2-acetylfuranonaphthoquinone profile

2-acetylfuranonaphthoquinone: has antineoplastic activity; structure in first source [Medical Subject Headings (MeSH), National Library of Medicine, extracted Dec-2023]

ID Source	ID
PubMed CID	10331844
CHEMBL ID	64130
SCHEMBL ID	1883845
MeSH ID	M0496111

Synonym
napabucasin
CHEMBL64130
2-acetylfuranonaphthoquinone
bbi608
bbi-608
2-acetylfuro-1,4-naphthoquinone
SCHEMBL1883845
bdbm50366597
83280-65-3
2-acetylnaphtho(2,3-b)furan-4,9-dione
napabucasin [usan:inn]
z1hhm49k7o ,
unii-z1hhm49k7o
S7977
CS-1747
HY-13919
2-acetyl-naphtho[2,3-b]furan-4,9-dione
2-acetyl-4h,9h-naphtho[2,3-b]furan-4,9-dione
DPHUWDIXHNQOSY-UHFFFAOYSA-N
naphtho(2,3-b)furan-4,9-dione, 2-acetyl-
napabucasin [jan]
napabucasin [usan]
2-acetylnaphtho[2,3-b]furan-4,9-dione
napabucasin [inn]
napabucasin [who-dd]
napabucasin (jan/usan/inn)
D10717
AC-32935
bbi 608
2-acetylbenzo[f][1]benzofuran-4,9-dione
fnq ,
napabucasin; bbi608
EX-A1314
AS-60519
AKOS027470201
napabucasin (bbi608)
DB12155
BCP07628
F17379
Z2027914355
mfcd28155270
EN300-207428
AMY27812
CCG-266871
Q27294876
gtpl11358
nsc788900
nsc-788900
2-acetyl naphtho2,3-bfuran-4,9-dione
nsc-816092
nsc816092

Excerpt	Reference	Relevance
" No serious adverse events/deaths were reported."	( Napabucasin Drug-Drug Interaction Potential, Safety, Tolerability, and Pharmacokinetics Following Oral Dosing in Healthy Adult Volunteers. Brantley, SJ; Dai, X; Goulet, MT; Hard, ML; Hitron, M; Karol, MD; McLaughlin, CF, 2021)	0.62
" Napabucasin was well-tolerated across the study (n = 70), and no serious adverse events or significant safety issues were reported when administered with or without food."	( Effects of a reactive oxygen species generator, napabucasin (BBI608), on tolerability, safety, pharmacokinetics, and QT/QTc interval in healthy volunteers. Horibuchi, Y; Iino, S; Kakuyama, H; Matsuki, S; Noda, N; Ogama, Y; Takagaki, T; Yodo, Y, 2021)	0.62
" The most frequently reported adverse events were diarrhea (83."	( A Phase I Study to Investigate the Safety, Tolerability and Pharmacokinetics of Napabucasin Combined with Sorafenib in Japanese Patients with Unresectable Hepatocellular Carcinoma. Eguchi, Y; Iino, S; Kageyama, R; Morimoto, M; Nakamura, S; Okusaka, T, 2023)	0.91

Excerpt	Reference	Relevance
" The pharmacokinetic results for napabucasin were consistent with prior publications."	( A Phase I Study to Investigate the Safety, Tolerability and Pharmacokinetics of Napabucasin Combined with Sorafenib in Japanese Patients with Unresectable Hepatocellular Carcinoma. Eguchi, Y; Iino, S; Kageyama, R; Morimoto, M; Nakamura, S; Okusaka, T, 2023)	0.91

Excerpt	Reference	Relevance
"Napabucasin 240 mg BID in combination with FOLFIRI and bevacizumab was tolerated, with a manageable safety profile in Japanese patients with metastatic CRC."	( Phase I study of napabucasin in combination with FOLFIRI + bevacizumab in Japanese patients with metastatic colorectal cancer. Bando, H; Iino, S; Kadowaki, S; Kageyama, R; Kawazoe, A; Masuishi, T; Muro, K; Taniguchi, H; Yoshino, T, 2021)	0.62

Excerpt	Reference	Relevance
" To improve its bioavailability and tumor accumulation, BBI608 is successfully encapsulated into redox-responsive PEGylated branched N-(2-hydroxypropyl) methacrylamide (HPMA)-deoxy cholic acid (DA) polymeric nanoparticles (BBI608-SS-NPs)."	( A redox-responsive nanosystem to suppress chemoresistant lung cancer through targeting STAT3. Chen, J; Chen, X; Feng, Q; Gu, Z; Huang, J; Li, J; Li, W; Li, X; Liu, X; Luo, K; Xiao, C; Xiao, K; Zheng, X, 2023)	0.91

Excerpt	Relevance	Reference
" More severe adverse events required reduced or discontinued dosing of napabucasin or medication to reverse or manage symptoms."	( Napabucasin: An Update on the First-in-Class Cancer Stemness Inhibitor. Grothey, A; Hubbard, JM, 2017)	0.46

Protein	Taxonomy	Measurement	Average (µ)	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
PPM1D protein	Homo sapiens (human)	Potency	0.5230	0.0052	9.4661	32.9993	AID1347411
Interferon beta	Homo sapiens (human)	Potency	0.5230	0.0033	9.1582	39.8107	AID1347411
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Retinal dehydrogenase 1	Homo sapiens (human)	IC50 (µMol)	0.4253	0.0200	1.0476	6.7900	AID1809349
Signal transducer and activator of transcription 3	Homo sapiens (human)	IC50 (µMol)	2.1000	0.0230	4.1378	9.9800	AID1657067; AID1708593
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Signal transducer and activator of transcription 3	Homo sapiens (human)	EC50 (µMol)	1.9500	1.9000	2.3000	3.0000	AID1356056; AID1356058
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Protein	Taxonomy	Measurement	Average	Min (ref.)	Avg (ref.)	Max (ref.)	Bioassay(s)
Signal transducer and activator of transcription 3	Homo sapiens (human)	DC50	2.1000	2.1000	2.1000	2.1000	AID1708587
Protein cereblon	Homo sapiens (human)	DC50	2.1000	0.0080	0.4835	2.1000	AID1708587
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Process	via Protein(s)	Taxonomy
retinoid metabolic process	Retinal dehydrogenase 1	Homo sapiens (human)
cellular aldehyde metabolic process	Retinal dehydrogenase 1	Homo sapiens (human)
gamma-aminobutyric acid biosynthetic process	Retinal dehydrogenase 1	Homo sapiens (human)
fructosamine catabolic process	Retinal dehydrogenase 1	Homo sapiens (human)
maintenance of lens transparency	Retinal dehydrogenase 1	Homo sapiens (human)
retinol metabolic process	Retinal dehydrogenase 1	Homo sapiens (human)
cellular detoxification of aldehyde	Retinal dehydrogenase 1	Homo sapiens (human)
negative regulation of cold-induced thermogenesis	Retinal dehydrogenase 1	Homo sapiens (human)
cell surface receptor signaling pathway via JAK-STAT	Interferon beta	Homo sapiens (human)
response to exogenous dsRNA	Interferon beta	Homo sapiens (human)
B cell activation involved in immune response	Interferon beta	Homo sapiens (human)
cell surface receptor signaling pathway	Interferon beta	Homo sapiens (human)
cell surface receptor signaling pathway via JAK-STAT	Interferon beta	Homo sapiens (human)
response to virus	Interferon beta	Homo sapiens (human)
positive regulation of autophagy	Interferon beta	Homo sapiens (human)
cytokine-mediated signaling pathway	Interferon beta	Homo sapiens (human)
natural killer cell activation	Interferon beta	Homo sapiens (human)
positive regulation of peptidyl-serine phosphorylation of STAT protein	Interferon beta	Homo sapiens (human)
cellular response to interferon-beta	Interferon beta	Homo sapiens (human)
B cell proliferation	Interferon beta	Homo sapiens (human)
negative regulation of viral genome replication	Interferon beta	Homo sapiens (human)
innate immune response	Interferon beta	Homo sapiens (human)
positive regulation of innate immune response	Interferon beta	Homo sapiens (human)
regulation of MHC class I biosynthetic process	Interferon beta	Homo sapiens (human)
negative regulation of T cell differentiation	Interferon beta	Homo sapiens (human)
positive regulation of transcription by RNA polymerase II	Interferon beta	Homo sapiens (human)
defense response to virus	Interferon beta	Homo sapiens (human)
type I interferon-mediated signaling pathway	Interferon beta	Homo sapiens (human)
neuron cellular homeostasis	Interferon beta	Homo sapiens (human)
cellular response to exogenous dsRNA	Interferon beta	Homo sapiens (human)
cellular response to virus	Interferon beta	Homo sapiens (human)
negative regulation of Lewy body formation	Interferon beta	Homo sapiens (human)
negative regulation of T-helper 2 cell cytokine production	Interferon beta	Homo sapiens (human)
positive regulation of apoptotic signaling pathway	Interferon beta	Homo sapiens (human)
response to exogenous dsRNA	Interferon beta	Homo sapiens (human)
B cell differentiation	Interferon beta	Homo sapiens (human)
natural killer cell activation involved in immune response	Interferon beta	Homo sapiens (human)
adaptive immune response	Interferon beta	Homo sapiens (human)
T cell activation involved in immune response	Interferon beta	Homo sapiens (human)
humoral immune response	Interferon beta	Homo sapiens (human)
positive regulation of vascular endothelial growth factor production	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of transcription by RNA polymerase II	Signal transducer and activator of transcription 3	Homo sapiens (human)
temperature homeostasis	Signal transducer and activator of transcription 3	Homo sapiens (human)
eye photoreceptor cell differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
regulation of DNA-templated transcription	Signal transducer and activator of transcription 3	Homo sapiens (human)
regulation of transcription by RNA polymerase II	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein import into nucleus	Signal transducer and activator of transcription 3	Homo sapiens (human)
inflammatory response	Signal transducer and activator of transcription 3	Homo sapiens (human)
signal transduction	Signal transducer and activator of transcription 3	Homo sapiens (human)
transforming growth factor beta receptor signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
cell surface receptor signaling pathway via JAK-STAT	Signal transducer and activator of transcription 3	Homo sapiens (human)
nervous system development	Signal transducer and activator of transcription 3	Homo sapiens (human)
cell population proliferation	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of cell population proliferation	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of autophagy	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of gene expression	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of gene expression	Signal transducer and activator of transcription 3	Homo sapiens (human)
phosphorylation	Signal transducer and activator of transcription 3	Homo sapiens (human)
cytokine-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
sexual reproduction	Signal transducer and activator of transcription 3	Homo sapiens (human)
cell differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of cell migration	Signal transducer and activator of transcription 3	Homo sapiens (human)
intracellular receptor signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
response to estradiol	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of interleukin-1 beta production	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of interleukin-10 production	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of interleukin-6 production	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of interleukin-8 production	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of tumor necrosis factor production	Signal transducer and activator of transcription 3	Homo sapiens (human)
cellular response to hormone stimulus	Signal transducer and activator of transcription 3	Homo sapiens (human)
leptin-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
somatic stem cell population maintenance	Signal transducer and activator of transcription 3	Homo sapiens (human)
interleukin-15-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
interleukin-2-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
interleukin-9-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
interleukin-11-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
regulation of multicellular organism growth	Signal transducer and activator of transcription 3	Homo sapiens (human)
glucose homeostasis	Signal transducer and activator of transcription 3	Homo sapiens (human)
eating behavior	Signal transducer and activator of transcription 3	Homo sapiens (human)
mRNA transcription by RNA polymerase II	Signal transducer and activator of transcription 3	Homo sapiens (human)
phosphatidylinositol 3-kinase/protein kinase B signal transduction	Signal transducer and activator of transcription 3	Homo sapiens (human)
cellular response to leptin stimulus	Signal transducer and activator of transcription 3	Homo sapiens (human)
response to leptin	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of erythrocyte differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of Notch signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of angiogenesis	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of glycolytic process	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of DNA-templated transcription	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of transcription by RNA polymerase II	Signal transducer and activator of transcription 3	Homo sapiens (human)
astrocyte differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of inflammatory response	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of NF-kappaB transcription factor activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
regulation of cell cycle	Signal transducer and activator of transcription 3	Homo sapiens (human)
radial glial cell differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
retinal rod cell differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
regulation of feeding behavior	Signal transducer and activator of transcription 3	Homo sapiens (human)
growth hormone receptor signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
growth hormone receptor signaling pathway via JAK-STAT	Signal transducer and activator of transcription 3	Homo sapiens (human)
interleukin-6-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
T-helper 17 type immune response	Signal transducer and activator of transcription 3	Homo sapiens (human)
T-helper 17 cell lineage commitment	Signal transducer and activator of transcription 3	Homo sapiens (human)
energy homeostasis	Signal transducer and activator of transcription 3	Homo sapiens (human)
cellular response to interleukin-17	Signal transducer and activator of transcription 3	Homo sapiens (human)
cell surface receptor signaling pathway via STAT	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of inflammatory response to wounding	Signal transducer and activator of transcription 3	Homo sapiens (human)
interleukin-10-mediated signaling pathway	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of cytokine production involved in inflammatory response	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of miRNA transcription	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of metalloendopeptidase activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
positive regulation of vascular endothelial cell proliferation	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of primary miRNA processing	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of stem cell differentiation	Signal transducer and activator of transcription 3	Homo sapiens (human)
negative regulation of neuron migration	Signal transducer and activator of transcription 3	Homo sapiens (human)
regulation of cell population proliferation	Signal transducer and activator of transcription 3	Homo sapiens (human)
response to peptide hormone	Signal transducer and activator of transcription 3	Homo sapiens (human)
defense response	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein ubiquitination	Protein cereblon	Homo sapiens (human)
positive regulation of Wnt signaling pathway	Protein cereblon	Homo sapiens (human)
negative regulation of protein-containing complex assembly	Protein cereblon	Homo sapiens (human)
positive regulation of protein-containing complex assembly	Protein cereblon	Homo sapiens (human)
negative regulation of monoatomic ion transmembrane transport	Protein cereblon	Homo sapiens (human)
locomotory exploration behavior	Protein cereblon	Homo sapiens (human)
proteasome-mediated ubiquitin-dependent protein catabolic process	Protein cereblon	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Process	via Protein(s)	Taxonomy
retinal dehydrogenase activity	Retinal dehydrogenase 1	Homo sapiens (human)
aldehyde dehydrogenase (NAD+) activity	Retinal dehydrogenase 1	Homo sapiens (human)
GTPase activator activity	Retinal dehydrogenase 1	Homo sapiens (human)
androgen binding	Retinal dehydrogenase 1	Homo sapiens (human)
protein binding	Retinal dehydrogenase 1	Homo sapiens (human)
aminobutyraldehyde dehydrogenase activity	Retinal dehydrogenase 1	Homo sapiens (human)
glyceraldehyde-3-phosphate dehydrogenase (NAD+) (non-phosphorylating) activity	Retinal dehydrogenase 1	Homo sapiens (human)
NAD binding	Retinal dehydrogenase 1	Homo sapiens (human)
3-deoxyglucosone dehydrogenase activity	Retinal dehydrogenase 1	Homo sapiens (human)
benzaldehyde dehydrogenase (NAD+) activity	Retinal dehydrogenase 1	Homo sapiens (human)
cytokine activity	Interferon beta	Homo sapiens (human)
cytokine receptor binding	Interferon beta	Homo sapiens (human)
type I interferon receptor binding	Interferon beta	Homo sapiens (human)
protein binding	Interferon beta	Homo sapiens (human)
chloramphenicol O-acetyltransferase activity	Interferon beta	Homo sapiens (human)
transcription cis-regulatory region binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
RNA polymerase II cis-regulatory region sequence-specific DNA binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
DNA-binding transcription factor activity, RNA polymerase II-specific	Signal transducer and activator of transcription 3	Homo sapiens (human)
DNA-binding transcription activator activity, RNA polymerase II-specific	Signal transducer and activator of transcription 3	Homo sapiens (human)
DNA binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
DNA-binding transcription factor activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
nuclear receptor activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
signaling receptor binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein kinase binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein phosphatase binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
chromatin DNA binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
signaling adaptor activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
identical protein binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein homodimerization activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein dimerization activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
RNA polymerase II-specific DNA-binding transcription factor binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
primary miRNA binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
lncRNA binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
DNA-binding transcription factor binding	Signal transducer and activator of transcription 3	Homo sapiens (human)
RNA sequestering activity	Signal transducer and activator of transcription 3	Homo sapiens (human)
protein binding	Protein cereblon	Homo sapiens (human)
transmembrane transporter binding	Protein cereblon	Homo sapiens (human)
metal ion binding	Protein cereblon	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Process	via Protein(s)	Taxonomy
cytoplasm	Retinal dehydrogenase 1	Homo sapiens (human)
cytosol	Retinal dehydrogenase 1	Homo sapiens (human)
axon	Retinal dehydrogenase 1	Homo sapiens (human)
synapse	Retinal dehydrogenase 1	Homo sapiens (human)
extracellular exosome	Retinal dehydrogenase 1	Homo sapiens (human)
extracellular space	Interferon beta	Homo sapiens (human)
extracellular region	Interferon beta	Homo sapiens (human)
nucleus	Signal transducer and activator of transcription 3	Homo sapiens (human)
nucleus	Signal transducer and activator of transcription 3	Homo sapiens (human)
nucleoplasm	Signal transducer and activator of transcription 3	Homo sapiens (human)
cytoplasm	Signal transducer and activator of transcription 3	Homo sapiens (human)
cytosol	Signal transducer and activator of transcription 3	Homo sapiens (human)
plasma membrane	Signal transducer and activator of transcription 3	Homo sapiens (human)
RNA polymerase II transcription regulator complex	Signal transducer and activator of transcription 3	Homo sapiens (human)
chromatin	Signal transducer and activator of transcription 3	Homo sapiens (human)
transcription regulator complex	Signal transducer and activator of transcription 3	Homo sapiens (human)
cytoplasm	Signal transducer and activator of transcription 3	Homo sapiens (human)
nucleus	Protein cereblon	Homo sapiens (human)
cytoplasm	Protein cereblon	Homo sapiens (human)
cytosol	Protein cereblon	Homo sapiens (human)
membrane	Protein cereblon	Homo sapiens (human)
perinuclear region of cytoplasm	Protein cereblon	Homo sapiens (human)
Cul4A-RING E3 ubiquitin ligase complex	Protein cereblon	Homo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Bioassays (197)

Assay ID	Title	Year	Journal	Article
AID1664179	Induction of apoptosis in human A549 cells assessed as early apoptotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 0.25 %)	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1395465	Antiproliferative activity against human HepG2 cells at 1 uM after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID95524	Effective cytotoxic dose against KB cells was evaluated	1998	Bioorganic & medicinal chemistry letters, Oct-06, Volume: 8, Issue:19	Synthesis and cytotoxicity of acetyl-4H,9H-naphtho[2,3-b]thiophene-4,9-diones.
AID1356051	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1664180	Induction of apoptosis in human A549 cells assessed as late apoptotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 3.70 %)	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID336955	Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 100 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID1657068	Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 0.5 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1491233	Selectivity ratio of IC50 for human A549 cells to IC50 for human MDA-MB-231 cells	2017	European journal of medicinal chemistry, Sep-08, Volume: 137	Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID1657058	Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation incubated for 2 hrs by Western blot analysis	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1809349	Inhibition of ALDH1A1 in human drug-tolerant MDA-MB-231/lapatinib cells assessed as after 24 hrs
AID1395464	Selectivity index, ratio of IC50 for human L02 cells to IC50 for human HepG2 cells	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1664168	Antiproliferative activity against human MDA-MB-231 cells assessed as reduction in cell viability measured after 48 hrs MTT assay	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1664171	Antiproliferative activity against human A549 cells assessed as reduction in cell viability measured after 48 hrs MTT assay	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID702314	Activity of human recombinant NQO-1 assessed as rate of superoxide generation measuring SOD-inhibitable reduction of succinoylated cytochrome c per unit enzyme at 25 umol/ml by spectrophotometry in presence of catalase and DTPA (Rvb = 0.2 +/- 0.1 micomol/	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1723870	Down regulation of LRPPRC expression in human PANC-1 cells at 3 times IC50 measured after 1 to 24 hrs by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1678186	Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as inhibition of tumor growth at 30 mg/kg, ip QD for 18 days relative to control
AID1848367	Anti-proliferative activity against human BXPC-3 cells assessed as cell growth inhibition incubated for 72 hrs by MTS assay	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID379984	Cytotoxicity against human SW626 cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1848457	Antitumor activity against human BXPC-3 cells xenografted BALB/c mouse model assessed as tumor growth inhibition at 30 mg/kg,po administrated once daily for 8 weeks	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1848467	Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as body weight change at 30 mg/kg,po administrated once daily for 8 weeks	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1664172	Cytotoxicity against human MCF10A cells assessed as reduction in cell viability measured after 48 hrs MTT assay	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1678151	Toxicity in nude BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on body weight level at 30 mg/kg, ip QD for 18 days relative to control
AID1809333	Antiproliferative activity against human drug tolerant MDA-MB-231/lapatinib cells assessed as inhibition of cell growth in measured after 72 hrs by MTT assay
AID379978	Cytotoxicity against human Lo1 cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1356059	Binding affinity to STAT3 in human MDA-MB-231 cells at 100 uM measured after 1 hr by DARTS-Western blot analysis	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395469	Antiproliferative activity against human HepG2 cells at 100 uM after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1848420	Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 phosphorylation at Tyr 705 at 4 uM incubated for 22 to 24 hrs by western blot analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1356042	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356053	Induction of superoxide generation in human MDA-MB-231 cells at 5 umol/L measured after 24 hrs in presence of NQO1 inhibitor dicoumarol by DHE staining based flow cytometry	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID702318	Antihyperproliferative activity against human HaCaT cells after 48 hrs by phase contrast microscopy	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1723838	Induction of reactive oxygen species in human MIA PaCa-2 cells assessed as reduction in GSH to GSSG ratio at 1 to 2 uM measured after 2 to 4 hrs by GSH/GSSG-glo assay	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1586017	Antiproliferative activity against human PC3 cells after 72 hrs by MTT assay	2019	European journal of medicinal chemistry, Jan-15, Volume: 162	A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708683	Antiproliferative activity against human BxPC-3 cells harboring ZFP91siRNA assessed as reduction in cell viability incubated for 48 hrs by MTT assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1718923	Anti-CSC activity in patient with pSTAT3-positive tumors assessed as overall survival time at 480 mg, po administered bid with interval of 12 hrs	2020	Journal of medicinal chemistry, 12-24, Volume: 63, Issue:24	Cancer Stem Cell (CSC) Inhibitors in Oncology-A Promise for a Better Therapeutic Outcome: State of the Art and Future Perspectives.
AID1657069	Effect on total STAT3 level in IL-6 induced human MCF7 cells at 0.5 to 4 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID336957	Cytotoxicity against human Raji cells assessed as cell viability at 1000 molar ratio
AID380856	Antiproliferative activity against human HaCaT cells	1999	Journal of natural products, Aug, Volume: 62, Issue:8	Potential antipsoriatic agents: lapacho compounds as potent inhibitors of HaCaT cell growth.
AID1356047	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1586014	Antiproliferative activity against human HepG2 cells after 72 hrs by MTT assay	2019	European journal of medicinal chemistry, Jan-15, Volume: 162	A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708587	Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as decrease in STAT3 expression level after 12 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356038	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356055	Induction of superoxide generation in human K562 cells at 5 umol/L measured after 24 hrs in presence of NQO1 inhibitor dicoumarol by DHE staining based flow cytometry	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395466	Antiproliferative activity against human HepG2 cells at 3 uM after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1708594	Antiproliferative activity against human HEK293 cells assessed as reduction in cell viability incubated for 24 hrs by MTT assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1664178	Induction of apoptosis in human A549 cells assessed as live cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 95.5 %)	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1356048	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356021	Antiproliferative activity against human MDA-MB-231 cells measured after 48 hrs by MTT assay	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1739908	Antiproliferative activity against human MDA-MB-231 cells overexpressing STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay	2020	European journal of medicinal chemistry, Sep-01, Volume: 201	Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy.
AID379979	Cytotoxicity against human Col2 cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID400161	In vivo cytotoxicity against mouse P388 cells at upto 35 mg/kg
AID1356037	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID389438	Anticancer activity against human DU145 cells after 72 hrs 25 ug/ml by XTT assay	2008	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 18, Issue:20	Semisynthesis and antitumoral activity of 2-acetylfuranonaphthoquinone and other naphthoquinone derivatives from lapachol.
AID336960	Cytotoxicity against human Raji cells assessed as cell viability at 10 molar ratio
AID379977	Cytotoxicity against human BC1 cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID95651	Evaluated for cytotoxicity in the KB cell culture assay	1987	Journal of medicinal chemistry, Nov, Volume: 30, Issue:11	Antitumor agents. 89. Psychorubrin, a new cytotoxic naphthoquinone from Psychotria rubra and its structure-activity relationships.
AID702316	Activity of human recombinant cytochrome P450 reductase assessed as rate of superoxide generation measuring SOD-inhibitable reduction of succinoylated cytochrome c per 2 mU enzyme at 100 umol/ml by spectrophotometry in presence of catalase and DTPA (Rvb =	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1356058	Inhibition of STAT3 phosphorylation at Y705 in human MDA-MB-231 cells assessed as reduction in ratio of phosphorylated STAT3 to total STAT3 level after 4 hrs by HTRF assay	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1657063	Inhibition of human recombinant N-terminal His-tagged JAK2 (826 to 1132 residue) expressed in baculovirus expression system at 100 uM using Srctide as substrate by mobility shift assay relative to control	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1678194	Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of lung at 30 mg/kg, ip QD for 18 days relative to control
AID1657074	Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 0.5 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1657071	Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 2 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1678144	Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on body weight at 30 mg/kg, ip QD for 18 days relative to control
AID1856428	Inhibition of STAT3 phosphorylation at Ser727 residue in human AGS cells at 4 uM by Western blotting analysis
AID1708605	Inhibition of STAT3 phosphorylation in human MIA PaCa-2 cells 1 uM after 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1809334	Antiproliferative activity against human HUVEC cells assessed as inhibition of cell growth in measured after 72 hrs by MTT assay
AID1664184	Induction of ROS generation in human A549 cells at 2 uM measured after 24 hrs by DCFH-DA probe based flow cytometry (Rvb = 4.92 %)	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1657075	Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 1 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723866	Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NAC by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1356022	Antiproliferative activity against human K562 cells measured after 48 hrs by MTT assay	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1848424	Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of Cyclin D1 expression at 4 uM incubated for 22 to 24 hrs by western blot analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1723840	Inhibition glutathione synthesis in human MIA PaCa-2 cells at 1 to 2 uM measured after 2 to 4 hrs by GSH/GSSG-glo assay	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1723867	Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NAC by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1708609	Binding affinity to NQO1 in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID379980	Cytotoxicity against human KB cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1657076	Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 2 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1491229	Cytotoxicity against human MDA-MB-231 cells assessed as growth inhibition after 72 hrs by MTT assay	2017	European journal of medicinal chemistry, Sep-08, Volume: 137	Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID379981	Cytotoxicity against human multidrug resistant KB-V cells in presence of vinblastine	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1395463	Antiproliferative activity against human L02 cells after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1657077	Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 4 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723854	Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID379982	Cytotoxicity against human multidrug resistant KB-V cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1708599	Inhibition of STAT3 phosphorylation in human BxPC-3 cells at 5 uM after 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1657062	Inhibition of human recombinant N-terminal GST-tagged JAK1 (850 to 1154 residue) expressed in baculovirus expression system at 100 uM using JAK1 peptide as substrate by mobility shift assay relative to control	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723850	Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1848366	Inhibition of ATP production in human BXPC-3 cells incubated for 20 to 24 hrs by ATP assay kit method	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1491232	Selectivity ratio of IC50 for human HepG2 cells to IC50 for human MDA-MB-231 cells	2017	European journal of medicinal chemistry, Sep-08, Volume: 137	Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID1356050	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395462	Antiproliferative activity against human HepG2 cells after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1537817	Antimycobacterial activity against Mycobacterium tuberculosis H37Ra UAlRa incubated for 6 days by luminescence based assay	2019	MedChemComm, Sep-01, Volume: 10, Issue:9	Discovery of napabucasin derivatives for the treatment of tuberculosis.
AID1491231	Cytotoxicity against human A549 cells assessed as growth inhibition after 72 hrs by MTT assay	2017	European journal of medicinal chemistry, Sep-08, Volume: 137	Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID1699864	Antiproliferative activity against human MDA-MB-468 cells assessed as reduction in cell growth measured after 48 hrs by CCK8 assay	2020	Bioorganic & medicinal chemistry, 12-15, Volume: 28, Issue:24	Identification of novel STAT3 inhibitors bearing 2-acetyl-7-phenylamino benzofuran scaffold for antitumour study.
AID1723869	Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NQO1 inhibitor dicoumarol by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1395468	Antiproliferative activity against human HepG2 cells at 30 uM after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1356041	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356052	Induction of superoxide generation in human MDA-MB-231 cells at 5 umol/L measured after 24 hrs by DHE staining based flow cytometry	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1848422	Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 protein level at 4 uM incubated for 22 to 24 hrs by western blot analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1664170	Antiproliferative activity against human HT-29 cells assessed as reduction in cell viability measured after 48 hrs MTT assay	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1707375	Antiproliferative activity against human MDA-MB-231 cells harbouring STAT3 assessed as reduction in cell viability at upto 10 uM incubated for 72 hrs by CyQuant assay	2021	Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1	Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID336954	Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 500 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID1356049	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356056	Inhibition of STAT3 phosphorylation at Y705 in human MDA-MB-231 cells after 4 hrs by HTRF assay	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356060	Binding affinity to STAT3 in human MDA-MB-231 cells at 100 uM treated for 1 hr followed by thermolysin addition measured after 30 mins by DARTS-Western blot analysis	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395467	Antiproliferative activity against human HepG2 cells at 10 uM after 48 hrs by CCK-8 assay	2018	European journal of medicinal chemistry, May-10, Volume: 151	Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1657056	Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells at 1 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis relative to control	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID400160	Cytotoxicity against human KB cells
AID1856409	Antiproliferative activity against human MKN-45 cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay
AID380857	Cytotoxicity against human HaCaT cells assessed as LDH release at 2 uM	1999	Journal of natural products, Aug, Volume: 62, Issue:8	Potential antipsoriatic agents: lapacho compounds as potent inhibitors of HaCaT cell growth.
AID1586013	Antiproliferative activity against human U251 cells after 72 hrs by MTT assay	2019	European journal of medicinal chemistry, Jan-15, Volume: 162	A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1586022	Aqueous solubility of the compound in water at 2 mg after 24 hrs by HPLC analysis	2019	European journal of medicinal chemistry, Jan-15, Volume: 162	A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1848474	Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on liver at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1356027	Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1723871	Down regulation of PNPT1 expression in human PANC-1 cells at 3 times IC50 measured after 1 to 24 hrs by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID379986	Cytotoxicity against human M109 cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID379985	Cytotoxicity against human SK-N-SH cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1678195	Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of spleen at 30 mg/kg, ip QD for 18 days relative to control
AID1586015	Antiproliferative activity against human HT-29 cells after 72 hrs by MTT assay	2019	European journal of medicinal chemistry, Jan-15, Volume: 162	A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708610	Inhibition of STAT3 in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1708604	Protac activity at CRBN/STAT3 in human MIA PaCa-2 cells assessed as effect on STAT3 expression levels at 1 uM incubated for 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1678198	Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as increased numbers of necrotic cells at 30 mg/kg, ip QD for 18 days by H and E staining based analysis relative to
AID1356026	Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 8 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1708589	Reduction in NQO1 levels in human BxPC-3 cells at 2 uM incubated for 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1750418	Inhibition of cell stemness in human HCT116 cells assessed as morphological alterations at 5 uM after 10 days by microscopic analysis
AID1708681	Inhibition of colony formation in human BxPC-3 cells assessed as reduction in colony formation at 0.06 to 0.5 uM incubated for 16 hrs in presence of NQO1 inhibitor dicoumarol	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1664169	Antiproliferative activity against human MCF7 cells assessed as reduction in cell viability measured after 48 hrs MTT assay	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1356046	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356057	Effect on total STAT3 level in human MDA-MB-231 cells at 0.1 to 30 umol/L after 4 hrs by HTRF assay	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1856429	Inhibition of STAT3 phosphorylation at Tyr705 residue in human AGS cells at 4 uM by Western blotting analysis
AID1356030	Induction of apoptosis in human MDA-MB-231 cells assessed as early apoptotic cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis relative to control	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1708596	Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as decrease in STAT3 expression level at 5 uM after 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356036	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1856411	Antiproliferative activity against human MGC-803 cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay
AID1739910	Antiproliferative activity against human HepG2 cells overexpressed STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay	2020	European journal of medicinal chemistry, Sep-01, Volume: 201	Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy.
AID1586016	Antiproliferative activity against mouse CT26 cells after 72 hrs by MTT assay	2019	European journal of medicinal chemistry, Jan-15, Volume: 162	A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708578	Antiproliferative activity against human MIA PaCa-2 cells assessed as reduction in cell viability incubated for 3 days by MTT assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1678149	Antitumor activity against human BXPC-3 cells xenografted in nude BALB/c mouse assessed as inhibition of tumor growth at 30 mg/kg, ip QD for 18 days relative to control
AID1657067	Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1657066	Inhibition of human recombinant N-terminal His-tagged JAK3 (795 to 1124 residue) expressed in baculovirus infected Sf21 insect cells up to 100 uM using Srctide as substrate by mobility shift assay	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID336958	Cytotoxicity against human Raji cells assessed as cell viability at 500 molar ratio
AID1848477	Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on kidney at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1657060	Cytotoxicity against human MCF7 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1856407	Inhibition of human recombinant STAT3 (127 to 722 residues) transcriptional activity expressed in HEK293T cells in presence of IL-6 by Dual-luciferase reporter gene assay
AID702317	Cytotoxicity against human HaCaT cells assessed as LDH release at 2 uM after 4 hrs by UV method	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID702315	Induction of superoxide generation in human HaCaT cells at 50 uM after 30 min by flow cytometry (Rvb = 7.1 +/- 5.2 )	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1750412	Inhibition of cell stemness in human HCT116 cells assessed as inhibition of CD44+/CD133+ expression at 20 uM after 24 hrs by flow cytometry analysis
AID1356040	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1707392	Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA hSIE probe binding to STAT3 in human MDA-MB-468 cell nuclear extract at 0.5 to 5 uM incubated for 3 hrs by EMSA analysis	2021	Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1	Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID1848473	Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on heart at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1678196	Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of kidney at 30 mg/kg, ip QD for 18 days relative to control
AID1723848	Inhibition of colony formation in human MIA PaCa-2 cells at 0.6 uM measured after 7 to 9 days in presence of necroptosis inhibitor necrostatin-1 by crystal violet staining based assay	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1657072	Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 4 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723868	Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NQO1 inhibitor dicoumarol by proteomics analysis	2020	Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17	A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1664181	Induction of apoptosis in human A549 cells assessed as necrotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 0.54 %)	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1809332	Antiproliferative activity against human MDA-MB-231 cells assessed as inhibition of cell growth measured after 72 hrs by MTT assay
AID1708607	Binding affinity to PDI in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356045	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356044	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356025	Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 6 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1708680	Antiproliferative activity against ZFP91 knockdown human BxPC-3 cells assessed as reduction in cell viability incubated for 48 hrs by MTT assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID336959	Cytotoxicity against human Raji cells assessed as cell viability at 100 molar ratio
AID1356024	Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 4 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1739909	Antiproliferative activity against human MDA-MB-468 cells overexpressing STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay	2020	European journal of medicinal chemistry, Sep-01, Volume: 201	Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy.
AID379983	Cytotoxicity against human LNCaP cells	2000	Journal of natural products, Apr, Volume: 63, Issue:4	Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1707393	Inhibition of STAT3 phosphorylation at Y705 residues in human MDA-MB-468 whole cell lysate at 0.5 to 2 uM incubated for 2 hrs by immunoblotting analysis	2021	Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1	Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID1678193	Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of liver at 30 mg/kg, ip QD for 18 days relative to control
AID1848475	Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on spleen at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1856410	Antiproliferative activity against human AGS cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay
AID1809336	Resistant factor, ratio of IC50 for antiproliferative activity against drug-tolerant human MDA-MB-231 cells to IC50 for human MDA-MB-231 cells
AID1657061	Cytotoxicity against human A549 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1678192	Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of heart at 30 mg/kg, ip QD for 18 days relative to control
AID1707373	Antiproliferative activity against human MCF7 cells assessed as reduction in cell viability incubated for 72 hrs by CyQuant assay	2021	Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1	Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID702312	Activity in dicoumarol-treated human HaCaT cells assessed as superoxide generation by flow cytometry (Rvb = 407.59 +/- 68.7 )	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID336953	Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 1000 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID702313	Induction of superoxide generation in human HaCaT cells at 5 micomol/L after 18 hrs by flow cytometry (Rvb = 367.5 +/- 80.1 )	2012	Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16	Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID389437	Anticancer activity against human DU145 cells after 72 hrs by XTT assay	2008	Bioorganic & medicinal chemistry letters, Oct-15, Volume: 18, Issue:20	Semisynthesis and antitumoral activity of 2-acetylfuranonaphthoquinone and other naphthoquinone derivatives from lapachol.
AID1657059	Cytotoxicity against human MDA-MB-231 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1848476	Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on lung at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1848368	Anti-proliferative activity against human Capan-2 cells assessed as cell growth inhibition incubated for 72 hrs by MTS assay	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1708579	Antiproliferative activity against human BxPC-3 cells assessed as reduction in cell viability incubated for 3 days by MTT assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356023	Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 2 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356039	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1809331	Antiproliferative activity against human MCF7 cells assessed as inhibition of cell growth measured after 72 hrs by MTT assay
AID1848423	Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of c-Myc expression at 4 uM incubated for 22 to 24 hrs by western blot analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1856408	Inhibition of ATP production in human MKN-45 cells incubated for 20 to 24 hrs by ATP assay kit method
AID1708591	Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as effect on GSPT1 protein expression level at 2 uM incubated for 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1664173	Substrate activity at human NQO1 assessed as amount of NADH oxidation assessed per umol NQO1	2020	Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16	Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1708614	Protac activity at CRBN/ZFP91 in human BxPC-3 cells assessed as induction of ZF91 degradation at upto 3 uM incubated for 16 hrs by western blot analysis	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356043	Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1678201	Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as increase in apoptotic cells level at 30 mg/kg, ip QD for 18 days by TUNEL assay relative to control
AID1708593	Inhibition of IL-6 induced STAT3 transcriptional activity in human HEK293 cells expressing SIE-luc2P preincubated for overnight followed by IL-6 stimulation and measured after 24 hr by Bio-Glo luciferase reagent based microplate reader assay	2021	Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1848421	Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 phosphorylation at Ser 727 at 4 uM incubated for 22 to 24 hrs by western blot analysis	2022	Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22	Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1657070	Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 1 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)	2020	Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6	STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1491230	Cytotoxicity against human HepG2 cells assessed as growth inhibition after 72 hrs by MTT assay	2017	European journal of medicinal chemistry, Sep-08, Volume: 137	Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID336961	Displacement of [3H]TPA from TPA receptor in ICR mouse dorsal epidermis
AID1356033	Induction of apoptosis in human MDA-MB-231 cells assessed as late apoptotic cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis relative to control	2018	Journal of natural products, 07-27, Volume: 81, Issue:7	Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID336956	Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 10 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID1347411	qHTS to identify inhibitors of the type 1 interferon - major histocompatibility complex class I in skeletal muscle: primary screen against the NCATS Mechanism Interrogation Plate v5.0 (MIPE) Libary	2020	ACS chemical biology, 07-17, Volume: 15, Issue:7	High-Throughput Screening to Identify Inhibitors of the Type I Interferon-Major Histocompatibility Complex Class I Pathway in Skeletal Muscle.
AID1347412	qHTS assay to identify inhibitors of the type 1 interferon - major histocompatibility complex class I in skeletal muscle: Counter screen cell viability and HiBit confirmation	2020	ACS chemical biology, 07-17, Volume: 15, Issue:7	High-Throughput Screening to Identify Inhibitors of the Type I Interferon-Major Histocompatibility Complex Class I Pathway in Skeletal Muscle.
[information is prepared from bioassay data collected from National Library of Medicine (NLM), extracted Dec-2023]

Timeframe	Studies, This Drug (%)	All Drugs %
pre-1990	1 (1.32)	18.7374
1990's	2 (2.63)	18.2507
2000's	4 (5.26)	29.6817
2010's	25 (32.89)	24.3611
2020's	44 (57.89)	2.80
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Publication Type	This drug (%)	All Drugs (%)
Trials	11 (13.92%)	5.53%
Reviews	2 (2.53%)	6.00%
Case Studies	0 (0.00%)	4.05%
Observational	0 (0.00%)	0.25%
Other	66 (83.54%)	84.16%
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Substance	Relationship Strength	Studies	Trials	Classes	Roles
bupropion Bupropion: A propiophenone-derived antidepressant and antismoking agent that inhibits the uptake of DOPAMINE.. bupropion : An aromatic ketone that is propiophenone carrying a tert-butylamino group at position 2 and a chloro substituent at position 3 on the phenyl ring.	4.62	1	1	aromatic ketone; monochlorobenzenes; secondary amino compound	antidepressant; environmental contaminant; xenobiotic
melatonin [no description available]	2.6	1	0	acetamides; tryptamines	anticonvulsant; central nervous system depressant; geroprotector; hormone; human metabolite; immunological adjuvant; mouse metabolite; radical scavenger
anthralin Anthralin: An anthracene derivative that disrupts MITOCHONDRIA function and structure and is used for the treatment of DERMATOSES, especially PSORIASIS. It may cause FOLLICULITIS.. anthralin : An anthracene compound derived by the substitution of -OH groups for hydrogen at C-1 and C-8, and with an oxo group at C-9.	2.43	2	0	anthracenes	antipsoriatic
caffeine [no description available]	4.62	1	1	purine alkaloid; trimethylxanthine	adenosine A2A receptor antagonist; adenosine receptor antagonist; adjuvant; central nervous system stimulant; diuretic; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; EC 3.1.4.* (phosphoric diester hydrolase) inhibitor; environmental contaminant; food additive; fungal metabolite; geroprotector; human blood serum metabolite; mouse metabolite; mutagen; plant metabolite; psychotropic drug; ryanodine receptor agonist; xenobiotic
fluorouracil Fluorouracil: A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the THYMIDYLATE SYNTHETASE conversion of deoxyuridylic acid to thymidylic acid.. 5-fluorouracil : A nucleobase analogue that is uracil in which the hydrogen at position 5 is replaced by fluorine. It is an antineoplastic agent which acts as an antimetabolite - following conversion to the active deoxynucleotide, it inhibits DNA synthesis (by blocking the conversion of deoxyuridylic acid to thymidylic acid by the cellular enzyme thymidylate synthetase) and so slows tumour growth.	3.99	1	1	nucleobase analogue; organofluorine compound	antimetabolite; antineoplastic agent; environmental contaminant; immunosuppressive agent; radiosensitizing agent; xenobiotic
flurbiprofen Flurbiprofen: An anti-inflammatory analgesic and antipyretic of the phenylalkynoic acid series. It has been shown to reduce bone resorption in periodontal disease by inhibiting CARBONIC ANHYDRASE.. flurbiprofen : A monocarboxylic acid that is a 2-fluoro-[1,1'-biphenyl-4-yl] moiety linked to C-2 of propionic acid. A non-steroidal anti-inflammatory, analgesic and antipyretic, it is used as a pre-operative anti-miotic as well as orally for arthritis or dental pain.	4.62	1	1	fluorobiphenyl; monocarboxylic acid	antipyretic; EC 1.14.99.1 (prostaglandin-endoperoxide synthase) inhibitor; non-narcotic analgesic; non-steroidal anti-inflammatory drug
lapachol lapachol : A hydroxy-1,4-naphthoquinone that is 1,4-naphthoquinone substituted by hydroxy and 3-methylbut-2-en-1-yl groups at positions 2 and 3, respectively. It is a natural compound that exhibits antibacterial and anticancer properties, first isolated in 1882 from the bark of Tabebuia avellanedae.	8.13	5	0
beta-lapachone beta-lapachone: antineoplastic inhibitor of reverse transcriptase, DNA topoisomerase, and DNA polymerase. beta-lapachone : A benzochromenone that is 3,4-dihydro-2H-benzo[h]chromene-5,6-dione substituted by geminal methyl groups at position 2. Isolated from Tabebuia avellanedae, it exhibits antineoplastic and anti-inflammatory activities.	3.16	5	0	benzochromenone; orthoquinones	anti-inflammatory agent; antineoplastic agent; plant metabolite
vitamin k 3 Vitamin K 3: A synthetic naphthoquinone without the isoprenoid side chain and biological activity, but can be converted to active vitamin K2, menaquinone, after alkylation in vivo.	2.07	1	0	1,4-naphthoquinones; vitamin K	angiogenesis inhibitor; antineoplastic agent; EC 3.4.22.69 (SARS coronavirus main proteinase) inhibitor; human urinary metabolite; nutraceutical
midazolam Midazolam: A short-acting hypnotic-sedative drug with anxiolytic and amnestic properties. It is used in dentistry, cardiac surgery, endoscopic procedures, as preanesthetic medication, and as an adjunct to local anesthesia. The short duration and cardiorespiratory stability makes it useful in poor-risk, elderly, and cardiac patients. It is water-soluble at pH less than 4 and lipid-soluble at physiological pH.. midazolam : An imidazobenzodiazepine that is 4H-imidazo[1,5-a][1,4]benzodiazepine which is substituted by a methyl, 2-fluorophenyl and chloro groups at positions 1, 6 and 8, respectively.	4.62	1	1	imidazobenzodiazepine; monofluorobenzenes; organochlorine compound	anticonvulsant; antineoplastic agent; anxiolytic drug; apoptosis inducer; central nervous system depressant; GABAA receptor agonist; general anaesthetic; muscle relaxant; sedative
omeprazole Omeprazole: A 4-methoxy-3,5-dimethylpyridyl, 5-methoxybenzimidazole derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits an H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.. omeprazole : A racemate comprising equimolar amounts of (R)- and (S)-omeprazole.. 5-methoxy-2-{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl}-1H-benzimidazole : A member of the class of benzimidazoles that is 1H-benzimidazole which is substituted by a [4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl group at position 2 and a methoxy group at position 5.	4.62	1	1	aromatic ether; benzimidazoles; pyridines; sulfoxide
tert-butylhydroperoxide tert-Butylhydroperoxide: A direct-acting oxidative stress-inducing agent used to examine the effects of oxidant stress on Ca(2+)-dependent signal transduction in vascular endothelial cells. It is also used as a catalyst in polymerization reactions and to introduce peroxy groups into organic molecules.. tert-butyl hydroperoxide : An alkyl hydroperoxide in which the alkyl group is tert-butyl. It is widely used in a variety of oxidation processes.	2.25	1	0	alkyl hydroperoxide	antibacterial agent; oxidising agent
isoxazoles Isoxazoles: Azoles with an OXYGEN and a NITROGEN next to each other at the 1,2 positions, in contrast to OXAZOLES that have nitrogens at the 1,3 positions.. isoxazole : A monocyclic heteroarene with a structure consisting of a 5-membered ring containing three carbon atoms and an oxygen and nitrogen atom adjacent to each other. It is the parent of the class of isoxazoles.. isoxazoles : Oxazoles in which the N and O atoms are adjacent.	2.17	1	0	isoxazoles; mancude organic heteromonocyclic parent; monocyclic heteroarene
pyrazines Pyrazines: A heterocyclic aromatic organic compound with the chemical formula C4H4N2.. pyrazine : A diazine that is benzene in which the carbon atoms at positions 1 and 4 have been replaced by nitrogen atoms.	2.17	1	0	diazine; pyrazines	Daphnia magna metabolite
plumbagin plumbagin: a superoxide anion generator. plumbagin : A hydroxy-1,4-naphthoquinone that is 1,4-naphthoquinone in which the hydrogens at positions 2 and 5 are substituted by methyl and hydroxy groups, respectively.	2.15	1	0	hydroxy-1,4-naphthoquinone; phenols	anticoagulant; antineoplastic agent; immunological adjuvant; metabolite
alpha-aminopyridine alpha-aminopyridine: RN given refers to parent cpd; structure in Merck Index, 9th ed, #485. aminopyridine : Compounds containing a pyridine skeleton substituted by one or more amine groups.	2.17	1	0
deoxycytidine [no description available]	8.22	5	5	pyrimidine 2'-deoxyribonucleoside	Escherichia coli metabolite; human metabolite; mouse metabolite; Saccharomyces cerevisiae metabolite
buthionine sulfoximine Buthionine Sulfoximine: A synthetic amino acid that depletes glutathione by irreversibly inhibiting gamma-glutamylcysteine synthetase. Inhibition of this enzyme is a critical step in glutathione biosynthesis. It has been shown to inhibit the proliferative response in human T-lymphocytes and inhibit macrophage activation. (J Biol Chem 1995;270(33):1945-7). 2-amino-4-(S-butylsulfonimidoyl)butanoic acid : A non-proteinogenic alpha-amino acid that is homocysteine in which the thiol group carries an oxo, imino and butyl groups.. S-butyl-DL-homocysteine (S,R)-sulfoximine : A sulfoximide that is the sulfoximine derivative of an analogue of DL-methionine in which the S-methyl group is replaced by S-butyl.	2.25	1	0	diastereoisomeric mixture; homocysteines; non-proteinogenic alpha-amino acid; sulfoximide	EC 6.3.2.2 (glutamate--cysteine ligase) inhibitor; ferroptosis inducer
camptothecin NSC 100880: carboxylate (opened lactone) form of camptothecin; RN refers to (S)-isomer; structure given in first source	4.77	2	2	delta-lactone; pyranoindolizinoquinoline; quinoline alkaloid; tertiary alcohol	antineoplastic agent; EC 5.99.1.2 (DNA topoisomerase) inhibitor; genotoxin; plant metabolite
ozone Ozone: The unstable triatomic form of oxygen, O3. It is a powerful oxidant that is produced for various chemical and industrial uses. Its production is also catalyzed in the ATMOSPHERE by ULTRAVIOLET RAY irradiation of oxygen or other ozone precursors such as VOLATILE ORGANIC COMPOUNDS and NITROGEN OXIDES. About 90% of the ozone in the atmosphere exists in the stratosphere (STRATOSPHERIC OZONE).. ozone : An elemental molecule with formula O3. An explosive, pale blue gas (b.p. -112degreeC) that has a characteristic, pungent odour, it is continuously produced in the upper atmosphere by the action of solar ultraviolet radiation on atmospheric oxygen. It is an antimicrobial agent used in the production of bottled water, as well as in the treatment of meat, poultry and other foodstuffs.	2.04	1	0	elemental molecule; gas molecular entity; reactive oxygen species; triatomic oxygen	antiseptic drug; disinfectant; electrophilic reagent; greenhouse gas; mutagen; oxidising agent; tracer
phosphotyrosine Phosphotyrosine: An amino acid that occurs in endogenous proteins. Tyrosine phosphorylation and dephosphorylation plays a role in cellular signal transduction and possibly in cell growth control and carcinogenesis.. O(4)-phospho-L-tyrosine : A non-proteinogenic L-alpha-amino acid that is L-tyrosine phosphorylated at the phenolic hydroxy group.	2.25	1	0	L-tyrosine derivative; non-proteinogenic L-alpha-amino acid; O(4)-phosphotyrosine	Escherichia coli metabolite; immunogen
paclitaxel Taxus: Genus of coniferous yew trees or shrubs, several species of which have medicinal uses. Notable is the Pacific yew, Taxus brevifolia, which is used to make the anti-neoplastic drug taxol (PACLITAXEL).	8.7	7	6	taxane diterpenoid; tetracyclic diterpenoid	antineoplastic agent; human metabolite; metabolite; microtubule-stabilising agent
gemcitabine gemcitabine : A 2'-deoxycytidine having geminal fluoro substituents in the 2'-position. An inhibitor of ribonucleotide reductase, gemcitabine is used in the treatment of various carcinomas, particularly non-small cell lung cancer, pancreatic cancer, bladder cancer and breast cancer.	8.22	5	5	organofluorine compound; pyrimidine 2'-deoxyribonucleoside	antimetabolite; antineoplastic agent; antiviral drug; DNA synthesis inhibitor; EC 1.17.4.1 (ribonucleoside-diphosphate reductase) inhibitor; environmental contaminant; immunosuppressive agent; photosensitizing agent; prodrug; radiosensitizing agent; xenobiotic
irinotecan [no description available]	2.25	1	0	carbamate ester; delta-lactone; N-acylpiperidine; pyranoindolizinoquinoline; ring assembly; tertiary alcohol; tertiary amino compound	antineoplastic agent; apoptosis inducer; EC 5.99.1.2 (DNA topoisomerase) inhibitor; prodrug
alpha-lapachone alpha-lapachone: structure in first source	2.96	4	0	organic heterotricyclic compound; organooxygen compound
xyloidone [no description available]	2	1	0
naphtho(2,3-b)furan-4,9-dione naphtho(2,3-b)furan-4,9-dione: structure given in first source	2.52	2	0
gefitinib [no description available]	2.31	1	0	aromatic ether; monochlorobenzenes; monofluorobenzenes; morpholines; quinazolines; secondary amino compound; tertiary amino compound	antineoplastic agent; epidermal growth factor receptor antagonist
pomalidomide 3-aminophthalimidoglutarimide: structure in first source	2.31	1	0	aromatic amine; dicarboximide; isoindoles; piperidones	angiogenesis inhibitor; antineoplastic agent; immunomodulator
sorafenib [no description available]	3.99	1	1	(trifluoromethyl)benzenes; aromatic ether; monochlorobenzenes; phenylureas; pyridinecarboxamide	angiogenesis inhibitor; anticoronaviral agent; antineoplastic agent; EC 2.7.11.1 (non-specific serine/threonine protein kinase) inhibitor; ferroptosis inducer; tyrosine kinase inhibitor
benzofurans Benzofurans: Compounds that contain a BENZENE ring fused to a furan ring.	13.27	53	13
leupeptins Leupeptins: A group of acylated oligopeptides produced by Actinomycetes that function as protease inhibitors. They have been known to inhibit to varying degrees trypsin, plasmin, KALLIKREINS, papain and the cathepsins.	2.31	1	0
tretinoin Tretinoin: An important regulator of GENE EXPRESSION during growth and development, and in NEOPLASMS. Tretinoin, also known as retinoic acid and derived from maternal VITAMIN A, is essential for normal GROWTH; and EMBRYONIC DEVELOPMENT. An excess of tretinoin can be teratogenic. It is used in the treatment of PSORIASIS; ACNE VULGARIS; and several other SKIN DISEASES. It has also been approved for use in promyelocytic leukemia (LEUKEMIA, PROMYELOCYTIC, ACUTE).. retinoic acid : A retinoid consisting of 3,7-dimethylnona-2,4,6,8-tetraenoic acid substituted at position 9 by a 2,6,6-trimethylcyclohex-1-en-1-yl group (geometry of the four exocyclic double bonds is not specified).. all-trans-retinoic acid : A retinoic acid in which all four exocyclic double bonds have E- (trans-) geometry.	2.31	1	0	retinoic acid; vitamin A	anti-inflammatory agent; antineoplastic agent; antioxidant; AP-1 antagonist; human metabolite; keratolytic drug; retinoic acid receptor agonist; retinoid X receptor agonist; signalling molecule
resveratrol trans-resveratrol : A resveratrol in which the double bond has E configuration.	2.25	1	0	resveratrol	antioxidant; phytoalexin; plant metabolite; quorum sensing inhibitor; radical scavenger
benzyloxycarbonylleucyl-leucyl-leucine aldehyde benzyloxycarbonylleucyl-leucyl-leucine aldehyde: proteasome inhibitor. N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal : A tripeptide that is L-leucyl-L-leucyl-L-leucine in which the C-terminal carboxy group has been reduced to the corresponding aldehyde and the N-terminal amino group is protected as its benzyloxycarbonyl derivative.	2.31	1	0	amino aldehyde; carbamate ester; tripeptide	proteasome inhibitor
tamoxifen [no description available]	2.21	1	0	stilbenoid; tertiary amino compound	angiogenesis inhibitor; antineoplastic agent; bone density conservation agent; EC 1.2.3.1 (aldehyde oxidase) inhibitor; EC 2.7.11.13 (protein kinase C) inhibitor; estrogen antagonist; estrogen receptor antagonist; estrogen receptor modulator
stattic [no description available]	2.94	3	0	1-benzothiophenes; C-nitro compound; sulfone	antineoplastic agent; radiosensitizing agent; STAT3 inhibitor
dasatinib N-(2-chloro-6-methylphenyl)-2-((6-(4-(2-hydroxyethyl)piperazin-1-yl)-2-methylpyrimidin-4-yl)amino)-1,3-thiazole-5-carboxamide: a dasatinib prodrug; structure in first source. dasatinib (anhydrous) : An aminopyrimidine that is 2-methylpyrimidine which is substituted at position 4 by the primary amino group of 2-amino-1,3-thiazole-5-carboxylic acid and at position 6 by a 4-(2-hydroxyethyl)piperazin-1-yl group, and in which the carboxylic acid group has been formally condensed with 2-chloro-6-methylaniline to afford the corresponding amide. A multi-targeted kinase inhibitor, it is used, particularly as the monohydrate, for the treatment of chronic, accelerated, or myeloid or lymphoid blast phase chronic myeloid leukemia. Note that the name 'dasatinib' is used to refer to the monohydrate (USAN) as well as to anhydrous dasatinib (INN).	2.25	1	0	1,3-thiazoles; aminopyrimidine; monocarboxylic acid amide; N-(2-hydroxyethyl)piperazine; N-arylpiperazine; organochlorine compound; secondary amino compound; tertiary amino compound	anticoronaviral agent; antineoplastic agent; tyrosine kinase inhibitor
sb 258585 SB 258585: is a high affinity ligand at 5-HT(6) receptors; structure in first source	2.11	1	0	piperazines
naphthoquinones Naphthoquinones: Naphthalene rings which contain two ketone moieties in any position. They can be substituted in any position except at the ketone groups.	13.31	57	13
garcinol garcinol: from stem bark of Garcinia huillensis; has chemotherapeutic activity against gram-positive & gram-negative cocci, mycobacteria & fungi	2.25	1	0
sirolimus Sirolimus: A macrolide compound obtained from Streptomyces hygroscopicus that acts by selectively blocking the transcriptional activation of cytokines thereby inhibiting cytokine production. It is bioactive only when bound to IMMUNOPHILINS. Sirolimus is a potent immunosuppressant and possesses both antifungal and antineoplastic properties.. sirolimus : A macrolide lactam isolated from Streptomyces hygroscopicus consisting of a 29-membered ring containing 4 trans double bonds, three of which are conjugated. It is an antibiotic, immunosupressive and antineoplastic agent.	2.76	2	0	antibiotic antifungal drug; cyclic acetal; cyclic ketone; ether; macrolide lactam; organic heterotricyclic compound; secondary alcohol	antibacterial drug; anticoronaviral agent; antineoplastic agent; bacterial metabolite; geroprotector; immunosuppressive agent; mTOR inhibitor
guttiferone e guttiferone E: isolated from the fruits of Garcinia pyrifera collected in Malaysia; structure in first source	2.25	1	0
dextromethorphan Dextromethorphan: Methyl analog of DEXTRORPHAN that shows high affinity binding to several regions of the brain, including the medullary cough center. This compound is an NMDA receptor antagonist (RECEPTORS, N-METHYL-D-ASPARTATE) and acts as a non-competitive channel blocker. It is one of the widely used ANTITUSSIVES, and is also used to study the involvement of glutamate receptors in neurotoxicity.. dextromethorphan : A 6-methoxy-11-methyl-1,3,4,9,10,10a-hexahydro-2H-10,4a-(epiminoethano)phenanthrene in which the sterocenters at positions 4a, 10 and 10a have S-configuration. It is a prodrug of dextrorphan and used as an antitussive drug for suppressing cough.	4.62	1	1	6-methoxy-11-methyl-1,3,4,9,10,10a-hexahydro-2H-10,4a-(epiminoethano)phenanthrene	antitussive; environmental contaminant; neurotoxin; NMDA receptor antagonist; oneirogen; prodrug; xenobiotic
chlorhexidine Chlorhexidine: A disinfectant and topical anti-infective agent used also as mouthwash to prevent oral plaque.. chlorhexidine : A bisbiguanide compound with a structure consisting of two (p-chlorophenyl)guanide units linked by a hexamethylene bridge.	2.25	1	0	biguanides; monochlorobenzenes	antibacterial agent; antiinfective agent
sepantronium sepantronium: a survivin suppressant with antineoplastic activity. sepantronium : An organic cation that is 1-(2-methoxyethyl)-2-methyl-1H-naphtho[2,3-d]imidazole-4,9-dione in which the nitrogen at position 3 of the napthoimidazole moiety has been alkylated by a pyrazin-2-ylmethyl group.	2.21	1	0	organic cation
2-methylnaphtho(2,3-b)furan-4,9-dione [no description available]	2.4	2	0
erastin erastin: an antineoplastic agent; structure in first source. erastin : A member of the class of quinazolines that is quinazolin-4(3H)-one in which the hydrogens at positions 2 and 3 are replaced by 1-{4-[(4-chlorophenoxy)acetyl]piperazin-1-yl}ethyl and 2-ethoxyphenyl groups, respectively. It is an inhibitor of voltage-dependent anion-selective channels (VDAC2 and VDAC3) and a potent ferroptosis inducer.	2.25	1	0	aromatic ether; diether; monochlorobenzenes; N-acylpiperazine; N-alkylpiperazine; quinazolines; tertiary carboxamide	antineoplastic agent; ferroptosis inducer; voltage-dependent anion channel inhibitor
cytochrome c-t Cytochromes c: Cytochromes of the c type that are found in eukaryotic MITOCHONDRIA. They serve as redox intermediates that accept electrons from MITOCHONDRIAL ELECTRON TRANSPORT COMPLEX III and transfer them to MITOCHONDRIAL ELECTRON TRANSPORT COMPLEX IV.	2.02	1	0
navitoclax [no description available]	2.31	1	0	aryl sulfide; monochlorobenzenes; morpholines; N-sulfonylcarboxamide; organofluorine compound; piperazines; secondary amino compound; sulfone; tertiary amino compound	antineoplastic agent; apoptosis inducer; B-cell lymphoma 2 inhibitor
incb-018424 [no description available]	2.31	1	0	nitrile; pyrazoles; pyrrolopyrimidine	antineoplastic agent; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor
baricitinib [no description available]	2.25	1	0	azetidines; nitrile; pyrazoles; pyrrolopyrimidine; sulfonamide	anti-inflammatory agent; antirheumatic drug; antiviral agent; EC 2.7.10.2 (non-specific protein-tyrosine kinase) inhibitor; immunosuppressive agent
abemaciclib [no description available]	2.17	1	0
bp-1-102 BP-1-102: a STAT3 inhibitor; structure in first source	2.61	2	0
vx-970 berzosertib: an ATR kinase inhibitor	2.17	1	0	sulfonamide
thromboplastin Thromboplastin: Constituent composed of protein and phospholipid that is widely distributed in many tissues. It serves as a cofactor with factor VIIa to activate factor X in the extrinsic pathway of blood coagulation.	2.25	1	0
levoleucovorin Levoleucovorin: A folate analog consisting of the pharmacologically active isomer of LEUCOVORIN.. (6S)-5-formyltetrahydrofolic acid : The pharmacologically active (6S)-stereoisomer of 5-formyltetrahydrofolic acid.	4.77	2	2	5-formyltetrahydrofolic acid	antineoplastic agent; metabolite
leptin Leptin: A 16-kDa peptide hormone secreted from WHITE ADIPOCYTES. Leptin serves as a feedback signal from fat cells to the CENTRAL NERVOUS SYSTEM in regulation of food intake, energy balance, and fat storage.	2.31	1	0

Condition	Indicated	Relationship Strength	Studies	Trials
Palmoplantaris Pustulosis [description not available]	0	2.43	2	0
Psoriasis A common genetically determined, chronic, inflammatory skin disease characterized by rounded erythematous, dry, scaling patches. The lesions have a predilection for nails, scalp, genitalia, extensor surfaces, and the lumbosacral region. Accelerated epidermopoiesis is considered to be the fundamental pathologic feature in psoriasis.	0	2.43	2	0
Leukemia P388 An experimental lymphocytic leukemia originally induced in DBA/2 mice by painting with methylcholanthrene.	0	2	1	0
Benign Neoplasms [description not available]	0	4.94	7	0
Neoplasms New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.	1	6.94	7	0
Cancer of Pancreas [description not available]	0	13.04	33	25
Pancreatic Neoplasms Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).	1	15.04	33	25
Electrocardiogram QT Prolonged [description not available]	0	3.7	1	1
Colicky Pain [description not available]	0	3.7	1	1
Diarrhea An increased liquidity or decreased consistency of FECES, such as running stool. Fecal consistency is related to the ratio of water-holding capacity of insoluble solids to total water, rather than the amount of water present. Diarrhea is not hyperdefecation or increased fecal weight.	0	3.7	1	1
Long QT Syndrome A condition that is characterized by episodes of fainting (SYNCOPE) and varying degree of ventricular arrhythmia as indicated by the prolonged QT interval. The inherited forms are caused by mutation of genes encoding cardiac ion channel proteins. The two major forms are ROMANO-WARD SYNDROME and JERVELL-LANGE NIELSEN SYNDROME.	0	3.7	1	1
Abdominal Pain Sensation of discomfort, distress, or agony in the abdominal region.	0	3.7	1	1
Malignant Melanoma [description not available]	0	2.76	3	0
Melanoma A malignant neoplasm derived from cells that are capable of forming melanin, which may occur in the skin of any part of the body, in the eye, or, rarely, in the mucous membranes of the genitalia, anus, oral cavity, or other sites. It occurs mostly in adults and may originate de novo or from a pigmented nevus or malignant lentigo. Melanomas frequently metastasize widely, and the regional lymph nodes, liver, lungs, and brain are likely to be involved. The incidence of malignant skin melanomas is rising rapidly in all parts of the world. (Stedman, 25th ed; from Rook et al., Textbook of Dermatology, 4th ed, p2445)	0	2.76	3	0
Cancer of Lung [description not available]	0	3.38	5	0
Lung Neoplasms Tumors or cancer of the LUNG.	0	3.38	5	0
Cancer of Cervix [description not available]	0	4.21	9	0
Cancer of Endometrium [description not available]	0	4.21	9	0
Uterine Cervical Neoplasms Tumors or cancer of the UTERINE CERVIX.	0	4.21	9	0
Endometrial Neoplasms Tumors or cancer of ENDOMETRIUM, the mucous lining of the UTERUS. These neoplasms can be benign or malignant. Their classification and grading are based on the various cell types and the percent of undifferentiated cells.	0	4.21	9	0
Cancer of Colon [description not available]	0	6.08	4	4
Cancer of Rectum [description not available]	0	6.14	5	4
Colorectal Cancer [description not available]	0	8.23	11	8
Colonic Neoplasms Tumors or cancer of the COLON.	0	6.08	4	4
Rectal Neoplasms Tumors or cancer of the RECTUM.	0	6.14	5	4
Colorectal Neoplasms Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.	1	10.23	11	8
Hepatocellular Carcinoma [description not available]	0	4.72	4	1
Cancer of Liver [description not available]	0	4.93	5	1
Carcinoma, Hepatocellular A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.	1	6.72	4	1
Liver Neoplasms Tumors or cancer of the LIVER.	0	4.93	5	1
Carcinoma, Non-Small Cell Lung [description not available]	0	2.69	2	0
Carcinoma, Non-Small-Cell Lung A heterogeneous aggregate of at least three distinct histological types of lung cancer, including SQUAMOUS CELL CARCINOMA; ADENOCARCINOMA; and LARGE CELL CARCINOMA. They are dealt with collectively because of their shared treatment strategy.	1	4.69	2	0
Breast Cancer [description not available]	0	2.21	1	0
Breast Neoplasms Tumors or cancer of the human BREAST.	0	2.21	1	0
Adverse Drug Event [description not available]	0	4.6	2	2
Adrenal Cancer [description not available]	0	3.64	1	1
Drug-Related Side Effects and Adverse Reactions Disorders that result from the intended use of PHARMACEUTICAL PREPARATIONS. Included in this heading are a broad variety of chemically-induced adverse conditions due to toxicity, DRUG INTERACTIONS, and metabolic effects of pharmaceuticals.	0	4.6	2	2
Angiogenesis, Pathologic [description not available]	0	2.25	1	0
Blood Poisoning [description not available]	0	2.25	1	0
Innate Inflammatory Response [description not available]	0	2.63	2	0
Inflammation A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function.	0	2.63	2	0
Sepsis Systemic inflammatory response syndrome with a proven or suspected infectious etiology. When sepsis is associated with organ dysfunction distant from the site of infection, it is called severe sepsis. When sepsis is accompanied by HYPOTENSION despite adequate fluid infusion, it is called SEPTIC SHOCK.	0	2.25	1	0
Microsatellite Instability The occurrence of highly polymorphic mono- and dinucleotide MICROSATELLITE REPEATS in somatic cells. It is a form of genome instability associated with defects in DNA MISMATCH REPAIR.	0	4.04	2	1
Metastase [description not available]	0	5.95	4	2
Neoplasm Metastasis The transfer of a neoplasm from one organ or part of the body to another remote from the primary site.	0	5.95	4	2
Diffuse Large B-Cell Lymphoma [description not available]	0	2.25	1	0
Lymphoma, Large B-Cell, Diffuse Malignant lymphoma composed of large B lymphoid cells whose nuclear size can exceed normal macrophage nuclei, or more than twice the size of a normal lymphocyte. The pattern is predominantly diffuse. Most of these lymphomas represent the malignant counterpart of B-lymphocytes at midstage in the process of differentiation.	0	2.25	1	0
Demineralization, Tooth [description not available]	0	2.25	1	0
Wasting Disease [description not available]	0	2.31	1	0
Disease Models, Animal Naturally-occurring or experimentally-induced animal diseases with pathological processes analogous to human diseases.	0	3.53	2	0
Insulin Sensitivity [description not available]	0	2.31	1	0
Atrophy, Muscle [description not available]	0	2.31	1	0
Cachexia General ill health, malnutrition, and weight loss, usually associated with chronic disease.	0	2.31	1	0
Insulin Resistance Diminished effectiveness of INSULIN in lowering blood sugar levels: requiring the use of 200 units or more of insulin per day to prevent HYPERGLYCEMIA or KETOSIS.	0	2.31	1	0
Muscular Atrophy Derangement in size and number of muscle fibers occurring with aging, reduction in blood supply, or following immobilization, prolonged weightlessness, malnutrition, and particularly in denervation.	0	2.31	1	0
Bone Cancer [description not available]	0	2.93	3	0
Osteogenic Sarcoma [description not available]	0	2.61	2	0
Bone Neoplasms Tumors or cancer located in bone tissue or specific BONES.	0	2.93	3	0
Osteosarcoma A sarcoma originating in bone-forming cells, affecting the ends of long bones. It is the most common and most malignant of sarcomas of the bones, and occurs chiefly among 10- to 25-year-old youths. (From Stedman, 25th ed)	0	2.61	2	0
Epithelial Ovarian Cancer [description not available]	0	2.31	1	0
Cancer of Ovary [description not available]	0	2.31	1	0
Carcinoma, Ovarian Epithelial A malignant neoplasm that originates in cells on the surface EPITHELIUM of the ovary and is the most common form of ovarian cancer. There are five histologic subtypes: papillary serous, endometrioid, mucinous, clear cell, and transitional cell. Mutations in BRCA1, OPCML, PRKN, PIK3CA, AKT1, CTNNB1, RRAS2, and CDH1 genes are associated with this cancer.	0	2.31	1	0
Ovarian Neoplasms Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS.	0	2.31	1	0
Cancer of Prostate [description not available]	0	2.31	1	0
Prostatic Neoplasms Tumors or cancer of the PROSTATE.	0	2.31	1	0
Invasiveness, Neoplasm [description not available]	0	2.31	1	0
Adenocarcinoma, Basal Cell [description not available]	0	3.98	2	1
Cancer of Esophagus [description not available]	0	3.56	1	1
Cancer of Stomach [description not available]	0	3.97	2	1
Adenocarcinoma A malignant epithelial tumor with a glandular organization.	0	3.98	2	1
Esophageal Neoplasms Tumors or cancer of the ESOPHAGUS.	0	3.56	1	1
Stomach Neoplasms Tumors or cancer of the STOMACH.	0	3.97	2	1
Experimental Hepatoma [description not available]	0	2.21	1	0
Acute Brain Injuries [description not available]	0	2.21	1	0
Brain Injuries Acute and chronic (see also BRAIN INJURIES, CHRONIC) injuries to the brain, including the cerebral hemispheres, CEREBELLUM, and BRAIN STEM. Clinical manifestations depend on the nature of injury. Diffuse trauma to the brain is frequently associated with DIFFUSE AXONAL INJURY or COMA, POST-TRAUMATIC. Localized injuries may be associated with NEUROBEHAVIORAL MANIFESTATIONS; HEMIPARESIS, or other focal neurologic deficits.	0	2.21	1	0
Carcinoma, Ductal, Pancreatic [description not available]	0	12.75	25	25
Carcinoma, Pancreatic Ductal Carcinoma that arises from the PANCREATIC DUCTS. It accounts for the majority of cancers derived from the PANCREAS.	1	14.75	25	25
Carcinogenesis The origin, production or development of cancer through genotypic and phenotypic changes which upset the normal balance between cell proliferation and cell death. Carcinogenesis generally requires a constellation of steps, which may occur quickly or over a period of many years.	0	2.21	1	0
Carcinoma, Epidermoid [description not available]	0	2.21	1	0
Hypopharyngeal Cancer [description not available]	0	2.21	1	0
Carcinoma, Squamous Cell A carcinoma derived from stratified SQUAMOUS EPITHELIAL CELLS. It may also occur in sites where glandular or columnar epithelium is normally present. (From Stedman, 25th ed)	0	2.21	1	0
Hypopharyngeal Neoplasms Tumors or cancer of the HYPOPHARYNX.	0	2.21	1	0
Acute Myelogenous Leukemia [description not available]	0	2.21	1	0
Leukemia, Myeloid, Acute Clonal expansion of myeloid blasts in bone marrow, blood, and other tissue. Myeloid leukemias develop from changes in cells that normally produce NEUTROPHILS; BASOPHILS; EOSINOPHILS; and MONOCYTES.	0	2.21	1	0
Astrocytoma, Grade IV [description not available]	0	2.21	1	0
Glioblastoma A malignant form of astrocytoma histologically characterized by pleomorphism of cells, nuclear atypia, microhemorrhage, and necrosis. They may arise in any region of the central nervous system, with a predilection for the cerebral hemispheres, basal ganglia, and commissural pathways. Clinical presentation most frequently occurs in the fifth or sixth decade of life with focal neurologic signs or seizures.	1	4.21	1	0
Cancer of Skin [description not available]	0	2.02	1	0
Skin Neoplasms Tumors or cancer of the SKIN.	0	2.02	1	0

2-acetylfuranonaphthoquinone

Description

Cross-References

Synonyms (51)

Research Excerpts

Toxicity

Pharmacokinetics

Compound-Compound Interactions

Bioavailability

Dosage Studied

Protein Targets (5)

Potency Measurements

Inhibition Measurements

Activation Measurements

Other Measurements

Biological Processes (118)

Molecular Functions (36)

Ceullar Components (16)

Bioassays (197)

Research

Studies (76)

Market Indicators

Research Demand Index: 11.56

Study Types

2-acetylfuranonaphthoquinone

Description

Cross-References

Synonyms (51)

Research Excerpts

Toxicity

Pharmacokinetics

Compound-Compound Interactions

Bioavailability

Dosage Studied

Protein Targets (5)

Potency Measurements

Inhibition Measurements

Activation Measurements

Other Measurements

Biological Processes (118)

Molecular Functions (36)

Ceullar Components (16)

Bioassays (197)

Research

Studies (76)

Market Indicators

Research Demand Index: 11.56

Study Types

Related Drugs (58)

Related Conditions (88)