thrombin-aptamer and pyrene

Guanine-rich regions of the human genome can adopt non-canonical secondary structures. Their role in regulating gene expression has turned them into promising targets for therapeutic intervention. Ligands based on polyaromatic moieties are especially suitable for targeting G-quadruplexes utilizing their size complementarity to interact with the large exposed surface area of four guanine bases. A predictable way of (de)stabilizing specific G-quadruplex structures through efficient base stacking of polyaromatic functional groups could become a valuable tool in our therapeutic arsenal. We have investigated the effect of pyrene-modified uridine nucleotides incorporated at several positions of the thrombin binding aptamer (TBA) as a model system. Characterization using spectroscopic and biophysical methods provided important insights into modes of interaction between pyrene groups and the G-quadruplex core as well as (de)stabilization by enthalpic and entropic contributions. NMR data demonstrated that incorporation of pyrene group into G-rich oligonucleotide such as TBA may result in significant changes in 3D structure such as formation of novel dimeric topology. Site specific structural changes induced by stacking of the pyrene moiety on nearby nucleobases corelate with distinct thrombin binding affinities and increased resistance against nuclease degradation.

Topics: Aptamers, Nucleotide; Deoxyribonucleases; Dimerization; Entropy; G-Quadruplexes; Humans; Pyrenes; Thermodynamics; Thrombin; Uracil Nucleotides

We constructed an excimer aptamer probe containing one pyrene molecule at each end of a DNA aptamer to achieve the detection of thrombin, which binds to the heparin-binding site of thrombin with high binding affinity. The specific binding of thrombin to the excimer aptamer probe brought the two pyrene molecules at the termini of the duplex of the aptamer into close proximity, generating an excimer. The excimer emitted a distinct fluorescence peak, and fluorometric measurement of excimer allowed the sensitive detection of thrombin. The effects of experimental conditions like pH, ionic strength, and cations were investigated and optimized. The detection limit for thrombin was about 42 pM. This aptamer switch has potential in the study of molecular interactions and protein sensing with other switch-based detection strategy.

Topics: Aptamers, Nucleotide; Biosensing Techniques; Fluorescent Dyes; Humans; Limit of Detection; Models, Molecular; Pyrenes; Spectrometry, Fluorescence; Thrombin

We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α(i) of emitting species.

Topics: Aptamers, Nucleotide; Base Sequence; Cations; Fluorescence; G-Quadruplexes; Humans; Oligonucleotides; Potassium; Pyrenes; Spectrometry, Fluorescence; Telomere