lactoferrin and Endometrial-Neoplasms

Cervical, uterine, and ovarian cancers are the most common malignancies of the female genital tract worldwide. Despite advances in prevention, early diagnosis, effective screening, and treatment programs, mortality remains high. Consequently, it is important to search for new treatments. The activity of bovine lactoferrin (bLF) and LF peptides against several types of cancer has been studied; however, only a few studies report the effect of bLF and LF peptides against cervical and endometrial cancers. In this study, we explored the effect of bLF as well as LF chimera and its constituent peptides LFcin17-30 and LFampin265-284 on the viability of cervical (HeLa, SiHa) and endometrial (KLE, HEC-1A) cancer cell lines. Cell proliferation was quantified with an MTT assay, cell morphological changes and damage were determined by Giemsa and phalloidin-TRITC and DAPI staining, and apoptotic and necrotic cells were identified by Alexa Fluor® 488 Annexin V and propidium iodide staining. Additionally, the effect of combinations of bLF and LF peptides with cisplatin was assessed. bLF and LF peptides inhibited the proliferation of uterine cancer cells and caused cellular morphological changes and damage to cell monolayers. bLF induced apoptosis, LFcin17-30 and LFampin265-284 induced apoptosis and necrosis, and LF chimera induced necrosis. Additionally, bLF and LF chimera showed an additive interaction with cisplatin against uterine cancer cells.

Topics: Animals; Antineoplastic Agents; Cattle; Cell Proliferation; Cell Survival; Cells, Cultured; Dose-Response Relationship, Drug; Drug Screening Assays, Antitumor; Endometrial Neoplasms; Female; Lactoferrin; Peptide Fragments; Uterine Cervical Neoplasms

We have investigated Lf immunoexpression as well as its biological meaning in 71 formalin-fixed, paraffin-embedded surgical samples of endometrial carcinomas (EC); 64 EC were endometrioid type, whereas 7 were non-endometrioid carcinomas. Immunohistochemistry was performed by primary antibodies against Lactoferrin (Lf), estrogen receptor (ER), progesterone receptor (PR) and Ki-67 antigen. Quantification of Lf immunoreactivity was performed using an intensity-distribution (ID) score. Moreover, the AgNOR technique according to guidelines of the Committee on AgNOR Quantification was used to assess the proliferation rate (NORA). A variable expression of Lf was revealed in 43 cases (61%) of EC. Endometrioid type carcinoma showed a significant higher Lf ID-score than non-endometrioid type; in contrast, no relationships were demonstrated between Lf immunoexpression and histologic grade, stage, clinical course as well as proliferative activity of EC. Moreover, a significantly higher Lf ID-score was encountered in ER-positive carcinomas. Survival analysis in EC indicated the architectural, nuclear and combined histologic grades as well as the stage, PR, Ki-67 and NORA as significant parameters. The utilization of Lf as a prognostic marker, able to identify patients at different risk of death, or alternatively, its clinical application as therapeutic agent, must be considered with great caution.

Topics: Adult; Aged; Aged, 80 and over; Antigens, Nuclear; Biomarkers, Tumor; Carcinoma; Cytoplasm; Endometrial Neoplasms; Female; Gonadal Steroid Hormones; Humans; Ki-67 Antigen; Lactoferrin; Middle Aged; Mitotic Index; Nuclear Proteins; Prognosis; Receptors, Estrogen; Receptors, Progesterone; Risk

Tamoxifen is the primary hormonal therapy for breast cancer and is also used as a breast cancer chemopreventative agent. A major problem with tamoxifen therapy is undesirable endometrial proliferation. To identify proteins associated with the growth stimulatory effects of tamoxifen in an ER-positive model, the present study profiled total cellular and secreted proteins regulated by estradiol and selective estrogen receptor modifiers (SERMs) in the Ishikawa endometrial adenocarcinoma cell line using two-dimensional gel electrophoresis. Following 24 h incubation with 10(-8) M estradiol, 10(-7) M 4-hydroxytamoxifen, or 10(-7) M EM-652 (Acolbifene), nine proteins exhibited significant increase in expression. The proteins identified were heat shock protein 90-alpha, and -beta, heterogeneous nuclear ribonucleoprotein F, RNA polymerase II-mediating protein, cytoskeletal keratin 8, cytoskeletal keratin 18, ubiquitin-conjugating enzyme E2-18 kDa and nucleoside diphosphate kinase B. These protein profiles may serve as novel indices of SERM response and may also provide insight into novel mechanisms of SERM-mediated growth.

Topics: Biomarkers; Carrier Proteins; Cell Line, Tumor; Cell Proliferation; Endometrial Neoplasms; Estradiol; Female; Heterogeneous-Nuclear Ribonucleoprotein Group F-H; HSP90 Heat-Shock Proteins; Humans; Keratins; Lactoferrin; Neoplasm Proteins; Phosphoproteins; Piperidines; Receptors, Estrogen; Selective Estrogen Receptor Modulators; Tamoxifen; Ubiquitin-Conjugating Enzymes

The human estrogen receptor (ERalpha) and the human estrogen receptor-related receptor (ERRalpha1, NR3B1a) are members of the steroid/thyroid hormone receptor superfamily. We previously cloned an isoform of ERRalpha1 cDNA and demonstrated that ERRalpha1 binds to the human lactoferrin gene promoter and enhances estrogen responsiveness during transient transfection experiments. In this study, we show that ERRalpha1 and ERalpha may interfere in each other's transcriptional activity by competition for binding and coactivator. A VP16-ERRalpha1 chimera was constructed and transiently transfected into human endometrial carcinoma HEC-1B cells. This chimera activated reporter constructs containing the human lactoferrin gene estrogen response element (ERE) and the synthetic palindromic 3X-ERE, suggesting that ERRalpha1 binds to these EREs. Therefore, ERRalpha1 can compete with ERalpha for binding to the same EREs. ERRalpha1 is organized into modules which include a N-terminal region that shows repression function, a Zn-finger region that binds DNA and an activation region at the C terminus. The activation function of ERRalpha1 was mapped to the conserved AF2 region in the C-terminus by deletion analysis. The transactivation activity of ERRalpha1 can be enhanced by coactivator (SRC-1a) and suppressed by ERalpha in the presence of estrogen, suggesting that SRC-1a is required by both receptors for their activity. The repression of ERRalpha1 activation function by estrogen bound ERalpha, however, could not be reversed by increasing concentration of SRC-1a in the cells. This finding is consistent with the squelching phenomenon that exists between ERalpha and other steroid receptor family members. The studies demonstrated that ERRalpha1 and ERalpha may potentially regulate the same target gene independently as well as interfere with each other's functional activity by competition for binding and coactivator.

Topics: Binding Sites; Binding, Competitive; DNA-Binding Proteins; Endometrial Neoplasms; ERRalpha Estrogen-Related Receptor; Estrogen Receptor alpha; Female; Gene Expression Regulation; Histone Acetyltransferases; Humans; Lactoferrin; Nuclear Receptor Coactivator 1; Nuclear Receptor Coactivators; Receptors, Cytoplasmic and Nuclear; Receptors, Estrogen; Response Elements; Transcription Factors; Transcription, Genetic; Tumor Cells, Cultured

We investigated the possible role of the estrogen-regulated protein lactoferrin (Lf) in the response of isolated normal human endometrial epithelial cells (NHEC) and established human endometrial carcinoma (EC) cell lines to tamoxifen (TAM). Using confocal laser scanning microscopy and a monospecific antibody, Lf was localized to the cytoplasm of normal and EC cells. Antibody neutralization of secreted Lf inhibited, whereas exogenous Lf (0--100 microg/ml) enhanced, cell proliferation in both classes of cells. Treatment of NHEC with TAM inhibited cell growth via a protein kinase-C-mediated pathway, concomitant with a reduction in the staining intensity for Lf. Importantly, in EC cells, TAM greatly enhanced the staining intensity for Lf, but did not affect cell growth. We propose that stable expression of Lf protein by EC cells may impart a survival advantage to these cells, which may, in part, account for the resistance of these cells to tamoxifen.

Topics: Animals; Anticarcinogenic Agents; Blotting, Western; Cell Division; Cell Survival; Cells, Cultured; Drug Resistance; Endometrial Neoplasms; Endometrium; Enzyme Inhibitors; Female; Humans; Lactoferrin; Microscopy, Confocal; Neutralization Tests; Protein Kinase C; Rabbits; Staurosporine; Tamoxifen; Tumor Cells, Cultured

We investigated tamoxifen's effects on the expression of growth regulatory genes in the endometrium to identify the mechanism by which tamoxifen induces proliferation.. Using immunohistochemical techniques, we analyzed 39 endometrial specimens for expression of Ki-67, lactoferrin, transforming growth factor-alpha, tumor necrosis factor receptor-II, adrenomedullin, estrogen receptors, and progesterone receptors. Twenty specimens were obtained from postmenopausal breast cancer patients treated with tamoxifen (20 mg/day) for at least 6 months to include two endometrial adenocarcinoma specimens. Five secretory phase, three proliferative phase, and seven atrophic endometrial specimens were used as controls. In addition, four endometrial adenocarcinoma specimens were reviewed from patients not treated with tamoxifen. Intensity of immunostaining was quantified using digitized imaging techniques.. Overexpression of both estrogen receptors and progesterone receptors, and an elevated proliferative index were the most consistent effects observed in benign endometrial specimens from tamoxifen-treated patients compared with atrophic controls (P <. 003). This staining pattern was also evident in adenocarcinomas from patients who received tamoxifen. Benign endometrium from tamoxifen-treated patients also expressed transforming growth factor-alpha, tumor necrosis factor receptor-II, lactoferrin, and adrenomedullin at levels comparable with those found in proliferative endometrial specimens.. These data provide further documentation that the uterotropic effects of tamoxifen may be due, at least in part, to the induction of estrogen receptors and progesterone receptors, as well as other genes associated with the proliferative phase. Furthermore, analysis of estrogen receptors, progesterone receptors, and Ki-67 may be useful in identifying postmenopausal individuals on tamoxifen, who are at increased risk for developing endometrial cancer.

Topics: Adrenomedullin; Antineoplastic Agents, Hormonal; Breast Neoplasms; Endometrial Neoplasms; Endometrium; Female; Gene Expression Regulation, Neoplastic; Genes, Regulator; Humans; Hyperplasia; Immunohistochemistry; Ki-67 Antigen; Lactoferrin; Peptides; Receptors, Estrogen; Receptors, Progesterone; Receptors, Tumor Necrosis Factor; Tamoxifen; Transforming Growth Factor alpha

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

Topics: 5' Untranslated Regions; Amino Acid Sequence; Animals; Base Sequence; Binding Sites; Cloning, Molecular; Colon; Endometrial Neoplasms; Exons; Female; Gene Expression Regulation, Neoplastic; Gene Library; Humans; Intestine, Small; Introns; Kruppel-Like Transcription Factors; Lactoferrin; Mice; Molecular Sequence Data; Recombinant Proteins; RNA, Messenger; Sequence Alignment; Sequence Homology, Amino Acid; Sequence Homology, Nucleic Acid; Trans-Activators; Transcription, Genetic; Tumor Cells, Cultured; Zinc Fingers

The mouse lactoferrin gene responded to forskolin, 12-O-tetradecanoyl phorbol-13-acetate, and epidermal growth factor (EGF) stimulation via two adjacent enhancer elements, the cAMP response element (CRE) and EGF response element (EGFRE), collectively referred to as the mitogen response unit. In this report, we examined the minimal promoter and enhancer elements of the mouse lactoferrin gene that are required for EGF-induced transcriptional activation. We found that the CRE and noncanonical TATA box (ATAAA) are the minimal promoter elements for basal activity of the chloramphenicol acetyltransferase (CAT) reporter construct whereas the EGFRE is needed for an additional activity induced by EGF in transiently transfected human endometrial carcinoma RL95-2 cells (RL95-2). The EGFRE, however, did not function in heterologous promoters [SV 40 and thymidine kinase (TK)]. Therefore, EGF-stimulated lactoferrin gene activity is promoter specific in RL95-2 cells. In transiently transfected cells, EGF and forskolin showed synergistic effects on the CAT reporter that contained both response elements. Mutation made at either element or insertion of extra nucleotides between the two elements severely affected EGF-stimulated activity. Nuclear protein prepared from RL95-2 cells formed three complexes (A, B, and C) with the oligonucleotides containing both EGFRE and CRE in electrophoretic mobility shift assay. A new complex (E) was detected with the nuclear protein of EGF-treated cells. By oligonucleotide competition experiments, we demonstrated that the complex E was generated by protein bound to CRE. EGF-induced binding activity could be abolished by calf intestinal alkaline phosphatase but not by the protein synthesis inhibitor, cycloheximide. Therefore, binding of a preexisting phosphoprotein to the CRE region could be one of the requirements for EGF-induced mouse lactoferrin gene promoter activity.

Topics: Animals; Binding Sites; Carcinoma; Electrophoresis; Endometrial Neoplasms; Epidermal Growth Factor; ErbB Receptors; Female; Gene Expression Regulation; Humans; Lactoferrin; Mice; Nuclear Proteins; Promoter Regions, Genetic; Receptors, Cyclic AMP; Recombinant Proteins; TATA Box; Transfection; Tumor Cells, Cultured

In vitro studies of endometrial carcinogenesis have been hampered by dedifferentiation of the cells in culture. Using the endometrial carcinoma cell line HEC-1B(L), we aimed to establish and characterize culture conditions that preserve a more differentiated state of the tumor cells. HEC-1B(L) cells grown in a serum-free defined medium on plastic (PL/SFDM) on top of a reconstituted basement membrane (Matrigel, MG/SFDM) or in a thick layer of Matrigel showed pronounced morphological differentiation as compared with HEC-1B(L) cells cultured on plastic in a medium containing serum (PL/10% FCS). Features of differentiation included cuboidal to columnar cell shape and an increase of rough endoplastic reticulum in Matrigel cultures. Gene expression of HEC-1B(L) cells was studied by metabolic [35S]methionine labeling and SDS-gel electrophoresis. HEC-1B(L) cells cultured in the presence of Matrigel showed two additional secretory proteins approximately 31 kD and 77 kD in size. rt-PCR was used to screen cell cultures for the presence of estrogen receptor, progesterone receptor, and lactoferrin-mRNA, genes typically expressed by normal endometrial epithelium. We found no expression of the estrogen receptor or progesterone receptor. Lactoferrin-mRNA was present under all culture conditions tested. Our results suggest a regulatory role of the extracellular matrix for the differentiation of the HEC-1B(L) cell line.

Topics: Adenocarcinoma; Aged; Basement Membrane; Cell Adhesion; Cell Differentiation; Collagen; Culture Media, Serum-Free; Drug Combinations; Endometrial Neoplasms; Endometrium; Extracellular Matrix; Female; Gene Expression Regulation, Neoplastic; Humans; Lactoferrin; Laminin; Neoplasm Proteins; Proteoglycans; Receptors, Estrogen; Receptors, Progesterone; RNA, Messenger; RNA, Neoplasm; Tumor Cells, Cultured

In the mouse uterus, lactoferrin is a major estrogen-inducible uterine secretory protein, and its expression correlates directly with the period of peak epithelial cell proliferation. In this study, we examine the expression of lactoferrin mRNA and protein in human endometrium, endometrial hyperplasias, and adenocarcinomas using immunohistochemistry, Western immunoblotting, and Northern and in situ RNA hybridization techniques. Our results reveal that lactoferrin is expressed in normal cycling endometrium by a restricted number of glandular epithelial cells located deep in the zona basalis. Two thirds (8 of 12) of the endometrial adenocarcinomas examined overexpress lactoferrin. This tumor-associated increase in lactoferrin expression includes an elevation in the mRNA and protein of individual cells and an increase in the number of cells expressing the protein. In comparison, only 1 of the 10 endometrial hyperplasia specimens examined demonstrates an increase in lactoferrin. We also observe distinct cytoplasmic and nuclear immunostaining patterns under different fixation conditions in both normal and malignant epithelial cells, similar to those previously reported in the mouse reproductive tract. Serial sections of malignant specimens show a good correlation between the localization of lactoferrin mRNA and protein in individual epithelial cells by in situ RNA hybridization and immunohistochemistry. Although the degree of lactoferrin expression in the adenocarcinomas did not correlate with the tumor stage, grade, or depth of invasion in these 12 patients, there was a striking inverse correlation between the presence of progesterone receptors and lactoferrin in all 8 lactoferrin-positive adenocarcinomas. In summary, lactoferrin is expressed in a region of normal endometrium known as the zona basalis which is not shed with menstruation and is frequently overexpressed by progesterone receptor-negative cells in endometrial adenocarcinomas.

Topics: Adenocarcinoma; Adult; Aged; Blotting, Northern; Cell Transformation, Neoplastic; Endometrial Hyperplasia; Endometrial Neoplasms; Endometrium; Female; Humans; Immunohistochemistry; In Situ Hybridization; Ki-67 Antigen; Lactoferrin; Middle Aged; Neoplasm Proteins; Nitrosourea Compounds; Nuclear Proteins; Phenotype; Receptor, ErbB-2; Receptors, Estrogen; Receptors, Progesterone; RNA, Messenger; Uterine Neoplasms

Lactoferrin promoter and the 5'-flanking region of both human and mouse were isolated from a genomic library constructed with lambda phage. A 2.0 kbp Sac I fragment of the human clone (HLF031a.30) and a 3.0 kbp Eco R I/Hinc II fragment of the mouse clone (mL14p9E) containing the lactoferrin promoter, 5'-flanking region, first exon and partial intron were sequenced completely. There were many sequence homologies between human and mouse at the promoter/enhancer (1 to -363) region, yet substantial divergence was observed beyond this region. To determine the promoter activity, 5'-deletion mutants of the mouse lactoferrin gene were linked to a CAT-reporter plasmid and transfected into the human endometrium carcinoma cell line, RL95-2. We identified a number of positive and negative regulatory sequences as well as the estrogen-response element in the 5'-flanking region of the lactoferrin gene. The imperfect estrogen response elements of both human and mouse are functional as demonstrated by transfection experiments, band-shift assay and DNase I footprint analysis. The molecular mechanism that governs the estrogen-stimulated response, however, differs between human and mouse.

Topics: Animals; Base Sequence; Cell Line; Cell Nucleus; Chloramphenicol O-Acetyltransferase; Consensus Sequence; Endometrial Neoplasms; Enhancer Elements, Genetic; Female; Genomic Library; Hominidae; Humans; Lactoferrin; Mice; Models, Biological; Molecular Sequence Data; Nucleic Acid Conformation; Oligodeoxyribonucleotides; Placenta; Pregnancy; Promoter Regions, Genetic; Restriction Mapping; Sequence Deletion; Sequence Homology, Nucleic Acid; Transfection; Tumor Cells, Cultured; Uterus; Xenopus

Estrogen exerts a variety of biological effects on human reproductive tissues. However, little is understood about the estrogenic effect on human endometrial cells in vitro. This study was designed to investigate estrogen action on c-myc and c-fos oncogenes and lactoferrin gene expression in human endometrial carcinoma RL95-2 cells. The results indicate that estrogen can induce c-myc oncogene expression in 4 h. Neither c-fos nor the lactoferrin messenger was detectable, nor could they be induced by estrogen. Transfection with human estrogen receptor expression vector to the RL95-2 cells does not restore the estrogen responsiveness. In addition to estrogen, epidermal growth factor (EGF) and tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA) can also induce c-myc expression with no effect on c-fos or lactoferrin expression. Our data suggest that the c-myc oncogene in human endometrial carcinoma RL95-2 cells is the sensitive target gene for steroid hormone and growth factor action.

Topics: Carcinoma; Endometrial Neoplasms; Estrogens; Female; Gene Expression Regulation, Neoplastic; Genes, fos; Genes, myc; Humans; Lactoferrin; Proto-Oncogene Proteins c-fos; Proto-Oncogene Proteins c-myc; RNA, Messenger; Signal Transduction; Tumor Cells, Cultured

Mouse lactoferrin is expressed in a variety of tissues under different types of control. To understand how molecular mechanisms govern the mode of lactoferrin expression, we isolated and characterized the 5'-flanking region of the lactoferrin gene. Several clones containing lactoferrin gene fragments were isolated from a mouse (129/J) genomic library including clone lambda J14, which contains a 7.5-kilobase pair 5'-flanking sequence. Sequence analysis of the region flanking the transcription initiation site revealed the following: a TATA-like sequence, two CAAT boxes, three GC boxes including one within the first intron, an AP2 site, seven PU boxes, an AC-rich region, a B1 sequence, and an estrogen-responsive element consensus sequence over-lapping with a chicken ovalbumin upstream promoter-binding element. Footprinting analysis demonstrated that several regions, including the putative estrogen-responsive element region, in the 5'-flanking sequence were protected from DNase I digestion. Promoter fragments were cloned into a chloramphenicol acetyltransferase receptor plasmid to study functional activity. The mouse lactoferrin gene promoter was active in human endometrium carcinoma RL 95-2 cells and in rat glioma C6 cells. Multiple upstream elements modulated the basal transcriptional promoter activity. The transcription level directed by this minimal promoter was controlled by both positive (between -1739 and -922) and negative (between -2644 and -1739, and between -589 and -291) regulatory sequences. A tissue-specific regulatory sequence was critical for the establishment of lactoferrin expression in human endometrium carcinoma cells, but not in rat glioma cells located between -1739 and -922. Reporter plasmid 0.6 mL14-CAT, containing the estrogen-responsive element sequence, was estrogen-responsive in the presence of estrogen receptor in human endometrium carcinoma RL 95-2 cells.

Topics: Amino Acid Sequence; Animals; Base Sequence; Cell Line; Endometrial Neoplasms; Estrogens; Female; Genes, Regulator; Humans; Introns; Lactoferrin; Liver; Mice; Mice, Inbred Strains; Molecular Sequence Data; Promoter Regions, Genetic; Rats; Receptors, Estrogen; Regulatory Sequences, Nucleic Acid; Restriction Mapping; TATA Box; Transfection