exudates and Hemoglobinopathies

Reproductive carrier screening started in some countries in the 1970s for hemoglobinopathies and Tay-Sachs disease. Cystic fibrosis carrier screening became possible in the late 1980s and with technical advances, screening of an ever increasing number of genes has become possible. The goal of carrier screening is to inform people about their risk of having children with autosomal recessive and X-linked recessive disorders, to allow for informed decision making about reproductive options. The consequence may be a decrease in the birth prevalence of these conditions, which has occurred in several countries for some conditions. Different programs target different groups (high school, premarital, couples before conception, couples attending fertility clinics, and pregnant women) as does the governance structure (public health initiative and user pays). Ancestry-based offers of screening are being replaced by expanded carrier screening panels with multiple genes that is independent of ancestry. This review describes screening in Australia, Cyprus, Israel, Italy, Malaysia, the Netherlands, Saudi Arabia, the United Kingdom, and the United States. It provides an insight into the enormous variability in how reproductive carrier screening is offered across the globe. This largely relates to geographical variation in carrier frequencies of genetic conditions and local health care, financial, cultural, and religious factors.

Topics: Abortion, Induced; Australia; Cyprus; Cystic Fibrosis; Female; Genetic Carrier Screening; Genetic Testing; Hemoglobinopathies; Heterozygote; Humans; Internationality; Israel; Italy; Malaysia; Netherlands; Pregnancy; Preimplantation Diagnosis; Prenatal Diagnosis; Saudi Arabia; Tay-Sachs Disease; Thalassemia; United Kingdom; United States

Topics: Anemia, Aplastic; Bone Marrow Transplantation; China; Cooperative Behavior; Family; Hematopoietic Stem Cell Transplantation; Hemoglobinopathies; Hong Kong; Humans; Immunologic Deficiency Syndromes; Leukemia; Lymphoma; Malaysia; Myelodysplastic Syndromes; Peripheral Blood Stem Cell Transplantation; Philippines; Singapore; Thailand; Tissue Donors; Transplantation, Autologous; Transplantation, Homologous

Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).. Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).. Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.. Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

Topics: Chromatography, High Pressure Liquid; Cross-Sectional Studies; Electrophoresis, Capillary; Female; Fetal Blood; Hemoglobinopathies; Humans; Infant, Newborn; Malaysia; Male; Mass Screening

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Topics: Base Sequence; beta-Globins; beta-Thalassemia; Blood Transfusion; Ethnicity; Female; Hemoglobinopathies; Hemoglobins, Abnormal; Homozygote; Humans; Malaysia; Male; Mutation; Population Groups

Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.

Topics: Adult; Anemia, Iron-Deficiency; Blood Cell Count; Blood Donors; Copper Sulfate; Erythrocyte Indices; Female; Hemoglobinopathies; Humans; Malaysia; Male; Middle Aged; Prevalence; Thalassemia; Young Adult

DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).

Topics: Asian People; Black People; DNA Probes; Gene Frequency; Gene Rearrangement; Georgia; Globins; Hemoglobinopathies; Humans; Malaysia; Promoter Regions, Genetic; Thalassemia

Topics: Blood Protein Electrophoresis; Erythrocyte Count; Female; Fetal Hemoglobin; Hematocrit; Hemoglobinopathies; Hemoglobins; Hemoglobins, Abnormal; Hemolysis; Homozygote; Humans; Malaysia; Pregnancy; Pregnancy Complications, Hematologic; Reticulocytes; Thalassemia

Topics: Agar; Asian People; Blood Protein Electrophoresis; Cellulose; Child; Electrophoresis; Erythrocytes; Glucosephosphate Dehydrogenase; Glutathione; Glutathione Reductase; Hemoglobinopathies; Hemoglobins, Abnormal; Homozygote; Humans; Jamaica; Malaysia; Male; Methemoglobin; Oxidoreductases; Peroxidases; Pyruvate Kinase

Topics: Acetates; Adult; Blood; Cellulose; Chromatography, DEAE-Cellulose; Electrophoresis; Electrophoresis, Starch Gel; Female; Hemoglobinopathies; Hemoglobins, Abnormal; Humans; Infant; Infant, Newborn; Malaysia; Male; Umbilical Cord

Topics: Adolescent; Adult; Asian People; Child; Child, Preschool; Electrophoresis, Starch Gel; Hemoglobin H; Hemoglobinopathies; Hemoglobins, Abnormal; Humans; Malaysia

Topics: Acid Phosphatase; Asian People; Blood Group Antigens; China; Emigration and Immigration; Erythrocytes; Ethnicity; Female; Genetics, Population; Glucosephosphate Dehydrogenase; Haptoglobins; Hemoglobinopathies; Hong Kong; Humans; Immunoglobulins; Malaysia; Male; Phosphoglucomutase; Phosphogluconate Dehydrogenase; Singapore; Taiwan; Transferrin; United States

Topics: Adolescent; Adult; Anemia, Hemolytic; Asian People; Blood Protein Electrophoresis; Child; Chromatography, DEAE-Cellulose; Female; Genes; Hemoglobinopathies; Hemoglobins, Abnormal; Humans; Inclusion Bodies; Infant; Iron; Malaysia; Male; Molecular Biology; Protein Denaturation; Thalassemia; Umbilical Cord

Topics: Adolescent; Adult; Blood Protein Electrophoresis; Carbonic Anhydrases; Catalase; Child; Electrophoresis, Paper; Erythrocytes, Abnormal; Female; Glucosephosphate Dehydrogenase; Glucosephosphate Dehydrogenase Deficiency; Hemoglobinopathies; Hemoglobins, Abnormal; Humans; Malaysia; Male; Pedigree

Topics: Female; Gout; Hemoglobinopathies; Humans; Hypersplenism; Malaysia; Male; Middle Aged; Racial Groups; Radiography; Sacroiliac Joint; Thalassemia