Initial resistance to antituberculosis drugs did not have a significant effect on smear conversion.. This study demonstrates that HIV-seropositive status is not a principal factor in delaying sputum conversion among patients receiving intensive phase tuberculosis treatment.. A prospective cohort study was undertaken to investigate the response of HIV-seropositive and -seronegative patients at St. Francis Leprosy Center, southeastern Uganda, to tuberculosis chemotherapy. The study population included 457 patients without a history of prior tuberculosis therapy between 1991 and 1993. The subjects were exposed to an intensive phase therapy of rifampicin, streptomycin, isoniazid, and pyrazinamide. After the treatment, sputum culture and sensitivity tests were conducted. Findings showed that 77% of the patients who never received tuberculosis treatment in the past converted to a negative smear status after the 8-week treatment. There was no significant difference in sputum conversion rates between HIV-seropositive and -seronegative patients. The study also revealed that HIV seropositivity prevalence was 28%. Among HIV-seronegative patients, conversion to a negative smear status occurred in 76% compared to 78% HIV-seropositive patients. Moreover, a significant number of HIV-seronegative patients died during the initial course of the therapy. Also, a high prevalence of isoniazid and streptomycin resistance was noted; however, this result never affected the conversions of smears. In conclusion, the study clearly demonstrates that other factors outside the seropositive status may be the principal causes of the delay in sputum conversion among patients receiving intensive tuberculosis chemotherapy.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance; Drug Therapy, Combination; Female; HIV Seronegativity; HIV Seroprevalence; Humans; Isoniazid; Male; Middle Aged; Prospective Studies; Pyrazinamide; Rifampin; Sputum; Streptomycin; Survival Analysis; Treatment Outcome; Tuberculosis, Pulmonary; Uganda

Previous studies in AIDS patients have shown that the peak serum concentration of rifampicin at 2 hours after administration are below normal ranges. These may be due to malabsorption of the drug resulting in therapeutic failure. However, there is no published data to demonstrate the pharmacokinetics of rifampicin in these AIDS patients. Therefore, the aim of this study was to provide such data. Eight AIDS patients with tuberculosis participated in this study. All patients were scheduled to receive oral rifampicin 600 mg once daily in the morning on an empty stomach. Rifampicin pharmacokinetics were studied on day 14. The mean Cmax was 9.81 +/- 4.41 ug/ml. The mean Tmax was 2.25 +/- 0.71 h. The mean AUC0-24 was 60.25 +/- 36.88 ug.h/ml. The results of our study did not confirm the previous studies. The absorption of rifampicin in most of our AIDS patients were not reduced and delayed. Therefore, rifampicin dosage adjustment for Thai patients may not be necessary.

Topics: Administration, Oral; Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Area Under Curve; Chromatography, High Pressure Liquid; Humans; Male; Middle Aged; Rifampin; Tuberculosis

To explore mechanisms by which drug resistance might arise as a result of poor compliance during short course chemotherapy.. Four theoretical mechanisms are first described.. Examples of the way the mechanisms probably operate are taken from: 1) a study of once-weekly chemotherapy with streptomycin and isoniazid, and 2) the pattern of drug susceptibility in cultures from patients who relapsed after the end of treatment.. Good compliance is vitally important. The value of a fourth drug in the initial phase of chemotherapy in preventing resistance is questioned. An explanation for mono-resistance to rifampicin in patients with the acquired immune deficiency syndrome (AIDS) is suggested.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Drug Administration Schedule; Drug Resistance, Microbial; Ethambutol; HIV Seropositivity; Humans; Isoniazid; Mutation; Mycobacterium tuberculosis; Patient Compliance; Pyrazinamide; Recurrence; Rifampin; Streptomycin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Actinomycetales Infections; AIDS-Related Opportunistic Infections; Colonic Polyps; Drug Therapy, Combination; Humans; Lung; Male; Middle Aged; Rhodococcus equi; Rifampin; Vancomycin

Topics: Administration, Oral; Administration, Topical; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Antifungal Agents; Candida albicans; Candidiasis, Oral; Chemistry, Pharmaceutical; Drug Therapy, Combination; Humans; Itraconazole; Male; Rifabutin; Rifampin

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Canada; Drug Interactions; Female; Guidelines as Topic; HIV Protease Inhibitors; Humans; Male; Rifampin; Skin Tests; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Anti-Infective Agents; Antitubercular Agents; Clinical Trials as Topic; Drug Approval; Drug Industry; Fluoroquinolones; Humans; Mycobacterium avium-intracellulare Infection; Rifampin; Technology, Pharmaceutical; Tuberculosis, Multidrug-Resistant; United States

Use of rifampin is required for short-course treatment regimens for tuberculosis. Tuberculosis caused by isolates of M. tuberculosis with resistance to rifampin and susceptibility to isoniazid is unusual, but it has been recognized through surveillance. Patients with tuberculosis (cases) with rifampin mono-resistance were compared with HIV-matched controls with tuberculosis caused by a drug-susceptible isolate. A total of 77 cases of rifampin mono-resistant tuberculosis were identified in this multicenter study. Three were determined to be laboratory contaminants, and 10 cases had an epidemiologic link to a case with rifampin mono-resistant tuberculosis, suggesting primary acquisition of rifampin-resistant isolates. Of the remaining 64 cases and 126 controls, there was no difference between cases and controls with regard to age, sex, race, foreign birth, homelessness, or history of incarceration. Cases were more likely to have a history of prior tuberculosis than were controls. Of the 38 cases and 74 controls with HIV infection, there was no difference between cases and controls with regard to age, sex, race, foreign birth, homelessness, history of incarceration, or prior tuberculosis. Cases were more likely to have histories of diarrhea, rifabutin use, or antifungal therapy. Laboratory analysis of available isolates showed that there was no evidence of spread of a single clone of M. tuberculosis. Further studies are needed to identify the causes of the development of rifampin resistance in HIV-infected persons with tuberculosis and to develop strategies to prevent its emergence.

Topics: Adult; Aged; Aged, 80 and over; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Female; Humans; Male; Middle Aged; Mycobacterium tuberculosis; Rifampin; Risk Factors; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Developing Countries; Drug Therapy, Combination; HIV-1; Humans; Isoniazid; Pyrazinamide; Rifampin; Tuberculosis

The treatment of tuberculosis usually includes the antibiotic rifampicin, especially in patients with concomitant human immunodeficiency virus infection. Some of these patients are in withdrawal therapy for drug abuse. When opiate screening is carried out in patients receiving rifampicin, false positive results are detected with the kinetic interaction of microparticles in solution method. We evaluated this interference in a Cobas-Integra analyzer and found a 12% cross-reactivity of rifampicin for antibiotic concentrations ranging from 0.19 to 6.08 mumol/l (156 to 5000 micrograms/l). This effect is not explained by the colour of the rifampicin solutions. Calculations assuming first order kinetics of elimination show that more than 18 hours after a single oral dose of 600 mg of rifampicin, a false positive result for opiates could be obtained. This indicates that the risk of a false positive result must always be considered when urine samples from these patients are analyzed.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; False Positive Reactions; Female; Humans; Immunoassay; Male; Microspheres; Narcotics; Opioid-Related Disorders; Rifampin; Tuberculosis, Pulmonary

To determine the current HIV seroprevalence in adult patients with pulmonary tuberculosis in Yaounde and to compare the incidence of adverse skin reactions in these patients with and without HIV infection receiving thiacetazone-free antituberculosis treatment.. Case series.. Chest clinic of Hospital Jamot in Yaounde, Cameroon.. 235 consecutive patients aged > or = 15 years with a diagnosis of pulmonary tuberculosis from July 1 to December 31, 1994.. HIV seroprevalence and incidence of adverse skin reactions to antituberculosis treatment.. Of the 235 patients studied, 156 (66%) were male (mean age: 33 range 17 to 84 years) and 79 were female (mean age: 30.3, range 16 to 64 years). Overall 16.6% (39 cases) of the 235 patients were HIV seropositive. The prevalence of HIV infection was significantly higher in women (24%) than in men (12.5%) (p = 0.045). Adverse skin reactions to antituberculosis treatment were observed in 11 (4.7%) of the 235 patients. The incidence of the reactions was significantly higher in HIV seropositive (23.1%) than HIV seronegative patients (1.0%) (p < 0.001). Two HIV seropositive patients who developed Steven-Jonson syndrome died. The drugs incriminated for adverse skin reactions in the nine patients who survived were pyrazinamide (four cases) and rifampicin (five cases).. HIV infected patients on antituberculosis drug should be monitored for adverse skin reactions which are sometimes fatal.

Topics: Adolescent; Adult; Aged; Aged, 80 and over; AIDS-Related Opportunistic Infections; Antitubercular Agents; Cameroon; Case-Control Studies; Drug Eruptions; Drug Therapy, Combination; Female; HIV Seroprevalence; Humans; Incidence; Male; Middle Aged; Pyrazinamide; Rifampin; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance, Microbial; HIV-1; Humans; Isoniazid; Mycobacterium tuberculosis; Pyrazinamide; Rifampin; Tuberculosis

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Humans; Isoniazid; Patient Compliance; Pyrazinamide; Randomized Controlled Trials as Topic; Rifampin; Tuberculosis

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antifungal Agents; Female; Fluconazole; Humans; Hypercalcemia; Pneumonia, Pneumocystis; Rifampin; Tuberculosis, Pulmonary

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Humans; Isoniazid; Rifampin; Tuberculosis, Multidrug-Resistant; United Kingdom

Isoniazid prophylaxis for 12 months effectively prevents tuberculosis in HIV-infected persons and may decrease the incidence of other HIV-related disease and mortality. Recent clinical trials have found that some short-course regimens also effectively prevent tuberculosis.. To compare the benefits, risks, and cost-effectiveness of isoniazid prophylaxis and short-course prophylaxis regimens.. Decision and cost-effectiveness analysis.. United States.. Hypothetical patients who are HIV-infected and have CD4 counts of 200 cells/mm3 or less and positive results on tuberculin skin tests.. Isoniazid prophylaxis lasting 12 months and six short-course prophylaxis regimens of isoniazid, rifampin, and pyrazinamide alone or in combination.. 5-year survival rate, life expectancy, lifetime incidence of tuberculosis, and cost per quality-adjusted life-year saved.. Compared with no prophylaxis, the 12-month isoniazid regimen increased 5-year survival rates by 9% and life expectancy by 8.7 months, decreased incidence of tuberculosis by 27%, and saved 4 medical care dollars for every 1 spent on prophylaxis. Regimens of isoniazid for 6 months, isoniazid and rifampin for 3 months, and rifampin and pyrazinamide for 2 months had similar results: 6.2- to 8.6-month increases in life expectancy, 19% to 26% reductions in incidence of tuberculosis, and 1 to 7 medical care dollars saved for every 1 spent on prophylaxis. A 3-month regimen of isoniazid, rifampin, and pyrazinamide resulted in fewer clinical benefits and was the only regimen tested that did not save medical care dollars.. Prophylaxis decreases the incidence of tuberculosis and increases life expectancy for HIV-infected patients. Some regimens save medical care dollars, and some short-course regimens have clinical and economic benefits similar to those of the 12-month isoniazid regimen. Short-course prophylaxis is a reasonable alternative to the 12-month isoniazid regimen.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Chemical and Drug Induced Liver Injury; Cost-Benefit Analysis; Decision Trees; Drug Administration Schedule; Drug Therapy, Combination; Humans; Isoniazid; Pyrazinamide; Quality-Adjusted Life Years; Rifampin; Survival Rate; Tuberculosis

The clinical, laboratory and radiological features of 30 children with clinically diagnosed tuberculous meningitis (TBM) who were HIV-seronegative were compared with those of ten HIV-infected children with TBM. Such comparative data are not currently available in the literature and so are an important addition to our knowledge of the HIV-TB co-infection epidemic. In comparison with the HIV-negative children, those infected with HIV were younger, had a shorter duration of symptoms and were more often Mantoux-negative (HIV-positive 23% vs HIV-negative 70%; p = 0.01). On presentation, all children in both groups were in MRC TBM stages II or III. Clinical features were similar in both groups but computed tomography of the brain showed more ventricular enlargement (HIV-positive 80% vs HIV-negative 63%), gyral enhancement (HIV-positive 60% vs HIV-negative 17%; p = 0.01) and cerebral atrophy (HIV-positive 40% vs HIV-negative 17%). Outcome was considerably worse in the HIV-positive children, of whom 30% died (vs HIV-negative 0/30; p = 0.01) and the remainder were moderately (HIV-positive 30% vs HIV-negative 24%) or severely (HIV-positive 30% vs HIV-negative 19%) handicapped at the end of treatment. While clinical features were not markedly different in HIV-infected and uninfected children with TBM, abnormal radiological findings were more common in the HIV-infected group and outcome was considerably worse. Co-existing HIV encephalopathy and diminished immune competence undoubtedly contributed to the more severe clinical and neuro-radiological features.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Child, Preschool; HIV Seronegativity; HIV Seropositivity; Humans; Infant; Isoniazid; Mycobacterium tuberculosis; Radiography; Retrospective Studies; Rifampin; Treatment Outcome; Tuberculosis, Meningeal

Several medical developments have great implications for treating HIV patients in developing countries, who account for about 90 percent of all cases. A simplified AZT regimen tested in Thailand may cut maternal-infant transmissions in half. The dispute on placebo trials to reduce transmission in developing countries may end. A two-drug tuberculosis regimen taken for two months has been found as effective as the current single-drug treatment taken for a year. Dried blood spots can be used to test viral loads, requiring a significantly smaller amount of blood for test accuracy; this will be especially useful in diagnosing and treating infants. Several studies testing dried blood are described.

Topics: AIDS-Related Opportunistic Infections; Anti-HIV Agents; Antibiotics, Antitubercular; Antitubercular Agents; Clinical Trials as Topic; Developing Countries; Drug Therapy, Combination; Female; Health Services Accessibility; HIV Infections; Humans; Infant, Newborn; Infectious Disease Transmission, Vertical; Isoniazid; Pregnancy; Pregnancy Complications, Infectious; Pyrazinamide; Reagent Kits, Diagnostic; Rifampin; RNA, Viral; Tuberculosis; Viral Load; Zidovudine

Study results presented at the 5th Conference on Retroviruses and Opportunistic Infections showed that a two-month regimen of rifampin with pyrazinamide proved to be as effective as a twelve-month regimen of isoniazid in the prevention of tuberculosis (TB) in HIV-positive individuals. HIV-positive individuals have a ten times greater chance of developing TB than HIV-negative individuals, and TB may contribute to greater viral loads and HIV progression. The short-term course is not recommended for patients using protease inhibitors due to drug interactions with rifampin to treat active TB. The recommendations for the prevention of TB in HIV-positive individuals will probably be changed when all the data are analyzed and confirmed.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Clinical Trials as Topic; Drug Therapy, Combination; Humans; Pyrazinamide; Rifampin; Tuberculosis

Two independent clinical trials are showing that patients with HIV and latent tuberculosis infections may only need two months of treatment to prevent active tuberculosis development. Studies examined the use of rifampin (RIF) and pyrazinamide (PZA), or isoniazid (INH) and pyridoxine. Results show that RIF/PZA, dosed either daily or twice weekly, is as effective in preventing tuberculosis in dually-infected adults, as INH/pyridoxine given for 6-12 months. Data on drug regimens used in preventing tuberculosis in patients with HIV infection are highlighted.

Topics: AIDS-Related Opportunistic Infections; Clinical Trials as Topic; Drug Administration Schedule; Drug Therapy, Combination; Humans; Isoniazid; Pyrazinamide; Rifampin; Treatment Outcome; Tuberculosis

Rifapentine was approved in June 1998 as a treatment for pulmonary tuberculosis. It is the first new drug approved for tuberculosis in 25 years. It will be sold under the name Priftin and will be available in October 1998. The protocol for the trial is described. Rifapentine will be used in combination with existing therapies, and its safety and efficacy are similar to Rifampin. The Food and Drug Administration praised the manufacturer, Hoechst Marion Roussel, for conducting trials overseas and seeking accelerated approval. There is very little data related to the use of the rifapentine in HIV- positive patients.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Clinical Trials as Topic; Drug Approval; Humans; Recurrence; Rifampin; Tuberculosis, Pulmonary; United States; United States Food and Drug Administration

The Centers for Disease Control and Prevention issued new guidelines for preventing and treating tuberculosis (TB) in persons with HIV. The guidelines recommend that all people with HIV be tested for TB and be treated if necessary. Also, the drug Rifampin, which can be used to treat TB, should not be used with protease inhibitors or with non-nucleoside reverse transcriptase inhibitors, as it impairs the effectiveness of those drugs. However, Rifabutin can be used with antiretroviral treatments. The guidelines also mention that there is a 2-month preventive treatment, which may be an alternative to the traditional 1-year Isoniazid treatment regimen.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Centers for Disease Control and Prevention, U.S.; Contraindications; Drug Interactions; Guidelines as Topic; HIV Protease Inhibitors; Humans; Reverse Transcriptase Inhibitors; Rifampin; Tuberculosis

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Ciprofloxacin; Clarithromycin; Diagnostic Errors; Drug Therapy, Combination; Humans; Mycobacterium Infections; Pneumonia, Bacterial; Rhodococcus equi; Rifampin; Vancomycin

Topics: AIDS-Related Opportunistic Infections; Desensitization, Immunologic; Drug Hypersensitivity; Humans; Rifampin; Tuberculosis

A 1991 survey showed high levels of drug resistance among tuberculosis patients in New York, NY. As a result, the tuberculosis control program was strengthened, including expanded use of directly observed therapy and improved infection control.. We collected isolates from every patient in New York City with a positive culture for Mycobacterium tuberculosis during April 1994; results were compared with those in the April 1991 survey.. From 1991 to 1994, the number of patients decreased from 466 to 332 patients. The percentage with isolates resistant to 1 or more antituberculosis drugs decreased from 33% to 24% (P < .01); with isolates resistant to at least isoniazid decreased from 26% to 18% (P < .05); and with isolates resistant to both isoniazid and rifampin decreased from 19% to 13% (P < .05). The number of patients with isolates resistant to both isoniazid and rifampin decreased by more than 50%. Among never previously treated patients, the percentage with resistance to 1 or more drugs decreased from 22% in 1991 to 13% in 1994 (P < .05). The number of patients with consistently positive culture results for more than 4 months decreased from 130 to 44. A history of antituberculosis treatment was the strongest predictor of drug resistance (odds ratio = 3.1; P < .001). Human immunodeficiency virus infection was associated with drug resistance among patients who never had been treated for tuberculosis.. Drug-resistant tuberculosis declined significantly in New York City from 1991 to 1994. Measures to control and prevent tuberculosis were associated with a 29% decrease in the proportion of drug resistance and a 52% decrease in the number of patients with multidrug-resistant tuberculosis.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Drug Resistance, Microbial; Drug Resistance, Multiple; Female; Humans; Isoniazid; Male; Middle Aged; Mycobacterium tuberculosis; New York City; Odds Ratio; Rifampin; Risk Factors; Treatment Failure; Tuberculosis, Pulmonary

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; DNA, Bacterial; Drug Resistance, Microbial; Female; Humans; Mycobacterium bovis; Polymerase Chain Reaction; Rifampin; Tuberculosis

Nineteen multidrug-resistant (MDR) Mycobacterium complex strains isolated in a nosocomial outbreak were characterized at the molecular level. The strains were microbiologically characterized as Mycobacterium bovis. The mpt40 sequence was not present in chromosomal DNA from these strains, supporting the fact that they were M. bovis. All of the isolates were resistant to isoniazid, rifampin, pyrazinamide, ethambutol, streptomycin, para-aminosalicylic acid, clarithromycin, cycloserine, ethionamide, ofloxacin, capreomycin, and amikacin. By performing the standardized IS6110 fingerprinting by restriction fragment length polymorphism (RFLP) analysis, we were able to differentiate two groups (groups A and B) containing two (16 isolates) and three (3 isolates) IS6110 copies, respectively. These strains were typed by spoligotyping, developed to distinguish M. bovis strains and also to distinguish them from M. tuberculosis strains (J. Kamerbeek et al., J. Clin. Microbiol. 35:907-914, 1997). All the strains were confirmed to be M. bovis. In addition, spoligotyping showed a difference in only 1 of 43 spacers between RFLP groups A and B. The rpo beta region of several strains representative of each identified group was cloned and sequenced, and identical mutations (Ser-531 to Leu) responsible for the rifampin resistance phenotype were found. To our knowledge, this is the first characterization at the molecular level of an MDR M. bovis strain responsible for a nosocomial outbreak.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Cloning, Molecular; Cross Infection; Disease Outbreaks; DNA Mutational Analysis; DNA Transposable Elements; DNA, Bacterial; Drug Resistance, Microbial; Drug Resistance, Multiple; Female; Humans; Male; Middle Aged; Mycobacterium bovis; Polymerase Chain Reaction; Polymorphism, Restriction Fragment Length; Rifampin; Spain; Tuberculosis, Multidrug-Resistant

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Resistance, Microbial; Humans; Male; Mycobacterium Infections, Nontuberculous; Rifabutin; Rifampin

Rhodococcus equi, formerly known as Corynebacterium equi, an aerobic, gram-positive, pleomorphic coccobacillus, is a well-known pathogen for domestic livestock. We present a biopsy- and culture-proven case of Rhodococcus equi brain abscesses in a patient seropositive for HIV, having an appearance not described previously.

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Drug Therapy, Combination; Epilepsy, Tonic-Clonic; Humans; Imipenem; Male; Rhodococcus equi; Rifampin; Tomography, X-Ray Computed

Mutations in a 69-bp region of the rpoB gene of Mycobacterium tuberculosis are associated with rifampin resistance (Rif[r]). These have been detected with mycobacterial DNA extracted from bacterial suspensions or respiratory specimens that were acid-fast smear positive. We experimented with a strategy for the rapid detection of Rif(r) in cerebrospinal fluid (CSF) samples. The strategy involves the amplification of the 69-bp region of rpoB by means of PCR and the identification of nucleotide mutations by single-strand conformation polymorphism (SSCP) analysis of the amplification products. Sixty-five CSF specimens collected from 29 patients (19 patients were coinfected with human immunodeficiency virus) with culture or autopsy-confirmed (22 patients) or highly probable (7 patients) tuberculosis of the central nervous system (CNS-TB) were processed. Amplified products suitable for evaluation by SSCP analysis were obtained from 37 CSF specimens from 25 subjects (86.2%). PCR-SSCP of CSF correctly identified the rifampin susceptibility phenotype of isolates from all 17 patients for whom the results of susceptibility tests carried out with strains cultured from CSF or respiratory samples were available. Moreover, this assay revealed the rifampin susceptibility genotype of isolates from the eight patients (three patients with culture-confirmed CNS-TB and five patients in whom CNS-TB was highly probable) for whom no susceptibility test results were available; the PCR-SSCP data obtained for these patients were concordant with the outcome after a standard antituberculosis treatment. The evolution of a mutation in the rpoB gene was documented in a patient during the course of treatment. PCR-SSCP analysis of CSF seems to be an efficacious method of predicting Rif(r) and would reduce the time required for susceptibility testing from approximately 4 to 8 weeks to a few days.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; DNA-Directed RNA Polymerases; Drug Resistance, Microbial; Female; Genes, Bacterial; HIV Seropositivity; Humans; Italy; Male; Middle Aged; Mycobacterium tuberculosis; Polymerase Chain Reaction; Polymorphism, Single-Stranded Conformational; Rifampin; Tuberculosis

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Ciprofloxacin; Clarithromycin; Drug Resistance, Microbial; Drug Resistance, Multiple; Drug Therapy, Combination; Erythromycin; Gentamicins; Humans; Male; Microbial Sensitivity Tests; Pneumonia, Bacterial; Rhodococcus equi; Rifampin; Vancomycin

We describe five compliant patients with human immunodeficiency virus (HIV)-associated tuberculosis (TB) that relapsed, with acquisition of resistance by the original Mycobacterium tuberculosis strains. Both the first and second isolates from each patient had the same IS (insertion sequence) 6110-based DNA fingerprint patterns. Three of the five patients developed TB that was resistant to rifampin alone; no mutation in the region of the rpoB gene was detected by a line probe assay in two of the isolates from these patients. We discuss several factors presumably associated with acquired drug resistance in HIV-infected patients, including exogenous reinfection, drug interactions, malabsorption of drugs, and the presence of a large organism burden.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; DNA-Directed RNA Polymerases; DNA, Bacterial; Drug Resistance, Microbial; Humans; Isoniazid; Mycobacterium tuberculosis; Patient Compliance; Rifampin; Tuberculosis

Urban county medical center.. To compare clinical outcomes associated with two treatment regimens for AIDS-associated disseminated Mycobacterium avium complex (DMAC). From 1989 to mid-1992, patients were treated with rifampin, ethambutol, and clofazimine; in mid-1992 clarithromycin replaced rifampin.. A retrospective review of patients with DMAC; the main outcome measures assessed were toxicity associated with DMAC treatment, transfusions after the diagnosis of DMAC, and survival.. 88 patients received the rifampin-based regimen and 86 were treated with the clarithromycin-based regimen. Drug-related adverse events were recorded less frequently with clarithromycin treatment (21% vs. 42%, P = 0.005), and additional antimycobacterial agents were used less often (28% vs. 44%, P = 0.04). In a multivariate logistic regression model, severe anemia at the time of DMAC diagnosis was associated with transfusion-dependence (relative risk [RR] 5.6, 95% confidence interval [CI] 2.2, 13.8, P < 0.001) and clarithromycin treatment was inversely associated with transfusion dependence (RR 0.4, 95% CI 0.1, 0.98, P = 0.04). In a multivariate Cox regression model including other factors affecting survival, clarithromycin treatment did not confer a survival advantage (P = 0.74).. The clarithromycin-containing regimen was better tolerated and was associated with substantially lower transfusion requirements than the rifampin-based regimen; survival was not affected.

Topics: Adult; Aged; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Antibiotics, Antitubercular; Bacteremia; Blood Transfusion; Clarithromycin; Colorado; Community Health Centers; Drug Therapy, Combination; Evaluation Studies as Topic; Female; Humans; Male; Middle Aged; Mycobacterium avium-intracellulare Infection; Retrospective Studies; Rifampin; Survival Rate; Treatment Outcome

Evaluate the effect of HIV infection in the appearance of toxicity in patients treated with rifampin, analysing the involved elements in its genesis.. We realized a comparative study of the epidemiologic and clinical characteristics, and the incidence of adverse reactions to rifampin (between 1986-1993), comparing the seropositive patients treated with rifampin, during more than 3 months, with one control group, of equal number of patients, without evidence of HIV infection, taken at random, with epidemiologic characteristics (age and sex) similar to the first group and also treated with rifampin during a similar period. In the group with HIV infection, we analysed the related epidemiologic, clinical and analytic characteristics, in a way statistically significative, with the appearance of toxicity to rifampin.. The risk of toxicity to rifampin was associated significantly to HIV infection (p < 0.01), without finding any other distinguishing characteristics among the analysed groups. Indicative parameters of advanced HIV infection: advanced clinical stage, minor level of lymphocytes CD4+, total leukocytes, total lymphocytes and quotient CD4+/CD8+, also high levels of beta 2-microglobulinemia and [correction of 2-microglobulina e] IgA, and a negative protein purified derivative test (PPD) were found statistically related with the appearance to toxicity to rifampin. Patients with number of lymphocytes CD4+ between 20-50/mm3, showed a major predisposition of suffering toxicity to rifampin.. HIV infection involved a notably increase of toxicity risk to rifampin. Clinical or analytic parameters associated with advanced illness conditioned an increase of this risk, essentially among patients with number of CD4+ between 20-50/mm.

Topics: Adult; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Hypersensitivity; Female; HIV Infections; HIV Seronegativity; HIV-1; Humans; Immunity, Cellular; Incidence; Male; Rifampin; Risk Factors; Spain; Tuberculosis, Pulmonary

Singapore's tuberculosis incidence of 49 to 57 per 100,000 population for 1987 to 1996 presents a picture that is intermediate between developed and developing countries. The proportion of drug-resistant isolates has remained stable at 4.3% to 5.5% from 1992 to 1996 despite rising HIV rates. From 1995 to 1996, of the 199 consecutive drug-resistant isolates at the Central Tuberculosis Laboratory, 66% were mono-resistant, 22% dual-resistant and 12% resistant to more than two drugs. Isoniazid resistance was most prevalent, being found in 72% of isolates, followed by streptomycin resistance in 45%. Resistance to isoniazid and streptomycin (21%) was more common than to isoniazid and rifampicin, i.e. multidrug resistance (MDR) (14%). The small numbers indicated by the low overall prevalence of resistance and the predominance of single-drug resistance support the current initial choice of the standard short course with its three-drug initial phase. Of the 170 cases with matching National Tuberculosis Registry data, 72% of drug-resistant cases represented initial and 28% acquired resistance; testifying to the effectiveness of present day treatment regimens in suppressing resistance when compliance is assured. Case-control analysis using 244 drug-sensitive controls randomly selected from notifications in 1995 to 1996 showed an odds ratio for drug-resistance between subjects with a previous history and no previous history of tuberculosis of 2.47 (95% CI 1.40 to 4.37; P = 0.0007). With each increment in the number of episodes of tuberculosis experienced, there was a trend of resistance to progressively more drugs (P = 0.000004). This association remained even when a logistic regression model including all predictor variables was fitted. No associations were found with age, history of contact with tuberculosis, cavitary disease and, most notably, with human immunodeficiency virus infection. This study reaffirms that a history of previous tuberculosis should increase clinicians' index of suspicion for drug resistance, the urgency with which culture and sensitivity results are sought and the vigour with which patients are followed-up and compliance monitored.

Topics: Adolescent; Adult; Age Factors; Aged; Aged, 80 and over; AIDS-Related Opportunistic Infections; Antitubercular Agents; Case-Control Studies; Ethambutol; Female; Humans; Incidence; Isoniazid; Male; Middle Aged; Recurrence; Rifampin; Singapore; Streptomycin; Tuberculosis, Multidrug-Resistant

Historically, infections caused by Mycobacterium tuberculosis have been treated simultaneously with isoniazid and rifampin. As a consequence of this combined therapy, strains resistant only to rifampin were rarely recovered. However, recently there has been an increasing number of reports describing HIV-positive patients infected with mono-rifampin-resistant M. tuberculosis strains. Organisms cultured from seven patients (including six with AIDS) with infections caused by mono-rifampin-resistant M. tuberculosis, and seen at one New York City hospital, were analyzed by molecular techniques to test the hypothesis that dissemination of a single clone had occurred. IS6110 DNA fingerprinting and automated DNA sequencing of a region of the RNA polymerase beta subunit structural gene (rpoB) containing mutations that confer rifampin resistance showed that all organisms independently acquired the mono-rifampin-resistant phenotype. Molecular analysis of mono-rifampin-resistant organisms cultured from 13 additional patients in New York City confirmed independent strain origin. The data rule out the possibility of person-to-person strain transmission among these patients, and they suggest that host factors such as poor compliance with antituberculosis medications or decreased absorption of rifampin have been a driving force in the origin of these strains.

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; DNA-Directed RNA Polymerases; Drug Resistance, Microbial; Genes, Bacterial; Humans; Microbial Sensitivity Tests; Mycobacterium tuberculosis; Point Mutation; Polymorphism, Restriction Fragment Length; Rifampin; Treatment Refusal; Tuberculosis, Pulmonary

To elucidate a case of tuberculous choroiditis in a patient with the acquired immunodeficiency syndrome (AIDS).. We treated a 35-year-old woman who had AIDS with neurologic involvement caused by Mycobacterium tuberculosis. She developed a yellow-white chorioretinal infiltrate with indistinct borders and mild vitreitis in the right eye, probably caused by this pathogen.. The patient's visual acuity improved in the right eye with healing of the ocular lesion and her neurologic condition improved after specific therapy with isoniazid, rifampin, and ethambutol.. Tuberculosis must be considered in the differential diagnosis of posterior uveitis and choroiditis in AIDS patients.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Chorioretinitis; Drug Therapy, Combination; Ethambutol; Female; Fundus Oculi; HIV-1; Humans; Isoniazid; Mycobacterium tuberculosis; Rifampin; Sputum; Tuberculosis, Meningeal; Tuberculosis, Ocular; Visual Acuity

Topics: Adult; AIDS-Related Opportunistic Infections; Bacteriological Techniques; DNA Mutational Analysis; DNA, Bacterial; Drug Resistance, Microbial; Humans; Male; Mycobacterium tuberculosis; Polymerase Chain Reaction; Polymorphism, Restriction Fragment Length; Rifampin; Tuberculosis

Atypical clinical manifestations and rapid progression of tuberculous disease (TB) are well-recognized in adults with the acquired immunodeficiency syndrome (AIDS). There are few reports of children with AIDS and TB. We report the manifestations, clinical course and outcome of 12 pediatric patients with AIDS and TB.. The charts of all children admitted to our institution, from 1989 through 1994, with the diagnoses of AIDS and culture-proved TB were reviewed.. Twelve children between the ages of 2 months and 13 years fit the criteria. The mean time between the diagnosis of AIDS and TB was 20 months. The most frequent presenting symptoms were fever (75%) and tachypnea (33%). All had negative Mantoux tests (5 tuberculin units of purified protein derivative). Extrapulmonary TB was present in 3 (25%). A source case was identified for 4 (33%). Previous pulmonary disease was present in 7 (58%). Chest roentgenograms were abnormal in 11 (91%), with diffuse interstitial infiltration the most common finding. Susceptibility tests were performed on 10 strains, 3 of which were resistant to 1 or more antituberculosis drugs. Three patients (25%) died of TB, 1 of whom was appropriately treated with antituberculosis drugs but had a strain resistant to isoniazid and rifampin.. Children with AIDS and TB most frequently present with atypical manifestations of TB. A high index of suspicion is needed to correctly diagnose TB in this group of children. Early diagnosis is important because most respond well when treated appropriately.

Topics: Acquired Immunodeficiency Syndrome; Adolescent; AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Antitubercular Agents; Capreomycin; Child; Child, Preschool; Ethambutol; Female; Humans; Infant; Isoniazid; Male; Microbial Sensitivity Tests; Pyrazinamide; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Acquired Immunodeficiency Syndrome; Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Antibiotics, Antitubercular; Drainage; Erythromycin; Humans; Male; Mastoiditis; Rhodococcus equi; Rifampin

Topics: AIDS-Related Opportunistic Infections; Antibiotics, Antitubercular; Drug Resistance, Microbial; Humans; Mycobacterium tuberculosis; Patient Compliance; Rifampin; Tuberculosis, Pulmonary

The Community Programs for Clinical Research on AIDS (CPCRA) presented several recent findings from clinical trials at the International Conference on AIDS. Weekly doses of fluconazole can safely prevent persistent yeast infections in HIV-infected women who frequently develop yeast infections of the mouth, vagina and throat. Combination antibiotic therapy given intermittently is an effective initial treatment for persons with HIV-related tuberculosis. High dosages of clarithromycin should not be given to patients with Mycobacterium avium complex (MAC); doses above 500 mg are associated with higher mortality levels. Researchers have also determined the genetic sequence of the virus that causes molluscum contagiosum, a skin disease affecting up to 18 percent of AIDS patients.

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Anti-Infective Agents; Antifungal Agents; Antitubercular Agents; Candidiasis; Child; Clarithromycin; Clinical Trials as Topic; DNA, Viral; Drug Therapy, Combination; Ethambutol; Female; Fluconazole; Humans; Isoniazid; Molluscum Contagiosum; Molluscum contagiosum virus; Multicenter Studies as Topic; Mycobacterium avium-intracellulare Infection; Ofloxacin; Patient Compliance; Pyrazinamide; Rifampin; Sequence Analysis, DNA; Tuberculosis

To determine the incidence of hepatotoxicity due to isoniazid and rifampin in inner-city patients with active tuberculosis.. A hospital-based review of 70 consecutive in-patients in a 770-bed, inner-city hospital. The patient population is primarily African-American and Hispanic.. Fifty-eight men and 12 women were followed from 2-12 wk (median 4 wk). Patients had to be treated for at least 2 wk to be eligible for the study. Patients were excluded if they had been on any anti-tuberculous or any other hepatotoxic drug during the 2-month period before their hospitalization. Aminotransferases, alkaline phosphatase, bilirubin, and albumin were obtained at least every 2 wk.. Hepatocellular toxicity, defined as AST and/or ALT greater than 200 IU/L, occurred in eight out of 70 (11.4%) patients. The mean age of these patients was 38.9 yr (22-58 yr). Patients with AIDS were significantly more likely to develop hepatotoxicity than those with any other risk factor (p < 0.01).. Baseline aminotransferases followed by monitoring may be necessary in AIDS patients.

Topics: Adult; AIDS-Related Opportunistic Infections; Alanine Transaminase; Alcoholism; Antitubercular Agents; Aspartate Aminotransferases; Chemical and Drug Induced Liver Injury; Clinical Enzyme Tests; Female; Humans; Incidence; Isoniazid; Liver Function Tests; Male; New York City; Poverty Areas; Rifampin; Risk Factors; Time Factors; Tuberculosis, Pulmonary

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Therapy, Combination; Female; HIV Seropositivity; Humans; Male; Patient Compliance; Rifampin; Risk Factors; South Africa; Thioacetazone; Tuberculosis

Acquired rifampin resistance without preexisting isoniazid resistance is highly unusual in patients with tuberculosis. The purpose of this report is to describe and characterize that unusual pattern of acquired drug resistance in three patients with human immunodeficiency virus (HIV) infection. The patients originally had Mycobacterium tuberculosis strains that were susceptible to isoniazid and rifampin. During treatment in two patients and after completion of therapy in the remaining one, each patient developed active, rifampin-resistant, isoniazid-susceptible tuberculosis. One patient subsequently developed isoniazid resistance also. Studies on patients' M. tuberculosis isolates using IS6110 restriction fragment length polymorphism typing and rpoB gene sequencing indicated that rifampin resistance in each patient arose during therapy by an rpoB gene mutation in the original M. tuberculosis isolate. Detection of this unusual drug-resistance phenotype in three patients with HIV infection suggests that acquired rifampin resistance is somehow associated with co-infection due to HIV and tuberculosis.

Topics: Adult; AIDS-Related Opportunistic Infections; Base Sequence; DNA, Bacterial; Drug Resistance, Microbial; Fatal Outcome; Humans; Isoniazid; Male; Middle Aged; Molecular Sequence Data; Mycobacterium tuberculosis; Polymerase Chain Reaction; Polymorphism, Restriction Fragment Length; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Dose-Response Relationship, Drug; Drug Administration Schedule; Drug Therapy, Combination; Ethambutol; Humans; Isoniazid; Pyrazinamide; Rifampin; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Antitubercular Agents; Drug Therapy, Combination; Female; Humans; Male; Rifampin; Treatment Outcome; Tuberculosis, Pulmonary

Acanthamoeba, a free-living ameba of soil and water, produces the rare infections of granulomatous amebic encephalitis and amebic keratitis. We report a 38-year-old white man with the acquired immunodeficiency syndrome (AIDS) who experienced Acanthamoeba infection that presented as multiple skin nodules without associated encephalitis. Histologic examination revealed necrotizing granulomatous inflammation with numerous amebic organisms that were cultured and identified as Acanthamoeba group 2, probably Acanthamoeba castellani by monoclonal antibodies. Results of in vitro susceptibility testing demonstrated resistance to all six tested drugs. A partial clinical response, however, was obtained with multidrug therapy.

Topics: Acanthamoeba; Adult; AIDS-Related Opportunistic Infections; Amebiasis; Amebicides; Amphotericin B; Animals; Anti-Bacterial Agents; Antimetabolites; Antiparasitic Agents; Drug Therapy, Combination; Flucytosine; Humans; Male; Rifampin

Several new studies are attempting to optimize prevention and treatment of Mycobacterium avium complex infection. Studies from California, France, and Canada are creating new data showing that a three-drug combination using clarithromycin is superior to two-drug or four-drug combinations. It is also suggested that a three-drug combination which includes clarithromycin may also delay the emergence of clarithromycin-resistant organisms.

Topics: AIDS-Related Opportunistic Infections; Azithromycin; CD4 Lymphocyte Count; Clarithromycin; Clinical Trials as Topic; Clofazimine; Dose-Response Relationship, Drug; Drug Therapy, Combination; Ethambutol; Humans; Mycobacterium avium-intracellulare Infection; Rifabutin; Rifampin

Infections of Rhodococcus equi, a well-known pathogen in animals which causes cavitated pneumonia similar to that caused by mycobacteria, were studied in three HIV-infected patients. This microorganism was isolated in the bronchoalveolar washings of two patients and in the sputum of the third. In two patients, Rh. equi represented the first clinical opportunistic manifestation of HIV disease. One patient died of concomitant Pneumocystis infection. The eradication of the microorganism occurred in two out of three patients. It was found that no isolates were resistant to erythromycin, claritromycin, rifampin, vancomycin, teicoplanin, imipenem, gentamycin or azithromycin (MIC values < or = 0.1 microgram/ml). Moreover, the quinolones (ciprofloxacin and ofloxacin) were found to be less effective, whereas neither the beta-lactam antibiotics nor chloramphenicol were effective therapy for this microrganism. At least two antimicrobial agents should be given contemporaneously to treat these infections for a period of up to several months. Our results suggest that the combinations erythromycin + rifampin or imipenem + teicoplanin are the most effective treatments in Rh. equi infections.

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Azithromycin; Bacteremia; Bronchoalveolar Lavage Fluid; Clarithromycin; Drug Resistance, Microbial; Drug Synergism; Drug Therapy, Combination; Erythromycin; Female; Gentamicins; HIV Infections; Humans; Imipenem; Male; Pleurisy; Pneumonia, Bacterial; Rhodococcus equi; Rifampin; Sputum; Teicoplanin; Vancomycin

We describe three men with disseminated, drug-sensitive tuberculosis and advanced human immunodeficiency virus disease (CD4+ lymphocyte count, < 50/mm3) who had flares of tuberculous lymphadenitis with suppuration during the initial weeks of successful chemotherapy. Bactericidal drugs may kindle these transient exacerbations, which involve neutrophils but apparently do not require normal helper T cell function. In patients with AIDS, as in immunocompetent individuals, treatment-related flares of lymphadenitis are usually not an adverse sign, provided that drug resistance and nonadherence have been excluded.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Ethambutol; Humans; Isoniazid; Leukocyte Count; Male; Pyrazinamide; Rifampin; Tuberculosis, Lymph Node; Tuberculosis, Multidrug-Resistant

In three patients, men of 30, 21 and 24 years old respectively, Rhodococcus equi pneumonia was diagnosed. Antibiotic treatment, followed by secondary prophylaxis, was successful. In one patient, lobectomy was done. R. equi, a well-known bacterial pathogen in horses, appears also to be pathogenic in humans in case of immunodeficiency.

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Drug Therapy, Combination; Erythromycin; Humans; Immunocompromised Host; Male; Pneumonia, Bacterial; Rhodococcus equi; Rifampin

Tuberculosis may be diagnosed too late, especially in HIV-infected patients, with consequences on bacillus transmission and survival. Empiric antibuberculosis treatment (EATT) may be started before diagnosis of tuberculosis is confirmed. As rifampicin is a broad spectrum antibiotic, EATT including rifampicin may be effective in infections other than tuberculosis, leading to misdiagnosis.. To define the efficiency criteria of EATT with or without rifampicin.. Between 1988 and 1991, 20 febrile patients with suspected tuberculosis (including 15 who were HIV-positive) were started on EATT in the absence of bacteriological or histological proof of tuberculosis. 10 patients (50%) received a 4-drug non-specific EATT including rifampicin, isoniazid, pyrazinamide and ethambutol, and 10 (50%), received a 3-drug specific EATT without rifampicin.. In 10 patients (50%), the diagnosis of tuberculosis was confirmed by positive cultures within a mean of 32 days (15-57 days) after the beginning of EATT (group TB 1). Of the 10 patients whose cultures remained negative, 4 (20%) became afebrile and showed improvement under EATT (group TB 2), and 6 (30%) remained febrile and did not improve (group No TB). Patients from groups TB 1 and TB 2 became afebrile within a mean of 11 days (1-54 days). This delay was not different between patients receiving specific or non-specific EATT. In patients receiving specific EATT, rifampicin was added to the initial 3-drug treatment after resolution of fever.. EATT appears to be a useful method for rapid presumptive diagnosis and treatment of tuberculosis.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Body Weight; Drug Administration Schedule; Drug Therapy, Combination; Ethambutol; Female; Fever; Follow-Up Studies; Humans; Isoniazid; Male; Middle Aged; Pyrazinamide; Rifampin; Time Factors; Treatment Outcome; Tuberculosis

We describe a case of recurrent Stomatococcus mucilaginosus lower respiratory tract infection in a patient with AIDS. Apart from S. mucilaginosus no other pathogens were found to account for infection. There was a rapid response to rifampicin, the organism being resistant to penicillin, co-trimoxazole and ciprofloxacin. Infections caused by this organism are increasingly described, but there are few reports of lower respiratory tract infection.

Topics: Acquired Immunodeficiency Syndrome; Adult; AIDS-Related Opportunistic Infections; Gram-Positive Cocci; Humans; Male; Respiratory Tract Infections; Rifampin

We report a patient with AIDS who presented with community-acquired cavitary Legionella pneumophila pneumonia. The patient recovered after an extended course of treatment with macrolide antibiotics. He returned to the hospital 4 months later with a febrile illness. Chest radiograms appeared normal. Cultures of blood yielded L. pneumophila. The isolate from blood was indistinguishable from the isolate from sputum taken during the first infection, as shown by restriction-endonuclease analysis and pulsed-field gel electrophoresis. These data suggest that the second infection represented reactivation of a persistent focus of infection that was not apparent when the patient had pneumonia.

Topics: Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Bacteremia; DNA, Bacterial; Drug Therapy, Combination; Electrophoresis, Gel, Pulsed-Field; Humans; Legionnaires' Disease; Macrolides; Male; Recurrence; Rifampin

Topics: Acquired Immunodeficiency Syndrome; Adult; AIDS-Related Opportunistic Infections; Bacteremia; Drug Resistance, Microbial; Humans; Male; Rifabutin; Rifampin; Staphylococcal Infections; Staphylococcus aureus; Staphylococcus epidermidis

Tuberculosis-control programmes are compromised by the increased frequency of multidrug-resistant strains of Mycobacterium tuberculosis. We used the polymerase chain reaction (PCR) and single-strand conformation polymorphism (SSCP) analysis techniques to establish the molecular basis of resistance in 37 drug-resistant isolates of M tuberculosis, and correlated these findings with clinical and antibiotic-sensitivity data. Resistance to isoniazid was found in 36 strains, 16 of which were also resistant to ethionamide. Of the 36 isoniazid-resistant strains, 23 had mutations in the katG gene, and 5 of these also had mutations in the inhA gene. A further 5 strains had alterations in the inhA locus without the katG gene being mutated. Rifampicin resistance was less frequent (13 strains) and usually associated with isoniazid resistance (11 of 13 strains). Mutations in the rpoB gene were detected for all these rifampicin-resistant isolates. Mutations in the rpsL and rrs genes, associated with streptomycin resistance, were found in 13 of 25 and 2 of 25 streptomycin-resistant strains, respectively. The same chromosomal mutations, or combinations of mutations, were found in strains displaying single or multidrug resistance, from cases of both primary and secondary resistance, and from patients infected with human immunodeficiency virus. Thus, multidrug resistance is not due to a novel mechanism and tuberculosis chemotherapy is not subject to a new threat.

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance, Microbial; Ethionamide; Female; Genes, Bacterial; Humans; Isoniazid; Male; Mutation; Mycobacterium tuberculosis; Polymerase Chain Reaction; Retrospective Studies; Rifampin; Streptomycin; Tuberculosis, Multidrug-Resistant

Topics: AIDS-Related Opportunistic Infections; Drug Resistance, Microbial; Humans; Infant; Male; Microbial Sensitivity Tests; Middle Aged; Rifampin; Streptococcus pneumoniae; Tuberculosis, Pulmonary

1. A 6-mo regimen consisting of isoniazid, rifampin, and pyrazinamide given for 2 mo followed by isoniazid and rifampin for 4 mo is the preferred treatment for patients with fully susceptible organisms who adhere to treatment. Ethambutol (or streptomycin in children too young to be monitored for visual acuity) should be included in the initial regimen until the results of drug susceptibility studies are available, unless there is little possibility of drug resistance (i.e., there is less than 4% primary resistance to isoniazid in the community, and the patient has had no previous treatment with antituberculosis medications, is not from a country with a high prevalence of drug resistance, and has no known exposure to a drug-resistant case). This four-drug, 6-mo regimen is effective even when the infecting organism is resistant to INH. This recommendation applies to both HIV-infected and uninfected persons. However, in the presence of HIV infection it is critically important to assess the clinical and bacteriologic response. If there is evidence of a slow or suboptimal response, therapy should be prolonged as judged on a case by case basis. 2. Alternatively, a 9-mo regimen of isoniazid and rifampin is acceptable for persons who cannot or should not take pyrazinamide. Ethambutol (or streptomycin in children too young to be monitored for visual acuity) should also be included until the results of drug susceptibility studies are available, unless there is little possibility of drug resistance (see Section 1 above). If INH resistance is demonstrated, rifampin and ethambutol should be continued for a minimum of 12 mo. 3. Consideration should be given to treating all patients with directly observed therapy (DOT). 4. Multiple-drug-resistant tuberculosis (i.e., resistance to at least isoniazid and rifampin) presents difficult treatment problems. Treatment must be individualized and based on susceptibility studies. In such cases, consultation with an expert in tuberculosis is recommended. 5. Children should be managed in essentially the same ways as adults using appropriately adjusted doses of the drugs. This document addresses specific important differences between the management of adults and children. 6. Extrapulmonary tuberculosis should be managed according to the principles and with the drug regimens outlined for pulmonary tuberculosis, except for children who have miliary tuberculosis, bone/joint tuberculosis, or tuberculous meningitis who should receive a mi

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Child; Clinical Protocols; Drug Monitoring; Ethambutol; Humans; Infant; Isoniazid; Patient Compliance; Pyrazinamide; Recurrence; Rifampin; Streptomycin; Tuberculosis; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Tuberculosis in HIV infected patients does not carry a worse therapeutic response rate. Treatment failure is usually due to incomplete schedule, with development of acquired resistance. Two patients with HIV infection and disseminated tuberculosis who developed fatal meningitis are presented.. In vitro studies of sensitivity to anti-tuberculous drugs were carried out, using the proportions method.. Following a good initial evolution, both patients were readmitted with tuberculous meningitis resistant to isoniazide in both and to rifampicin in one of the patients. In one patient, the original strain (which was sensitive) was available. In this patient, changes in the treatment were performed in the initial phase.. The importance of anti-tuberculous multiple therapy, particularly in the initial phases, for HIV positive patients is crucial. The lengthen of admission when good patient's compliance is in question, but also to avoid, whenever possible, changes in treatment are important measures in this stage. Meningitis may occur as a form of therapeutic failure and its cure may be difficult if the strains are resistant.

Topics: Adult; AIDS-Related Opportunistic Infections; Antitubercular Agents; Drug Resistance, Microbial; Drug Therapy, Combination; Fatal Outcome; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Pyrazinamide; Rifampin; Streptomycin; Tuberculosis, Meningeal; Zidovudine

Topics: Adult; AIDS-Related Opportunistic Infections; Ethambutol; Female; Humans; Isoniazid; Male; Mycobacterium tuberculosis; Polymerase Chain Reaction; Rifampin; Streptomycin; Superinfection; Tuberculosis, Meningeal; Tuberculosis, Multidrug-Resistant; Tuberculosis, Pulmonary

Topics: Adult; AIDS-Related Opportunistic Infections; Drug Interactions; Histoplasmosis; Humans; Itraconazole; Male; Rifampin; Tuberculosis, Pulmonary

From January 1990 to December 1991, 16 patients with multidrug-resistant tuberculosis (MDR-TB) caused by Mycobacterium tuberculosis resistant to isoniazid, rifampin, and streptomycin were diagnosed at Elmhurst Hospital. Compared with other TB patients, MDR-TB patients were more likely to have human immunodeficiency virus (HIV) infection (14/16 vs. 21/204, P < .001) and a prior admission (10/16 vs. 3/204, P < .001). HIV-infected patients hospitalized for > 10 days within three rooms of an infectious MDR-TB patient had higher risk of acquiring MDR-TB than did HIV-infected patients with shorter hospitalizations or locations further from the MDR-TB patient(s) (6/28 vs. 2/90, P < .001). Isolates of 6 of 8 MDR-TB patients in a chain of transmission were identical by restriction fragment length polymorphism DNA typing. Ambulation on the wards of inadequately masked TB patients and lack of negative pressure in isolation rooms probably facilitated transmission. This report documents nosocomial transmission of MDR-TB and underscores the need for effective isolation practices and facilities in health care institutions.

Topics: AIDS-Related Opportunistic Infections; Cross Infection; DNA, Bacterial; Drug Resistance; Hospitals, Urban; Humans; Isoniazid; Mycobacterium tuberculosis; New York City; Polymorphism, Restriction Fragment Length; Rifampin; Streptomycin; Time Factors; Tuberculosis

Topics: AIDS-Related Opportunistic Infections; Anti-Infective Agents; Drug Therapy, Combination; Erythromycin; Humans; Legionnaires' Disease; Male; Middle Aged; Ofloxacin; Rifampin

Twenty-seven human immunodeficiency virus-infected patients with disseminated Mycobacterium avium complex disease who were treated with oral antimycobacterial agents (clofazimine, ciprofloxacin, ethambutol, and rifampin) were studied to evaluate the usefulness of monitoring serum drug concentrations and testing in vitro susceptibility of M. avium complex (MAC) isolates. Twenty patients tolerated treatment with three or four antimycobacterial agents for at least 8 weeks; mycobacteremia was eradicated in 7 (35%). The in vitro susceptibilities of MAC isolates to antimycobacterial agents were similar for these 7 and for the 13 who did not respond to antimycobacterial treatment. Serum drug levels were below the expected range in 6 of the 7 whose mycobacteremia was cleared and in 9 of the 13 nonresponders (P = .41). These low serum concentrations of antimycobacterial drugs may be due to impaired drug absorption in patients with AIDS and disseminated MAC disease.

Topics: Administration, Oral; Adolescent; Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Ciprofloxacin; Clofazimine; Drug Monitoring; Ethambutol; Female; Humans; Male; Microbial Sensitivity Tests; Mycobacterium avium Complex; Mycobacterium avium-intracellulare Infection; Prospective Studies; Rifampin

Topics: AIDS-Related Opportunistic Infections; Antitubercular Agents; Humans; Isoniazid; Mycobacterium tuberculosis; Rifampin; Tuberculosis, Multidrug-Resistant

Topics: AIDS-Related Opportunistic Infections; Drug Resistance, Microbial; HIV Seropositivity; Humans; Mycobacterium tuberculosis; Recurrence; Rifampin; Tuberculosis, Pulmonary

A patient with AIDS developed a purplish, necrotic skin lesion followed by fevers, constitutional symptoms, and watery diarrhea. Stains of samples from the skin lesion and of stool and bone marrow revealed acid-fast bacilli, and Mycobacterium avium was isolated from cultures of these specimens and blood. With the initiation of multiagent oral antimycobacterial therapy, the patient's symptoms abated and the cutaneous lesion reepithelialized. We believe this lesion to be a manifestation of disseminated infection due to Mycobacterium avium complex (MAC). As the population of patients with AIDS who have CD4 cell counts of < 100/mm3 increases, new and unusual manifestations of disseminated MAC infection can be expected. New oral agents with increased activity against MAC may make early recognition and treatment of MAC infections more rewarding.

Topics: Administration, Oral; Adult; AIDS-Related Opportunistic Infections; Ciprofloxacin; Clarithromycin; Drug Therapy, Combination; Ethambutol; Humans; Male; Mycobacterium avium; Mycobacterium avium-intracellulare Infection; Rifampin; Skin Diseases, Bacterial

Several A- and B-ring-substituted sampangines were synthesized and evaluated for antifungal and antimycobacterial activity against AIDS-related opportunistic infection pathogens. Electrophilic halogenation provided a channel for structural elaboration of the sampangine B-ring at position 4, while the synthesis of A-ring 3-substituted sampangines and benzo[4,5]sampangine (24) were achieved from the corresponding functionalized cleistopholines. Two-dimensional NMR spectroscopy was used to rigorously characterize the A- and B-ring substituent patterns. Structure-activity relationship studies revealed the activity of the sampangines was enhanced by the presence of a substituent at position 3 or by a 4,5-benzo group.

Topics: AIDS-Related Opportunistic Infections; Alkaloids; Anti-Bacterial Agents; Antifungal Agents; Aporphines; Magnetic Resonance Spectroscopy; Microbial Sensitivity Tests; Models, Molecular; Molecular Structure; Mycobacterium avium Complex; Structure-Activity Relationship; X-Ray Diffraction

Topics: Actinomycetales Infections; Adult; AIDS-Related Opportunistic Infections; Anti-Bacterial Agents; Erythromycin; Humans; Lung Diseases; Male; Rhodococcus equi; Rifampin

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

Topics: Adolescent; Adult; AIDS-Related Opportunistic Infections; Base Sequence; DNA, Bacterial; Drug Therapy, Combination; Ethambutol; Female; HIV-1; Humans; Isoniazid; Male; Molecular Sequence Data; Mycobacterium tuberculosis; Polymerase Chain Reaction; Rifampin; Sensitivity and Specificity; Tuberculosis