Page last updated: 2024-11-12

2-acetylfuranonaphthoquinone

Description

2-acetylfuranonaphthoquinone: has antineoplastic activity; structure in first source [Medical Subject Headings (MeSH), National Library of Medicine, extracted Dec-2023]

Cross-References

ID SourceID
PubMed CID10331844
CHEMBL ID64130
SCHEMBL ID1883845
MeSH IDM0496111

Synonyms (51)

Synonym
napabucasin
CHEMBL64130
2-acetylfuranonaphthoquinone
bbi608
bbi-608
2-acetylfuro-1,4-naphthoquinone
SCHEMBL1883845
bdbm50366597
83280-65-3
2-acetylnaphtho(2,3-b)furan-4,9-dione
napabucasin [usan:inn]
z1hhm49k7o ,
unii-z1hhm49k7o
S7977
CS-1747
HY-13919
2-acetyl-naphtho[2,3-b]furan-4,9-dione
2-acetyl-4h,9h-naphtho[2,3-b]furan-4,9-dione
DPHUWDIXHNQOSY-UHFFFAOYSA-N
naphtho(2,3-b)furan-4,9-dione, 2-acetyl-
napabucasin [jan]
napabucasin [usan]
2-acetylnaphtho[2,3-b]furan-4,9-dione
napabucasin [inn]
napabucasin [who-dd]
napabucasin (jan/usan/inn)
D10717
AC-32935
bbi 608
2-acetylbenzo[f][1]benzofuran-4,9-dione
fnq ,
napabucasin; bbi608
EX-A1314
AS-60519
AKOS027470201
napabucasin (bbi608)
DB12155
BCP07628
F17379
Z2027914355
mfcd28155270
EN300-207428
AMY27812
CCG-266871
Q27294876
gtpl11358
nsc788900
nsc-788900
2-acetyl naphtho2,3-bfuran-4,9-dione
nsc-816092
nsc816092

Research Excerpts

Toxicity

ExcerptReferenceRelevance
" No serious adverse events/deaths were reported."( Napabucasin Drug-Drug Interaction Potential, Safety, Tolerability, and Pharmacokinetics Following Oral Dosing in Healthy Adult Volunteers.
Brantley, SJ; Dai, X; Goulet, MT; Hard, ML; Hitron, M; Karol, MD; McLaughlin, CF, 2021
)
0.62
" Napabucasin was well-tolerated across the study (n = 70), and no serious adverse events or significant safety issues were reported when administered with or without food."( Effects of a reactive oxygen species generator, napabucasin (BBI608), on tolerability, safety, pharmacokinetics, and QT/QTc interval in healthy volunteers.
Horibuchi, Y; Iino, S; Kakuyama, H; Matsuki, S; Noda, N; Ogama, Y; Takagaki, T; Yodo, Y, 2021
)
0.62
" The most frequently reported adverse events were diarrhea (83."( A Phase I Study to Investigate the Safety, Tolerability and Pharmacokinetics of Napabucasin Combined with Sorafenib in Japanese Patients with Unresectable Hepatocellular Carcinoma.
Eguchi, Y; Iino, S; Kageyama, R; Morimoto, M; Nakamura, S; Okusaka, T, 2023
)
0.91

Pharmacokinetics

ExcerptReferenceRelevance
" The pharmacokinetic results for napabucasin were consistent with prior publications."( A Phase I Study to Investigate the Safety, Tolerability and Pharmacokinetics of Napabucasin Combined with Sorafenib in Japanese Patients with Unresectable Hepatocellular Carcinoma.
Eguchi, Y; Iino, S; Kageyama, R; Morimoto, M; Nakamura, S; Okusaka, T, 2023
)
0.91

Compound-Compound Interactions

ExcerptReferenceRelevance
"Napabucasin 240 mg BID in combination with FOLFIRI and bevacizumab was tolerated, with a manageable safety profile in Japanese patients with metastatic CRC."( Phase I study of napabucasin in combination with FOLFIRI + bevacizumab in Japanese patients with metastatic colorectal cancer.
Bando, H; Iino, S; Kadowaki, S; Kageyama, R; Kawazoe, A; Masuishi, T; Muro, K; Taniguchi, H; Yoshino, T, 2021
)
0.62

Bioavailability

ExcerptReferenceRelevance
" To improve its bioavailability and tumor accumulation, BBI608 is successfully encapsulated into redox-responsive PEGylated branched N-(2-hydroxypropyl) methacrylamide (HPMA)-deoxy cholic acid (DA) polymeric nanoparticles (BBI608-SS-NPs)."( A redox-responsive nanosystem to suppress chemoresistant lung cancer through targeting STAT3.
Chen, J; Chen, X; Feng, Q; Gu, Z; Huang, J; Li, J; Li, W; Li, X; Liu, X; Luo, K; Xiao, C; Xiao, K; Zheng, X, 2023
)
0.91

Dosage Studied

ExcerptRelevanceReference
" More severe adverse events required reduced or discontinued dosing of napabucasin or medication to reverse or manage symptoms."( Napabucasin: An Update on the First-in-Class Cancer Stemness Inhibitor.
Grothey, A; Hubbard, JM, 2017
)
0.46
[information is derived through text-mining from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Protein Targets (5)

Potency Measurements

ProteinTaxonomyMeasurementAverage (µ)Min (ref.)Avg (ref.)Max (ref.)Bioassay(s)
PPM1D proteinHomo sapiens (human)Potency0.52300.00529.466132.9993AID1347411
Interferon betaHomo sapiens (human)Potency0.52300.00339.158239.8107AID1347411
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Inhibition Measurements

ProteinTaxonomyMeasurementAverageMin (ref.)Avg (ref.)Max (ref.)Bioassay(s)
Retinal dehydrogenase 1Homo sapiens (human)IC50 (µMol)0.42530.02001.04766.7900AID1809349
Signal transducer and activator of transcription 3Homo sapiens (human)IC50 (µMol)2.10000.02304.13789.9800AID1657067; AID1708593
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Activation Measurements

ProteinTaxonomyMeasurementAverageMin (ref.)Avg (ref.)Max (ref.)Bioassay(s)
Signal transducer and activator of transcription 3Homo sapiens (human)EC50 (µMol)1.95001.90002.30003.0000AID1356056; AID1356058
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Other Measurements

ProteinTaxonomyMeasurementAverageMin (ref.)Avg (ref.)Max (ref.)Bioassay(s)
Signal transducer and activator of transcription 3Homo sapiens (human)DC502.10002.10002.10002.1000AID1708587
Protein cereblonHomo sapiens (human)DC502.10000.00800.48352.1000AID1708587
[prepared from compound, protein, and bioassay information from National Library of Medicine (NLM), extracted Dec-2023]

Biological Processes (118)

Processvia Protein(s)Taxonomy
retinoid metabolic processRetinal dehydrogenase 1Homo sapiens (human)
cellular aldehyde metabolic processRetinal dehydrogenase 1Homo sapiens (human)
gamma-aminobutyric acid biosynthetic processRetinal dehydrogenase 1Homo sapiens (human)
fructosamine catabolic processRetinal dehydrogenase 1Homo sapiens (human)
maintenance of lens transparencyRetinal dehydrogenase 1Homo sapiens (human)
retinol metabolic processRetinal dehydrogenase 1Homo sapiens (human)
cellular detoxification of aldehydeRetinal dehydrogenase 1Homo sapiens (human)
negative regulation of cold-induced thermogenesisRetinal dehydrogenase 1Homo sapiens (human)
cell surface receptor signaling pathway via JAK-STATInterferon betaHomo sapiens (human)
response to exogenous dsRNAInterferon betaHomo sapiens (human)
B cell activation involved in immune responseInterferon betaHomo sapiens (human)
cell surface receptor signaling pathwayInterferon betaHomo sapiens (human)
cell surface receptor signaling pathway via JAK-STATInterferon betaHomo sapiens (human)
response to virusInterferon betaHomo sapiens (human)
positive regulation of autophagyInterferon betaHomo sapiens (human)
cytokine-mediated signaling pathwayInterferon betaHomo sapiens (human)
natural killer cell activationInterferon betaHomo sapiens (human)
positive regulation of peptidyl-serine phosphorylation of STAT proteinInterferon betaHomo sapiens (human)
cellular response to interferon-betaInterferon betaHomo sapiens (human)
B cell proliferationInterferon betaHomo sapiens (human)
negative regulation of viral genome replicationInterferon betaHomo sapiens (human)
innate immune responseInterferon betaHomo sapiens (human)
positive regulation of innate immune responseInterferon betaHomo sapiens (human)
regulation of MHC class I biosynthetic processInterferon betaHomo sapiens (human)
negative regulation of T cell differentiationInterferon betaHomo sapiens (human)
positive regulation of transcription by RNA polymerase IIInterferon betaHomo sapiens (human)
defense response to virusInterferon betaHomo sapiens (human)
type I interferon-mediated signaling pathwayInterferon betaHomo sapiens (human)
neuron cellular homeostasisInterferon betaHomo sapiens (human)
cellular response to exogenous dsRNAInterferon betaHomo sapiens (human)
cellular response to virusInterferon betaHomo sapiens (human)
negative regulation of Lewy body formationInterferon betaHomo sapiens (human)
negative regulation of T-helper 2 cell cytokine productionInterferon betaHomo sapiens (human)
positive regulation of apoptotic signaling pathwayInterferon betaHomo sapiens (human)
response to exogenous dsRNAInterferon betaHomo sapiens (human)
B cell differentiationInterferon betaHomo sapiens (human)
natural killer cell activation involved in immune responseInterferon betaHomo sapiens (human)
adaptive immune responseInterferon betaHomo sapiens (human)
T cell activation involved in immune responseInterferon betaHomo sapiens (human)
humoral immune responseInterferon betaHomo sapiens (human)
positive regulation of vascular endothelial growth factor productionSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of transcription by RNA polymerase IISignal transducer and activator of transcription 3Homo sapiens (human)
temperature homeostasisSignal transducer and activator of transcription 3Homo sapiens (human)
eye photoreceptor cell differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
regulation of DNA-templated transcriptionSignal transducer and activator of transcription 3Homo sapiens (human)
regulation of transcription by RNA polymerase IISignal transducer and activator of transcription 3Homo sapiens (human)
protein import into nucleusSignal transducer and activator of transcription 3Homo sapiens (human)
inflammatory responseSignal transducer and activator of transcription 3Homo sapiens (human)
signal transductionSignal transducer and activator of transcription 3Homo sapiens (human)
transforming growth factor beta receptor signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
cell surface receptor signaling pathway via JAK-STATSignal transducer and activator of transcription 3Homo sapiens (human)
nervous system developmentSignal transducer and activator of transcription 3Homo sapiens (human)
cell population proliferationSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of cell population proliferationSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of autophagySignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of gene expressionSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of gene expressionSignal transducer and activator of transcription 3Homo sapiens (human)
phosphorylationSignal transducer and activator of transcription 3Homo sapiens (human)
cytokine-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
sexual reproductionSignal transducer and activator of transcription 3Homo sapiens (human)
cell differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of cell migrationSignal transducer and activator of transcription 3Homo sapiens (human)
intracellular receptor signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
response to estradiolSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of interleukin-1 beta productionSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of interleukin-10 productionSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of interleukin-6 productionSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of interleukin-8 productionSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of tumor necrosis factor productionSignal transducer and activator of transcription 3Homo sapiens (human)
cellular response to hormone stimulusSignal transducer and activator of transcription 3Homo sapiens (human)
leptin-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
somatic stem cell population maintenanceSignal transducer and activator of transcription 3Homo sapiens (human)
interleukin-15-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
interleukin-2-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
interleukin-9-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
interleukin-11-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
regulation of multicellular organism growthSignal transducer and activator of transcription 3Homo sapiens (human)
glucose homeostasisSignal transducer and activator of transcription 3Homo sapiens (human)
eating behaviorSignal transducer and activator of transcription 3Homo sapiens (human)
mRNA transcription by RNA polymerase IISignal transducer and activator of transcription 3Homo sapiens (human)
phosphatidylinositol 3-kinase/protein kinase B signal transductionSignal transducer and activator of transcription 3Homo sapiens (human)
cellular response to leptin stimulusSignal transducer and activator of transcription 3Homo sapiens (human)
response to leptinSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of erythrocyte differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of Notch signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of angiogenesisSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of glycolytic processSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of DNA-templated transcriptionSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of transcription by RNA polymerase IISignal transducer and activator of transcription 3Homo sapiens (human)
astrocyte differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of inflammatory responseSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of NF-kappaB transcription factor activitySignal transducer and activator of transcription 3Homo sapiens (human)
regulation of cell cycleSignal transducer and activator of transcription 3Homo sapiens (human)
radial glial cell differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
retinal rod cell differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
regulation of feeding behaviorSignal transducer and activator of transcription 3Homo sapiens (human)
growth hormone receptor signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
growth hormone receptor signaling pathway via JAK-STATSignal transducer and activator of transcription 3Homo sapiens (human)
interleukin-6-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
T-helper 17 type immune responseSignal transducer and activator of transcription 3Homo sapiens (human)
T-helper 17 cell lineage commitmentSignal transducer and activator of transcription 3Homo sapiens (human)
energy homeostasisSignal transducer and activator of transcription 3Homo sapiens (human)
cellular response to interleukin-17Signal transducer and activator of transcription 3Homo sapiens (human)
cell surface receptor signaling pathway via STATSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of inflammatory response to woundingSignal transducer and activator of transcription 3Homo sapiens (human)
interleukin-10-mediated signaling pathwaySignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of cytokine production involved in inflammatory responseSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of miRNA transcriptionSignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of metalloendopeptidase activitySignal transducer and activator of transcription 3Homo sapiens (human)
positive regulation of vascular endothelial cell proliferationSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of primary miRNA processingSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of stem cell differentiationSignal transducer and activator of transcription 3Homo sapiens (human)
negative regulation of neuron migrationSignal transducer and activator of transcription 3Homo sapiens (human)
regulation of cell population proliferationSignal transducer and activator of transcription 3Homo sapiens (human)
response to peptide hormoneSignal transducer and activator of transcription 3Homo sapiens (human)
defense responseSignal transducer and activator of transcription 3Homo sapiens (human)
protein ubiquitinationProtein cereblonHomo sapiens (human)
positive regulation of Wnt signaling pathwayProtein cereblonHomo sapiens (human)
negative regulation of protein-containing complex assemblyProtein cereblonHomo sapiens (human)
positive regulation of protein-containing complex assemblyProtein cereblonHomo sapiens (human)
negative regulation of monoatomic ion transmembrane transportProtein cereblonHomo sapiens (human)
locomotory exploration behaviorProtein cereblonHomo sapiens (human)
proteasome-mediated ubiquitin-dependent protein catabolic processProtein cereblonHomo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Molecular Functions (36)

Processvia Protein(s)Taxonomy
retinal dehydrogenase activityRetinal dehydrogenase 1Homo sapiens (human)
aldehyde dehydrogenase (NAD+) activityRetinal dehydrogenase 1Homo sapiens (human)
GTPase activator activityRetinal dehydrogenase 1Homo sapiens (human)
androgen bindingRetinal dehydrogenase 1Homo sapiens (human)
protein bindingRetinal dehydrogenase 1Homo sapiens (human)
aminobutyraldehyde dehydrogenase activityRetinal dehydrogenase 1Homo sapiens (human)
glyceraldehyde-3-phosphate dehydrogenase (NAD+) (non-phosphorylating) activityRetinal dehydrogenase 1Homo sapiens (human)
NAD bindingRetinal dehydrogenase 1Homo sapiens (human)
3-deoxyglucosone dehydrogenase activityRetinal dehydrogenase 1Homo sapiens (human)
benzaldehyde dehydrogenase (NAD+) activityRetinal dehydrogenase 1Homo sapiens (human)
cytokine activityInterferon betaHomo sapiens (human)
cytokine receptor bindingInterferon betaHomo sapiens (human)
type I interferon receptor bindingInterferon betaHomo sapiens (human)
protein bindingInterferon betaHomo sapiens (human)
chloramphenicol O-acetyltransferase activityInterferon betaHomo sapiens (human)
transcription cis-regulatory region bindingSignal transducer and activator of transcription 3Homo sapiens (human)
RNA polymerase II cis-regulatory region sequence-specific DNA bindingSignal transducer and activator of transcription 3Homo sapiens (human)
DNA-binding transcription factor activity, RNA polymerase II-specificSignal transducer and activator of transcription 3Homo sapiens (human)
DNA-binding transcription activator activity, RNA polymerase II-specificSignal transducer and activator of transcription 3Homo sapiens (human)
DNA bindingSignal transducer and activator of transcription 3Homo sapiens (human)
DNA-binding transcription factor activitySignal transducer and activator of transcription 3Homo sapiens (human)
nuclear receptor activitySignal transducer and activator of transcription 3Homo sapiens (human)
signaling receptor bindingSignal transducer and activator of transcription 3Homo sapiens (human)
protein bindingSignal transducer and activator of transcription 3Homo sapiens (human)
protein kinase bindingSignal transducer and activator of transcription 3Homo sapiens (human)
protein phosphatase bindingSignal transducer and activator of transcription 3Homo sapiens (human)
chromatin DNA bindingSignal transducer and activator of transcription 3Homo sapiens (human)
signaling adaptor activitySignal transducer and activator of transcription 3Homo sapiens (human)
identical protein bindingSignal transducer and activator of transcription 3Homo sapiens (human)
protein homodimerization activitySignal transducer and activator of transcription 3Homo sapiens (human)
protein dimerization activitySignal transducer and activator of transcription 3Homo sapiens (human)
RNA polymerase II-specific DNA-binding transcription factor bindingSignal transducer and activator of transcription 3Homo sapiens (human)
primary miRNA bindingSignal transducer and activator of transcription 3Homo sapiens (human)
lncRNA bindingSignal transducer and activator of transcription 3Homo sapiens (human)
DNA-binding transcription factor bindingSignal transducer and activator of transcription 3Homo sapiens (human)
RNA sequestering activitySignal transducer and activator of transcription 3Homo sapiens (human)
protein bindingProtein cereblonHomo sapiens (human)
transmembrane transporter bindingProtein cereblonHomo sapiens (human)
metal ion bindingProtein cereblonHomo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Ceullar Components (16)

Processvia Protein(s)Taxonomy
cytoplasmRetinal dehydrogenase 1Homo sapiens (human)
cytosolRetinal dehydrogenase 1Homo sapiens (human)
axonRetinal dehydrogenase 1Homo sapiens (human)
synapseRetinal dehydrogenase 1Homo sapiens (human)
extracellular exosomeRetinal dehydrogenase 1Homo sapiens (human)
extracellular spaceInterferon betaHomo sapiens (human)
extracellular regionInterferon betaHomo sapiens (human)
nucleusSignal transducer and activator of transcription 3Homo sapiens (human)
nucleusSignal transducer and activator of transcription 3Homo sapiens (human)
nucleoplasmSignal transducer and activator of transcription 3Homo sapiens (human)
cytoplasmSignal transducer and activator of transcription 3Homo sapiens (human)
cytosolSignal transducer and activator of transcription 3Homo sapiens (human)
plasma membraneSignal transducer and activator of transcription 3Homo sapiens (human)
RNA polymerase II transcription regulator complexSignal transducer and activator of transcription 3Homo sapiens (human)
chromatinSignal transducer and activator of transcription 3Homo sapiens (human)
transcription regulator complexSignal transducer and activator of transcription 3Homo sapiens (human)
cytoplasmSignal transducer and activator of transcription 3Homo sapiens (human)
nucleusProtein cereblonHomo sapiens (human)
cytoplasmProtein cereblonHomo sapiens (human)
cytosolProtein cereblonHomo sapiens (human)
membraneProtein cereblonHomo sapiens (human)
perinuclear region of cytoplasmProtein cereblonHomo sapiens (human)
Cul4A-RING E3 ubiquitin ligase complexProtein cereblonHomo sapiens (human)
[Information is prepared from geneontology information from the June-17-2024 release]

Bioassays (197)

Assay IDTitleYearJournalArticle
AID1664179Induction of apoptosis in human A549 cells assessed as early apoptotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 0.25 %)2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1395465Antiproliferative activity against human HepG2 cells at 1 uM after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID95524Effective cytotoxic dose against KB cells was evaluated1998Bioorganic & medicinal chemistry letters, Oct-06, Volume: 8, Issue:19
Synthesis and cytotoxicity of acetyl-4H,9H-naphtho[2,3-b]thiophene-4,9-diones.
AID1356051Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1664180Induction of apoptosis in human A549 cells assessed as late apoptotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 3.70 %)2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID336955Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 100 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID1657068Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 0.5 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1491233Selectivity ratio of IC50 for human A549 cells to IC50 for human MDA-MB-231 cells2017European journal of medicinal chemistry, Sep-08, Volume: 137Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID1657058Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation incubated for 2 hrs by Western blot analysis2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1809349Inhibition of ALDH1A1 in human drug-tolerant MDA-MB-231/lapatinib cells assessed as after 24 hrs
AID1395464Selectivity index, ratio of IC50 for human L02 cells to IC50 for human HepG2 cells2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1664168Antiproliferative activity against human MDA-MB-231 cells assessed as reduction in cell viability measured after 48 hrs MTT assay2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1664171Antiproliferative activity against human A549 cells assessed as reduction in cell viability measured after 48 hrs MTT assay2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID702314Activity of human recombinant NQO-1 assessed as rate of superoxide generation measuring SOD-inhibitable reduction of succinoylated cytochrome c per unit enzyme at 25 umol/ml by spectrophotometry in presence of catalase and DTPA (Rvb = 0.2 +/- 0.1 micomol/2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1723870Down regulation of LRPPRC expression in human PANC-1 cells at 3 times IC50 measured after 1 to 24 hrs by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1678186Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as inhibition of tumor growth at 30 mg/kg, ip QD for 18 days relative to control
AID1848367Anti-proliferative activity against human BXPC-3 cells assessed as cell growth inhibition incubated for 72 hrs by MTS assay2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID379984Cytotoxicity against human SW626 cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1848457Antitumor activity against human BXPC-3 cells xenografted BALB/c mouse model assessed as tumor growth inhibition at 30 mg/kg,po administrated once daily for 8 weeks2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1848467Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as body weight change at 30 mg/kg,po administrated once daily for 8 weeks2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1664172Cytotoxicity against human MCF10A cells assessed as reduction in cell viability measured after 48 hrs MTT assay2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1678151Toxicity in nude BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on body weight level at 30 mg/kg, ip QD for 18 days relative to control
AID1809333Antiproliferative activity against human drug tolerant MDA-MB-231/lapatinib cells assessed as inhibition of cell growth in measured after 72 hrs by MTT assay
AID379978Cytotoxicity against human Lo1 cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1356059Binding affinity to STAT3 in human MDA-MB-231 cells at 100 uM measured after 1 hr by DARTS-Western blot analysis2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395469Antiproliferative activity against human HepG2 cells at 100 uM after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1848420Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 phosphorylation at Tyr 705 at 4 uM incubated for 22 to 24 hrs by western blot analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1356042Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356053Induction of superoxide generation in human MDA-MB-231 cells at 5 umol/L measured after 24 hrs in presence of NQO1 inhibitor dicoumarol by DHE staining based flow cytometry2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID702318Antihyperproliferative activity against human HaCaT cells after 48 hrs by phase contrast microscopy2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1723838Induction of reactive oxygen species in human MIA PaCa-2 cells assessed as reduction in GSH to GSSG ratio at 1 to 2 uM measured after 2 to 4 hrs by GSH/GSSG-glo assay2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1586017Antiproliferative activity against human PC3 cells after 72 hrs by MTT assay2019European journal of medicinal chemistry, Jan-15, Volume: 162A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708683Antiproliferative activity against human BxPC-3 cells harboring ZFP91siRNA assessed as reduction in cell viability incubated for 48 hrs by MTT assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1718923Anti-CSC activity in patient with pSTAT3-positive tumors assessed as overall survival time at 480 mg, po administered bid with interval of 12 hrs2020Journal of medicinal chemistry, 12-24, Volume: 63, Issue:24
Cancer Stem Cell (CSC) Inhibitors in Oncology-A Promise for a Better Therapeutic Outcome: State of the Art and Future Perspectives.
AID1657069Effect on total STAT3 level in IL-6 induced human MCF7 cells at 0.5 to 4 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID336957Cytotoxicity against human Raji cells assessed as cell viability at 1000 molar ratio
AID380856Antiproliferative activity against human HaCaT cells1999Journal of natural products, Aug, Volume: 62, Issue:8
Potential antipsoriatic agents: lapacho compounds as potent inhibitors of HaCaT cell growth.
AID1356047Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1586014Antiproliferative activity against human HepG2 cells after 72 hrs by MTT assay2019European journal of medicinal chemistry, Jan-15, Volume: 162A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708587Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as decrease in STAT3 expression level after 12 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356038Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356055Induction of superoxide generation in human K562 cells at 5 umol/L measured after 24 hrs in presence of NQO1 inhibitor dicoumarol by DHE staining based flow cytometry2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395466Antiproliferative activity against human HepG2 cells at 3 uM after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1708594Antiproliferative activity against human HEK293 cells assessed as reduction in cell viability incubated for 24 hrs by MTT assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1664178Induction of apoptosis in human A549 cells assessed as live cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 95.5 %)2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1356048Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356021Antiproliferative activity against human MDA-MB-231 cells measured after 48 hrs by MTT assay2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1739908Antiproliferative activity against human MDA-MB-231 cells overexpressing STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay2020European journal of medicinal chemistry, Sep-01, Volume: 201Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy.
AID379979Cytotoxicity against human Col2 cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID400161In vivo cytotoxicity against mouse P388 cells at upto 35 mg/kg
AID1356037Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID389438Anticancer activity against human DU145 cells after 72 hrs 25 ug/ml by XTT assay2008Bioorganic & medicinal chemistry letters, Oct-15, Volume: 18, Issue:20
Semisynthesis and antitumoral activity of 2-acetylfuranonaphthoquinone and other naphthoquinone derivatives from lapachol.
AID336960Cytotoxicity against human Raji cells assessed as cell viability at 10 molar ratio
AID379977Cytotoxicity against human BC1 cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID95651Evaluated for cytotoxicity in the KB cell culture assay1987Journal of medicinal chemistry, Nov, Volume: 30, Issue:11
Antitumor agents. 89. Psychorubrin, a new cytotoxic naphthoquinone from Psychotria rubra and its structure-activity relationships.
AID702316Activity of human recombinant cytochrome P450 reductase assessed as rate of superoxide generation measuring SOD-inhibitable reduction of succinoylated cytochrome c per 2 mU enzyme at 100 umol/ml by spectrophotometry in presence of catalase and DTPA (Rvb =2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1356058Inhibition of STAT3 phosphorylation at Y705 in human MDA-MB-231 cells assessed as reduction in ratio of phosphorylated STAT3 to total STAT3 level after 4 hrs by HTRF assay2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1657063Inhibition of human recombinant N-terminal His-tagged JAK2 (826 to 1132 residue) expressed in baculovirus expression system at 100 uM using Srctide as substrate by mobility shift assay relative to control2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1678194Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of lung at 30 mg/kg, ip QD for 18 days relative to control
AID1657074Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 0.5 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1657071Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 2 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1678144Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on body weight at 30 mg/kg, ip QD for 18 days relative to control
AID1856428Inhibition of STAT3 phosphorylation at Ser727 residue in human AGS cells at 4 uM by Western blotting analysis
AID1708605Inhibition of STAT3 phosphorylation in human MIA PaCa-2 cells 1 uM after 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1809334Antiproliferative activity against human HUVEC cells assessed as inhibition of cell growth in measured after 72 hrs by MTT assay
AID1664184Induction of ROS generation in human A549 cells at 2 uM measured after 24 hrs by DCFH-DA probe based flow cytometry (Rvb = 4.92 %)2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1657075Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 1 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723866Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NAC by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1356022Antiproliferative activity against human K562 cells measured after 48 hrs by MTT assay2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1848424Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of Cyclin D1 expression at 4 uM incubated for 22 to 24 hrs by western blot analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1723840Inhibition glutathione synthesis in human MIA PaCa-2 cells at 1 to 2 uM measured after 2 to 4 hrs by GSH/GSSG-glo assay2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1723867Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NAC by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1708609Binding affinity to NQO1 in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID379980Cytotoxicity against human KB cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1657076Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 2 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1491229Cytotoxicity against human MDA-MB-231 cells assessed as growth inhibition after 72 hrs by MTT assay2017European journal of medicinal chemistry, Sep-08, Volume: 137Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID379981Cytotoxicity against human multidrug resistant KB-V cells in presence of vinblastine2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1395463Antiproliferative activity against human L02 cells after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1657077Inhibition of JAK/STAT signaling in human MDA-MB-231 cells assessed as decrease in STAT3 phosphorylation by measuring phosphorylated intensity level at 4 uM incubated for 2 hrs by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723854Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID379982Cytotoxicity against human multidrug resistant KB-V cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1708599Inhibition of STAT3 phosphorylation in human BxPC-3 cells at 5 uM after 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1657062Inhibition of human recombinant N-terminal GST-tagged JAK1 (850 to 1154 residue) expressed in baculovirus expression system at 100 uM using JAK1 peptide as substrate by mobility shift assay relative to control2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723850Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1848366Inhibition of ATP production in human BXPC-3 cells incubated for 20 to 24 hrs by ATP assay kit method2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1491232Selectivity ratio of IC50 for human HepG2 cells to IC50 for human MDA-MB-231 cells2017European journal of medicinal chemistry, Sep-08, Volume: 137Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID1356050Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395462Antiproliferative activity against human HepG2 cells after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1537817Antimycobacterial activity against Mycobacterium tuberculosis H37Ra UAlRa incubated for 6 days by luminescence based assay2019MedChemComm, Sep-01, Volume: 10, Issue:9
Discovery of napabucasin derivatives for the treatment of tuberculosis.
AID1491231Cytotoxicity against human A549 cells assessed as growth inhibition after 72 hrs by MTT assay2017European journal of medicinal chemistry, Sep-08, Volume: 137Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID1699864Antiproliferative activity against human MDA-MB-468 cells assessed as reduction in cell growth measured after 48 hrs by CCK8 assay2020Bioorganic & medicinal chemistry, 12-15, Volume: 28, Issue:24
Identification of novel STAT3 inhibitors bearing 2-acetyl-7-phenylamino benzofuran scaffold for antitumour study.
AID1723869Down regulation of PNPT1 expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NQO1 inhibitor dicoumarol by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1395468Antiproliferative activity against human HepG2 cells at 30 uM after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1356041Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356052Induction of superoxide generation in human MDA-MB-231 cells at 5 umol/L measured after 24 hrs by DHE staining based flow cytometry2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1848422Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 protein level at 4 uM incubated for 22 to 24 hrs by western blot analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1664170Antiproliferative activity against human HT-29 cells assessed as reduction in cell viability measured after 48 hrs MTT assay2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1707375Antiproliferative activity against human MDA-MB-231 cells harbouring STAT3 assessed as reduction in cell viability at upto 10 uM incubated for 72 hrs by CyQuant assay2021Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID336954Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 500 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID1356049Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 30 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356056Inhibition of STAT3 phosphorylation at Y705 in human MDA-MB-231 cells after 4 hrs by HTRF assay2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356060Binding affinity to STAT3 in human MDA-MB-231 cells at 100 uM treated for 1 hr followed by thermolysin addition measured after 30 mins by DARTS-Western blot analysis2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1395467Antiproliferative activity against human HepG2 cells at 10 uM after 48 hrs by CCK-8 assay2018European journal of medicinal chemistry, May-10, Volume: 151Design, synthesis and activity of BBI608 derivatives targeting on stem cells.
AID1657056Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells at 1 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis relative to control2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID400160Cytotoxicity against human KB cells
AID1856409Antiproliferative activity against human MKN-45 cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay
AID380857Cytotoxicity against human HaCaT cells assessed as LDH release at 2 uM1999Journal of natural products, Aug, Volume: 62, Issue:8
Potential antipsoriatic agents: lapacho compounds as potent inhibitors of HaCaT cell growth.
AID1586013Antiproliferative activity against human U251 cells after 72 hrs by MTT assay2019European journal of medicinal chemistry, Jan-15, Volume: 162A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1586022Aqueous solubility of the compound in water at 2 mg after 24 hrs by HPLC analysis2019European journal of medicinal chemistry, Jan-15, Volume: 162A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1848474Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on liver at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1356027Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1723871Down regulation of PNPT1 expression in human PANC-1 cells at 3 times IC50 measured after 1 to 24 hrs by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID379986Cytotoxicity against human M109 cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID379985Cytotoxicity against human SK-N-SH cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1678195Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of spleen at 30 mg/kg, ip QD for 18 days relative to control
AID1586015Antiproliferative activity against human HT-29 cells after 72 hrs by MTT assay2019European journal of medicinal chemistry, Jan-15, Volume: 162A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708610Inhibition of STAT3 in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1708604Protac activity at CRBN/STAT3 in human MIA PaCa-2 cells assessed as effect on STAT3 expression levels at 1 uM incubated for 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1678198Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as increased numbers of necrotic cells at 30 mg/kg, ip QD for 18 days by H and E staining based analysis relative to
AID1356026Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 8 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1708589Reduction in NQO1 levels in human BxPC-3 cells at 2 uM incubated for 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1750418Inhibition of cell stemness in human HCT116 cells assessed as morphological alterations at 5 uM after 10 days by microscopic analysis
AID1708681Inhibition of colony formation in human BxPC-3 cells assessed as reduction in colony formation at 0.06 to 0.5 uM incubated for 16 hrs in presence of NQO1 inhibitor dicoumarol2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1664169Antiproliferative activity against human MCF7 cells assessed as reduction in cell viability measured after 48 hrs MTT assay2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1356046Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at S phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 12%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356057Effect on total STAT3 level in human MDA-MB-231 cells at 0.1 to 30 umol/L after 4 hrs by HTRF assay2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1856429Inhibition of STAT3 phosphorylation at Tyr705 residue in human AGS cells at 4 uM by Western blotting analysis
AID1356030Induction of apoptosis in human MDA-MB-231 cells assessed as early apoptotic cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis relative to control2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1708596Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as decrease in STAT3 expression level at 5 uM after 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356036Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1856411Antiproliferative activity against human MGC-803 cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay
AID1739910Antiproliferative activity against human HepG2 cells overexpressed STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay2020European journal of medicinal chemistry, Sep-01, Volume: 201Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy.
AID1586016Antiproliferative activity against mouse CT26 cells after 72 hrs by MTT assay2019European journal of medicinal chemistry, Jan-15, Volume: 162A novel series of napabucasin derivatives as orally active inhibitors of signal transducer and activator of transcription 3 (STAT3).
AID1708578Antiproliferative activity against human MIA PaCa-2 cells assessed as reduction in cell viability incubated for 3 days by MTT assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1678149Antitumor activity against human BXPC-3 cells xenografted in nude BALB/c mouse assessed as inhibition of tumor growth at 30 mg/kg, ip QD for 18 days relative to control
AID1657067Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1657066Inhibition of human recombinant N-terminal His-tagged JAK3 (795 to 1124 residue) expressed in baculovirus infected Sf21 insect cells up to 100 uM using Srctide as substrate by mobility shift assay2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID336958Cytotoxicity against human Raji cells assessed as cell viability at 500 molar ratio
AID1848477Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on kidney at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1657060Cytotoxicity against human MCF7 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1856407Inhibition of human recombinant STAT3 (127 to 722 residues) transcriptional activity expressed in HEK293T cells in presence of IL-6 by Dual-luciferase reporter gene assay
AID702317Cytotoxicity against human HaCaT cells assessed as LDH release at 2 uM after 4 hrs by UV method2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID702315Induction of superoxide generation in human HaCaT cells at 50 uM after 30 min by flow cytometry (Rvb = 7.1 +/- 5.2 )2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID1750412Inhibition of cell stemness in human HCT116 cells assessed as inhibition of CD44+/CD133+ expression at 20 uM after 24 hrs by flow cytometry analysis
AID1356040Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1707392Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA hSIE probe binding to STAT3 in human MDA-MB-468 cell nuclear extract at 0.5 to 5 uM incubated for 3 hrs by EMSA analysis2021Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID1848473Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on heart at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1678196Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of kidney at 30 mg/kg, ip QD for 18 days relative to control
AID1723848Inhibition of colony formation in human MIA PaCa-2 cells at 0.6 uM measured after 7 to 9 days in presence of necroptosis inhibitor necrostatin-1 by crystal violet staining based assay2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1657072Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 4 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1723868Down regulation of LRPPRC expression in human MIA PaCa-2 cells at 3 times IC50 measured after 4 hrs in presence of NQO1 inhibitor dicoumarol by proteomics analysis2020Journal of medicinal chemistry, 09-10, Volume: 63, Issue:17
A Novel Redox Modulator Induces a GPX4-Mediated Cell Death That Is Dependent on Iron and Reactive Oxygen Species.
AID1664181Induction of apoptosis in human A549 cells assessed as necrotic cells at 2 uM measured after 24 hrs by annexinV-FITC/propidium iodide staining based flow cytometry (Rvb = 0.54 %)2020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1809332Antiproliferative activity against human MDA-MB-231 cells assessed as inhibition of cell growth measured after 72 hrs by MTT assay
AID1708607Binding affinity to PDI in human BxPC-3 cells assessed as thermal stability by measuring shift in melting temperature at 100 uM measured after 1 hr by cellular thermal shift assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356045Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G1 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 62%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356044Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at sub-G0 phase at 10 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 3%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356025Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 6 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1708680Antiproliferative activity against ZFP91 knockdown human BxPC-3 cells assessed as reduction in cell viability incubated for 48 hrs by MTT assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID336959Cytotoxicity against human Raji cells assessed as cell viability at 100 molar ratio
AID1356024Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 4 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1739909Antiproliferative activity against human MDA-MB-468 cells overexpressing STAT3 assessed as reduction in cell growth incubated for 48 hrs by CCK-8 assay2020European journal of medicinal chemistry, Sep-01, Volume: 201Design, synthesis and biological evaluation of novel potent STAT3 inhibitors based on BBI608 for cancer therapy.
AID379983Cytotoxicity against human LNCaP cells2000Journal of natural products, Apr, Volume: 63, Issue:4
Cytotoxic constituents of the roots of Ekmanianthe longiflora.
AID1707393Inhibition of STAT3 phosphorylation at Y705 residues in human MDA-MB-468 whole cell lysate at 0.5 to 2 uM incubated for 2 hrs by immunoblotting analysis2021Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID1678193Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of liver at 30 mg/kg, ip QD for 18 days relative to control
AID1848475Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on spleen at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1856410Antiproliferative activity against human AGS cells assessed as reduction in cell viability incubated for 72 hrs by MTS assay
AID1809336Resistant factor, ratio of IC50 for antiproliferative activity against drug-tolerant human MDA-MB-231 cells to IC50 for human MDA-MB-231 cells
AID1657061Cytotoxicity against human A549 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1678192Toxicity in BALB/c mouse model of patient-derived xenograft implanted with patient-derived pancreatic cancer cells assessed as effect on normal anatomical structures of heart at 30 mg/kg, ip QD for 18 days relative to control
AID1707373Antiproliferative activity against human MCF7 cells assessed as reduction in cell viability incubated for 72 hrs by CyQuant assay2021Journal of medicinal chemistry, 01-14, Volume: 64, Issue:1
Discovery of Novel Azetidine Amides as Potent Small-Molecule STAT3 Inhibitors.
AID702312Activity in dicoumarol-treated human HaCaT cells assessed as superoxide generation by flow cytometry (Rvb = 407.59 +/- 68.7 )2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID336953Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 1000 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID702313Induction of superoxide generation in human HaCaT cells at 5 micomol/L after 18 hrs by flow cytometry (Rvb = 367.5 +/- 80.1 )2012Journal of medicinal chemistry, Aug-23, Volume: 55, Issue:16
Synthesis and structure-activity relationships of lapacho analogues. 1. Suppression of human keratinocyte hyperproliferation by 2-substituted naphtho[2,3-b]furan-4,9-diones, activation by enzymatic one- and two-electron reduction, and intracellular genera
AID389437Anticancer activity against human DU145 cells after 72 hrs by XTT assay2008Bioorganic & medicinal chemistry letters, Oct-15, Volume: 18, Issue:20
Semisynthesis and antitumoral activity of 2-acetylfuranonaphthoquinone and other naphthoquinone derivatives from lapachol.
AID1657059Cytotoxicity against human MDA-MB-231 cells assessed as reduction in cell proliferation measured after 72 hrs by WST8 assay2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1848476Toxicity in BALB/c mouse xenografted with human BXPC-3 cells assessed as effect on lung at 30 mg/kg,po administrated once daily for 8 weeks by H and E staining based microscopic analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1848368Anti-proliferative activity against human Capan-2 cells assessed as cell growth inhibition incubated for 72 hrs by MTS assay2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1708579Antiproliferative activity against human BxPC-3 cells assessed as reduction in cell viability incubated for 3 days by MTT assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356023Induction of apoptosis in human MDA-MB-231 cells assessed as viable cells at 10 umol/L measured after 2 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis (Rvb = 97 to 98%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1356039Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 1 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1809331Antiproliferative activity against human MCF7 cells assessed as inhibition of cell growth measured after 72 hrs by MTT assay
AID1848423Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of c-Myc expression at 4 uM incubated for 22 to 24 hrs by western blot analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1856408Inhibition of ATP production in human MKN-45 cells incubated for 20 to 24 hrs by ATP assay kit method
AID1708591Protac activity at CRBN/STAT3 in human BxPC-3 cells assessed as effect on GSPT1 protein expression level at 2 uM incubated for 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1664173Substrate activity at human NQO1 assessed as amount of NADH oxidation assessed per umol NQO12020Bioorganic & medicinal chemistry letters, 08-15, Volume: 30, Issue:16
Synthesis and biological evaluation of novel isothiazoloquinoline quinone analogues.
AID1708614Protac activity at CRBN/ZFP91 in human BxPC-3 cells assessed as induction of ZF91 degradation at upto 3 uM incubated for 16 hrs by western blot analysis2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1356043Cell cycle arrest in human MDA-MB-231 cells assessed as accumulation at G2 phase at 3 uM measured after 24 hrs by propidium iodide staining based flow cytometry (Rvb = 23%)2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID1678201Antitumor activity against patient-derived pancreatic cancer cells xenografted in BALB/c mouse model of patient-derived xenograft assessed as increase in apoptotic cells level at 30 mg/kg, ip QD for 18 days by TUNEL assay relative to control
AID1708593Inhibition of IL-6 induced STAT3 transcriptional activity in human HEK293 cells expressing SIE-luc2P preincubated for overnight followed by IL-6 stimulation and measured after 24 hr by Bio-Glo luciferase reagent based microplate reader assay2021Journal of medicinal chemistry, 02-11, Volume: 64, Issue:3
Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91.
AID1848421Inhibition of STAT3 in human BXPC-3 cells assessed as inhibition of STAT3 phosphorylation at Ser 727 at 4 uM incubated for 22 to 24 hrs by western blot analysis2022Journal of medicinal chemistry, 11-24, Volume: 65, Issue:22
Discovery of a Highly Potent and Orally Bioavailable STAT3 Dual Phosphorylation Inhibitor for Pancreatic Cancer Treatment.
AID1657070Inhibition of IL-6 induced STAT3 phosphorylation at Tyr705 residue in human MCF7 cells assessed as phosphorylation intensity level at 1 uM preincubated for 1 hr followed by IL-6 stimulation and measured after 1 hr by Western blot analysis (Rvb = 100%)2020Bioorganic & medicinal chemistry, 03-15, Volume: 28, Issue:6
STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae.
AID1491230Cytotoxicity against human HepG2 cells assessed as growth inhibition after 72 hrs by MTT assay2017European journal of medicinal chemistry, Sep-08, Volume: 137Novel NO-releasing plumbagin derivatives: Design, synthesis and evaluation of antiproliferative activity.
AID336961Displacement of [3H]TPA from TPA receptor in ICR mouse dorsal epidermis
AID1356033Induction of apoptosis in human MDA-MB-231 cells assessed as late apoptotic cells at 10 umol/L measured after 24 hrs by annexin-V-FITC/7-AAD staining based flow cytometric analysis relative to control2018Journal of natural products, 07-27, Volume: 81, Issue:7
Napabucasin and Related Heterocycle-Fused Naphthoquinones as STAT3 Inhibitors with Antiproliferative Activity against Cancer Cells.
AID336956Inhibition of TPA-induced EBV-early antigen activation in human Raji cells at 10 molar ratio after 48 hrs by indirect immunofluorescence technique relative to TPA
AID1347411qHTS to identify inhibitors of the type 1 interferon - major histocompatibility complex class I in skeletal muscle: primary screen against the NCATS Mechanism Interrogation Plate v5.0 (MIPE) Libary2020ACS chemical biology, 07-17, Volume: 15, Issue:7
High-Throughput Screening to Identify Inhibitors of the Type I Interferon-Major Histocompatibility Complex Class I Pathway in Skeletal Muscle.
AID1347412qHTS assay to identify inhibitors of the type 1 interferon - major histocompatibility complex class I in skeletal muscle: Counter screen cell viability and HiBit confirmation2020ACS chemical biology, 07-17, Volume: 15, Issue:7
High-Throughput Screening to Identify Inhibitors of the Type I Interferon-Major Histocompatibility Complex Class I Pathway in Skeletal Muscle.
[information is prepared from bioassay data collected from National Library of Medicine (NLM), extracted Dec-2023]

Research

Studies (76)

TimeframeStudies, This Drug (%)All Drugs %
pre-19901 (1.32)18.7374
1990's2 (2.63)18.2507
2000's4 (5.26)29.6817
2010's25 (32.89)24.3611
2020's44 (57.89)2.80
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]

Market Indicators

Research Demand Index: 11.56

According to the monthly volume, diversity, and competition of internet searches for this compound, as well the volume and growth of publications, there is estimated to be weak demand-to-supply ratio for research on this compound.

MetricThis Compound (vs All)
Research Demand Index11.56 (24.57)
Research Supply Index4.51 (2.92)
Research Growth Index6.07 (4.65)
Search Engine Demand Index0.00 (26.88)
Search Engine Supply Index0.00 (0.95)

This Compound (11.56)

All Compounds (24.57)

Study Types

Publication TypeThis drug (%)All Drugs (%)
Trials11 (13.92%)5.53%
Reviews2 (2.53%)6.00%
Case Studies0 (0.00%)4.05%
Observational0 (0.00%)0.25%
Other66 (83.54%)84.16%
[information is prepared from research data collected from National Library of Medicine (NLM), extracted Dec-2023]
chemdatabank.com