AID1664179 | Induction of apoptosis in human A549 cells assessed as early apoptotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 0.25 %) | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1395465 | Antiproliferative activity against human HepG2 cells at 1 uM after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID95524 | Effective cytotoxic dose against KB cells was evaluated | 1998 | Bioorganic & medicinal chemistry letters, Oct-06, Volume: 8, Issue:19
| Synthesis and cytotoxicity of acetyl-4H,9H-naphtho[2,3-b]thiophene-4,9-diones. |
AID1356051 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1664180 | Induction of apoptosis in human A549 cells assessed as late apoptotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 3.70 %) | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID336955 | Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 100 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA | | | |
AID1657068 | Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 0.5 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1491233 | Selectivity ratio of IC50 for human A549 cells to IC50 for human MDA-MB-231 cells | 2017 | European journal of medicinal chemistry, Sep-08, Volume: 137 | Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity. |
AID1657058 | Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation incubated for 2 hrs by Western blot analysis | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1809349 | Inhibition of ALDH1A1 in human drug-tolerant MDA-MB-231/lapatinib cells assessed as after 24 hrs | | | |
AID1395464 | Selectivity index, ratio of IC50 for human L02 cells to IC50 for human HepG2 cells | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1664168 | Antiproliferative activity against human MDA-MB-231 cells assessed as reduction in cell viability measured after 48 hrs MTT assay | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1664171 | Antiproliferative activity against human A549 cells assessed as reduction in cell viability measured after 48 hrs MTT assay | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID702314 | Activity of human recombinant NQO-1 assessed as rate of superoxide generation measuring SOD-inhibitable reduction of succinoylated cytochrome c per unit enzyme at 25 umol/ml by spectrophotometry in presence of catalase and DTPA (Rvb = 0.2 +/- 0.1 micomol/ | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID1723870 | Down regulation of LRPPRC expression in human PANC-1 cells at 3 times IC50 measured after 1 to 24 hrs by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1678186 | Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as inhibition of tumor growth at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1848367 | Anti-proliferative activity against human BXPC-3 cells assessed as cell growth inhibition incubated for 72 hrs by MTS assay | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID379984 | Cytotoxicity against human SW626 cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1848457 | Antitumor activity against human BXPC-3 cells xenografted BALB/c mouse model assessed as tumor growth inhibition at 30 mg/kg,po administrated once daily for 8 weeks | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1848467 | Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as body weight change at 30 mg/kg,po administrated once daily for 8 weeks | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1664172 | Cytotoxicity against human MCF10A cells assessed as reduction in cell viability measured after 48 hrs MTT assay | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1678151 | Toxicity in nude BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on body weight level at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1809333 | Antiproliferative activity against human drug tolerant MDA-MB-231/lapatinib cells assessed as inhibition of cell growth in measured after 72 hrs by MTT assay | | | |
AID379978 | Cytotoxicity against human Lo1 cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1356059 | Binding affinity to STAT3 in human MDA-MB-231 cells at 100 uM measured after 1 hr by DARTS-Western blot analysis | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1395469 | Antiproliferative activity against human HepG2 cells at 100 uM after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1848420 | Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 phosphorylation at Tyr 705 at 4 uM incubated for 22 to 24 hrs by western blot analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1356042 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356053 | Induction of superoxide generation in human MDA-MB-231 cells at 5 umol/L measured after 24 hrs in presence of NQO1 inhibitor dicoumarol by DHE staining based flow cytometry | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID702318 | Antihyperproliferative activity against human HaCaT cells after 48 hrs by phase contrast microscopy | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID1723838 | Induction of reactive oxygen species in human MIA PaCa-2 cells assessed as reduction in GSH to GSSG ratio at 1 to 2 uM measured after 2 to 4 hrs by GSH/GSSG-glo assay | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1586017 | Antiproliferative activity against human PC3 cells after 72 hrs by MTT assay | 2019 | European journal of medicinal chemistry, Jan-15, Volume: 162 | A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3). |
AID1708683 | Antiproliferative activity against human BxPC-3 cells harboring ZFP91siRNA assessed as reduction in cell viability incubated for 48 hrs by MTT assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1718923 | Anti-CSC activity in patient with pSTAT3-positive tumors assessed as overall survival time at 480 mg, po administered bid with interval of 12 hrs | 2020 | Journal of medicinal chemistry, 12-24, Volume: 63, Issue:24
| Cancer Stem Cell (CSC) Inhibitors in Oncology-A Promise for a Better Therapeutic Outcome: State of the Art and Future Perspectives. |
AID1657069 | Effect on total STAT3 level in IL-6 induced human MCF7 cells at 0.5 to 4 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID336957 | Cytotoxicity against human Raji cells assessed as cell viability at 1000 molar ratio | | | |
AID380856 | Antiproliferative activity against human HaCaT cells | 1999 | Journal of natural products, Aug, Volume: 62, Issue:8
| Potential antipsoriatic agents: lapacho compounds as potent inhibitors of HaCaT cell growth. |
AID1356047 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1586014 | Antiproliferative activity against human HepG2 cells after 72 hrs by MTT assay | 2019 | European journal of medicinal chemistry, Jan-15, Volume: 162 | A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3). |
AID1708587 | Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as decrease in STAT3 expression level after 12 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1356038 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356055 | Induction of superoxide generation in human K562 cells at 5 umol/L measured after 24 hrs in presence of NQO1 inhibitor dicoumarol by DHE staining based flow cytometry | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1395466 | Antiproliferative activity against human HepG2 cells at 3 uM after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1708594 | Antiproliferative activity against human HEK293 cells assessed as reduction in cell viability incubated for 24 hrs by MTT assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1664178 | Induction of apoptosis in human A549 cells assessed as live cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 95.5 %) | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1356048 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356021 | Antiproliferative activity against human MDA-MB-231 cells measured after 48 hrs by MTT assay | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1739908 | Antiproliferative activity against human MDA-MB-231 cells overexpressing STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay | 2020 | European journal of medicinal chemistry, Sep-01, Volume: 201 | Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy. |
AID379979 | Cytotoxicity against human Col2 cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID400161 | In vivo cytotoxicity against mouse P388 cells at upto 35 mg/kg | | | |
AID1356037 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID389438 | Anticancer activity against human DU145 cells after 72 hrs 25 ug/ml by XTT assay | 2008 | Bioorganic & medicinal chemistry letters, Oct-15, Volume: 18, Issue:20
| Semisynthesis and antitumoral activity of 2-acetylfuranonaphthoquinone and other naphthoquinone derivatives from lapachol. |
AID336960 | Cytotoxicity against human Raji cells assessed as cell viability at 10 molar ratio | | | |
AID379977 | Cytotoxicity against human BC1 cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID95651 | Evaluated for cytotoxicity in the KB cell culture assay | 1987 | Journal of medicinal chemistry, Nov, Volume: 30, Issue:11
| Antitumor agents. 89. Psychorubrin, a new cytotoxic naphthoquinone from Psychotria rubra and its structure-activity relationships. |
AID702316 | Activity of human recombinant cytochrome P450 reductase assessed as rate of superoxide generation measuring SOD-inhibitable reduction of succinoylated cytochrome c per 2 mU enzyme at 100 umol/ml by spectrophotometry in presence of catalase and DTPA (Rvb = | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID1356058 | Inhibition of STAT3 phosphorylation at Y705 in human MDA-MB-231 cells assessed as reduction in ratio of phosphorylated STAT3 to total STAT3 level after 4 hrs by HTRF assay | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1657063 | Inhibition of human recombinant N-terminal His-tagged JAK2 (826 to 1132 residue) expressed in baculovirus expression system at 100 uM using Srctide as substrate by mobility shift assay relative to control | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1678194 | Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of lung at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1657074 | Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 0.5 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1657071 | Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 2 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1678144 | Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on body weight at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1856428 | Inhibition of STAT3 phosphorylation at Ser727 residue in human AGS cells at 4 uM by Western blotting analysis | | | |
AID1708605 | Inhibition of STAT3 phosphorylation in human MIA PaCa-2 cells 1 uM after 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1809334 | Antiproliferative activity against human HUVEC cells assessed as inhibition of cell growth in measured after 72 hrs by MTT assay | | | |
AID1664184 | Induction of ROS generation in human A549 cells at 2 uM measured after 24 hrs by DCFH-DA probe based flow cytometry (Rvb = 4.92 %) | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1657075 | Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 1 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1723866 | Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NAC by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1356022 | Antiproliferative activity against human K562 cells measured after 48 hrs by MTT assay | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1848424 | Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of Cyclin D1 expression at 4 uM incubated for 22 to 24 hrs by western blot analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1723840 | Inhibition glutathione synthesis in human MIA PaCa-2 cells at 1 to 2 uM measured after 2 to 4 hrs by GSH/GSSG-glo assay | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1723867 | Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NAC by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1708609 | Binding affinity to NQO1 in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID379980 | Cytotoxicity against human KB cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1657076 | Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 2 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1491229 | Cytotoxicity against human MDA-MB-231 cells assessed as growth inhibition after 72 hrs by MTT assay | 2017 | European journal of medicinal chemistry, Sep-08, Volume: 137 | Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity. |
AID379981 | Cytotoxicity against human multidrug resistant KB-V cells in presence of vinblastine | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1395463 | Antiproliferative activity against human L02 cells after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1657077 | Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 4 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1723854 | Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID379982 | Cytotoxicity against human multidrug resistant KB-V cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1708599 | Inhibition of STAT3 phosphorylation in human BxPC-3 cells at 5 uM after 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1657062 | Inhibition of human recombinant N-terminal GST-tagged JAK1 (850 to 1154 residue) expressed in baculovirus expression system at 100 uM using JAK1 peptide as substrate by mobility shift assay relative to control | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1723850 | Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1848366 | Inhibition of ATP production in human BXPC-3 cells incubated for 20 to 24 hrs by ATP assay kit method | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1491232 | Selectivity ratio of IC50 for human HepG2 cells to IC50 for human MDA-MB-231 cells | 2017 | European journal of medicinal chemistry, Sep-08, Volume: 137 | Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity. |
AID1356050 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1395462 | Antiproliferative activity against human HepG2 cells after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1537817 | Antimycobacterial activity against Mycobacterium tuberculosis H37Ra UAlRa incubated for 6 days by luminescence based assay | 2019 | MedChemComm, Sep-01, Volume: 10, Issue:9
| Discovery of napabucasin derivatives for the treatment of tuberculosis. |
AID1491231 | Cytotoxicity against human A549 cells assessed as growth inhibition after 72 hrs by MTT assay | 2017 | European journal of medicinal chemistry, Sep-08, Volume: 137 | Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity. |
AID1699864 | Antiproliferative activity against human MDA-MB-468 cells assessed as reduction in cell growth measured after 48 hrs by CCK8 assay | 2020 | Bioorganic & medicinal chemistry, 12-15, Volume: 28, Issue:24
| Identification of novel STAT3 inhibitors bearing 2-acetyl-7-phenylamino benzofuran scaffold for antitumour study. |
AID1723869 | Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NQO1 inhibitor dicoumarol by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1395468 | Antiproliferative activity against human HepG2 cells at 30 uM after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1356041 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356052 | Induction of superoxide generation in human MDA-MB-231 cells at 5 umol/L measured after 24 hrs by DHE staining based flow cytometry | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1848422 | Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 protein level at 4 uM incubated for 22 to 24 hrs by western blot analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1664170 | Antiproliferative activity against human HT-29 cells assessed as reduction in cell viability measured after 48 hrs MTT assay | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1707375 | Antiproliferative activity against human MDA-MB-231 cells harbouring STAT3 assessed as reduction in cell viability at upto 10 uM incubated for 72 hrs by CyQuant assay | 2021 | Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
| Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors. |
AID336954 | Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 500 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA | | | |
AID1356049 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356056 | Inhibition of STAT3 phosphorylation at Y705 in human MDA-MB-231 cells after 4 hrs by HTRF assay | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356060 | Binding affinity to STAT3 in human MDA-MB-231 cells at 100 uM treated for 1 hr followed by thermolysin addition measured after 30 mins by DARTS-Western blot analysis | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1395467 | Antiproliferative activity against human HepG2 cells at 10 uM after 48 hrs by CCK-8 assay | 2018 | European journal of medicinal chemistry, May-10, Volume: 151 | Design, synthesis and activity of BBI608 derivatives targeting on stem cells. |
AID1657056 | Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells at 1 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis relative to control | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID400160 | Cytotoxicity against human KB cells | | | |
AID1856409 | Antiproliferative activity against human MKN-45 cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay | | | |
AID380857 | Cytotoxicity against human HaCaT cells assessed as LDH release at 2 uM | 1999 | Journal of natural products, Aug, Volume: 62, Issue:8
| Potential antipsoriatic agents: lapacho compounds as potent inhibitors of HaCaT cell growth. |
AID1586013 | Antiproliferative activity against human U251 cells after 72 hrs by MTT assay | 2019 | European journal of medicinal chemistry, Jan-15, Volume: 162 | A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3). |
AID1586022 | Aqueous solubility of the compound in water at 2 mg after 24 hrs by HPLC analysis | 2019 | European journal of medicinal chemistry, Jan-15, Volume: 162 | A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3). |
AID1848474 | Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on liver at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1356027 | Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1723871 | Down regulation of PNPT1 expression in human PANC-1 cells at 3 times IC50 measured after 1 to 24 hrs by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID379986 | Cytotoxicity against human M109 cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID379985 | Cytotoxicity against human SK-N-SH cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1678195 | Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of spleen at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1586015 | Antiproliferative activity against human HT-29 cells after 72 hrs by MTT assay | 2019 | European journal of medicinal chemistry, Jan-15, Volume: 162 | A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3). |
AID1708610 | Inhibition of STAT3 in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1708604 | Protac activity at CRBN/STAT3 in human MIA PaCa-2 cells assessed as effect on STAT3 expression levels at 1 uM incubated for 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1678198 | Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as increased numbers of necrotic cells at 30 mg/kg, ip QD for 18 days by H and E staining based analysis relative to | | | |
AID1356026 | Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 8 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1708589 | Reduction in NQO1 levels in human BxPC-3 cells at 2 uM incubated for 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1750418 | Inhibition of cell stemness in human HCT116 cells assessed as morphological alterations at 5 uM after 10 days by microscopic analysis | | | |
AID1708681 | Inhibition of colony formation in human BxPC-3 cells assessed as reduction in colony formation at 0.06 to 0.5 uM incubated for 16 hrs in presence of NQO1 inhibitor dicoumarol | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1664169 | Antiproliferative activity against human MCF7 cells assessed as reduction in cell viability measured after 48 hrs MTT assay | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1356046 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356057 | Effect on total STAT3 level in human MDA-MB-231 cells at 0.1 to 30 umol/L after 4 hrs by HTRF assay | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1856429 | Inhibition of STAT3 phosphorylation at Tyr705 residue in human AGS cells at 4 uM by Western blotting analysis | | | |
AID1356030 | Induction of apoptosis in human MDA-MB-231 cells assessed as early apoptotic cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis relative to control | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1708596 | Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as decrease in STAT3 expression level at 5 uM after 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1356036 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1856411 | Antiproliferative activity against human MGC-803 cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay | | | |
AID1739910 | Antiproliferative activity against human HepG2 cells overexpressed STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay | 2020 | European journal of medicinal chemistry, Sep-01, Volume: 201 | Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy. |
AID1586016 | Antiproliferative activity against mouse CT26 cells after 72 hrs by MTT assay | 2019 | European journal of medicinal chemistry, Jan-15, Volume: 162 | A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3). |
AID1708578 | Antiproliferative activity against human MIA PaCa-2 cells assessed as reduction in cell viability incubated for 3 days by MTT assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1678149 | Antitumor activity against human BXPC-3 cells xenografted in nude BALB/c mouse assessed as inhibition of tumor growth at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1657067 | Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1657066 | Inhibition of human recombinant N-terminal His-tagged JAK3 (795 to 1124 residue) expressed in baculovirus infected Sf21 insect cells up to 100 uM using Srctide as substrate by mobility shift assay | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID336958 | Cytotoxicity against human Raji cells assessed as cell viability at 500 molar ratio | | | |
AID1848477 | Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on kidney at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1657060 | Cytotoxicity against human MCF7 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1856407 | Inhibition of human recombinant STAT3 (127 to 722 residues) transcriptional activity expressed in HEK293T cells in presence of IL-6 by Dual-luciferase reporter gene assay | | | |
AID702317 | Cytotoxicity against human HaCaT cells assessed as LDH release at 2 uM after 4 hrs by UV method | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID702315 | Induction of superoxide generation in human HaCaT cells at 50 uM after 30 min by flow cytometry (Rvb = 7.1 +/- 5.2 ) | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID1750412 | Inhibition of cell stemness in human HCT116 cells assessed as inhibition of CD44+/CD133+ expression at 20 uM after 24 hrs by flow cytometry analysis | | | |
AID1356040 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1707392 | Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA hSIE probe binding to STAT3 in human MDA-MB-468 cell nuclear extract at 0.5 to 5 uM incubated for 3 hrs by EMSA analysis | 2021 | Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
| Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors. |
AID1848473 | Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on heart at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1678196 | Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of kidney at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1723848 | Inhibition of colony formation in human MIA PaCa-2 cells at 0.6 uM measured after 7 to 9 days in presence of necroptosis inhibitor necrostatin-1 by crystal violet staining based assay | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1657072 | Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 4 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1723868 | Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NQO1 inhibitor dicoumarol by proteomics analysis | 2020 | Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
| A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species. |
AID1664181 | Induction of apoptosis in human A549 cells assessed as necrotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 0.54 %) | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1809332 | Antiproliferative activity against human MDA-MB-231 cells assessed as inhibition of cell growth measured after 72 hrs by MTT assay | | | |
AID1708607 | Binding affinity to PDI in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1356045 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356044 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356025 | Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 6 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1708680 | Antiproliferative activity against ZFP91 knockdown human BxPC-3 cells assessed as reduction in cell viability incubated for 48 hrs by MTT assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID336959 | Cytotoxicity against human Raji cells assessed as cell viability at 100 molar ratio | | | |
AID1356024 | Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 4 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1739909 | Antiproliferative activity against human MDA-MB-468 cells overexpressing STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay | 2020 | European journal of medicinal chemistry, Sep-01, Volume: 201 | Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy. |
AID379983 | Cytotoxicity against human LNCaP cells | 2000 | Journal of natural products, Apr, Volume: 63, Issue:4
| Cytotoxic constituents of the roots of Ekmanianthe longiflora. |
AID1707393 | Inhibition of STAT3 phosphorylation at Y705 residues in human MDA-MB-468 whole cell lysate at 0.5 to 2 uM incubated for 2 hrs by immunoblotting analysis | 2021 | Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
| Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors. |
AID1678193 | Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of liver at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1848475 | Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on spleen at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1856410 | Antiproliferative activity against human AGS cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay | | | |
AID1809336 | Resistant factor, ratio of IC50 for antiproliferative activity against drug-tolerant human MDA-MB-231 cells to IC50 for human MDA-MB-231 cells | | | |
AID1657061 | Cytotoxicity against human A549 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1678192 | Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of heart at 30 mg/kg, ip QD for 18 days relative to control | | | |
AID1707373 | Antiproliferative activity against human MCF7 cells assessed as reduction in cell viability incubated for 72 hrs by CyQuant assay | 2021 | Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
| Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors. |
AID702312 | Activity in dicoumarol-treated human HaCaT cells assessed as superoxide generation by flow cytometry (Rvb = 407.59 +/- 68.7 ) | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID336953 | Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 1000 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA | | | |
AID702313 | Induction of superoxide generation in human HaCaT cells at 5 micomol/L after 18 hrs by flow cytometry (Rvb = 367.5 +/- 80.1 ) | 2012 | Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
| Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera |
AID389437 | Anticancer activity against human DU145 cells after 72 hrs by XTT assay | 2008 | Bioorganic & medicinal chemistry letters, Oct-15, Volume: 18, Issue:20
| Semisynthesis and antitumoral activity of 2-acetylfuranonaphthoquinone and other naphthoquinone derivatives from lapachol. |
AID1657059 | Cytotoxicity against human MDA-MB-231 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1848476 | Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on lung at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1848368 | Anti-proliferative activity against human Capan-2 cells assessed as cell growth inhibition incubated for 72 hrs by MTS assay | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1708579 | Antiproliferative activity against human BxPC-3 cells assessed as reduction in cell viability incubated for 3 days by MTT assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1356023 | Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 2 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1356039 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1809331 | Antiproliferative activity against human MCF7 cells assessed as inhibition of cell growth measured after 72 hrs by MTT assay | | | |
AID1848423 | Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of c-Myc expression at 4 uM incubated for 22 to 24 hrs by western blot analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1856408 | Inhibition of ATP production in human MKN-45 cells incubated for 20 to 24 hrs by ATP assay kit method | | | |
AID1708591 | Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as effect on GSPT1 protein expression level at 2 uM incubated for 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1664173 | Substrate activity at human NQO1 assessed as amount of NADH oxidation assessed per umol NQO1 | 2020 | Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
| Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues. |
AID1708614 | Protac activity at CRBN/ZFP91 in human BxPC-3 cells assessed as induction of ZF91 degradation at upto 3 uM incubated for 16 hrs by western blot analysis | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1356043 | Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%) | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID1678201 | Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as increase in apoptotic cells level at 30 mg/kg, ip QD for 18 days by TUNEL assay relative to control | | | |
AID1708593 | Inhibition of IL-6 induced STAT3 transcriptional activity in human HEK293 cells expressing SIE-luc2P preincubated for overnight followed by IL-6 stimulation and measured after 24 hr by Bio-Glo luciferase reagent based microplate reader assay | 2021 | Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
| Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. |
AID1848421 | Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 phosphorylation at Ser 727 at 4 uM incubated for 22 to 24 hrs by western blot analysis | 2022 | Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
| Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment. |
AID1657070 | Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 1 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%) | 2020 | Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
| STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. |
AID1491230 | Cytotoxicity against human HepG2 cells assessed as growth inhibition after 72 hrs by MTT assay | 2017 | European journal of medicinal chemistry, Sep-08, Volume: 137 | Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity. |
AID336961 | Displacement of [3H]TPA from TPA receptor in ICR mouse dorsal epidermis | | | |
AID1356033 | Induction of apoptosis in human MDA-MB-231 cells assessed as late apoptotic cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis relative to control | 2018 | Journal of natural products, 07-27, Volume: 81, Issue:7
| Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells. |
AID336956 | Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 10 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA | | | |
AID1347411 | qHTS to identify inhibitors of the type 1 interferon - major histocompatibility complex class I in skeletal muscle: primary screen against the NCATS Mechanism Interrogation Plate v5.0 (MIPE) Libary | 2020 | ACS chemical biology, 07-17, Volume: 15, Issue:7
| High-Throughput Screening to Identify Inhibitors of the Type I Interferon-Major Histocompatibility Complex Class I Pathway in Skeletal Muscle. |
AID1347412 | qHTS assay to identify inhibitors of the type 1 interferon - major histocompatibility complex class I in skeletal muscle: Counter screen cell viability and HiBit confirmation | 2020 | ACS chemical biology, 07-17, Volume: 15, Issue:7
| High-Throughput Screening to Identify Inhibitors of the Type I Interferon-Major Histocompatibility Complex Class I Pathway in Skeletal Muscle. |
[information is prepared from bioassay data collected from National Library of Medicine (NLM), extracted Dec-2023] |